WO2019031368A1 - Promoteur modifié - Google Patents

Promoteur modifié Download PDF

Info

Publication number
WO2019031368A1
WO2019031368A1 PCT/JP2018/028937 JP2018028937W WO2019031368A1 WO 2019031368 A1 WO2019031368 A1 WO 2019031368A1 JP 2018028937 W JP2018028937 W JP 2018028937W WO 2019031368 A1 WO2019031368 A1 WO 2019031368A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleotide sequence
polynucleotide
promoter
nucleotides
Prior art date
Application number
PCT/JP2018/028937
Other languages
English (en)
Japanese (ja)
Inventor
大視 掛下
望 柴田
洋介 志田
渉 小笠原
Original Assignee
花王株式会社
国立大学法人長岡技術科学大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from JP2018143957A external-priority patent/JP7138505B2/ja
Application filed by 花王株式会社, 国立大学法人長岡技術科学大学 filed Critical 花王株式会社
Priority to US16/635,311 priority Critical patent/US11542499B2/en
Publication of WO2019031368A1 publication Critical patent/WO2019031368A1/fr
Priority to PH12020500275A priority patent/PH12020500275A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material

Definitions

  • the present invention relates to a modified promoter and a method for producing the same, and a vector and a transformant containing the modified promoter.
  • biomass material hereinafter sometimes referred to as “biomass”
  • biomass material a technology for producing sugar from cellulose in biomass material
  • fuel such as ethanol or a chemical product by a fermentation method or the like.
  • biomass material hereinafter sometimes referred to as “biomass”
  • fuel such as ethanol or a chemical product by a fermentation method or the like.
  • various technological developments have been advanced with the background of recent interest in environmental problems, and large-scale production of fuels and chemicals by this technology has also begun to be developed.
  • Biomass is composed of cellulose fibers and hemicellulose and lignin mainly containing xylan surrounding them.
  • an enzyme that hydrolyzes cellulose and hemicellulose is required.
  • Biomass saccharification by cellulase and enzymatic degradation of biomass by hemicellulase and ligninase have been conventionally performed.
  • Patent Document 1 discloses an enzyme composition for converting biomass containing a cellulase and a hemicellulase such as Trichoderma reesei-derived xylanase and arabinofuranosidase into sugar.
  • Patent Document 2 discloses a method for producing sugar by causing a biomass resource to react a protein having xylanase activity derived from a microorganism group present in bagasse compost and cellulase.
  • the filamentous fungus Trichoderma reesei is a bacterium that efficiently produces xylanase, and is conventionally used for xylanase production.
  • Three xylanases (Xyn1, Xyn2 and Xyn3) have been reported to date as xylanases from Trichoderma reesei.
  • Xyn1 and Xyn2 are classified into glycosidic hydrolase family 11 (glycoside hydrolase family 11: GH11), but Xyn 3 is classified into glycosidic hydrolase family 10 (glycoside hydrolase family 10: GH10) And Xyn1 and Xyn2 belong to different families.
  • Xyn3 shows high expression only in the PC-3-7 strain.
  • the expression level of Xyn3 in strain PC-3-7 is higher than that of the other two xylanases Xyn1 and Xyn2.
  • Xyn3 is expressed in a regulatory mechanism different from Xyn1 and Xyn2. While expression of Xyn1 and Xyn2 is induced by xylan and cellulose, expression of Xyn3 is not induced by xylan (enzyme substrate) but is induced by cellulose and its derivatives (Non-patent Documents 1 and 2) . In order to elucidate the expression control mechanism of these xylanases, analysis of the promoters of these genes has been carried out.
  • the region essential for the expression of Xyn3 includes the binding domain (5'-GGCTAT-3 'and 5'-GGCAAA-) of Xyr1 (a transcriptional regulator essential for lignocellulase production) on the promoter region of the gene encoding Xyn3.
  • a cis element composed of a 3 ') and a 16 bp spacer sequence has been reported (Non-patent Document 3).
  • a cis element composed of a binding domain (5'-GGCTAA-3 ') of Xyr1 and a spacer sequence of 10 bp is reported on the promoter region of the gene encoding Xyn1.
  • Non-Patent Document 4 Although the promoter of Xyn1 and the promoter of Xyn3 have cis elements with similar structures to each other, their inducers are different. The reason why the responsiveness of cis element to cellulose and xylan differs among these promoters is not clear.
  • Patent Document 1 JP-A-2011-515089 (Patent Document 2) JP-A-2012-029678 (Non-Patent Document 1) Appl Microbiol Biotechnol, 1998, 49: 718-724 (Non-patent document 2) Appl Microbiol Biotechnol, 2006, 72: 995-1003 (Non-Patent Document 3) Fungal Genet Biol, 2009, 46 (8): 564-574. (Non-Patent Document 4) Eukaryot Cell, 2006, 5 (3): 447-456
  • the invention is a modified promoter, It consists of a polynucleotide of Xyn3 promoter including a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1,
  • the polynucleotide of the Xyn3 promoter is as follows: A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleot
  • the present invention provides a vector containing the above-mentioned modified promoter.
  • the present invention provides a DNA fragment comprising a gene of interest and the above modified promoter upstream of the gene.
  • the present invention provides a transformant comprising the vector or the DNA fragment.
  • the invention relates to a method of producing a modified promoter, comprising Substituting or inserting a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to the nucleotides 374 to 401 of SEQ ID NO: 1 in the polynucleotide of the Xyn 3 promoter Including
  • the polynucleotide of the Xyn3 promoter is as follows: A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90%
  • B GUS activity after culture in the presence of xylan.
  • White bar X3-2RB_AB1 strain
  • black bar PC-3-7 strain.
  • nucleotide sequences and amino acid sequences is calculated by the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it is calculated by performing analysis with Unit size to compare (ktup) of 2 using a homology analysis (Search homology) program of genetic information processing software Genetyx-Win.
  • amino acid sequence or nucleotide sequence is 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, more preferably 99% or more identity.
  • amino acid sequence or nucleotide sequence is 95% or more, preferably 96% or more, more preferably 97% or more, still more preferably 98% or more, still more preferably 99% or more of identity.
  • the "corresponding position" or “corresponding region” on the amino acid sequence or nucleotide sequence refers to the target sequence and the reference sequence (for example, the nucleotide sequence shown in SEQ ID NO: 1) with maximum homology. It can be determined by aligning as given. Alignment of amino acid sequences or nucleotide sequences can be performed using known algorithms, the procedures of which are known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple alignment program (Thompson, JD et al, 1994, Nucleic Acids Res. 22: 4673-4680) with default settings. Alternatively, Clustal W2 or Clustal omega, which is a revised version of Clustal W, can be used.
  • Clustal W, Clustal W2 and Clustal omega are, for example, Japanese DNA data operated by the European Bioinformatics Institute (EBI [www.ebi.ac.uk/index.html]) and the National Institute of Genetics. It can be used on the bank (DDBJ [www.ddbj.nig.ac.jp/searches-j.html]) website.
  • the position or region of the target sequence aligned corresponding to an arbitrary region of the reference sequence by the alignment described above is regarded as "corresponding position" or "corresponding region” to the arbitrary region.
  • upstream and downstream with respect to a gene refers to upstream and downstream of the transcription direction of the gene.
  • a gene located downstream of a promoter means that the gene is present 3 'of the promoter in the DNA sense strand, and upstream of the gene is 5' of the gene in the DNA sense strand. Means the side area.
  • an "operable linkage" between a promoter and a gene means that the promoter is linked so as to direct transcription of the gene.
  • Procedures for "operably linking" promoters and genes are well known to those skilled in the art.
  • promoter activity refers to an activity that promotes expression of a gene located downstream thereof, more specifically, an activity that promotes transcription from DNA to mRNA of a gene located downstream.
  • Promoter activity can be confirmed by using an appropriate reporter gene.
  • promoter activity can be confirmed by linking a DNA encoding a detectable protein downstream of the promoter, ie, by linking a reporter gene, and measuring the amount of the expression product of the reporter gene.
  • reporter genes include genes of fluorescent proteins such as ⁇ -galactosidase (LacZ) gene, ⁇ -glucuronidase (GUS) gene, luciferase gene, ⁇ -lactamase gene, GFP (Green Fluorescent Protein) gene and the like.
  • promoter activity can also be confirmed by measuring the expression level of mRNA transcribed from a reporter gene by quantitative RT-PCR or the like.
  • a “foreign” gene or polynucleotide is a gene or polynucleotide that has been introduced into the cell from the outside.
  • the foreign gene or polynucleotide may be from an organism homologous to the cell into which it has been introduced, or may be from a different organism (i.e., a heterologous gene or polynucleotide).
  • Xyn3 promoter refers to a promoter of a gene encoding xylanase Xyn3 and a promoter equivalent thereto.
  • Examples of Xyn3 promoters include promoters consisting of the following polynucleotides: A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% It consists of a nucleotide sequence which is identical and which comprises a sequence represented by GGCTAT-NNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2; N is any nucleotide) in a region corresponding to nucleotide
  • nucleotide sequence at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1 include the nucleotide sequence shown in nucleotides 3 to 1073 of SEQ ID NO: 1.
  • nucleotide sequence at least 90% identical to the nucleotide sequence shown by nucleotides 350 to 1084 of SEQ ID NO: 1 can be mentioned.
  • sequences contain a sequence represented by GGCTAT-NNNNNNNNNNNNNN-NN-NN-TNTGNN (SEQ ID NO: 2; N is any nucleotide) in a region corresponding to nucleotides 372-399 of SEQ ID NO: 1, and a cellulose-derived promoter It has activity.
  • a further example of the Xyn3 promoter of the present invention includes a promoter consisting of the following polynucleotide: A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or nucleotides 350 to 1073 of SEQ ID NO: 1 Nucleotide which is at least 90% identical to the nucleotide sequence shown and which corresponds to nucleotides 374-401 of SEQ ID NO: 1 in the region corresponding to nucleotides GGCTAT-NNNNNNNNNNNNNN-NN-NNTNNN-TTTGCC (SEQ ID NO: 2; N is any nucleotide) A polynucleotide
  • the GGCTAT-NNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2) is a cis element of the Xyn3 promoter.
  • sequence number 2 the sequence shown by GGCTATATAGGACACTGTCAATTTTGCC (sequence number 3) is mentioned.
  • the Xyn3 promoter has a motif (Fungal Genet Biol, 2008, 45: 1094-1102) possessed by the existing xylanase promoter.
  • the motif include TATA box, CREI binding site, ACEI binding site, ACEII binding site, CAAT motif and the like.
  • TATA box (eg, TATA) in a region corresponding to nucleotides 860 to 863 and nucleotides 889 to 892 of SEQ ID NO: 1; Regions corresponding to nucleotides 53 to 58, nucleotides 124 to 129, nucleotides 249 to 254, nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1
  • a CREI binding site eg, a sequence selected from the group consisting of CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC and CTGGGG
  • ACEI binding site eg, TGCCT, AGGCA, etc.
  • ACEII binding site for example, a sequence selected from the group consisting of GGCTAA, TTAGCC, and GGCT
  • cis element of Xyn1 promoter refers to a cis element present on the promoter of a gene encoding xylanase Xyn1 and cis elements equivalent thereto.
  • An example of the cis element of the Xyn1 promoter includes a polynucleotide consisting of a nucleotide sequence represented by GGCTAA-NNNNNNNN-TTAGCC (SEQ ID NO: 4; N is any nucleotide).
  • Preferred examples of the sequence shown in SEQ ID NO: 4 include the sequence shown in GGCTAAATGCGACATCTTAGCC (SEQ ID NO: 5).
  • the present invention relates to the provision of a modified promoter derived from a xylanase promoter, and a method of producing the same.
  • the present invention also relates to the provision of vectors and transformants containing the modified promoter.
  • the present inventors have modified the cis element of the promoter of the gene encoding xylanase Xyn3 based on the cis elements of other xylanase promoters, thereby inducing the expression inducibility of the promoter of the gene encoding Xyn3 in biomass.
  • the modified promoter of the present invention has an improved ability to induce sophorose and cellulose, and may further have the ability to be induced by a xylan-based substance. According to the present invention, it is possible to improve the efficiency of microbiological production of xylanase and other enzymes involved in the degradation or saccharification of biomass.
  • the present invention provides modified promoters.
  • the modified promoter of the present invention is a modified promoter of Xyn3 promoter.
  • the modified promoter of the present invention is obtained by substituting or inserting a polynucleotide containing a cis element of Xyn1 promoter or a complementary strand thereof to a cis element region in a polynucleotide of Xyn3 promoter. is there.
  • the Xyn3 promoter is a parent promoter of the modified promoter of the present invention.
  • substitution or insertion of a cis element (or its complementary strand) consisting of a predetermined nucleotide sequence, or a polynucleotide containing the same into the Xyn3 promoter is to the side of the promoter linked to the DNA sense strand.
  • the predetermined nucleotide sequence (or the complementary strand thereof) is arranged.
  • the modified promoter of the present invention contains a cis element (or a complementary strand thereof) consisting of a predetermined nucleotide sequence, or a polynucleotide containing the same
  • the predetermined nucleotide sequence or a complementary strand thereof
  • the promoter Are present on the side which is linked to the DNA sense strand of
  • the invention is a modified promoter, It consists of a polynucleotide of Xyn3 promoter including a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1,
  • the polynucleotide of the Xyn3 promoter is as follows: A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 and corresponding to
  • the polynucleotide of the Xyn3 promoter is A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A region identical to that of SEQ ID NO: 1 and corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and having a cellulose-induced promoter activity , Polynucleotides, It is.
  • the polynucleotide of the Xyn3 promoter is A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide comprising a nucleotide sequence which is identical and corresponds to nucleotides 374-401 of SEQ ID NO: 1 and which comprises the sequence shown by GGCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3) and has a cellulose-induced promoter activity, It is.
  • the polynucleotide of said Xyn3 promoter is A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3-1073 of SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or represented by nucleotides 350 to 1073 of SEQ ID NO: 1 GGCTAT-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  • the SEQ. Polynucleotides having promoter activity It is.
  • the sequence represented by GGCTAT-NNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2) is the sequence represented by GCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).
  • the polynucleotide of said Xyn3 promoter is A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3-1073 of SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or represented by nucleotides 350 to 1073 of SEQ ID NO: 1 GGCTAT-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  • the region is derived from cellulose, which is at least 95% identical to the nucleotide sequence and at least 95% identical to the nucleotide sequence and corresponding to nucleotides 374 to 401 of Polynucleotides having promoter activity, It is.
  • the sequence represented by GGCTAT-NNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2) is the sequence represented by GCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).
  • the polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown in GGCTAAATGCGACATCTTAGCC (SEQ ID NO: 5).
  • a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 in the polynucleotide of Xyn3 promoter (parent promoter) (also referred to as “region 374 to 401 in the following specification”)
  • a polynucleotide containing one or more cis-element polynucleotides of the Xyn1 promoter or a complementary strand thereof (hereinafter also referred to as “Xyn1 cis-element-containing fragment” in the following specification) is substituted or inserted, There is.
  • the number of the Xyn1 cis element or its complementary strand contained in the Xyn1 cis element-containing fragment is preferably 1 to 10, more preferably 1 to 8, still more preferably 1 to 6, further preferably 2 to 6 It is preferably one, two, three or six.
  • the Xyn1 cis element-containing fragment comprises 1 to 10, more preferably 1 to 8, more preferably 1 to 6 polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or the complementary strand thereof More preferably, it is a polynucleotide containing 2 to 6, more preferably 1, 2, 3 or 6. Therefore, in a preferred embodiment, the modified promoter of the present invention comprises 1 to 10, more preferably 1 to 8, more preferably 1 to 6 polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or the complementary strand thereof. , More preferably 2 to 6, still more preferably 1, 2, 3 or 6.
  • the Xyn1 cis-element-containing fragment comprises 1 to 10, more preferably 1 to 8, still more preferably 1 to 6, polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 5 Is a polynucleotide comprising 2 to 6, more preferably 1, 2, 3 or 6.
  • the Xyn1 cis-element-containing fragment has 1 to 10, more preferably 1 to 8, more preferably 1 to 10, complementary strands of a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 It is a polynucleotide containing six, more preferably 2 to 6, more preferably 1, 2, 3 or 6.
  • the Xyn1 cis-element-containing fragment is a polynucleotide comprising two polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 5, or a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 It is a polynucleotide containing one or two complementary strands.
  • the Xyn1 cis-element containing fragment is a polynucleotide comprising three polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 5 or a poly consisting of the nucleotide sequence shown in SEQ ID NO: 5 A polynucleotide comprising three or six complementary strands of nucleotides.
  • the Xyn1 cis-element-containing fragment comprises two or more polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or 5 or a complementary strand thereof, it is preferable to have a spacer sequence between each of them.
  • the spacer sequence may be a sequence consisting of 5 to 20 bases which does not inhibit the gene expression control function of the Xyn1 cis element-containing fragment. Examples of the spacer sequence include TCAAGA, TCTAGA and the like.
  • Xyn1 cis-element-containing fragment examples include the nucleotide sequence shown in SEQ ID NO: 5 or its complementary strand; and the spacer sequence linked downstream of the nucleotide sequence shown in SEQ ID NO: 5 or its complementary strand 2 or more, preferably 2 to 10, more preferably 2 to 8, still more preferably 2 to 6, still more preferably 3 to 6, still more preferably 2, 3 or 6, of the above sequence
  • the above-mentioned spacer sequences may be arranged at the most upstream and the most downstream.
  • Preferred examples of said Xyn1 cis-element containing fragment are: A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43, Can be mentioned.
  • the modified promoter of the present invention comprises the following polynucleotide in the 374 to 401 region compared to the Xyn3 promoter (parent promoter): A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43.
  • HAP2 / 3/5 binding site transcription promoting factor, 5'-CCAAT-3 '
  • CREI binding site carbon source catabolite repressor, 5'-SYGGRG-
  • the Xyn1 cis-element-containing fragment to be substituted or inserted into the parent promoter is preferably one that does not contain the HAP2 / 3/5 binding site and the CREI binding site.
  • the modified promoter of the present invention does not contain the HAP2 / 3/5 binding site and the CREI binding site in the vicinity of the cis element of the substituted or inserted Xyn1 promoter. If the Xyn1 cis-element-containing fragment not containing the HAP2 / 3/5 binding site and the CREI binding site is substituted or inserted in the No. 374 to No.
  • the entire 374 to 401 region of the Xyn3 promoter may be replaced with the Xyn1 cis element-containing fragment, or the nucleotides of the 374 to 401 region
  • the Xyn1 cis-element-containing fragment may be inserted into the inside of the region while leaving all the fragments.
  • the Xyn1 cis-element-containing fragment may be inserted inside the 374th-401th region so that a part of the 374th-401th region is replaced with the Xyn1 cis-element-containing fragment.
  • the regions 374 to 401 may be entirely deleted or partially deleted, or in the Xyn1 cis element-containing fragment It may be divided.
  • the entire 374 to 401 region of the Xyn3 promoter is substituted with the Xyn1 cis element-containing fragment, and the entire 374 to 401 region is deleted. There is.
  • the method for obtaining the modified promoter of the present invention is not particularly limited, and can be obtained by a conventional chemical synthesis method or a genetic engineering method.
  • the modified promoter of the present invention can be artificially synthesized.
  • a service such as Invitrogen can be used.
  • the modified promoter of the present invention can be produced by genetically modifying the Xyn3 promoter (parent promoter).
  • the parent promoter of the modified promoter of the present invention may be artificially synthesized by the means described above, but may also be cloned from a microorganism.
  • a polynucleotide of the Xyn3 promoter consisting of the nucleotide sequence shown in SEQ ID NO: 1 can be cloned from Trichoderma reesei PC-3-7 strain.
  • the parent promoter of the modified promoter of the present invention can be cloned from a mutated Trichoderma reesei strain PC-3-7.
  • a mutation is introduced into the DNA of the Xyn3 promoter in Trichoderma reesei PC-3-7 strain, and among the obtained mutant DNA, at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1,
  • a polynucleotide consisting of a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of the number 1 and having a promoter activity can be selected.
  • mutagenesis for example, ultraviolet irradiation and site-directed mutagenesis can be mentioned.
  • the promoter activity of the mutant DNA can be measured, for example, by operably linking the target gene downstream of the mutagenized DNA and analyzing the expression amount of the target gene.
  • the introduction of these mutations and the selection of the target mutant DNA are routine procedures of those skilled in the art.
  • substitution or insertion of the Xyn1 cis-element-containing fragment into the region 374 to 401 of the parent promoter can be carried out according to procedures well known to those skilled in the art such as construction of a fragment using PCR, ligation and the like.
  • an upstream fragment and a downstream fragment of the region 374 to 401 of the parent promoter (Xyn3 promoter) and a fragment containing Xyn1 cis element are prepared by PCR, and they are ligated to form Xyn1 between the upstream fragment and the downstream fragment.
  • a DNA fragment containing the modified promoter of the present invention can be prepared, which contains the Xyn1 cis-element-containing fragment instead of the 374 to 401 regions.
  • the modified promoter of the present invention has the function of controlling the expression of the gene located downstream thereof.
  • a DNA fragment having an expression control region excellent in transcriptional activity can be obtained.
  • a DNA fragment can be constructed which comprises a gene of interest and the modified promoter of the present invention operably linked upstream thereof.
  • a DNA fragment containing the modified promoter of the present invention can be constructed to have restriction enzyme recognition sequences at both ends. The restriction enzyme recognition sequence can be used to introduce the modified promoter of the present invention into a vector.
  • a modified vector of the present invention is introduced into a vector by cutting a known vector with a restriction enzyme and adding thereto a DNA fragment containing the modified promoter of the present invention and having a restriction enzyme cleavage sequence at the end. Can be done (restriction enzyme method).
  • the modified promoter of the present invention can be contained in a vector.
  • an expression vector capable of enhancing expression of the target gene at the transcription level can be obtained.
  • the modified promoter of the present invention can be operably linked upstream of the DNA encoding the target gene.
  • the vector having the promoter of the present invention may be in the form introduced into the chromosome of the host cell or in the form retained extrachromosomally.
  • a DNA fragment having a target gene and the modified promoter of the present invention operably linked upstream thereof may be constructed and directly introduced into the genome of the host cell.
  • the vector incorporating the modified promoter of the present invention is not particularly limited as long as it is stably maintained and can be propagated in a host cell, and includes, for example, AMA1 which functions as a self-sustaining replication factor in Aspergillus microorganism A plasmid etc. are mentioned.
  • the modified promoter of the present invention has an improved ability to induce promoter activity by cellulose or a derivative thereof possessed by the parent promoter Xyn3 promoter. Preferably, the ability to induce promoter activity by xylan or a derivative thereof is obtained.
  • the modified promoter of the present invention is suitable for use in the presence of cellulose and xylan.
  • the modified promoter of the present invention is suitable as a promoter for enzymes used in the process of biomass degradation or biomass saccharification.
  • the target gene operably linked to the promoter or vector in the vector or DNA fragment containing the modified promoter of the present invention includes enzymes used in the process of biomass degradation or biomass saccharification, such as cellulases (eg, ⁇ -endoglucanase , Cellobiohydrolase, ⁇ -glucosidase, etc., hemicellulase (eg, endoxylanase, ⁇ -xylosidase, arabinofuranosidase, glucuronidase, acetyl xylan esterase, mannanase, ⁇ -mannosidase, ferulic acid esterase etc.), xylanase etc. Genes are preferred.
  • cellulases eg, ⁇ -endoglucanase , Cellobiohydrolase, ⁇ -glucosidase, etc.
  • hemicellulase eg, endoxylanase, ⁇ -xylosidase
  • the target gene a gene that is controlled by a promoter that is not naturally induced in expression by cellulose or xylan is preferable.
  • a more preferred example of the target gene operably linked to the modified promoter of the present invention is a polynucleotide encoding xylanase Xyn3 consisting of the amino acid sequence shown in SEQ ID NO: 38, an amino acid sequence at least 90% identical to SEQ ID NO: 38 Or a nucleotide sequence represented by SEQ ID NO: 37 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto, which encodes xylanase, and the like.
  • a polynucleotide encoding xylanase PspXyn (WO2016 / 208492) consisting of the amino acid sequence shown by SEQ ID NO: 40, encoding a xylanase consisting of an amino acid sequence at least 90% identical to SEQ ID NO: 40
  • the polynucleotide includes a nucleotide sequence shown by SEQ ID NO: 39 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto, which encodes xylanase, and the like.
  • the types of target genes that can be operably linked to the promoter of the present invention are not limited thereto.
  • the vector or DNA fragment containing the modified promoter of the present invention can be transformed by a general transformation method such as electroporation, transformation, transfection, conjugation, protoplast, particle gun method, Agrobacterium method etc.
  • the transformant of the present invention can be obtained by introducing it into a host cell using
  • filamentous fungi examples include, for example, Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor.
  • Trichoderma reesei and mutants thereof include Trichoderma reesei QM9414 and mutants thereof, such as Licoderma reesei PC-3-7.
  • a modified promoter which It consists of a polynucleotide of Xyn3 promoter including a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1,
  • the polynucleotide of the Xyn3 promoter is as follows: A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleotides 374
  • the polynucleotide of the Xyn3 promoter is Preferably, it contains one or more selected from the group consisting of TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif, More preferably, the modified promoter according to [1], which comprises TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif.
  • TATA box is a TATA box (eg, TATA) in a region corresponding to nucleotides 860 to 863 and nucleotides 889 to 892 of SEQ ID NO: 1.
  • the CREI binding site is Preferably, a CREI binding site (for example, CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC, and CTGGGG in a region corresponding to nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1).
  • a CREI binding site for example, CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC, and CTGGGG in a region corresponding to nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1).
  • a CREI binding site eg, a sequence selected from the group consisting of CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC and CTGGGG
  • the modified promoter according to [2] or [3].
  • the ACEII binding site is selected from the group consisting of ACEII binding sites (eg, GGCTAA, TTAGCC, and GGCTAA) in the regions corresponding to nucleotides 594 to 599 and nucleotides 845 to 850 of SEQ ID NO: 1 A modified promoter according to any one of [2] to [5].
  • ACEII binding sites eg, GGCTAA, TTAGCC, and GGCTAA
  • the modified promoter according to any one of [2] to [6], wherein the CAAT motif is a CAAT motif (for example, CCAAT) in a region corresponding to nucleotides 583 to 587.
  • CAAT motif for example, CCAAT
  • the polynucleotide of the Xyn3 promoter is A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide which is identical and comprises a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and having a cellulose-induced promoter activity,
  • the modified promoter according to any one of [1] to [7], which is
  • the polynucleotide of the Xyn3 promoter is A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or nucleotides 350 to 1073 of SEQ ID NO: 1 A nucleotide sequence comprising a sequence represented by SEQ ID NO: 2 in a region corresponding to nucleotides 374-401 of SEQ ID NO: 1 and at least 90% identical to the nucleotide sequence Having a polynucleotide,
  • the modified promoter according to any one of [1] to [7], which is
  • the modified promoter according to any one of [1] to [9], wherein the nucleotide sequence containing the sequence represented by SEQ ID NO: 2 is the sequence represented by GGCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).
  • the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof is a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4 or a complementary strand thereof Any one of [1] to [10], more preferably 1 to 8, still more preferably 1 to 6, still more preferably 2 to 6, still more preferably 1, 2, 3 or 6 The modified promoter described in paragraph.
  • modified promoter according to [11], preferably, wherein the polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 4 is a polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 5.
  • the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof does not contain a HAP2 / 3/5 binding site and a CREI binding site,
  • the HAP2 / 3/5 binding site is CCAAT
  • the CREI binding site is SYGGRG or CCCCAG
  • the modified promoter according to any one of [1] to [12].
  • the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof,
  • It is a polynucleotide consisting of one, more preferably 3 to 6, still more preferably 2, 3 or 6 repeats.
  • the modified promoter according to any one of [1] to [13].
  • the polynucleotide containing a cis-element polynucleotide of the one or more Xyn1 promoters or a complementary strand thereof is: A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43,
  • the modified promoter according to any one of [1] to [15], which is
  • a method for producing a modified promoter comprising Substituting or inserting a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to the nucleotides 374 to 401 of SEQ ID NO: 1 in the polynucleotide of the Xyn 3 promoter Including
  • the polynucleotide of the Xyn3 promoter is as follows: A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID
  • the polynucleotide of the Xyn3 promoter is Preferably, it contains one or more selected from the group consisting of TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif, More preferably, the method according to [18], which comprises TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif.
  • TATA box is a TATA box (eg, TATA) in a region corresponding to nucleotides 860 to 863 and nucleotides 889 to 892 of SEQ ID NO: 1.
  • the CREI binding site is Preferably, a CREI binding site (for example, CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC, and CTGGGG in a region corresponding to nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1).
  • a CREI binding site for example, CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC, and CTGGGG in a region corresponding to nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1).
  • a CREI binding site eg, a sequence selected from the group consisting of CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC and CTGGGG
  • a CREI binding site eg, a sequence selected from the group consisting of CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC and CTGGGG
  • the ACE II binding site is selected from the group consisting of ACE II binding sites (eg, GGCTAA, TTAGCC, and GGCTAA) in the regions corresponding to nucleotides 594 to 599 and nucleotides 845 to 850 of SEQ ID NO: 1
  • ACE II binding sites eg, GGCTAA, TTAGCC, and GGCTAA
  • CAAT motif is a CAAT motif (eg, CCAAT) in a region corresponding to nucleotides 583 to 587.
  • the polynucleotide of the Xyn3 promoter is A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide which is identical and comprises a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and having a cellulose-induced promoter activity, The method according to any one of [18] to [24], which is
  • the polynucleotide of the Xyn3 promoter is A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1; A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or nucleotides 350 to 1073 of SEQ ID NO: 1 A nucleotide sequence comprising a sequence represented by SEQ ID NO: 2 in a region corresponding to nucleotides 374-401 of SEQ ID NO: 1 and at least 90% identical to the nucleotide sequence Having a polynucleotide, The method according to any one of [18] to [24], which is
  • nucleotide sequence containing the sequence shown in SEQ ID NO: 2 is the sequence shown in GGCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).
  • the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof is 1 to 10 of a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4 or a complementary strand thereof Any one of [18] to [27], more preferably 1 to 8, still more preferably 1 to 6, still more preferably 2 to 6, still more preferably 1, 2, 3 or 6 Method according to paragraph.
  • polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 4 is a polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 5.
  • the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof does not contain a HAP2 / 3/5 binding site and a CREI binding site,
  • the HAP2 / 3/5 binding site is CCAAT
  • the CREI binding site is SYGGRG or CCCCAG
  • the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof,
  • It is a polynucleotide consisting of one, more preferably 3 to 6, more preferably 2, 3 or 6 repeats. The method according to any one of [18] to [30].
  • the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof is: A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41; A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43, The method according to any one of [18] to [32], which is
  • a vector comprising the modified promoter according to any one of [1] to [17].
  • the vector according to [35] wherein the modified promoter is linked upstream of the target gene.
  • the target gene is Preferably, a gene encoding an enzyme selected from the group consisting of cellulase, hemicellulase and cellulase, More preferably, the nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto and encoding a xylanase, or the nucleotide sequence of SEQ ID NO: 39 or at least 90% identical thereto A polynucleotide encoding a xylanase consisting of [36] The vector according to [36].
  • a DNA fragment comprising a target gene and the modified promoter according to any one of [1] to [17] linked upstream of the gene.
  • the target gene is Preferably, a gene encoding an enzyme selected from the group consisting of cellulase, hemicellulase and cellulase, More preferably, the nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto and encoding a xylanase, or the nucleotide sequence of SEQ ID NO: 39 or at least 90% identical thereto A polynucleotide encoding a xylanase consisting of The DNA fragment of [38].
  • a transformant comprising the vector of any one of [35] to [37] or the DNA fragment of [38] or [39].
  • the transformant according to [40] which is a Trichoderma sp.
  • Example 1 Preparation of Modified Xyn3 Promoter (1) Cloning of Xyn3 Promoter Using a gene region including the upstream of a gene (xyn3) encoding xylanase Xyn3 derived from Trichoderma reesei PC-3-7 strain as a template, primer xyn3-EcoRI- The Xyn3 promoter region (SEQ ID NO: 1) including the primer fragment at both ends was amplified by PCR using U (SEQ ID NO: 9) and the primer xyn3-NcoI (SEQ ID NO: 10). The obtained DNA fragment was introduced into pT7blue (Novagen) to obtain a plasmid pTxyn3PD0.
  • a plasmid pTxyn3PD0 was cleaved with BamHI and XbaI to obtain a DNA fragment containing a promoter region, which was amplified and introduced into a pKF18K plasmid (Takara) to obtain a Xyn3 promoter-containing plasmid pKFxyn3PD0.
  • Example 2 Preparation of Reporter Cassette Containing Modified Promoter (1) Preparation of GUS Reporter-Containing Plasmid
  • GUS ⁇ which is a reporter under the control of each promoter
  • a reporter cassette was constructed in which a gene (gus) encoding -glucuronidase was introduced.
  • the downstream region of 0.8 kbp xyn3 amplified by primers xyn3-SpeI (SEQ ID NO: 15) and primer xyn3-EcoRI-D (SEQ ID NO: 16) was introduced into pT7Blue-T (Novagen) to obtain pTxyn3T. .
  • the gus gene is amplified using pBACgus-1 (Novagen) as a template, primer gus-NcoI (SEQ ID NO: 17) and primer gus-SpeI (SEQ ID NO: 18), and introduced into pT7Blue-T. I got one.
  • pTxyn3T and pTgus-1 were digested with SpeI and ligated to construct pTgus-2 (having xyn3 downstream region after stop codon of gus gene).
  • the modified promoter-containing plasmid fragment and the pTgus-2 fragment were ligated to prepare plasmids pTxyn3-1 Box, pTxyn3-2 Box, pTxyn3-1RBox, and pTxyn3-2RBox, respectively.
  • the resulting plasmid was digested with EcoRI and NsiI, respectively, to obtain a fragment containing promoter-GUS.
  • pBxyn3SE This plasmid was partially digested with EcoRI and blunted to construct pBxyn3SE 'in which only the EcoRI site present in the downstream region was deleted.
  • p3SR2 Mol Cell Biol, 1983, 3 (8): 1430-1439
  • pBxyn3SE ' was digested with NarI and ligated with the 3.5 kbp DNA fragment to obtain pBxyn3amdS.
  • the resulting plasmid was digested with coRI and NsiI to obtain a fragment containing xyn3-amdS.
  • Example 3 Preparation of Transformant and Evaluation of Inducibility of Promoter (1) Acquisition of Transformant A transformant having a reporter cassette containing the modified promoter prepared in Example 2 was prepared. First, the plasmid containing the GUS reporter cassette prepared in (2) of Example 2 was cleaved with SalI. The obtained fragment was introduced into Trichoderma reesei strain PC-3-7 by the protoplast PEG method (Biotechnol Bioeng, 2012, Jan; 109 (1): 92-99).
  • Transformants were selected from selection medium (2% (w / v) glucose, 0.6 mg / mL MgSO 4 , 0.6 mg / mL CaCl 2 , 12.5 mM CsCl 2 , 10 mM KH 2 ) using acetamide as a single nitrogen source.
  • PO 4 Buffer pH 5.5
  • the selected transformant candidate strain was cultured twice in a minimal medium supplemented with acetamide and stabilized.
  • the homologous recombination and the introduced copy number in the transformant were confirmed by Southern analysis using AlkPhos Direct kit (GE Healthcare Bio Science, Waukesha, WI). As a result, it was confirmed that the reporter cassette was homologously recombined in one copy at the position of the xyn3 gene on the genome.
  • Transformants into which pBxyn3ag-D0C, pBxyn3ag- ⁇ cis, pBxyn3ag-1Box, pBxyn3ag-1RBox, pBxyn3ag-2Box, and pBxyn3ag-2RBox have been introduced are respectively strain D0C, strain ⁇ cis, strain 1Box, strain 1RBox, strain 2Box And 2R Box stock.
  • the collected cells were treated with an induction medium as the sole carbon source for the promoter (0.0075% (w / v) CaCl 2 ⁇ 2H 2 O, 0.0075% (w / v) MgSO 4 ⁇ 7H 2 )
  • the culture was transferred to 50 mL of O, 0.025% (w / v) Tween 80, 0.025% (w / v) Trace element * 1) , 50 mM citrate buffer (pH 4.0)).
  • Inducers include 0.1% (w / v) glucose, 0.05% (w / v) sorbose, 0.01% (w / v) sophorus, 0.1% (w / v) xylose, or One of 0.1% (w / v) birch wood xylan was used.
  • the ⁇ -glucuronidase (GUS) activity and the amount of protein in the GUS extract were measured to determine the GUS activity per protein amount.
  • GUS activity was quantified by measuring fluorescence after reacting for 10 minutes at 37 ° C. using 4-Methylumbelliferyl- ⁇ -D-glucuronide (4-MUG) as a substrate.
  • the amount of protein was quantified by the Bradford method using bovine immunoglobulin as a standard.
  • FIG. 2A depicts GUS activity in extracts of cells cultured in the presence of glucose, sorbose, or the cellulosic substrate Sophorose.
  • D0C strain control
  • GUS activity was detected in the presence of sorbose or sophorose.
  • the ⁇ cis strain showed extremely low GUS activity as compared to the D0C strain in the presence of both sorbose and sophorose.
  • 1Box strain and 1R Box strain introductionoduced strain of a modified promoter into which a cis element of Xyn1 promoter or one complementary strand is inserted
  • the GUS activity in the presence of Sophorus is 2.3 times and 2.times. It has increased sixfold.
  • FIG. 2B represents GUS activity in extracts of cells cultured in the presence of xylan-based substrates (xylose or xylan).
  • xylan-based substrates xylose or xylan.
  • xylan-based substrates xylose or xylan.
  • strains 1RBox, 2Box and 2RBox exhibited GUS activity in the presence of either xylose or xylan.
  • the results shown in FIG. 2 indicate that the modified Xyn3 promoter into which a cis element of the Xyn1 promoter has been introduced can improve the inducibility by a cellulose-based substrate, and can further acquire the inducibility by a xylan-based substrate.
  • Example 4 Evaluation of Inducibility of Promoter (1) Preparation of Modified Xyn 3 Promoter 3 Box, 3 R Box and 6 R Box
  • cis element SEQ ID NO: 5 of promoter of gene encoding Xyn 1 or its complement
  • a DNA fragment (3 Box and 3 R Box; SEQ ID NOs: 41 and 42) containing three strands and Xbal site at both ends was constructed.
  • a DNA fragment (6RBox; SEQ ID NO: 43) was synthesized which contains six complementary strands of the sequence shown in SEQ ID NO: 5 and contains XbaI sites at both ends. Each of these DNA fragments was used to prepare a modified Xyn3 promoter-containing plasmid by the procedure of Example 1 (4).
  • FIG. 4 shows the data of the 2R Box strain measured in Example 3.
  • the expression of the GUS reporter was improved in the 3Box strain and the 3R Box strain as compared to the 2R Box strain, and was further improved in the 6R Box strain, in the presence of either Sophorus or xylan. From these results, it was suggested that the promoter activity of the modified Xyn3 promoter was increased according to the number of cis elements of the introduced Xyn1 promoter.
  • PCR Inverse PCR was also performed using pBxyn3ag-D0C as a template and the primers aX3invert (SEQ ID NO: 21) and sX3invert (SEQ ID NO: 22). These PCR products were cloned using In-fusion PCR advanced kit (TaKaRaBio, Shiga, Japan) to obtain pBxyn3aabgl1.
  • pBxyn3aabg1 has the aabgl1 gene under the control of the upstream region of xyn3 and the amdS gene as a selection marker at the NarI site of the downstream region.
  • the inverse PCR product of pBxyn3aabgl1 was constructed using pBxyn3aabgl1 as a template and primers recyinvert3a (SEQ ID NO: 23) and primer recyinvert3s (SEQ ID NO: 24).
  • the downstream region 748 bp of xyn3 was amplified using the genome of PC-3-7 strain as a template and primers xyn3 reps (SEQ ID NO: 25) and xyn3 repa (SEQ ID NO: 26), and introduced into the HincII site of pUC118 (Takara) ( pUxyn3DR).
  • pUxyn3DR was digested with EcoRV and BamHI to obtain a DNA fragment.
  • pBpyr4 (a plasmid obtained by cloning a DNA fragment containing the pyr4 gene derived from Trichoderma reesei and its upstream and downstream regions into pBluescript II SK (+) (Novagen)) was digested with EcoRV and BamHI to obtain a DNA fragment. The resulting DNA fragments were ligated to obtain pBpyr4RM (a fragment in which the downstream region of xyn3 was inserted downstream of the pyr4 selection marker).
  • pBpyr4RM Using pBpyr4RM as a template, amplification was carried out with primers recyclex3s (SEQ ID NO: 27) and primers recyclex3a (SEQ ID NO: 28) to which sequences of the downstream region of xyn 3 were added, respectively. The resulting amplified fragment was in-fused with pBxyn3aabgl1 to obtain pBxyn3aabgl1pyr4RM.
  • PBxyn3aabgl1pyr4RM was amplified by inverse PCR using primers xyn1_2Box_inv_Rv (SEQ ID NO: 29) and Aabgl1_Fw (SEQ ID NO: 30).
  • pKFxyn3-2RBox was amplified with primer xyn1_2box_Fw (SEQ ID NO: 31) and primer xyn1_2box_Rv (SEQ ID NO: 32) to obtain a DNA fragment containing 2R Box region (SEQ ID NO: 8).
  • These PCR products were ligated to obtain pBxyn3_2RBaabgl1pyr4RM in which the upstream region of xyn3 was replaced with a promoter containing 2R Box region.
  • the enzyme activity and the amount of protein were measured for the culture supernatants of the X3_2RB_AB1 strain (strain enhanced with BGL activity by introducing a modified promoter) and the PC-3-7 strain (host).
  • the culture supernatant was subjected to SDS-PAGE with 12.5% polyacrylamide and stained with Coomassie Brilliant Blue R250.
  • a Precision Plus Dual Color Standard Marker Bio-Rad Laboratories was used for molecular weight determination.
  • the amount of protein was determined by the Bradford method using bovine immunoglobulin as a standard.
  • the avicelase, carboxymethylcellulose (CMCase), and xylanase activities were calculated by measuring the amount of reducing sugar obtained by the enzyme reaction by the 3,5-dinitrosalicylic acid (DNS) method.
  • the enzymatic reaction for determination of avicelase activity was carried out at 50 ° C. for 30 minutes using a reaction solution in which 1% (w / v) Avicel (registered trademark) was suspended in 50 mM sodium acetate buffer (pH 5.0).
  • the enzyme reaction for measurement of CMCase activity was carried out at 50 ° C. for 15 minutes using a reaction solution in which 40 mM carboxymethyl cellulose (CMC) was dissolved in 50 mM sodium acetate buffer.
  • the enzyme reaction for measuring xylanase activity was carried out at 50 ° C. for 10 minutes using a reaction solution in which 1% (w / v) birch wood xylan was dissolved in 50 mM sodium acetate buffer.
  • the activity of 1 U was defined as the amount of enzyme that produces 1 ⁇ mol equivalent of glucose (or xylose) in 1 minute.
  • the enzyme was allowed to react at 50 ° C. for 10 minutes in a reaction solution in which a final concentration of 20 mM cellobiose (Sigma) was added to 50 mM acetic acid buffer, and then the glucose concentration was measured by Glucose C2 kit (Wako).
  • One unit of cellobiase activity was an amount of enzyme that produces 2 ⁇ mol of glucose in one minute.
  • aaBGL in the culture supernatant sample was observed using Western blotting with anti-BGL antibody.
  • Western blotting was performed using a semi-dry blotting apparatus (ATTO). After protein separation by SDS-PAGE, proteins were transferred to Immobilon-P membrane (Merck Millipore).
  • ECL select western blotting detection reagent GE healthcare
  • the anti-aa BGL antibody one obtained by preparing an antibody by rabbit immunization using purified aa BGL as an antigen was used. Also, HRP-labeled secondary antibodies were detected using GE Healthcare.
  • Table 1 shows the amounts of proteins in the X3_2RB_AB1 strain and the PC-3-7 strain, and the results of measurement of avicelase, CMCase, cellobiase, and xylanase activities.
  • the CMCase activity and the xylanase activity were comparable between the X3-2RB_AB1 strain and the PC-3-7 strain, but the cellobiase activity was 35.0 U / mL (Avicel® containing medium) and 17 in the X3-2RB_AB1 strain. .7 U / mL (Avicel.RTM. + Xylan-containing medium), which increased about 120 and 85 times over the PC-3-7 strain, respectively.
  • the avicelase activity also showed about 30% higher activity than the host strain in the X3-2RB_AB1 strain. From these results, it was suggested that, in the culture in the presence of cellulose, cellulose and xylan, the 2R Box promoter efficiently expressed the gene of AaBGL1 linked downstream.
  • PC-3-7 strain and X3-2RB_AB1 strain were cultured in a medium containing 0.3% (w / v) glucose for 2 days to obtain resting cells. Derivation of the obtained cells with 0.01% (w / v) sophorus (cellulose-based substrate, strong cellulase derivative) or 0.1% (w / v) xylan (xylan-based substrate) as the sole carbon source After culturing for 1, 3, 6, and 9 hours in the medium, transcriptional analysis was performed to examine gene expression.
  • a major cellulase gene cbh1 As target genes for transcriptional analysis, a major cellulase gene cbh1, a major xylanase gene xyn1, a transcription activation factor xyr1 essential for cellulase production, a xylanase gene xyn3 and aabgl1 were analyzed. Gene expression was measured by quantitative real-time PCR, and relative expression level was determined when expression level of ⁇ -actin (act1) was 1.
  • Xyn3 is originally expressed in Trichoderma reesei PC-3-7 strain, but is not expressed in Trichoderma reesei QM9414 strain, which is its ancestor.
  • the possibility of the modified Xyn3 promoter functioning in the QM9414 strain was examined.
  • Example 5 The procedure is the same as in Example 5, but using pBxyn3_2RBaabgl1pyr4RM, a plasmid containing an expression cassette into which aabgl1 has been introduced under the control of a modified Xyn3 promoter containing the 2R Box region (SEQ ID NO: 8) using QM9414 as the host of transformants.
  • the transformant QMX3-2RB_AB1 into which was introduced was prepared.
  • the enzyme activities in the QMX3-2RB_AB1 strain and the host QM9414 strain were measured in the same manner as in Example 5 (4).
  • the concentration of xylan in the induction medium was 0.01% (w / v).
  • the transcriptional activity of aabgl1 was examined in the same manner as in Example 5 (5).
  • Example 7 Evaluation of Xyn3 Expression Using Modified Xyn3 Promoter (1) Construction of Trichoderma reesei Xyn3 Expression Cassette The genome of PC-3-7 strain is used as a template, primer pyr4_Fw (SEQ ID NO: 33) and primer pyr4_Rv (SEQ ID NO: 34) was used to obtain a DNA fragment containing the upstream region 2,274 bp and the downstream region 1,244 bp of pyr4 and the pyr4 ORF. This DNA fragment was inserted into pUC118 linearized with HincII to prepare pU ⁇ pyr4.
  • Inverse PCR was performed using pBxyn3_2RBaabgl1pyr4RM prepared in Example 5 as a template and the primers aX3invert (SEQ ID NO: 21) and sX3invert (SEQ ID NO: 22). Furthermore, using the PC-3-7 strain genomic DNA as a template, the xyn3 ORF is amplified using primer xyn3_Fw (SEQ ID NO: 35) and primer xyn3_Rv (SEQ ID NO: 36), and phosphate group addition is carried out with Blunting Kination kit (TaKaRa). Did. These DNA fragments were ligated to produce pBxyn3_2RBxyn3pyr4RM.
  • Media composition is as follows: 1% (w / v) glucose, 0.14% (w / v) (NH 4 ) 2 SO 4 , 0.2% (w / v) KH 2 PO 4 , 0 .03% (w / v) CaCl 2 ⁇ 2 H 2 O, 0.03% (w / v) MgSO 4 ⁇ 7 H 2 O, 0.1% (w / v) high polypeptone N, 0.05% (w / V) Bacto Yeast extract, 0.1% (w / v) Tween 80, 0.1% (w / v) Trace element 2, 50 mM tartaric acid buffer (pH 4.0).
  • Trace element 2 is as follows: 6 mg H 3 BO 3 , 26 mg (NH 4 ) 6 Mo 7 O 24 ⁇ 4 H 2 O, 100 mg FeCl 3 ⁇ 6 H 2 O, 40 mg CuSO 4 ⁇ 5 H 2 O, 8 mg MnCl 2 ⁇ 4 H 2 O, 200 mg ZnCl 2 was added to 100 mL with distilled water.
  • the culture supernatant was recovered in the same manner as in Example 5 (3), and the protein concentration was measured by the bradford method.
  • the amount of protein was calculated based on a calibration curve using bovine gamma globulin as a standard protein, using Quick Start protein assay (BioRad).
  • BioRad Quick Start protein assay
  • the relative ratio of the amount of protein in the culture supernatant (JN24) of strain E1AB1_X3-2RBX3 was determined, where the amount of protein in the culture supernatant of strain E1AB1 (JN13) was 1.
  • JN24 had a 23% improvement in protein productivity as compared to the JN13 strain.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un promoteur modifié dérivé d'un promoteur de xylanase. Le promoteur modifié comprend un polynucléotide du promoteur Xyn3 qui comprend un polynucléotide contenant au moins un polynucléotide à élément cis du promoteur Xyn1 ou une chaîne complémentaire de celui-ci dans une région correspondant aux nucléotides aux positions 374-401 dans la SEQ ID NO : 1. Le polynucléotide du promoteur Xyn3 comprend : la séquence nucléotidique représentée par la SEQ ID NO : 1 ; une séquence nucléotidique représentée par les nucléotides aux positions 350-1084 dans la SEQ ID NO : 1 ; ou une séquence nucléotidique ayant une identité de 90 % ou plus aux séquences susmentionnées et contenant la séquence représentée par la SEQ ID NO : 2 dans la région correspondant aux nucléotides aux positions 374-401 dans la SEQ ID NO : 1. Le polynucléotide à élément cis du promoteur Xyn1 est un polynucléotide qui comprend la séquence nucléotidique représentée par la SEQ ID NO : 4.
PCT/JP2018/028937 2017-08-09 2018-08-01 Promoteur modifié WO2019031368A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/635,311 US11542499B2 (en) 2017-08-09 2018-08-01 Modified promoter
PH12020500275A PH12020500275A1 (en) 2017-08-09 2020-02-06 Modified promoter

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2017-153983 2017-08-09
JP2017153983 2017-08-09
JP2018-143957 2018-07-31
JP2018143957A JP7138505B2 (ja) 2017-08-09 2018-07-31 改変プロモーター

Publications (1)

Publication Number Publication Date
WO2019031368A1 true WO2019031368A1 (fr) 2019-02-14

Family

ID=65271508

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2018/028937 WO2019031368A1 (fr) 2017-08-09 2018-08-01 Promoteur modifié

Country Status (1)

Country Link
WO (1) WO2019031368A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012075369A (ja) * 2010-09-30 2012-04-19 Toyota Motor Corp シス作用エレメント及びその利用
WO2016170283A1 (fr) * 2015-04-23 2016-10-27 IFP Energies Nouvelles Promoteurs inductibles de trichoderma reesei
JP2017012006A (ja) * 2015-06-26 2017-01-19 花王株式会社 新規キシラナーゼ

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012075369A (ja) * 2010-09-30 2012-04-19 Toyota Motor Corp シス作用エレメント及びその利用
WO2016170283A1 (fr) * 2015-04-23 2016-10-27 IFP Energies Nouvelles Promoteurs inductibles de trichoderma reesei
JP2017012006A (ja) * 2015-06-26 2017-01-19 花王株式会社 新規キシラナーゼ

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
FURUKAWA , TAKANORI ET AL.: "Analysis of transcription-activating region of xylanase III gene (xyn3) in trichoderma reesei PC-3-7", LECTURE ABSTRACTS OF THE JAPANESE SOCIETY OF APPLIED GLYCOSCIENCE, vol. 52, 2005, pages 45 *
FURUKAWA, TAKANORI ET AL.: "Binding specificity of trichoderma reesei-derived xylanase regulator 1 (Xyrl", LECTURE ABSTRACTS OF CONFERENCE OF JAPAN SOCIETY OF BIOSCIENCE, BIOTECHNOLOGY, AND AGROCHEMISTRY, vol. 103, 2008 *
FURUKAWA, TAKANORI ET AL.: "Transcription- activating region existing in 5'-upstream region of trichoderma reesei xyn3 gene", LECTURE ABSTRACTS OF CONFERENCE OF JAPAN SOCIETY OF BIOSCIENCE, BIOTECHNOLOGY, AND AGROCHEMISTRY, 2005, pages 28 *
HIRASAWA, H. ET AL.: "Engineering of the Trichoderma reesei xylanase3 promoter for efficient enzyme expression", APPL. MICROBIOL. BIOTECHNOL., vol. 102, no. 6, 7 February 2018 (2018-02-07), pages 2737 - 2752, XP036441053 *
LI, W. -C. ET AL.: "Trichoderma reesei complete genome sequence, repeat-induced point mutation, and partitioning of CAZyme gene clusters", BIOTECHNOL. BIOFUELS., vol. 10, no. 1, 3 July 2017 (2017-07-03), pages 170, XP055575639 *
OGASAWARA, W. ET AL.: "Cloning, functional expression and promoter analysis of xylanase III gene from Trichoderma reesei", APPL. MICROBIOL. BIOTECHNOL., vol. 72, 2006, pages 995 - 1003, XP019441655, DOI: doi:10.1007/s00253-006-0365-y *
RAUSCHER, R . ET AL.: "Transcriptional Regulation of xyn1, Encoding Xylanase I, in Hypocrea jecorina", EEUKARYOTIC CELL, vol. 5, no. 3, 2006, pages 447 - 456, XP055235005, DOI: doi:10.1128/EC.5.3.447-456.2006 *

Similar Documents

Publication Publication Date Title
US20180208945A1 (en) Genome editing systems and methods of use
CA2876287C (fr) Souche deficiente en agse
BRPI9914278B1 (pt) cepa recombinante de chrysosporium, e, método para produzir um polipeptídeo de interesse
JP7334997B2 (ja) 高酵素活性のセルラーゼ高分泌発現トリコデルマ・リーゼイを迅速にスクリーニングする方法
WO2014013073A1 (fr) Souche déficiente en amylase
US20080070277A1 (en) Homologous Amds Genes as Selectable Marker
JP2019528797A (ja) 誘導基質の非存在下における糸状菌細胞内でのタンパク質の産生
Wang et al. Secretory overproduction of a raw starch-degrading glucoamylase in Penicillium oxalicum using strong promoter and signal peptide
Rahman et al. Evaluation and characterization of Trichoderma reesei cellulase and xylanase promoters
US9322027B2 (en) Expression constructs comprising fungal promoters
Sun et al. Heterologous expression of codon optimized Trichoderma reesei Cel6A in Pichia pastoris
Wang et al. Development of a powerful synthetic hybrid promoter to improve the cellulase system of Trichoderma reesei for efficient saccharification of corncob residues
WO2012043755A1 (fr) Élément agissant en cis et son utilisation
US11542499B2 (en) Modified promoter
Jin et al. Heterologous expression of an endo-β-1, 4-glucanase gene from the anaerobic fungus Orpinomyces PC-2 in Trichoderma reesei
WO2001025468A1 (fr) Criblage a rendement eleve de banques d'adn exprimees, dans des champignons filamenteux
Han et al. Effect of VIB gene on cellulase production of Trichoderma orientalis EU7-22
WO2019031368A1 (fr) Promoteur modifié
CN114107360B (zh) 一种通过干扰磷酸酶基因提高里氏木霉纤维素酶表达的方法
CN106190874A (zh) 一种强化丝状真菌蛋白质生产的方法
Shida et al. Functional analysis of the egl3 upstream region in filamentous fungus Trichoderma reesei
US11225679B2 (en) Mutant β-glucosidase
EP4441202A1 (fr) Compositions et procédés pour une production améliorée de protéines dans des cellules fongiques
EP3282012B1 (fr) Variantes améliorées de cellobiohydrolase 1
WO2024137350A2 (fr) Souches fongiques recombinantes et leurs procédés de production de protéines cohérentes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18843687

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18843687

Country of ref document: EP

Kind code of ref document: A1