WO2019031368A1

WO2019031368A1 - Modified promoter

Info

Publication number: WO2019031368A1
Application number: PCT/JP2018/028937
Authority: WO
Inventors: 大視掛下; 望柴田; 洋介志田; 渉小笠原
Original assignee: 花王株式会社; 国立大学法人長岡技術科学大学
Priority date: 2017-08-09
Filing date: 2018-08-01
Publication date: 2019-02-14

Abstract

Provided is a modified promoter derived from a xylanase promoter. The modified promoter comprises a polynucleotide of the Xyn3 promoter which comprises a polynucleotide containing at least one cis-element polynucleotide of the Xyn1 promoter or a complementary chain thereof in a region corresponding to the nucleotides at the 374-401 positions in SEQ ID NO: 1. The polynucleotide of the Xyn3 promoter comprises: the nucleotide sequence represented by SEQ ID NO: 1; a nucleotide sequence represented by the nucleotides at the 350-1084 positions in SEQ ID NO: 1; or a nucleotide sequence having an identity of 90% or more to the aforesaid sequences and containing the sequence represented by SEQ ID NO: 2 in the region corresponding to the nucleotides at the 374-401 positions in SEQ ID NO: 1. The cis-element polynucleotide of the Xyn1 promoter is a polynucleotide which comprises the nucleotide sequence represented by SEQ ID NO: 4.

Description

Modified promoter

The present invention relates to a modified promoter and a method for producing the same, and a vector and a transformant containing the modified promoter.

There is known a technology for producing sugar from cellulose in biomass material (hereinafter sometimes referred to as "biomass") and converting it into fuel such as ethanol or a chemical product by a fermentation method or the like. With regard to this technology, various technological developments have been advanced with the background of recent interest in environmental problems, and large-scale production of fuels and chemicals by this technology has also begun to be developed.

Biomass is composed of cellulose fibers and hemicellulose and lignin mainly containing xylan surrounding them. In the production of sugar from biomass, an enzyme that hydrolyzes cellulose and hemicellulose is required. Biomass saccharification by cellulase and enzymatic degradation of biomass by hemicellulase and ligninase have been conventionally performed. For example, Patent Document 1 discloses an enzyme composition for converting biomass containing a cellulase and a hemicellulase such as Trichoderma reesei-derived xylanase and arabinofuranosidase into sugar. Further, Patent Document 2 discloses a method for producing sugar by causing a biomass resource to react a protein having xylanase activity derived from a microorganism group present in bagasse compost and cellulase.

The filamentous fungus Trichoderma reesei is a bacterium that efficiently produces xylanase, and is conventionally used for xylanase production. Three xylanases (Xyn1, Xyn2 and Xyn3) have been reported to date as xylanases from Trichoderma reesei. Among these xylanases, Xyn1 and Xyn2 are classified into glycosidic hydrolase family 11 (glycoside hydrolase family 11: GH11), but Xyn 3 is classified into glycosidic hydrolase family 10 (glycoside hydrolase family 10: GH10) And Xyn1 and Xyn2 belong to different families. Among the numerous Trichoderma reesei mutants derived from Trichoderma reesei strain QM9414, Xyn3 shows high expression only in the PC-3-7 strain. The expression level of Xyn3 in strain PC-3-7 is higher than that of the other two xylanases Xyn1 and Xyn2.

Also, Xyn3 is expressed in a regulatory mechanism different from Xyn1 and Xyn2. While expression of Xyn1 and Xyn2 is induced by xylan and cellulose, expression of Xyn3 is not induced by xylan (enzyme substrate) but is induced by cellulose and its derivatives (Non-patent Documents 1 and 2) . In order to elucidate the expression control mechanism of these xylanases, analysis of the promoters of these genes has been carried out. The region essential for the expression of Xyn3 includes the binding domain (5'-GGCTAT-3 'and 5'-GGCAAA-) of Xyr1 (a transcriptional regulator essential for lignocellulase production) on the promoter region of the gene encoding Xyn3. A cis element composed of a 3 ') and a 16 bp spacer sequence has been reported (Non-patent Document 3). On the other hand, as a region essential for the expression of Xyn1, a cis element composed of a binding domain (5'-GGCTAA-3 ') of Xyr1 and a spacer sequence of 10 bp is reported on the promoter region of the gene encoding Xyn1. (Non-Patent Document 4). Thus, although the promoter of Xyn1 and the promoter of Xyn3 have cis elements with similar structures to each other, their inducers are different. The reason why the responsiveness of cis element to cellulose and xylan differs among these promoters is not clear.

(Patent Document 1) JP-A-2011-515089 (Patent Document 2) JP-A-2012-029678 (Non-Patent Document 1) Appl Microbiol Biotechnol, 1998, 49: 718-724
(Non-patent document 2) Appl Microbiol Biotechnol, 2006, 72: 995-1003
(Non-Patent Document 3) Fungal Genet Biol, 2009, 46 (8): 564-574.
(Non-Patent Document 4) Eukaryot Cell, 2006, 5 (3): 447-456

In one aspect the invention is a modified promoter,
It consists of a polynucleotide of Xyn3 promoter including a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1,
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and a cellulose-induced promoter activity Having a polynucleotide,
And
The polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4), and contains the polynucleotide of the cis element of the one or more Xyn1 promoters or a complementary strand thereof The polynucleotide does not contain HAP2 / 3/5 binding site and CREI binding site,
Provide a modified promoter.

In another aspect, the present invention provides a vector containing the above-mentioned modified promoter.

In another aspect, the present invention provides a DNA fragment comprising a gene of interest and the above modified promoter upstream of the gene.

In another aspect, the present invention provides a transformant comprising the vector or the DNA fragment.

In a further aspect, the invention relates to a method of producing a modified promoter, comprising
Substituting or inserting a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to the nucleotides 374 to 401 of SEQ ID NO: 1 in the polynucleotide of the Xyn 3 promoter Including
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and a cellulose-induced promoter activity Having a polynucleotide,
And
The polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4), and contains the polynucleotide of the cis element of the one or more Xyn1 promoters or a complementary strand thereof The polynucleotide does not contain HAP2 / 3/5 binding site and CREI binding site,
Provide a way.

Sequence of the cis element region contained in the modified promoter in the GUS reporter cassette prepared in Example 2. Black frame: cis element of Xyn1 promoter, black outline letter: XYRI binding site. GUS activity in extracts of modified promoter-transduced cells after induction culture for 12 hours. A: GUS activity after culture in the presence of glucose, sorbose or sophorose. B: GUS activity after culture in the presence of xylose or xylan. GUS reporter cassette in transformants used in Example 4. Box: cis element of Xyn1 promoter. Relative GUS activity in extracts of modified promoter-transduced cells after induction culture. A: GUS activity after culture in the presence of Sophorus. B: GUS activity after culture in the presence of xylan. Western blotting analysis of culture supernatants of PC-3-7 strain and X3-2RB_AB1 strain. Left: culture supernatant from 1% Avicel® containing medium, right: culture supernatant from 1% Avicel® and 0.5% xylan containing medium. Expression of cbh1, xyr1, xyn3 and aabgl1 genes in X3-2 RB_AB1 strain and PC-3-7 strain under 0.01% sophorus induction. White bar: X3-2RB_AB1 strain, black bar: PC-3-7 strain. Expression of xyn1, xyr1, xyn3 and aabgl1 genes in strains X3-2RB_AB1 and PC-3-7 under 0.1% xylan induction. White bar: X3-2RB_AB1 strain, black bar: PC-3-7 strain. Western blotting analysis of culture supernatants of QM9414 strain and QMX3-2RB_AB1 strain. Left: culture supernatant from 1% Avicel® containing medium, right: culture supernatant from 1% Avicel® and 0.5% xylan containing medium. Expression of aabgl1 gene in QMX3-2RB_AB1 strain and QM9414 strain. A: Under 0.01% Sophorus induction B: Under 0.01% xylan induction White bar: QMX3-2RB_AB1 strain, black bar: QM 9414 strain. SDS-PAGE analysis of culture supernatant (JN13) of E1 AB1 strain and culture supernatant (JN24) of E1 AB1_X3-2RBX3.

Detailed Description of the Invention

All patent, non-patent and other publications cited herein are hereby incorporated by reference in their entirety.

Herein, the identity of nucleotide sequences and amino acid sequences is calculated by the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it is calculated by performing analysis with Unit size to compare (ktup) of 2 using a homology analysis (Search homology) program of genetic information processing software Genetyx-Win.

In the present specification, "at least 90% identity" with respect to the amino acid sequence or nucleotide sequence is 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, more preferably 99% or more identity. In the present specification, “at least 95% identity” with respect to the amino acid sequence or nucleotide sequence is 95% or more, preferably 96% or more, more preferably 97% or more, still more preferably 98% or more, still more preferably 99% or more of identity.

In the present specification, the "corresponding position" or "corresponding region" on the amino acid sequence or nucleotide sequence refers to the target sequence and the reference sequence (for example, the nucleotide sequence shown in SEQ ID NO: 1) with maximum homology. It can be determined by aligning as given. Alignment of amino acid sequences or nucleotide sequences can be performed using known algorithms, the procedures of which are known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple alignment program (Thompson, JD et al, 1994, Nucleic Acids Res. 22: 4673-4680) with default settings. Alternatively, Clustal W2 or Clustal omega, which is a revised version of Clustal W, can be used. Clustal W, Clustal W2 and Clustal omega are, for example, Japanese DNA data operated by the European Bioinformatics Institute (EBI [www.ebi.ac.uk/index.html]) and the National Institute of Genetics. It can be used on the bank (DDBJ [www.ddbj.nig.ac.jp/searches-j.html]) website. The position or region of the target sequence aligned corresponding to an arbitrary region of the reference sequence by the alignment described above is regarded as "corresponding position" or "corresponding region" to the arbitrary region.

As used herein, "upstream" and "downstream" with respect to a gene refers to upstream and downstream of the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is present 3 'of the promoter in the DNA sense strand, and upstream of the gene is 5' of the gene in the DNA sense strand. Means the side area.

As used herein, an "operable linkage" between a promoter and a gene means that the promoter is linked so as to direct transcription of the gene. Procedures for "operably linking" promoters and genes are well known to those skilled in the art.

As used herein, “promoter activity” refers to an activity that promotes expression of a gene located downstream thereof, more specifically, an activity that promotes transcription from DNA to mRNA of a gene located downstream. Promoter activity can be confirmed by using an appropriate reporter gene. For example, promoter activity can be confirmed by linking a DNA encoding a detectable protein downstream of the promoter, ie, by linking a reporter gene, and measuring the amount of the expression product of the reporter gene. Examples of reporter genes include genes of fluorescent proteins such as β-galactosidase (LacZ) gene, β-glucuronidase (GUS) gene, luciferase gene, β-lactamase gene, GFP (Green Fluorescent Protein) gene and the like. Alternatively, promoter activity can also be confirmed by measuring the expression level of mRNA transcribed from a reporter gene by quantitative RT-PCR or the like.

As used herein, the term "intrinsic" used in reference to a cell function, property, or trait is used to indicate that the function, property, or trait is originally present in the cell. In contrast, the term "foreign" is used to denote an externally introduced function, property, or trait, not originally present in the cell. For example, a "foreign" gene or polynucleotide is a gene or polynucleotide that has been introduced into the cell from the outside. The foreign gene or polynucleotide may be from an organism homologous to the cell into which it has been introduced, or may be from a different organism (i.e., a heterologous gene or polynucleotide).

As used herein, "Xyn3 promoter" refers to a promoter of a gene encoding xylanase Xyn3 and a promoter equivalent thereto. Examples of Xyn3 promoters include promoters consisting of the following polynucleotides:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% It consists of a nucleotide sequence which is identical and which comprises a sequence represented by GGCTAT-NNNNNNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2; N is any nucleotide) in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1, and A polynucleotide having induced promoter activity.

Preferred examples of the nucleotide sequence at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1 include the nucleotide sequence shown in nucleotides 3 to 1073 of SEQ ID NO: 1. As a preferred example of a nucleotide sequence at least 90% identical to the nucleotide sequence shown by nucleotides 350 to 1084 of SEQ ID NO: 1, the nucleotide sequence shown by nucleotides 350 to 1073 of SEQ ID NO: 1 can be mentioned. These sequences contain a sequence represented by GGCTAT-NNNNNNNNNNNNNNNN-NN-NN-TNTGNN (SEQ ID NO: 2; N is any nucleotide) in a region corresponding to nucleotides 372-399 of SEQ ID NO: 1, and a cellulose-derived promoter It has activity. Thus, a further example of the Xyn3 promoter of the present invention includes a promoter consisting of the following polynucleotide:
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or nucleotides 350 to 1073 of SEQ ID NO: 1 Nucleotide which is at least 90% identical to the nucleotide sequence shown and which corresponds to nucleotides 374-401 of SEQ ID NO: 1 in the region corresponding to nucleotides GGCTAT-NNNNNNNNNNNNNNNNNN-NN-NNTNNN-TTTGCC (SEQ ID NO: 2; N is any nucleotide) A polynucleotide consisting of a sequence and having cellulose-induced promoter activity.

The GGCTAT-NNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2) is a cis element of the Xyn3 promoter. As a preferable example of the said sequence shown by sequence number 2, the sequence shown by GGCTATATAGGACACTGTCAATTTTGCC (sequence number 3) is mentioned.

Preferably, the Xyn3 promoter has a motif (Fungal Genet Biol, 2008, 45: 1094-1102) possessed by the existing xylanase promoter. Examples of the motif include TATA box, CREI binding site, ACEI binding site, ACEII binding site, CAAT motif and the like. The following areas may be mentioned in more detail:
TATA box (eg, TATA) in a region corresponding to nucleotides 860 to 863 and nucleotides 889 to 892 of SEQ ID NO: 1;
Regions corresponding to nucleotides 53 to 58, nucleotides 124 to 129, nucleotides 249 to 254, nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1 A CREI binding site (eg, a sequence selected from the group consisting of CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC and CTGGGG):
ACEI binding site (eg, TGCCT, AGGCA, etc.) in a region corresponding to nucleotides 350 to 354 of SEQ ID NO: 1;
ACEII binding site (for example, a sequence selected from the group consisting of GGCTAA, TTAGCC, and GGCTAA) in a region corresponding to nucleotides 594 to 599 and nucleotides 845 to 850 of SEQ ID NO: 1; and SEQ ID NO: 583 CAAT motif (eg, CCAAT) in the region corresponding to nucleotides 587.

As used herein, “cis element of Xyn1 promoter” refers to a cis element present on the promoter of a gene encoding xylanase Xyn1 and cis elements equivalent thereto. An example of the cis element of the Xyn1 promoter includes a polynucleotide consisting of a nucleotide sequence represented by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4; N is any nucleotide). Preferred examples of the sequence shown in SEQ ID NO: 4 include the sequence shown in GGCTAAATGCGACATCTTAGCC (SEQ ID NO: 5).

The present invention relates to the provision of a modified promoter derived from a xylanase promoter, and a method of producing the same. The present invention also relates to the provision of vectors and transformants containing the modified promoter.

The present inventors have modified the cis element of the promoter of the gene encoding xylanase Xyn3 based on the cis elements of other xylanase promoters, thereby inducing the expression inducibility of the promoter of the gene encoding Xyn3 in biomass. Was found to improve.

The modified promoter of the present invention has an improved ability to induce sophorose and cellulose, and may further have the ability to be induced by a xylan-based substance. According to the present invention, it is possible to improve the efficiency of microbiological production of xylanase and other enzymes involved in the degradation or saccharification of biomass.

The present invention provides modified promoters. The modified promoter of the present invention is a modified promoter of Xyn3 promoter. Typically, the modified promoter of the present invention is obtained by substituting or inserting a polynucleotide containing a cis element of Xyn1 promoter or a complementary strand thereof to a cis element region in a polynucleotide of Xyn3 promoter. is there. The Xyn3 promoter is a parent promoter of the modified promoter of the present invention.

In the present invention, substitution or insertion of a cis element (or its complementary strand) consisting of a predetermined nucleotide sequence, or a polynucleotide containing the same into the Xyn3 promoter is to the side of the promoter linked to the DNA sense strand. , The predetermined nucleotide sequence (or the complementary strand thereof) is arranged. Similarly, when the modified promoter of the present invention contains a cis element (or a complementary strand thereof) consisting of a predetermined nucleotide sequence, or a polynucleotide containing the same, the predetermined nucleotide sequence (or a complementary strand thereof) is the promoter Are present on the side which is linked to the DNA sense strand of

In a preferred embodiment, the invention is a modified promoter,
It consists of a polynucleotide of Xyn3 promoter including a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1,
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 and corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and having a cellulose-induced promoter activity , Polynucleotides,
And the polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4)
Provide a modified promoter.

In a preferred embodiment, the polynucleotide of the Xyn3 promoter is
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A region identical to that of SEQ ID NO: 1 and corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and having a cellulose-induced promoter activity , Polynucleotides,
It is.

In a more preferred embodiment, the polynucleotide of the Xyn3 promoter is
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide comprising a nucleotide sequence which is identical and corresponds to nucleotides 374-401 of SEQ ID NO: 1 and which comprises the sequence shown by GGCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3) and has a cellulose-induced promoter activity,
It is.

In a further preferred embodiment, the polynucleotide of said Xyn3 promoter is
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3-1073 of SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or represented by nucleotides 350 to 1073 of SEQ ID NO: 1 GGCTAT-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN (SEQ. The SEQ. Polynucleotides having promoter activity,
It is. In a further preferred embodiment, the sequence represented by GGCTAT-NNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2) is the sequence represented by GCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).

In a further preferred embodiment, the polynucleotide of said Xyn3 promoter is
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3-1073 of SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or represented by nucleotides 350 to 1073 of SEQ ID NO: 1 GGCTAT-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN (SEQ. The region is derived from cellulose, which is at least 95% identical to the nucleotide sequence and at least 95% identical to the nucleotide sequence and corresponding to nucleotides 374 to 401 of Polynucleotides having promoter activity,
It is. In a further preferred embodiment, the sequence represented by GGCTAT-NNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2) is the sequence represented by GCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).

In a preferred embodiment, the polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown in GGCTAAATGCGACATCTTAGCC (SEQ ID NO: 5).

In the modified promoter of the present invention, a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 in the polynucleotide of Xyn3 promoter (parent promoter) (also referred to as “region 374 to 401 in the following specification”) A polynucleotide containing one or more cis-element polynucleotides of the Xyn1 promoter or a complementary strand thereof (hereinafter also referred to as “Xyn1 cis-element-containing fragment” in the following specification) is substituted or inserted, There is. The number of the Xyn1 cis element or its complementary strand contained in the Xyn1 cis element-containing fragment is preferably 1 to 10, more preferably 1 to 8, still more preferably 1 to 6, further preferably 2 to 6 It is preferably one, two, three or six.

In a preferred embodiment, the Xyn1 cis element-containing fragment comprises 1 to 10, more preferably 1 to 8, more preferably 1 to 6 polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or the complementary strand thereof More preferably, it is a polynucleotide containing 2 to 6, more preferably 1, 2, 3 or 6. Therefore, in a preferred embodiment, the modified promoter of the present invention comprises 1 to 10, more preferably 1 to 8, more preferably 1 to 6 polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or the complementary strand thereof. , More preferably 2 to 6, still more preferably 1, 2, 3 or 6.

In a further preferred embodiment, the Xyn1 cis-element-containing fragment comprises 1 to 10, more preferably 1 to 8, still more preferably 1 to 6, polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 5 Is a polynucleotide comprising 2 to 6, more preferably 1, 2, 3 or 6. In another further preferred embodiment, the Xyn1 cis-element-containing fragment has 1 to 10, more preferably 1 to 8, more preferably 1 to 10, complementary strands of a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 It is a polynucleotide containing six, more preferably 2 to 6, more preferably 1, 2, 3 or 6. In a still preferred embodiment, the Xyn1 cis-element-containing fragment is a polynucleotide comprising two polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 5, or a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 It is a polynucleotide containing one or two complementary strands. In another still preferred embodiment, the Xyn1 cis-element containing fragment is a polynucleotide comprising three polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 5 or a poly consisting of the nucleotide sequence shown in SEQ ID NO: 5 A polynucleotide comprising three or six complementary strands of nucleotides.

When the Xyn1 cis-element-containing fragment comprises two or more polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or 5 or a complementary strand thereof, it is preferable to have a spacer sequence between each of them. The spacer sequence may be a sequence consisting of 5 to 20 bases which does not inhibit the gene expression control function of the Xyn1 cis element-containing fragment. Examples of the spacer sequence include TCAAGA, TCTAGA and the like.

Therefore, preferred examples of the Xyn1 cis-element-containing fragment include the nucleotide sequence shown in SEQ ID NO: 5 or its complementary strand; and the spacer sequence linked downstream of the nucleotide sequence shown in SEQ ID NO: 5 or its complementary strand 2 or more, preferably 2 to 10, more preferably 2 to 8, still more preferably 2 to 6, still more preferably 3 to 6, still more preferably 2, 3 or 6, of the above sequence And a polynucleotide consisting of In these Xyn1 cis-element-containing fragments, the above-mentioned spacer sequences may be arranged at the most upstream and the most downstream.

Preferred examples of said Xyn1 cis-element containing fragment are:
A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43,
Can be mentioned.

Thus, in a preferred embodiment, the modified promoter of the present invention comprises the following polynucleotide in the 374 to 401 region compared to the Xyn3 promoter (parent promoter):
A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43.

In the promoter of Xyn1 gene, HAP2 / 3/5 binding site (transcription promoting factor, 5'-CCAAT-3 ') and CREI binding site (carbon source catabolite repressor, 5'-SYGGRG-) adjacent to its cis element 3 ', 5'-CCCCAG-3') is present (Biosci Biotechnol Biochem, 2016, 80 (9): 1712-1729). On the other hand, the Xyn1 cis-element-containing fragment to be substituted or inserted into the parent promoter is preferably one that does not contain the HAP2 / 3/5 binding site and the CREI binding site. Also preferably, the modified promoter of the present invention does not contain the HAP2 / 3/5 binding site and the CREI binding site in the vicinity of the cis element of the substituted or inserted Xyn1 promoter. If the Xyn1 cis-element-containing fragment not containing the HAP2 / 3/5 binding site and the CREI binding site is substituted or inserted in the No. 374 to No. 401 region of the Xyn3 promoter, the vicinity of the substituted or inserted Xyn1 promoter cis element HAP2 / 3/5 binding site and CREI binding site are not located in It has been reported that when the cis-element of Xyn1 promoter containing HAP binding site or CREI binding site is substituted or inserted, the promoter activity of the modified promoter is reduced (Applied Microbiology and Biotechnology, 2018, 102 (6): 2737-2752 ).

When producing the modified promoter of the present invention from the parent promoter, the entire 374 to 401 region of the Xyn3 promoter may be replaced with the Xyn1 cis element-containing fragment, or the nucleotides of the 374 to 401 region The Xyn1 cis-element-containing fragment may be inserted into the inside of the region while leaving all the fragments. Alternatively, the Xyn1 cis-element-containing fragment may be inserted inside the 374th-401th region so that a part of the 374th-401th region is replaced with the Xyn1 cis-element-containing fragment. In other words, in the modified promoter of the present invention, the regions 374 to 401 may be entirely deleted or partially deleted, or in the Xyn1 cis element-containing fragment It may be divided. Preferably, in the modified promoter of the present invention, the entire 374 to 401 region of the Xyn3 promoter is substituted with the Xyn1 cis element-containing fragment, and the entire 374 to 401 region is deleted. There is.

The method for obtaining the modified promoter of the present invention is not particularly limited, and can be obtained by a conventional chemical synthesis method or a genetic engineering method. For example, the modified promoter of the present invention can be artificially synthesized. For artificial synthesis of DNA, for example, a service such as Invitrogen can be used. Alternatively, the modified promoter of the present invention can be produced by genetically modifying the Xyn3 promoter (parent promoter).

The parent promoter of the modified promoter of the present invention may be artificially synthesized by the means described above, but may also be cloned from a microorganism. For example, a polynucleotide of the Xyn3 promoter consisting of the nucleotide sequence shown in SEQ ID NO: 1 can be cloned from Trichoderma reesei PC-3-7 strain.

Alternatively, the parent promoter of the modified promoter of the present invention can be cloned from a mutated Trichoderma reesei strain PC-3-7. For example, a mutation is introduced into the DNA of the Xyn3 promoter in Trichoderma reesei PC-3-7 strain, and among the obtained mutant DNA, at least 90% identical to the nucleotide sequence shown in SEQ ID NO: 1, A polynucleotide consisting of a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of the number 1 and having a promoter activity can be selected. As a method of mutagenesis, for example, ultraviolet irradiation and site-directed mutagenesis can be mentioned. The promoter activity of the mutant DNA can be measured, for example, by operably linking the target gene downstream of the mutagenized DNA and analyzing the expression amount of the target gene. The introduction of these mutations and the selection of the target mutant DNA are routine procedures of those skilled in the art.

The substitution or insertion of the Xyn1 cis-element-containing fragment into the region 374 to 401 of the parent promoter can be carried out according to procedures well known to those skilled in the art such as construction of a fragment using PCR, ligation and the like. For example, an upstream fragment and a downstream fragment of the region 374 to 401 of the parent promoter (Xyn3 promoter) and a fragment containing Xyn1 cis element are prepared by PCR, and they are ligated to form Xyn1 between the upstream fragment and the downstream fragment. By arranging a cis-element-containing fragment, a DNA fragment containing the modified promoter of the present invention can be prepared, which contains the Xyn1 cis-element-containing fragment instead of the 374 to 401 regions.

The modified promoter of the present invention has the function of controlling the expression of the gene located downstream thereof. By using the modified promoter of the present invention, a DNA fragment having an expression control region excellent in transcriptional activity can be obtained. For example, a DNA fragment can be constructed which comprises a gene of interest and the modified promoter of the present invention operably linked upstream thereof. Alternatively, a DNA fragment containing the modified promoter of the present invention can be constructed to have restriction enzyme recognition sequences at both ends. The restriction enzyme recognition sequence can be used to introduce the modified promoter of the present invention into a vector. That is, a modified vector of the present invention is introduced into a vector by cutting a known vector with a restriction enzyme and adding thereto a DNA fragment containing the modified promoter of the present invention and having a restriction enzyme cleavage sequence at the end. Can be done (restriction enzyme method).

Thus, the modified promoter of the present invention can be contained in a vector. By incorporating the modified promoter of the present invention into a vector that allows expression of a target gene, an expression vector capable of enhancing expression of the target gene at the transcription level can be obtained. In the expression vector, the modified promoter of the present invention can be operably linked upstream of the DNA encoding the target gene. The vector having the promoter of the present invention may be in the form introduced into the chromosome of the host cell or in the form retained extrachromosomally. Alternatively, a DNA fragment having a target gene and the modified promoter of the present invention operably linked upstream thereof may be constructed and directly introduced into the genome of the host cell.

The vector incorporating the modified promoter of the present invention is not particularly limited as long as it is stably maintained and can be propagated in a host cell, and includes, for example, AMA1 which functions as a self-sustaining replication factor in Aspergillus microorganism A plasmid etc. are mentioned.

The modified promoter of the present invention has an improved ability to induce promoter activity by cellulose or a derivative thereof possessed by the parent promoter Xyn3 promoter. Preferably, the ability to induce promoter activity by xylan or a derivative thereof is obtained. Thus, the modified promoter of the present invention is suitable for use in the presence of cellulose and xylan. For example, the modified promoter of the present invention is suitable as a promoter for enzymes used in the process of biomass degradation or biomass saccharification.

Therefore, the target gene operably linked to the promoter or vector in the vector or DNA fragment containing the modified promoter of the present invention includes enzymes used in the process of biomass degradation or biomass saccharification, such as cellulases (eg, β-endoglucanase , Cellobiohydrolase, β-glucosidase, etc., hemicellulase (eg, endoxylanase, β-xylosidase, arabinofuranosidase, glucuronidase, acetyl xylan esterase, mannanase, β-mannosidase, ferulic acid esterase etc.), xylanase etc. Genes are preferred. Alternatively, as the target gene, a gene that is controlled by a promoter that is not naturally induced in expression by cellulose or xylan is preferable. A more preferred example of the target gene operably linked to the modified promoter of the present invention is a polynucleotide encoding xylanase Xyn3 consisting of the amino acid sequence shown in SEQ ID NO: 38, an amino acid sequence at least 90% identical to SEQ ID NO: 38 Or a nucleotide sequence represented by SEQ ID NO: 37 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto, which encodes xylanase, and the like. In another preferred example of the target gene, a polynucleotide encoding xylanase PspXyn (WO2016 / 208492) consisting of the amino acid sequence shown by SEQ ID NO: 40, encoding a xylanase consisting of an amino acid sequence at least 90% identical to SEQ ID NO: 40 The polynucleotide includes a nucleotide sequence shown by SEQ ID NO: 39 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto, which encodes xylanase, and the like. However, the types of target genes that can be operably linked to the promoter of the present invention are not limited thereto.

The vector or DNA fragment containing the modified promoter of the present invention can be transformed by a general transformation method such as electroporation, transformation, transfection, conjugation, protoplast, particle gun method, Agrobacterium method etc. The transformant of the present invention can be obtained by introducing it into a host cell using

Examples of host cells into which the above vectors and DNA fragments are introduced are not particularly limited as long as the promoter of the present invention can function as a promoter in the cells, but usually eukaryotes, preferably fungi Preferably, filamentous fungi are mentioned. Preferred filamentous fungi include, for example, Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor. Myceliophthora, Neocallimastix, Neurospora, Pasilomyces, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Rhizopus, Schizophyllum, Tala omyces genus Thermoascus genus Thielavia genus Tolypocladium sp, Trametes sp, and the genus Trichoderma filamentous fungus and the like, these, preferably Trichoderma genus, Trichoderma reesei and its mutant strain is more preferable. Examples of Trichoderma reesei and mutants thereof include Trichoderma reesei QM9414 and mutants thereof, such as Licoderma reesei PC-3-7.

The following materials, methods of manufacture, uses, methods, etc. are further disclosed herein as exemplary embodiments of the present invention. However, the present invention is not limited to these embodiments.

[1] A modified promoter, which
It consists of a polynucleotide of Xyn3 promoter including a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1,
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and a cellulose-induced promoter activity Having a polynucleotide,
And
The polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4), and contains the polynucleotide of the cis element of the one or more Xyn1 promoters or a complementary strand thereof A modified promoter, wherein the polynucleotide does not contain HAP2 / 3/5 binding site and CREI binding site.

[2] The polynucleotide of the Xyn3 promoter is
Preferably, it contains one or more selected from the group consisting of TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif,
More preferably, the modified promoter according to [1], which comprises TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif.

[3] The modified promoter according to [2], preferably, wherein said TATA box is a TATA box (eg, TATA) in a region corresponding to nucleotides 860 to 863 and nucleotides 889 to 892 of SEQ ID NO: 1.

[4] The CREI binding site is
Preferably, a CREI binding site (for example, CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC, and CTGGGG in a region corresponding to nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1). A sequence selected from the group consisting of
More preferably, nucleotides 53 to 58, nucleotides 124 to 129, nucleotides 249 to 254, nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1 A CREI binding site (eg, a sequence selected from the group consisting of CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC and CTGGGG) in the region corresponding to
The modified promoter according to [2] or [3].

[5] The modified promoter according to any one of [2] to [4], preferably, wherein the ACEI binding site is TGCCT or AGGCA in a region corresponding to nucleotides 350 to 354 of SEQ ID NO: 1.

[6] Preferably, the ACEII binding site is selected from the group consisting of ACEII binding sites (eg, GGCTAA, TTAGCC, and GGCTAA) in the regions corresponding to nucleotides 594 to 599 and nucleotides 845 to 850 of SEQ ID NO: 1 A modified promoter according to any one of [2] to [5].

[7] Preferably, the modified promoter according to any one of [2] to [6], wherein the CAAT motif is a CAAT motif (for example, CCAAT) in a region corresponding to nucleotides 583 to 587.

[8] Preferably, the polynucleotide of the Xyn3 promoter is
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide which is identical and comprises a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and having a cellulose-induced promoter activity,
The modified promoter according to any one of [1] to [7], which is

[9] Preferably, the polynucleotide of the Xyn3 promoter is
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or nucleotides 350 to 1073 of SEQ ID NO: 1 A nucleotide sequence comprising a sequence represented by SEQ ID NO: 2 in a region corresponding to nucleotides 374-401 of SEQ ID NO: 1 and at least 90% identical to the nucleotide sequence Having a polynucleotide,
The modified promoter according to any one of [1] to [7], which is

[10] Preferably, the modified promoter according to any one of [1] to [9], wherein the nucleotide sequence containing the sequence represented by SEQ ID NO: 2 is the sequence represented by GGCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).

[11] Preferably, the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof is a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4 or a complementary strand thereof Any one of [1] to [10], more preferably 1 to 8, still more preferably 1 to 6, still more preferably 2 to 6, still more preferably 1, 2, 3 or 6 The modified promoter described in paragraph.

[12] The modified promoter according to [11], preferably, wherein the polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 4 is a polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 5.

[13] Preferably, the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof does not contain a HAP2 / 3/5 binding site and a CREI binding site,
The HAP2 / 3/5 binding site is CCAAT, and the CREI binding site is SYGGRG or CCCCAG,
The modified promoter according to any one of [1] to [12].

[14] Preferably, the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof,
The nucleotide sequence shown in SEQ ID NO: 5 or its complementary strand,
2 or more, more preferably 2 to 10, still more preferably 2 to 8, still more preferably 2 to 6 of the nucleotide sequence shown in SEQ ID NO: 5 or a sequence in which a spacer sequence is linked downstream of the complementary strand thereof It is a polynucleotide consisting of one, more preferably 3 to 6, still more preferably 2, 3 or 6 repeats.
The modified promoter according to any one of [1] to [13].

[15] The modified promoter according to [14], preferably, wherein the spacer sequence is TCAAGA or TCTAGA.

[16] Preferably, the polynucleotide containing a cis-element polynucleotide of the one or more Xyn1 promoters or a complementary strand thereof is:
A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43,
The modified promoter according to any one of [1] to [15], which is

[17] Preferably, all or part of the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 is deleted or a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 The modified promoter according to any one of [1] to [16], which is interrupted by a polynucleotide containing a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof.

[18] A method for producing a modified promoter, comprising
Substituting or inserting a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to the nucleotides 374 to 401 of SEQ ID NO: 1 in the polynucleotide of the Xyn 3 promoter Including
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and a cellulose-induced promoter activity Having a polynucleotide,
And
The polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4), and contains the polynucleotide of the cis element of the one or more Xyn1 promoters or a complementary strand thereof The polynucleotide does not contain HAP2 / 3/5 binding site and CREI binding site,
Method.

[19] The polynucleotide of the Xyn3 promoter is
Preferably, it contains one or more selected from the group consisting of TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif,
More preferably, the method according to [18], which comprises TATA box, CREI binding site, ACEI binding site, ACEII binding site, and CAAT motif.

[20] The method according to [19], preferably, wherein said TATA box is a TATA box (eg, TATA) in a region corresponding to nucleotides 860 to 863 and nucleotides 889 to 892 of SEQ ID NO: 1.

[21] The CREI binding site is
Preferably, a CREI binding site (for example, CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC, and CTGGGG in a region corresponding to nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1). A sequence selected from the group consisting of
More preferably, nucleotides 53 to 58, nucleotides 124 to 129, nucleotides 249 to 254, nucleotides 456 to 461, nucleotides 509 to 514, and nucleotides 811 to 816 of SEQ ID NO: 1 A CREI binding site (eg, a sequence selected from the group consisting of CTCCAG, CTCCAC, CCCCAG, CTCCGG, CTCCGC and CTGGGG) in the region corresponding to
The method according to [19] or [20].

[22] The method according to any one of [19] to [21], preferably, wherein the ACEI binding site is TGCCT or AGGCA in a region corresponding to nucleotides 350 to 354 of SEQ ID NO: 1.

[23] Preferably, the ACE II binding site is selected from the group consisting of ACE II binding sites (eg, GGCTAA, TTAGCC, and GGCTAA) in the regions corresponding to nucleotides 594 to 599 and nucleotides 845 to 850 of SEQ ID NO: 1 The method according to any one of [19] to [22],

[24] The method according to any one of [19] to [23], preferably, wherein the CAAT motif is a CAAT motif (eg, CCAAT) in a region corresponding to nucleotides 583 to 587.

[25] Preferably, the polynucleotide of the Xyn3 promoter is
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide which is identical and comprises a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and having a cellulose-induced promoter activity,
The method according to any one of [18] to [24], which is

[26] Preferably, the polynucleotide of the Xyn3 promoter is
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or nucleotides 350 to 1073 of SEQ ID NO: 1 A nucleotide sequence comprising a sequence represented by SEQ ID NO: 2 in a region corresponding to nucleotides 374-401 of SEQ ID NO: 1 and at least 90% identical to the nucleotide sequence Having a polynucleotide,
The method according to any one of [18] to [24], which is

[27] Preferably, the method according to any one of [18] to [26], wherein the nucleotide sequence containing the sequence shown in SEQ ID NO: 2 is the sequence shown in GGCTATATAGGACACTGTCAATTTTGCC (SEQ ID NO: 3).

[28] Preferably, the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof is 1 to 10 of a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4 or a complementary strand thereof Any one of [18] to [27], more preferably 1 to 8, still more preferably 1 to 6, still more preferably 2 to 6, still more preferably 1, 2, 3 or 6 Method according to paragraph.

[29] The method according to [28], preferably, wherein the polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 4 is a polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 5.

[30] Preferably, the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof does not contain a HAP2 / 3/5 binding site and a CREI binding site,
The HAP2 / 3/5 binding site is CCAAT, and the CREI binding site is SYGGRG or CCCCAG,
The method according to any one of [18] to [29].

[31] Preferably, the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof,
The nucleotide sequence shown in SEQ ID NO: 5 or its complementary strand,
2 or more, more preferably 2 to 10, still more preferably 2 to 8, still more preferably 2 to 6 of the nucleotide sequence shown in SEQ ID NO: 5 or a sequence in which a spacer sequence is linked downstream of the complementary strand thereof It is a polynucleotide consisting of one, more preferably 3 to 6, more preferably 2, 3 or 6 repeats.
The method according to any one of [18] to [30].

[32] The method according to [31], preferably, wherein the spacer sequence is TCAAGA or TCTAGA.

[33] Preferably, the polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof is:
A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43,
The method according to any one of [18] to [32], which is

[34] Preferably, all or a part of a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 which is a polynucleotide containing a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof The method according to any one of [18] to [33], which is substituted or inserted into a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1.

[35] A vector comprising the modified promoter according to any one of [1] to [17].

[36] Preferably, the vector according to [35], wherein the modified promoter is linked upstream of the target gene.

[37] The target gene is
Preferably, a gene encoding an enzyme selected from the group consisting of cellulase, hemicellulase and cellulase,
More preferably, the nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto and encoding a xylanase, or the nucleotide sequence of SEQ ID NO: 39 or at least 90% identical thereto A polynucleotide encoding a xylanase consisting of
[36] The vector according to [36].

[38] A DNA fragment comprising a target gene and the modified promoter according to any one of [1] to [17] linked upstream of the gene.

[39] The target gene is
Preferably, a gene encoding an enzyme selected from the group consisting of cellulase, hemicellulase and cellulase,
More preferably, the nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence consisting of a nucleotide sequence at least 90% identical thereto and encoding a xylanase, or the nucleotide sequence of SEQ ID NO: 39 or at least 90% identical thereto A polynucleotide encoding a xylanase consisting of
The DNA fragment of [38].

[40] A transformant comprising the vector of any one of [35] to [37] or the DNA fragment of [38] or [39].
[41] The transformant according to [40], which is a Trichoderma sp.

Hereinafter, the present invention will be described in more detail based on examples, but the present invention is not limited thereto.

Example 1 Preparation of Modified Xyn3 Promoter (1) Cloning of Xyn3 Promoter Using a gene region including the upstream of a gene (xyn3) encoding xylanase Xyn3 derived from Trichoderma reesei PC-3-7 strain as a template, primer xyn3-EcoRI- The Xyn3 promoter region (SEQ ID NO: 1) including the primer fragment at both ends was amplified by PCR using U (SEQ ID NO: 9) and the primer xyn3-NcoI (SEQ ID NO: 10). The obtained DNA fragment was introduced into pT7blue (Novagen) to obtain a plasmid pTxyn3PD0. For construction of a reporter cassette, a plasmid pTxyn3PD0 was cleaved with BamHI and XbaI to obtain a DNA fragment containing a promoter region, which was amplified and introduced into a pKF18K plasmid (Takara) to obtain a Xyn3 promoter-containing plasmid pKFxyn3PD0.

(2) Removal of cis element from Xyn3 promoter Removal of cis element (SEQ ID NO: 3) of Xyn3 promoter and XbaI by PCR using primers xyn3P_cis_inv_Fw (SEQ ID NO: 11) and primer xyn3P_cis_inv_Rv (SEQ ID NO: 12) for pKFxyn3PD0. A restriction enzyme site was added. The plasmid pKFxyn3P-Δcis was obtained by self-ligation of this PCR product.

(3) Preparation of Xyn1 Promoter cis Element-Containing Fragment A DNA fragment containing a cis element (SEQ ID NO: 5) of the promoter of the gene encoding Xyn 1 was constructed. SEQ ID NO: 5 using primer 1 Box_Fw (SEQ ID NO: 13) and Primer 1 Box Rv (SEQ ID NO: 14) from the gene region including the upstream of the gene (xyn 1) encoding xylanase Xyn1 derived from Trichoderma reesei strain PC-3-7. A DNA fragment (1 Box; SEQ ID NO: 6) containing one sequence shown in and containing XbaI sites at both ends, and its complementary strand (1R Box) were constructed. Furthermore, a DNA fragment (2 Box and 2 R Box; SEQ ID NOs: 7 and 8) was synthesized which contains the sequence shown in SEQ ID NO: 5 or two complementary strands thereof, and contains XbaI site at both ends.

(4) Preparation of modified Xyn3 promoter-containing plasmid Each DNA fragment prepared in (3) is introduced into pKFxyn3P-Δcis digested with XbaI, and modified promoter-containing plasmids pKFxyn3-1Box, pKFxyn3-1RBox, pKFxyn3-2Box, and pKFxyn3-2RBox was constructed.

Example 2 Preparation of Reporter Cassette Containing Modified Promoter (1) Preparation of GUS Reporter-Containing Plasmid In order to evaluate the inducibility of the modified Xyn 3 promoter prepared in Example 1, GUS (β which is a reporter under the control of each promoter) A reporter cassette was constructed in which a gene (gus) encoding -glucuronidase was introduced. The downstream region of 0.8 kbp xyn3 amplified by primers xyn3-SpeI (SEQ ID NO: 15) and primer xyn3-EcoRI-D (SEQ ID NO: 16) was introduced into pT7Blue-T (Novagen) to obtain pTxyn3T. . In addition, the gus gene is amplified using pBACgus-1 (Novagen) as a template, primer gus-NcoI (SEQ ID NO: 17) and primer gus-SpeI (SEQ ID NO: 18), and introduced into pT7Blue-T. I got one. pTxyn3T and pTgus-1 were digested with SpeI and ligated to construct pTgus-2 (having xyn3 downstream region after stop codon of gus gene).

(2) Preparation of promoter-GUS fragment The plasmid containing pKFxyn3PD0, pKFxyn3P-Δcis, and the modified promoter prepared in Example 1 was cleaved with BamHI and NcoI to obtain a DNA fragment. PTgus-2 prepared in (1) was cleaved with BamHI and NcoI to obtain a DNA fragment. The pKFxyn3PD0 fragment and the pTgus-2 fragment were ligated to create a plasmid pTxyn3-PD0. The pKFxyn3P-Δcis and pTgus-2 fragments were ligated to create the plasmid pTxyn3-Δcis. Furthermore, the modified promoter-containing plasmid fragment and the pTgus-2 fragment were ligated to prepare plasmids pTxyn3-1 Box, pTxyn3-2 Box, pTxyn3-1RBox, and pTxyn3-2RBox, respectively. The resulting plasmid was digested with EcoRI and NsiI, respectively, to obtain a fragment containing promoter-GUS.

(3) Preparation of xyn3-amdS fragment A 7.7 kbp DNA fragment (3.1 kbp xyn3 upstream region, 1.4 kbp xyn3 ORF, 3.2 kbp) from Trichoderma reesei PC-3-7 strain, containing the ORF of xyn3 Containing the xyn3 downstream region of pBluescript II SK (Novagen) was digested with EcoRI and blunted to construct pBE (EcoRI site deleted). pBE was digested with SalI and ligated with the above-mentioned 7.7 kbp fragment to obtain pBxyn3S '. This plasmid was partially digested with EcoRI and blunted to construct pBxyn3SE 'in which only the EcoRI site present in the downstream region was deleted. p3SR2 (Mol Cell Biol, 1983, 3 (8): 1430-1439) is digested with SpeI and XbaI, and a 3.5 kbp DNA fragment containing the amdS gene (Aspergillus nidulans acetoamylase gene amdS, and its upstream and downstream regions) Included). pBxyn3SE 'was digested with NarI and ligated with the 3.5 kbp DNA fragment to obtain pBxyn3amdS. The resulting plasmid was digested with coRI and NsiI to obtain a fragment containing xyn3-amdS.

(4) Preparation of GUS Reporter Cassette for Promoter Analysis The promoter-GUS fragment prepared in (2) was introduced into the xyn3-amdS fragment prepared in (3), and the plasmid for promoter analysis pBxyn3ag-D0C containing the GUS reporter cassette was used, pBxyn3ag-Δcis, pBxyn3ag-1 Box, pBxyn3ag-1 RBox, pBxyn3ag-2 Box, and pBxyn3ag-2 RBox were prepared. The resulting ^{plasmid, Genome Lab TM Dye Terminator Cycle Sequencing} Quick Start kit, and using the ^{CEQ TM 2000XL DNA sequencer (Beckman Coulter} ), modified Xyn3 promoter, gus gene was sequence verified amdS gene. The sequence of the cis element region contained in the modified promoter in the generated reporter cassette is shown in FIG.

Example 3 Preparation of Transformant and Evaluation of Inducibility of Promoter (1) Acquisition of Transformant A transformant having a reporter cassette containing the modified promoter prepared in Example 2 was prepared. First, the plasmid containing the GUS reporter cassette prepared in (2) of Example 2 was cleaved with SalI. The obtained fragment was introduced into Trichoderma reesei strain PC-3-7 by the protoplast PEG method (Biotechnol Bioeng, 2012, Jan; 109 (1): 92-99).

Transformants were selected from selection medium (2% (w / v) glucose, 0.6 mg / mL MgSO ₄ , 0.6 mg / mL CaCl ₂ , 12.5 mM CsCl ₂ , 10 mM KH ₂ ) using acetamide as a single nitrogen source. PO ₄ Buffer (pH 5.5), 0.005 mg / mL FeSO ₄ · 7H ₂ O, 0.0016 mg / mL MnSO ₄ · H ₂ O, 0.0014 mg / mL ZnSO ₄ · 7H ₂ O, 0.002 mg / mL CoCl were selected by _{2, 2% (w / v} ) agar). The selected transformant candidate strain was cultured twice in a minimal medium supplemented with acetamide and stabilized. The homologous recombination and the introduced copy number in the transformant were confirmed by Southern analysis using AlkPhos Direct kit (GE Healthcare Bio Science, Waukesha, WI). As a result, it was confirmed that the reporter cassette was homologously recombined in one copy at the position of the xyn3 gene on the genome. Transformants into which pBxyn3ag-D0C, pBxyn3ag-Δcis, pBxyn3ag-1Box, pBxyn3ag-1RBox, pBxyn3ag-2Box, and pBxyn3ag-2RBox have been introduced are respectively strain D0C, strain Δcis, strain 1Box, strain 1RBox, strain 2Box And 2R Box stock.

(2) Preparation of cell extract and GUS activity measurement Conidia of 1 × 10 ⁶ transformants were cultured at 28 ° C., 220 rpm for 48 h in 50 mL of a culture medium containing 0.3% (w / v) glucose And the cells were collected by filtration. The collected cells were treated with an induction medium as the sole carbon source for the promoter (0.0075% (w / v) CaCl ₂ · 2H ₂ O, 0.0075% (w / v) MgSO ₄ · 7H ₂ ) The culture was transferred to 50 mL of O, 0.025% (w / v) Tween 80, 0.025% (w / v) Trace element ^{* 1)} , 50 mM citrate buffer (pH 4.0)). Inducers include 0.1% (w / v) glucose, 0.05% (w / v) sorbose, 0.01% (w / v) sophorus, 0.1% (w / v) xylose, or One of 0.1% (w / v) birch wood xylan was used.
* 1) Trace element composition: 0.006% (w / v) H ₃ BO ₃ , 0.026% (w / v) (NH ₄ ) 6Mo ₇ O ₂ 4 · 4H ₂ O, 0.1% (w) / V) FeCl ₃ · 6H ₂ O, 0.4% (w / v) CuSO ₄ · 5H ₂ O, 0.008% (w / v) MnCl ₂ · 4H ₂ O, 0.2% (w / v) ) ZnCl ₂

After induction for 12 h, mycelium was recovered using miracloth and immediately frozen with liquid nitrogen. Frozen mycelium is powdered by multi-bead shocker, GUS extract (50 mM sodium phosphate buffer, 10 mM EDTA (pH 8.0) 10 mM β-mercaptoethanol, 0.1% (w / v) Triton X, 0.1% (w) / V) It was suspended in sodium lauroyl sarcosinate) and centrifuged at 13,000 × g, 15 min, 4 ° C. The obtained supernatant was used as a GUS extract. The β-glucuronidase (GUS) activity and the amount of protein in the GUS extract were measured to determine the GUS activity per protein amount. GUS activity was quantified by measuring fluorescence after reacting for 10 minutes at 37 ° C. using 4-Methylumbelliferyl-β-D-glucuronide (4-MUG) as a substrate. The amount of protein was quantified by the Bradford method using bovine immunoglobulin as a standard.

(3) Results The measurement results of GUS activity are shown in FIG. FIG. 2A depicts GUS activity in extracts of cells cultured in the presence of glucose, sorbose, or the cellulosic substrate Sophorose. In the D0C strain (control), GUS activity was detected in the presence of sorbose or sophorose. The Δcis strain showed extremely low GUS activity as compared to the D0C strain in the presence of both sorbose and sophorose. In the 1Box strain and 1R Box strain (introduced strain of a modified promoter into which a cis element of Xyn1 promoter or one complementary strand is inserted), the GUS activity in the presence of Sophorus is 2.3 times and 2.times. It has increased sixfold. In the 2Box strain (introduced strain of the modified promoter into which two cis elements of the Xyn1 promoter were inserted), GUS activity in the presence of Sophorus increased by 3.2 times. On the other hand, GUS activity in the presence of Sophorus of 2R Box strain (introduced strain of modified promoter into which two complementary strands of cis element of Xyn1 promoter were inserted) was equivalent to that of 1 Box strain.

FIG. 2B represents GUS activity in extracts of cells cultured in the presence of xylan-based substrates (xylose or xylan). When induced with xylan substrates, GUS activity could not be detected in strain D0C and strain 1Box. On the other hand, strains 1RBox, 2Box and 2RBox exhibited GUS activity in the presence of either xylose or xylan.

The results shown in FIG. 2 indicate that the modified Xyn3 promoter into which a cis element of the Xyn1 promoter has been introduced can improve the inducibility by a cellulose-based substrate, and can further acquire the inducibility by a xylan-based substrate.

Example 4 Evaluation of Inducibility of Promoter (1) Preparation of Modified Xyn 3 Promoter 3 Box, 3 R Box and 6 R Box In the procedure of Example 1 (3), cis element (SEQ ID NO: 5) of promoter of gene encoding Xyn 1 or its complement A DNA fragment (3 Box and 3 R Box; SEQ ID NOs: 41 and 42) containing three strands and Xbal site at both ends was constructed. Furthermore, a DNA fragment (6RBox; SEQ ID NO: 43) was synthesized which contains six complementary strands of the sequence shown in SEQ ID NO: 5 and contains XbaI sites at both ends. Each of these DNA fragments was used to prepare a modified Xyn3 promoter-containing plasmid by the procedure of Example 1 (4).

(2) Evaluation of Inducibility of Promoter According to the procedure of Example 2, a GUS reporter cassette (FIG. 3) containing the modified Xyn3 promoter prepared in (1) above was constructed, and then a plasmid for promoter analysis containing the GUS reporter cassette Was produced. The transformants 3Box strain, 3R Box strain and 6 R Box strain were produced by the procedure of Example 3 using the prepared plasmid. The GUS activity in the extract of cells cultured in the presence of Sophorus (FIG. 4A) or xylan (FIG. 4B) was measured using the prepared transformants. The relative GUS activity was determined when the GUS activity of wild type (D0C strain) was taken as 100.

(3) Results

The relative GUS activity for each transformant is shown in FIG. FIG. 4 also shows the data of the 2R Box strain measured in Example 3. The expression of the GUS reporter was improved in the 3Box strain and the 3R Box strain as compared to the 2R Box strain, and was further improved in the 6R Box strain, in the presence of either Sophorus or xylan. From these results, it was suggested that the promoter activity of the modified Xyn3 promoter was increased according to the number of cis elements of the introduced Xyn1 promoter.

Example 5 Evaluation of enzyme expression using modified Xyn3 promoter (1) Construction of Aspergillus aculeatus bgl1 (aabgl1) expression cassette pABG7 (Biosci biotech biochem, 1998, 62 (8): 1615-1618) as a template, upstream of xyn 3 PCR was carried out using the primer aabgl1_xyn3P (SEQ ID NO: 19) to which the sequence was added and the primer aabgl1_xyn3T (SEQ ID NO: 20) to which the downstream sequence of xyn3 was added, and β of Aspergillus aculeatus to which the upstream and downstream sequences of xyn3 were added at both ends A gene (aabgl1) fragment encoding glucosidase (AaBGL1) was obtained. Inverse PCR was also performed using pBxyn3ag-D0C as a template and the primers aX3invert (SEQ ID NO: 21) and sX3invert (SEQ ID NO: 22). These PCR products were cloned using In-fusion PCR advanced kit (TaKaRaBio, Shiga, Japan) to obtain pBxyn3aabgl1. pBxyn3aabg1 has the aabgl1 gene under the control of the upstream region of xyn3 and the amdS gene as a selection marker at the NarI site of the downstream region. In order to recycle the marker, the inverse PCR product of pBxyn3aabgl1 (with the amdS marker removed) was constructed using pBxyn3aabgl1 as a template and primers recyinvert3a (SEQ ID NO: 23) and primer recyinvert3s (SEQ ID NO: 24).

The downstream region 748 bp of xyn3 was amplified using the genome of PC-3-7 strain as a template and primers xyn3 reps (SEQ ID NO: 25) and xyn3 repa (SEQ ID NO: 26), and introduced into the HincII site of pUC118 (Takara) ( pUxyn3DR). pUxyn3DR was digested with EcoRV and BamHI to obtain a DNA fragment. Also, pBpyr4 (a plasmid obtained by cloning a DNA fragment containing the pyr4 gene derived from Trichoderma reesei and its upstream and downstream regions into pBluescript II SK (+) (Novagen)) was digested with EcoRV and BamHI to obtain a DNA fragment. The resulting DNA fragments were ligated to obtain pBpyr4RM (a fragment in which the downstream region of xyn3 was inserted downstream of the pyr4 selection marker). Using pBpyr4RM as a template, amplification was carried out with primers recyclex3s (SEQ ID NO: 27) and primers recyclex3a (SEQ ID NO: 28) to which sequences of the downstream region of xyn 3 were added, respectively. The resulting amplified fragment was in-fused with pBxyn3aabgl1 to obtain pBxyn3aabgl1pyr4RM.

PBxyn3aabgl1pyr4RM was amplified by inverse PCR using primers xyn1_2Box_inv_Rv (SEQ ID NO: 29) and Aabgl1_Fw (SEQ ID NO: 30). In addition, pKFxyn3-2RBox was amplified with primer xyn1_2box_Fw (SEQ ID NO: 31) and primer xyn1_2box_Rv (SEQ ID NO: 32) to obtain a DNA fragment containing 2R Box region (SEQ ID NO: 8). These PCR products were ligated to obtain pBxyn3_2RBaabgl1pyr4RM in which the upstream region of xyn3 was replaced with a promoter containing 2R Box region.

(2) Acquisition of Transformant The vector pBxyn3_2RBaabgl1pyr4RM constructed in the above (1) was cleaved with SspI and NotI, and introduced into a host strain for transformation. The introduction was performed by the protoplast PEG method (Biotechnol Bioeng, 2012, Jan; 109 (1): 92-99). As a host strain, PC-3-7 strain was used. The transformant was cultured in a minimal medium from which uridine was removed for selection based on uridine auxotrophy. Transformant candidate strains were stabilized by culturing twice in minimal medium supplemented with acetamide or without uridine. The homologous recombination and the introduced copy number were confirmed by Southern analysis using AlkPhos Direct kit (GE Healthcare Bio Science, Waukesha, WI). The resulting transformant was called X3_2RB_AB1.

(3) culturing the host strain and transformants, Difco ^TM Potato Dextrose Agar (hereinafter, PDA) grown in a medium, conidia 0.9% (w / v) NaCl , 10% (w / v) glycerol solution Stored at -80.degree. For cellulase production, 1 × 10 ⁷ conidia with 1% (w / v) Avicel® (microcrystalline cellulose), or 1% (w / v) Avicel® and 0.5% (W / v) Xylan as a carbon source medium (0.14% (w / v) (NH ₄ ) ₂ SO ₄ , 0.2% (w / v) KH ₂ PO ₄ , 0.03% (w) _{_{/ v) CaCl 2 · 2H 2}} O, 0.03% (w / v) MgSO 4 · 7H 2 O, 0.1% (w / v) Bacto TM polypeptone, 0.05% (w / v) Bacto TM Inoculate 50 mL of Yeast extract, 0.1% (w / v) Tween 80, 0.1% (w / v) Trace element (described above), 50 mM Tartrate buffer (pH 4.0)), 5 at 28 ° C, 220 rpm It was cultured for a day. The culture supernatant was collected by filtration with Miracloth and used as an enzyme preparation.

(4) Enzyme Analysis The enzyme activity and the amount of protein were measured for the culture supernatants of the X3_2RB_AB1 strain (strain enhanced with BGL activity by introducing a modified promoter) and the PC-3-7 strain (host). The culture supernatant was subjected to SDS-PAGE with 12.5% polyacrylamide and stained with Coomassie Brilliant Blue R250. A Precision Plus Dual Color Standard Marker (Bio-Rad Laboratories) was used for molecular weight determination. The amount of protein was determined by the Bradford method using bovine immunoglobulin as a standard.

The avicelase, carboxymethylcellulose (CMCase), and xylanase activities were calculated by measuring the amount of reducing sugar obtained by the enzyme reaction by the 3,5-dinitrosalicylic acid (DNS) method. The enzymatic reaction for determination of avicelase activity was carried out at 50 ° C. for 30 minutes using a reaction solution in which 1% (w / v) Avicel (registered trademark) was suspended in 50 mM sodium acetate buffer (pH 5.0). The enzyme reaction for measurement of CMCase activity was carried out at 50 ° C. for 15 minutes using a reaction solution in which 40 mM carboxymethyl cellulose (CMC) was dissolved in 50 mM sodium acetate buffer. The enzyme reaction for measuring xylanase activity was carried out at 50 ° C. for 10 minutes using a reaction solution in which 1% (w / v) birch wood xylan was dissolved in 50 mM sodium acetate buffer. The activity of 1 U was defined as the amount of enzyme that produces 1 μmol equivalent of glucose (or xylose) in 1 minute. In the cellobiase activity measurement, the enzyme was allowed to react at 50 ° C. for 10 minutes in a reaction solution in which a final concentration of 20 mM cellobiose (Sigma) was added to 50 mM acetic acid buffer, and then the glucose concentration was measured by Glucose C2 kit (Wako). One unit of cellobiase activity was an amount of enzyme that produces 2 μmol of glucose in one minute.

The expression of aaBGL in the culture supernatant sample was observed using Western blotting with anti-BGL antibody. Western blotting was performed using a semi-dry blotting apparatus (ATTO). After protein separation by SDS-PAGE, proteins were transferred to Immobilon-P membrane (Merck Millipore). For protein detection, ECL select western blotting detection reagent (GE healthcare) was used. As the anti-aa BGL antibody, one obtained by preparing an antibody by rabbit immunization using purified aa BGL as an antigen was used. Also, HRP-labeled secondary antibodies were detected using GE Healthcare. As a result of western blotting analysis, a band of AaBGL1 was observed at around 130 kDa in the X3_2RB_AB1 strain and was not observed in the PC-3-7 strain (host). (Figure 5). Two bands around 130 kDa were observed in the X3_2RB_AB1 strain, but none of them were observed in the PC-3-7 strain (host). Therefore, not a nonspecific band but a sugar chain modification to AaBGL It was considered to be caused by the change in molecular weight size during electrophoresis.

Table 1 shows the amounts of proteins in the X3_2RB_AB1 strain and the PC-3-7 strain, and the results of measurement of avicelase, CMCase, cellobiase, and xylanase activities. The CMCase activity and the xylanase activity were comparable between the X3-2RB_AB1 strain and the PC-3-7 strain, but the cellobiase activity was 35.0 U / mL (Avicel® containing medium) and 17 in the X3-2RB_AB1 strain. .7 U / mL (Avicel.RTM. + Xylan-containing medium), which increased about 120 and 85 times over the PC-3-7 strain, respectively. Moreover, the avicelase activity also showed about 30% higher activity than the host strain in the X3-2RB_AB1 strain. From these results, it was suggested that, in the culture in the presence of cellulose, cellulose and xylan, the 2R Box promoter efficiently expressed the gene of AaBGL1 linked downstream.

(5) Transcription analysis In order to evaluate at the transcription level of the modified Xyn3 promoter, transcription analysis of PC-3-7 strain and X3-2RB_AB1 strain was performed. PC-3-7 strain and X3-2RB_AB1 strain were cultured in a medium containing 0.3% (w / v) glucose for 2 days to obtain resting cells. Derivation of the obtained cells with 0.01% (w / v) sophorus (cellulose-based substrate, strong cellulase derivative) or 0.1% (w / v) xylan (xylan-based substrate) as the sole carbon source After culturing for 1, 3, 6, and 9 hours in the medium, transcriptional analysis was performed to examine gene expression. As target genes for transcriptional analysis, a major cellulase gene cbh1, a major xylanase gene xyn1, a transcription activation factor xyr1 essential for cellulase production, a xylanase gene xyn3 and aabgl1 were analyzed. Gene expression was measured by quantitative real-time PCR, and relative expression level was determined when expression level of β-actin (act1) was 1.

The results are shown in FIG. 6 and FIG. Under Sophorus induction, the expression levels of cbh1, xyr1, and xyn3 were similar in strains PC-3-7 and X3-2RB_AB1 (FIG. 6). Also, as is conventionally known, xyn1 was not expressed under Sophorose induction (data not shown). On the other hand, under xylan induction, neither the PC-3-7 strain nor the X3-2RB_AB1 strain expressed xyn3 and the xyn1 expression level was high (FIG. 7). These results are consistent with the conventional findings on the promoter activity of these genes. On the other hand, in the X3-2RB_AB1 strain, expression of aabgl1 was observed under sophorose and xylan induction, and it was shown that these inducers activate the modified Xyn3 promoter.

Example 6 Expression of AaBGL1 by Modified Xyn3 Promoter in QM9414 Strain (Xyn3 Non-Expressing Strain) Xyn3 is originally expressed in Trichoderma reesei PC-3-7 strain, but is not expressed in Trichoderma reesei QM9414 strain, which is its ancestor. In this example, the possibility of the modified Xyn3 promoter functioning in the QM9414 strain was examined.

The procedure is the same as in Example 5, but using pBxyn3_2RBaabgl1pyr4RM, a plasmid containing an expression cassette into which aabgl1 has been introduced under the control of a modified Xyn3 promoter containing the 2R Box region (SEQ ID NO: 8) using QM9414 as the host of transformants. The transformant QMX3-2RB_AB1 into which was introduced was prepared. Furthermore, the enzyme activities in the QMX3-2RB_AB1 strain and the host QM9414 strain were measured in the same manner as in Example 5 (4). However, the concentration of xylan in the induction medium was 0.01% (w / v). Furthermore, the transcriptional activity of aabgl1 was examined in the same manner as in Example 5 (5).

In the western blotting analysis of the culture supernatant of the QMX3-2RB_AB1 strain, a band of AaBGL1 was observed (FIG. 8). Furthermore, the QMX3-2RB_AB1 strain showed higher levels of protein, as well as avicelase activity and cellobiase activity than QM9414 (host) (Table 2). Moreover, as a result of transcription analysis, in the QMX3-2RB_AB1 strain, transcription of aabgl1 was confirmed both under Sophorus (cellulose-based substrate) induction (FIG. 9A) and under xylan (xylan-based substrate) induction (FIG. 9B), and control of the modified promoter Below, it was shown that transcription of aabgl1 was promoted.

Example 7 Evaluation of Xyn3 Expression Using Modified Xyn3 Promoter (1) Construction of Trichoderma reesei Xyn3 Expression Cassette The genome of PC-3-7 strain is used as a template, primer pyr4_Fw (SEQ ID NO: 33) and primer pyr4_Rv (SEQ ID NO: 34) Was used to obtain a DNA fragment containing the upstream region 2,274 bp and the downstream region 1,244 bp of pyr4 and the pyr4 ORF. This DNA fragment was inserted into pUC118 linearized with HincII to prepare pUΔpyr4.

Inverse PCR was performed using pBxyn3_2RBaabgl1pyr4RM prepared in Example 5 as a template and the primers aX3invert (SEQ ID NO: 21) and sX3invert (SEQ ID NO: 22). Furthermore, using the PC-3-7 strain genomic DNA as a template, the xyn3 ORF is amplified using primer xyn3_Fw (SEQ ID NO: 35) and primer xyn3_Rv (SEQ ID NO: 36), and phosphate group addition is carried out with Blunting Kination kit (TaKaRa). Did. These DNA fragments were ligated to produce pBxyn3_2RBxyn3pyr4RM.

(2) Preparation of Transformant A fragment prepared by digesting pUΔpyr4 prepared in (1) with HindIII and XbaI was prepared, and this was introduced into a host by the protoplast-PEG method. As a host strain, E1AB1 strain (Enzyme Microb Technol, 2016, 82: 89-95) was used. Selection was performed in a minimal medium supplemented with 10 mM FOA and 20 mM uridine to obtain E1AB1 strain Δpyr4 strain. Subsequently, a fragment obtained by digesting pBxyn3_2RBxyn3pyr4RM prepared in (1) with ApaI and NotI was introduced into E1AB1 strain Δpyr4. Among transformant candidates selected in the minimal medium containing no uridine, the transformant showing the highest saccharification ability was obtained as E1AB1_X3-2RBX3.

(3) Cultivation of Transformant The enzyme productivity of the transformant was evaluated by the following culture. As a preculture, 50 mL of culture medium was charged in a 500 mL flask, spores were inoculated to 1 × 10 ⁵ cells / mL, and shake culture was performed at 28 ° C. and 220 rpm (PRXYg-98R manufactured by Priss). Media composition is as follows: 1% (w / v) glucose, 0.14% (w / v) (NH ₄ ) ₂ SO ₄ , 0.2% (w / v) KH ₂ PO ₄ , 0 .03% (w / v) CaCl ₂ · 2 H ₂ O, 0.03% (w / v) MgSO ₄ · 7 H ₂ O, 0.1% (w / v) high polypeptone N, 0.05% (w / V) Bacto Yeast extract, 0.1% (w / v) Tween 80, 0.1% (w / v)

Trace element

2, 50 mM tartaric acid buffer (pH 4.0). The composition of Trace element 2 is as follows: 6 mg H ₃ BO ₃ , 26 mg (NH ₄ ) ₆ Mo ₇ O ₂₄ · 4 H ₂ O, 100 mg FeCl ₃ · 6 H ₂ O, 40 mg CuSO ₄ · 5 H ₂ O, 8 mg MnCl ₂ · 4 H ₂ O, 200 mg ZnCl ₂ was added to 100 mL with distilled water.

After preculturing for 2 days, main culture was performed using a jar fermenter (BTR-25NA1S-8M manufactured by Biot). The above preculture was inoculated at 10% (v / v) and cultured for 5 days. 10% (w / v) Avicel (registered trademark) + 2% (w / v) xylan as a carbon source, and the other medium components are 0.42% (w / v) (NH ₄ ) ₂ SO ₄ , 0. 2% (w / v) KH ₂ PO ₄ , 0.03% (w / v) CaCl ₂ · 2 H ₂ O, 0.03% (w / v) MgSO ₄ · 7 H ₂ O, 0.1% (w) / V) High polypeptone N, 0.05% (w / v) Bacto Yeast extract, 0.1% (w / v) Tween 80, 0.1% (w / v) Trace element (described above), 0.2 % (W / v) Antifoam PE-L. The setting of the jar fermenter is as follows: temperature 28 ° C., pH 4.5, the number of stirring changes so as to keep DO = 3.0 ppm constant.

The culture supernatant was recovered in the same manner as in Example 5 (3), and the protein concentration was measured by the bradford method. In the bradford method, the amount of protein was calculated based on a calibration curve using bovine gamma globulin as a standard protein, using Quick Start protein assay (BioRad). At that time, the relative ratio of the amount of protein in the culture supernatant (JN24) of strain E1AB1_X3-2RBX3 was determined, where the amount of protein in the culture supernatant of strain E1AB1 (JN13) was 1. As a result, JN24 had a 23% improvement in protein productivity as compared to the JN13 strain.

As a result of SDS-PAGE analysis of each culture supernatant, it was observed that in JN24, only the band of Xyn3 was significantly increased compared to JN13, which is the culture supernatant of the original strain (FIG. 10) . The intensity of the bands of this SDS-PAGE was quantified using Image Lab (Biorat) to calculate the protein amount ratio of each enzyme. As a result of calculating and comparing the amount of enzyme contained in each of JN13 and JN24 from the calculated value and the amount of protein in the supernatant, most of the enzymes were equivalent in JN13 and JN24, but only Xyn3 was 4 times in JN24 It has increased over. Thus, it was found that most of the proteins produced by JN24 were Xyn3. From this, it was shown that the modified Xyn3 promoter is a promoter capable of highly expressing a protein even in jar fermenter culture.

The sequences of the primers used in the above examples are shown in Tables 3 to 4 below.

Claims

A modified promoter,
It consists of a polynucleotide of Xyn3 promoter including a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1,
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and a cellulose-induced promoter activity Having a polynucleotide,
And
The polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4), and contains the polynucleotide of the cis element of the one or more Xyn1 promoters or a complementary strand thereof A modified promoter, wherein the polynucleotide does not contain HAP2 / 3/5 binding site and CREI binding site.
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide which is identical and comprises a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and having a cellulose-induced promoter activity,
The modified promoter according to claim 1, which is
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3-1073 of SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or represented by nucleotides 350 to 1073 of SEQ ID NO: 1 It consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence and contains the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and has a cellulose-induced promoter activity , Polynucleotides,
The modified promoter according to claim 1, which is
The polynucleotide comprising a polynucleotide of a cis element of the one or more Xyn1 promoters or a complementary strand thereof comprises 1 to 10 polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or a complementary strand thereof The modified promoter according to any one of to 3.
The modified promoter according to claim 4, wherein the polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 4 is a polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 5.
The polynucleotide comprising the polynucleotide of the cis element of the one or more Xyn1 promoters or the complementary strand thereof is as follows:
A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43,
The modified promoter according to claim 4 or 5, which is
A vector containing the modified promoter according to any one of claims 1 to 6.
The vector according to claim 7, wherein the modified promoter is linked upstream of the target gene.
The target gene is a nucleotide sequence consisting of a nucleotide sequence shown in SEQ ID NO: 37 or a nucleotide sequence consisting of at least 90% identical thereto and encoding a xylanase, or a nucleotide sequence shown in SEQ ID NO: 39 or at least 90% The vector according to claim 8, which is a polynucleotide consisting of the same nucleotide sequence and encoding xylanase.
A DNA fragment comprising a gene of interest and the modified promoter according to any one of claims 1 to 6 linked upstream of said gene.
The target gene is a nucleotide sequence consisting of a nucleotide sequence shown in SEQ ID NO: 37 or a nucleotide sequence consisting of at least 90% identical thereto and encoding a xylanase, or a nucleotide sequence shown in SEQ ID NO: 39 or at least 90% 11. The DNA fragment according to claim 10, which is a polynucleotide consisting of the same nucleotide sequence and encoding xylanase.
A transformant comprising the vector according to any one of claims 7 to 9 or the DNA fragment according to claim 10 or 11.
The transformant according to claim 12, which is Trichoderma.
A method for producing a modified promoter, comprising
Substituting or inserting a polynucleotide containing a polynucleotide of cis element of one or more Xyn1 promoters or a complementary strand thereof in a region corresponding to the nucleotides 374 to 401 of SEQ ID NO: 1 in the polynucleotide of the Xyn 3 promoter Including
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 90% A region identical to that of SEQ ID NO: 1 corresponding to nucleotides 374 to 401, consisting of a nucleotide sequence comprising the sequence shown by GGCTAT-NNNNNNNNNNNNNNNNNN-TTTGCC (SEQ ID NO: 2), and a cellulose-induced promoter activity Having a polynucleotide,
And
The polynucleotide of the cis element of the Xyn1 promoter consists of the nucleotide sequence shown by GGCTAA-NNNNNNNNNN-TTAGCC (SEQ ID NO: 4), and contains the polynucleotide of the cis element of the one or more Xyn1 promoters or a complementary strand thereof The polynucleotide does not contain HAP2 / 3/5 binding site and CREI binding site,
Method.
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1; or a nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence represented by nucleotides 350 to 1084 of SEQ ID NO: 1 at least 95% A polynucleotide which is identical and comprises a nucleotide sequence comprising the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and having a cellulose-induced promoter activity,
15. The method of claim 14, wherein
The polynucleotide of the Xyn3 promoter is as follows:
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 3-1073 of SEQ ID NO: 1;
A polynucleotide consisting of a nucleotide sequence represented by nucleotides 350 to 1073 of SEQ ID NO: 1; or a nucleotide sequence represented by nucleotides 3 to 1073 of SEQ ID NO: 1, or represented by nucleotides 350 to 1073 of SEQ ID NO: 1 It consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence and contains the sequence shown in SEQ ID NO: 2 in the region corresponding to nucleotides 374 to 401 of SEQ ID NO: 1 and has a cellulose-induced promoter activity , Polynucleotides,
15. The method of claim 14, wherein
The polynucleotide comprising the polynucleotide of the cis element of the one or more Xyn1 promoter or the complementary strand thereof, comprises 1 to 10 polynucleotides consisting of the nucleotide sequence shown in SEQ ID NO: 4 or a complementary strand thereof The method according to any one of 14 to 16.
The method according to claim 17, wherein the polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 4 is a polynucleotide consisting of the nucleotide sequence shown by SEQ ID NO: 5.
The polynucleotide comprising the polynucleotide of the cis element of the one or more Xyn1 promoters or the complementary strand thereof comprises:
A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6 or its complementary strand;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 7;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 41;
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 42; or
A polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 43,
The method according to claim 17 or 18, which is