WO2019016310A1 - Méthodes et compositions de traitement de cancers - Google Patents

Méthodes et compositions de traitement de cancers Download PDF

Info

Publication number
WO2019016310A1
WO2019016310A1 PCT/EP2018/069619 EP2018069619W WO2019016310A1 WO 2019016310 A1 WO2019016310 A1 WO 2019016310A1 EP 2018069619 W EP2018069619 W EP 2018069619W WO 2019016310 A1 WO2019016310 A1 WO 2019016310A1
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
cancer
cell
cells
data
Prior art date
Application number
PCT/EP2018/069619
Other languages
English (en)
Inventor
Cédric GAGGIOLI
Thomas BERTERO
Original Assignee
INSERM (Institut National de la Santé et de la Recherche Médicale)
Universite Nice Sophia Antipolis
Centre National De La Recherche Scientifique (Cnrs)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSERM (Institut National de la Santé et de la Recherche Médicale), Universite Nice Sophia Antipolis, Centre National De La Recherche Scientifique (Cnrs) filed Critical INSERM (Institut National de la Santé et de la Recherche Médicale)
Publication of WO2019016310A1 publication Critical patent/WO2019016310A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50—Pyridazines; Hydrogenated pyridazines
    • A61K31/501—Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • the invention is in the field of oncology. More particularly, the invention relates to methods and compositions for treating cancers with a combination of inhibitors of GLSl and SLC1A3.
  • Non-transformed cell types within the tumor microenvironment continuously co-evolve with tumor cancer cells to promote tumorigenesis (Hanahan and Weinberg, 2011; Kalluri, 2016; Quail and Joyce, 2013).
  • Evidence has indicated that fibroblasts are among the first cells to be recruited by tumor cells; however, it is widely accepted that normal fibroblasts generally suppress tumor formation (Kalluri, 2016).
  • normal fibroblasts are thought to interact with tumor cells and are converted to Cancer-Associated Fibroblasts (CAF). Once accomplished, CAF promote extensive tissue remodelling (or tumor niche formation).
  • Tumors alter their metabolic program to maintain cell autonomous proliferation in the nutrient-poor conditions of tumor microenvironment (Vander Heiden and DeBerardinis, 2017).
  • Some of the most striking changes of tumor cellular bioenergetics include Warburg metabolism (i.e., a chronic shift in energy production from mitochondrial oxidative phosphorylation to glycolysis) and increases in glutamino lysis, amino acid and lipid metabolism, flux through the pentose phosphate pathway, macromolecule biosynthesis, and mitochondrial biogenesis (Ben- Sahra and Manning, 2017; Sullivan et al., 2016; Vander Heiden and DeBerardinis, 2017).
  • the invention relates to a method for treating cancer in a subject in need thereof comprising a step of administering the subject with a therapeutically effective amount of GLS1 and SLC1A3 inhibitors.
  • the invention is defined by the claims.
  • CAF are a predominant cell type in the squamous cell carcinoma (SCC) stroma and are important mediators of the desmoplastic response (Quail and Joyce, 2013). Their abundance suggests that their communication with cancer cells may alter tumor cell metabolism. Consequently, in this study inventors investigated whether a metabolic response to tumor niche stiffness controls tumor progression. Specifically, inventors aimed to determine whether ECM stiffness directly modulates both cancer cell and CAF metabolism and coordinates nutrient availability within the tumor niche to support the metabolic needs of tumor progression. They elucidate the interconnection between mechanotransduction and tumor metabolic reprogramming, and show a stiffness-dependent tumor progression promoted by amino acid crosstalk between stromal and cancer cells.
  • the present invention relates to a method for treating cancer in a subject in need thereof comprising a step of administering said subject with a therapeutically effective amount of GLS1 and SLC1A3 inhibitors.
  • treating refers to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse.
  • the treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.
  • therapeutic regimen is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy.
  • a therapeutic regimen may include an induction regimen and a maintenance regimen.
  • the phrase “induction regimen” or “induction period” refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease.
  • the general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen.
  • An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both.
  • maintenance regimen refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years).
  • a maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).
  • the term “subject” refers to any mammals, such as a rodent, a feline, a canine, and a primate. Particularly, in the present invention, the subject is a human afflicted with or susceptible to be afflicted with a cancer.
  • the term “cancer” refers to an abnormal cell growth with the potential to invade or spread to other parts of the body. In the context of the invention, the cancer is a solid cancer.
  • solid cancer has its general meaning in the art and refers to solid cancer selected from the group consisting of, but not limited to, head and neck squamous cell carcinoma (HNSCC), adrenal cortical cancer, anal cancer, bile duct cancer (e.g.
  • periphilar cancer distal bile duct cancer, intrahepatic bile duct cancer), bladder cancer, bone cancer (e.g. osteoblastoma, osteochrondroma, hemangioma, chondromyxoid fibroma, osteosarcoma, chondrosarcoma, fibrosarcoma, malignant fibrous histiocytoma, giant cell tumor of the bone, chordoma, multiple myeloma), brain and central nervous system cancer (e.g.
  • breast cancer e.g. ductal carcinoma in situ, infiltrating ductal carcinoma, infiltrating lobular carcinoma, lobular carcinoma in situ, gynecomastia
  • cervical cancer colorectal cancer
  • endometrial cancer e.g.
  • small cell lung cancer non-small cell lung cancer
  • mesothelioma plasmacytoma, nasal cavity and paranasal sinus cancer (e.g. esthesioneuroblastoma, midline granuloma), nasopharyngeal cancer, neuroblastoma, oral cavity and oropharyngeal cancer, ovarian cancer, pancreatic cancer, penile cancer, pituitary cancer, prostate cancer, retinoblastoma, rhabdomyosarcoma (e.g. embryonal rhabdomyosarcoma, alveolar rhabdomyosarcoma, pleomorphic rhabdomyosarcoma), salivary gland cancer, skin cancer (e.g.
  • melanoma nonmelanoma skin cancer
  • stomach cancer testicular cancer (e.g. seminoma, nonseminoma germ cell cancer), thymus cancer, thyroid cancer (e.g. follicular carcinoma, anaplastic carcinoma, poorly differentiated carcinoma, medullary thyroid carcinoma), vaginal cancer, vulvar cancer, and uterine cancer (e.g. uterine leiomyosarcoma).
  • testicular cancer e.g. seminoma, nonseminoma germ cell cancer
  • thymus cancer thyroid cancer (e.g. follicular carcinoma, anaplastic carcinoma, poorly differentiated carcinoma, medullary thyroid carcinoma), vaginal cancer, vulvar cancer, and uterine cancer (e.g. uterine leiomyosarcoma).
  • testicular cancer e.g. seminoma, nonseminoma germ cell cancer
  • thymus cancer e.g. follicular carcinoma, anaplastic carcinoma, poorly differentiated carcinoma
  • GLSl also known as glutaminase, L-glutaminase or glutamine amino hydrolase refers to a phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia.
  • This enzyme in human is encoded by GLSl gene.
  • the naturally occurring human GLSl gene has a nucleotide sequence as shown in Genbank Accession numbers NM 014905.4 and the naturally occurring human GLSl protein has an aminoacid sequence as shown in Genbank Accession numbers NP 055720.3.
  • the naturally occurring murine GLS1 gene has a nucleotide sequence as shown in Genbank Accession numbers NM 001081081.2 and the naturally occurring murine GLS 1 protein has an aminoacid sequence as shown in Genbank Accession numbers_NP_001074550.1.
  • SLC1A3 refers to solute carrier family 1, member 3. It is a member of a high affinity glutamate transporter family. It is a protein that, in humans, is encoded by the SLC1A3 gene. This gene functions in the termination of excitatory neurotransmission in central nervous system.
  • the naturally occurring human SLC1A3 gene has a nucleotide sequence as shown in Genbank Accession numbers NM_001166696.2 and the naturally occurring human SLC1A3 protein has an aminoacid sequence as shown in Genbank Accession numbers NP 001160168.1.
  • the naturally occurring murine SLC1A3 gene has a nucleotide sequence as shown in Genbank Accession numbers NM_148938.3 and the naturally occurring murine GLS1 protein has an aminoacid sequence as shown in Genbank Accession numbers NP_683740.1.
  • GLS1 and SLC1A3 inhibitors refers to a natural or synthetic compounds that have a biological effect to inhibit the activity or the expression of GLS1 and SLC1A3. More particularly, such compound is capable of inhibiting the catalyses activity of GLS1 (and thus the transport of the glutamate).
  • the GLS1 and SLC1A3 inhibitors are peptide, petptidomimetic, small organic molecules, antibodies, aptamers, siRNA or antisense oligonucleotides.
  • peptidomimetic refers to a small protein-like chain designed to mimic a peptide.
  • the inhibitor of GLS1 and SLC1A3 is an aptamer.
  • Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity.
  • the GLS1 and SLC1A3 inhibitors are small organic molecules.
  • small organic molecule refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
  • the GLS1 and SLC1A3 inhibitors are CB839 and TFB- TBOA.
  • the term CB839 refers to an inhibitor of human glutaminase, this small molecule is developed by Calithera and is ongoing on Phase lb. The CAS number of this molecule is 1439399-58-2. This molecule has the following formula and structure in the art
  • FB-TBOA refers to (2S, 3S)-3-[3-[4- (trifluoromethyl)benzoylamino]benzyloxy]aspartate, is a glutamate transport activity inhibitor.
  • the CAS number of this molecule is 480439-73-4. This molecule has the following formula and structure in the art C19H17F3N2O6:
  • the GLS1 and SLC1A3 inhibitors are an antibodies.
  • antibodies is used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies) formed from at least two intact antibodies, and antibody fragments so long as they exhibit the desired biological activity.
  • the term includes antibody fragments that comprise an antigen binding domain such as Fab', Fab, F(ab')2, single domain antibodies (DABs), TandAbs dimer, Fv, scFv (single chain Fv), dsFv, ds-scFv, Fd, linear antibodies, minibodies, diabodies, bispecific antibody fragments, bibody, tribody (scFv-Fab fusions, bispecific or trispecific, respectively); sc-diabody; kappa(lamda) bodies (scFv-CL fusions); BiTE (Bispecific T-cell Engager, scFv- scFv tandems to attract T cells); DVD-Ig (dual variable domain antibody, bispecific format); SIP (small immunoprotein, a kind of minibody); SMIP ("small modular immunopharmaceutical” scFv-Fc dimer; DART (ds-stabilized diabody "Dual Affinity ReTargeting
  • Antibodies can be fragmented using conventional techniques. For example, F(ab')2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments.
  • Fab, Fab' and F(ab')2, scFv, Fv, dsFv, Fd, dAbs, TandAbs, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized by recombinant techniques or can be chemically synthesized. Techniques for producing antibody fragments are well known and described in the art. For example, each of Beckman et al., 2006; Holliger & Hudson, 2005; Le Gall et al, 2004; Reff & Heard, 2001 ; Reiter et al, 1996; and Young et al, 1995 further describe and enable the production of effective antibody fragments.
  • the antibody is a "chimeric" antibody as described in U.S. Pat. No. 4,816,567.
  • the antibody is a humanized antibody, such as described U.S. Pat. Nos. 6,982,321 and 7,087,409.
  • the antibody is a human antibody.
  • a "human antibody” such as described in US 6,075,181 and 6,150,584.
  • the antibody is a single domain antibody such as described in EP 0 368 684, WO 06/030220 and WO 06/003388.
  • the inhibitor is a monoclonal antibody.
  • Monoclonal antibodies can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique, the human B-cell hybridoma technique and the EBV-hybridoma technique.
  • the GLS1 and SLC1A3 inhibitors is an intrabody having specificity for GLS1 and SLC1A3.
  • the term "intrabody” generally refer to an intracellular antibody or antibody fragment.
  • Antibodies in particular single chain variable antibody fragments (scFv), can be modified for intracellular localization. Such modification may entail for example, the fusion to a stable intracellular protein, such as, e.g., maltose binding protein, or the addition of intracellular trafficking/localization peptide sequences, such as, e.g., the endoplasmic reticulum retention.
  • the intrabody is a single domain antibody.
  • the antibody according to the invention is a single domain antibody.
  • single domain antibody sdAb or “VHH” refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called “nanobody®”. According to the invention, sdAb can particularly be llama sdAb.
  • the GLS1 and SLC1A3 inhibitors is a short hairpin RNA (shRNA), a small interfering RNA (siRNA) or an antisense oligonucleotide which inhibits the expression of GLS1 and SLC1A3.
  • the inhibitor of GLS1 and SLC 1 A3 expression is siRNA.
  • a short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference.
  • shRNA is generally expressed using a vector introduced into cells, wherein the vector utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited.
  • the shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA- induced silencing complex (RISC).
  • RISC RNA- induced silencing complex
  • This complex binds to and cleaves mRNAs that match the siRNA to which it is bound.
  • Small interfering RNA siRNA
  • siRNA is a class of 20-25 nucleotide- long double- stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway whereby the siRNA interferes with the expression of a specific gene.
  • Anti- sense oligonucleotides include anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of the targeted mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of the targeted protein, and thus activity, in a cell.
  • antisense oligonucleotides of at least about 1 bases and complementary to unique regions of the mRNA transcript sequence can be synthesized, e.g., by conventional phosphodiester techniques. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos.
  • Antisense oligonucleotides, siRNAs, shRNAs of the invention may be delivered in vivo alone or in association with a vector.
  • a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid to the cells and typically mast cells.
  • the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
  • the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid sequences.
  • Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rous sarcoma virus; adenovirus, adeno- associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus.
  • retrovirus such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rous sarcoma virus
  • adenovirus adeno- associated virus
  • SV40-type viruses polyoma viruses
  • Epstein-Barr viruses Epstein-Barr viruses
  • papilloma viruses herpes virus
  • vaccinia virus
  • the inhibitor of GLS1 and SLC1A3 expression is an endonuclease.
  • sequencing technologies have provided an unprecedentedly detailed overview of the multiple genetic aberrations in cancer.
  • these new data strongly emphasize the need of fast and reliable strategies to characterize the normal and pathological function of these genes and assess their role, in particular as driving factors during oncogenesis.
  • the new technologies provide the means to recreate the actual mutations observed in cancer through direct manipulation of the genome. Indeed, natural and engineered nuclease enzymes have attracted considerable attention in the recent years.
  • NHEJ errorprone nonhomologous end-joining
  • HDR high-fidelity homo logy-directed repair
  • the endonuclease is CRISPR-cas.
  • the term CRISPR-cas As used herein, the term
  • CRISPR-cas has its general meaning in the art and refers to clustered regularly interspaced short palindromic repeats associated which are the segments of prokaryotic DNA containing short repetitions of base sequences.
  • the endonuclease is CRISPR-cas9 which is from Streptococcus pyogenes.
  • the CRISPR/Cas9 system has been described in US 8697359 Bl and US 2014/0068797. Originally an adaptive immune system in prokaryotes (Barrangou and Marraffmi, 2014), CRISPR has been recently engineered into a new powerful tool for genome editing. It has already been successfully used to target important genes in many cell lines and organisms, including human (Mali et al., 2013, Science, Vol. 339 : 823-826), bacteria (Fabre et al., 2014, PLoS Negl. Trap. Dis., Vol.
  • the endonuclease is CRISPR-Cpfl which is the more recently characterized CRISPR from Provotella and Francisella 1 (Cpfl) in Zetsche et al. ("Cpfl is a Single RNA-guided Endonuclease of a Class 2 CRISPR-Cas System (2015); Cell; 163, 1-13).
  • administering refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., inhibitors of GLS1 and SLC1A3) into the subject, such as by mucosal, intradermal, intravenous, subcutaneous, intramuscular delivery and/or any other method of physical delivery described herein or known in the art.
  • a disease, or a symptom thereof is being treated, administration of the substance typically occurs after the onset of the disease or symptoms thereof.
  • administration of the substance typically occurs before the onset of the disease or symptoms thereof.
  • the two inhibitors as described above are administered in combination to the subject suffering from a cancer.
  • the inhibitors are administered as a combined preparation.
  • the GLS1 and SLC1A3 inhibitors are administered simultaneously, separately or sequentially.
  • administration simultaneously refers to administration of 2 active ingredients by the same route and at the same time or at substantially the same time.
  • administration separately refers to an administration of 2 active ingredients at the same time or at substantially the same time by different routes.
  • administration sequentially refers to an administration of 2 active ingredients at different times, the administration route being identical or different.
  • a “therapeutically effective amount” is intended for a minimal amount of active agent which is necessary to impart therapeutic benefit to a subject.
  • a “therapeutically effective amount” to a subject is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder. It will be understood that the total daily usage of the compounds of the present invention will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidential with the specific compound employed; and like factors well known in the medical arts.
  • the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day.
  • the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated.
  • a medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient.
  • An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.
  • the GLS1 and SLC1A3 inhibitors as described above may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form pharmaceutical compositions.
  • pharmaceutically acceptable excipients such as a carboxylate, a carboxylate, a carboxylate, a carboxylate, a carboxylate, a carboxylate, a carboxylate, a carboxylate, a pharmaceutically acceptable.
  • a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • compositions of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, local or rectal administration can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings.
  • Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.
  • the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
  • vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
  • These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • Solutions comprising compounds of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the polypeptide (or nucleic acid encoding thereof) can be formulated into a composition in a neutral or salt form.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
  • the carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the active polypeptides in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • sterile powders for the preparation of sterile injectable solutions
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof.
  • solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed.
  • parenteral administration in an aqueous solution for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • the invention thus relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the inhibitors of GLS1 and SLClA3.
  • the pharmaceutical composition according to the invention wherein the inhibitors of GLS1 and SLC1A3 are TBOA and CD839.
  • FIGURES are a diagrammatic representation of FIGURES.
  • Figure 1 The aspartate/glutamate transporter SLC1A3 is needed to sustain CAF and SCC pro-tumoral activities.
  • RT-qPCR analyses of SLC1A family expression in SCC12, fibroblast and CAF cells reveal that SLC1A3 was increased by stiffness and overexpressed in CAF compared to fibroblast.
  • GLS1 and SLC1A3 blunted proliferation, even when aspartate was added.
  • Traction force microscopy revealed that supplementation by glutamate sustained CAF-dependant ECM contraction, even when GLS 1 was knocked down.
  • A-B Intratumoral aspartate (A) and glutamate (B measurement revealed a decrease of both aspartate and glutamate level in mice treated with CB839 and CB839+TFB-TBOA as compared to control (Vehicle Coimmuno fluorescence microscopy and quantification revealed a decrease of stromal activation as reflected by D-SMA stain as well as a decrease of PCNA-positive cells in CB839- and CB839+TFB-TBOA-treated mice compared with vehicle control.
  • Intratumoral aspartate and glutamate (G) measurement revealed a decrease of both aspartate and glutamate level in mice treated with CB839 and CB839+TFB-TBOA as compared to control (Vehicle).
  • Human cancer cell lines including head and neck cancer cell lines CAL27 and CAL33, lung cancer cell lines A427 and A549, breast cancer lines MDA-MB-231 and MDA-MB-468 and Human primary Dermal Fibroblasts (hDF), and human HEK293Tcells as well as murin breast cancer cell lines 67NR, 410.4 and 4T1 were purchased from ATCC and maintained in DMEM supplemented with 10% FCS (fetal calf serum) and 2mM glutamine.
  • FCS fetal calf serum
  • CAFs Carcinoma associated fibroblasts isolated from patients with head and neck, and breast cancer were cultured in DMEM supplemented with 10% FCS, 2mM glutamine and insulin-trans ferrin- selenium (Invitrogen).
  • SCC12 skin cancer cell line was cultured in FAD media, as described previously (Gaggioli et al, 2007). All cells were grown in collagen-coated plastic (50ug/mL) at 37oC in a humidified 5% C02 atmosphere. Experiments were performed at passages 3-10. Collagen-coated hydrogels were purchased from Matrigen.
  • BPTES Sigma Aldrich
  • CB839 Selleckchem
  • TFB-TBOA Selleckchem
  • Y27632 Sigma Aldrich
  • Verteporfm Sigma Aldrich
  • PF573228 Sigma Aldrich
  • Glutamate was purchased from Sigma Aldrich and used at concentration of 2mM; aspartate was purchased from Sigma Aldrich and used at concentration of lOmM, consistent with prior in vitro studies linking cancer cell proliferation to glutamine metabolism and aspartate levels (Birsoy et al., 2015; Sullivan et al., 2015).
  • On Target Plus siRNAs for YAP J-012200-07 and J-012200-05,), TAZ (WWTR1; J- 016083-05 and J-016083-06), GLS1 (J-004548-09; J-004548-10), SLC1A3 (J-007427-05; J- 007427-07) and scrambled control D-001810-01 and D-001810-02) were purchased from Thermo Scientific/Dhermacon. Cells were plated in collagen-coated plastic (50ug/mL) and transfected 24h later at 70-80% confluence using siRNA (25nM) and Lipofectamine 2000 reagent (Life Technologies), according to the manufacturers' instructions. Eight hours after transfection, cells were trypsinized and re-plated on hydrogel or used for spheroid assay.
  • AACCTCGAGGTTACACCAAAAACTTGAAAGTTTTTG were sub-cloned in the pL O- Tet-On (Wiederschain et al, 2009) using EcoRI and Agel restriction sites. Stable expression of these constructs in 4T1 cells, and BalB/c mouse CAFs was achieved by lentiviral transduction. All cloned plasmids were confirmed by DNA sequencing.
  • HEK293T cells were transfected using Lipofectamine 2000 (Life Technologies) with lentiviral plasmids along with packaging plasmids (pPACK, System Biosciences), according to the manufacturer's instructions. Virus was harvested, sterile filtered (0.45 um), and utilized for subsequent infection of 410.4 and Balb/c mouse CAFs (24-48 hour incubation) for gene transduction.
  • Metabolite extraction was performed essentially as described with minor modifications (Oldham et al., Cell Metabo, 2016). Briefly, metabolites were extracted from cultured cells on dry ice using 80% aqueous methanol precooled at -80°C. Supernatants were extracted with 4 volumes of 100% methanol precooled at -80°C for 4 hours at -80°C. An internal standard, [13C4]-2-oxoglutarate ([13C4]-20G) (Cambridge Isotope Laboratories), was added during metabolite extraction. Insoluble material from both cell and supernatant extractions was removed by centrifugation at 20,000 g for 15 minutes at 4°C.
  • the supernatant was analyzed by targeted LC-MS/MS as previously described (Oldham et al., Cell Metabo, 2016). Metabolites were separated using a ZIC-HILIC stationary phase (150 mm x 2.1 mm x 3.5 mm; Merck). The MS parameters were optimized using a glutamine standard solution. Monitored mass transitions were 87 to 87 (pyruvate), 132 to 88 (aspartate), 145 to 101 (20G), 145 to 127 (glutamine), 146 to 128 (glutamate), and 149 to 105 ([13C4J-20G). Mass transitions and retention time windows were confirmed by the analysis of neat and matrix-spiked standards. Peak areas were quantified by Xcalibur Software (Thermo Fisher Scientific) and manually reviewed.
  • RNA content was extracted using the miRNeasy kit (Qiagen) according to the manufacturer's instructions. Total RNA concentration was determined using a ND-1000 micro-spectrophotometer (NanoDrop Technologies).
  • cDNA was amplified via fluorescently labeled Taqman primer sets using an Applied Biosystems 7900HT Fast Real Time PCR device. Fold-change of RNA species was calculated using the formula (2- ⁇ Ct), normalized to RPLP0 expression.
  • Cell-derived matrices were generated as described (Beacham et al., Current protocol in cell biology 2006). Briefly, normal fibroblast or CAF were seeded at a density of 200,000 cells per well in a 6-well plate. When confluent, cells were cultured for a further 10 days, with medium being changed every 48 h to complete medium supplemented with 50 mg.ml-l ascorbic acid (Sigma- Aldrich) to ensure collagen cross-linking. Mature matrices were then denuded of cells using lysis buffer (PBS containing 20 mM NH40H and 0.5 % (vol/vol) Triton X-100).
  • lysis buffer PBS containing 20 mM NH40H and 0.5 % (vol/vol) Triton X-100).
  • matrices were incubated with 10 mg.ml-1 DNase I (Roche) at 37 °C for 30 min. Matrices were then stored in PBS containing 1% (vol/vol) penicillin/streptomycin at 4 °C before use.
  • Tractions exerted by CAF were estimated by measuring bead displacement fields, computing corresponding traction fields using Fourier transform traction microscopy, and calculating root- mean-square traction using the PIV 5particle Image velocity) and TFM (Traction force microscopy) pakage on ImageJ (Tseng et al, 2012). To measure baseline noise, the same procedure was performed on a cell- free region.
  • SCC12 cells transfected with the indicated siR A - or not- were plated in triplicate in 6 well plates at 30 000 cells per well. After overnight incubation for cells to adhere, 6 wells were counted to determine initial count at time of treatments (glutamate, aspartate, BPTES, CB-839 or TFB-TBOA). After 1 day, 2 days or 3 days, the entire contents of the well was trypsinized and counted and proliferation rate was calculated.
  • SCC12 cells treated with the indicated siRNA or pharmacological inhibitors were plated in 6 well plates at 30 000 cells per well. After 6 hours incubation for cells to adhere, 6 wells were imaged every 10 minutes during 10 hours using an Axiovert 200M motorized microscope stand (Zeiss) and a xlO magnification objective. Images were analyzed to determine the distance travelled by cells using the TrackMate package on ImageJ.
  • Cancer cells SCC12 or MDA-MB-4608 and CAF cells were removed from the cell culture dishes with trypsin and re-suspended in DMEM 10% FCS.
  • the solution contained a 1 :1 ratio of cancer cells and CAF cells at a concentration of 1 x 106 cells per mL.
  • Fifty-micro litre droplets were plated onto the underside of a 10 cm culture dish and allowed to form spheroids in a 37 °C incubator 24 hours.
  • the spheroids were then embedded in a collagen I/Matrigel gel mix at a concentration of approximately 4 mg ml-l collagen I and 2 mg ml-l Matrigel (BD Bioscience) in 24-well glass-bottomed cell culture plates (MatTek).
  • the gel was incubated for at least 45 min at 37 °C with 5% C02.
  • the gel was covered with DMEM media. Forty-eight hours later, the spheroids were imaged with an inverted at a magnification of x4 and xlO. Invasion was quantified using ImageJ.
  • GLS1 abl56876; 1/1000
  • LDHA ab47010; 1/1000
  • Tubulin T4026; 1/5000
  • SLC1A3 SLC1A3
  • Metastatic mouse (Balb/c) 4T 1 breast cancer cell line (Yang et al., 2004) were implanted into the right fourth mammary fat pad in 10 ⁇ Matrigel of 8 weeks old female Balb/c mice. After 10 days, mice with palpable tumor (5-10mm3) were randomly assigned to treatment groups and underwent i.p. injection daily with 20mg/kg of Verteporfin (Tocris Bioscience) or vehicle control. In parallel but in separate mouse cohort, ⁇ -aminopropionitrile (BAPN; 100 mg/kg/d; Sigma- Aldrich) was administered in drinking water. Tumor dimensions were measured using digital calipers, and tumor volume was calculated as (small diameter)2 x (large diameter)/2..
  • BAPN 100 mg/kg/d
  • Sigma- Aldrich ⁇ -aminopropionitrile
  • mice were monitored daily for breast cancer progression and euthanized according to a standard body condition score, taking into account initial signs of moribund state and discomfort associated with the progression of breast cancer. Mice were also euthanized when total tumor burden exceeded 1,500 mm3 in volume. Postmortem, the lungs, and livers were harvested and examined for the presence of macroscopic lesions.
  • mice were monitored daily for breast cancer progression and euthanized according to a standard body condition score, taking into account initial signs of moribund state and discomfort associated with the progression of breast cancer. Mice were also euthanized when total tumor burden exceeded 1,500 mm3 in volume. Postmortem, the lungs were harvested and examined for the presence of macroscopic lesions.
  • Non invasive mouse (Balb/c) 67NR (5.105) breast cancer cell line were co-implanted with CAF (1.106) isolated from Balb/c mammary tumor and stably transfected with either doxycycline inducible sh-NC (Control) or shGLSl or shSLClA3 or shGLSl and shSLClA3 were implanted into the right fourth mammary fat pad in 10 ⁇ Matrigel of 8 weeks old female Balb/c mice. After 1 days, mice were treated with lmg/mL doxycycline (Sigma) 5% sucrose in dirking water. Mice were killed 35 days post injection, tumors were removed.
  • tumors were paraffin-embedded.
  • 5- ⁇ paraffin sections were made and stained with haematoxylin and eosin or Picrosirius Red. Local invasion was determined by observation under light microscopy.
  • mice with palpable tumor 5-10mm3 were randomly assigned to treatment groups and underwent i.p. injection daily with 20mg/kg of CB839 (Tocris Bioscience) or with 20mg/kg of TFB-TBOA or with 20mg/kg CB839 and 20mg/kg TFB-TBOA or vehicle control.
  • Tumor dimensions were measured using digital calipers, and tumor volume was calculated as (small diameter)2 x (large diameter)/2.
  • mice were monitored daily for breast cancer progression and euthanized according to a standard body condition score, taking into account initial signs of moribund state and discomfort associated with the progression of breast cancer. Mice were also euthanized when total tumor burden exceeded 1,500 mni3 in volume. Postmortem, the lungs, and livers were harvested and examined for the presence of macroscopic lesions.
  • Tumor specimens were obtained at initial surgery (Face and Neck University Institute, Nice, France) from primary diagnosed HNSCC. None of the patient received neoadjuvant chemotherapy and/or radiotherapy. Written informed consent was obtained from each patient and the study was approved by the hospital ethics committee.
  • Patient tumor material was collected in culture medium and partially digested during 1 hour at room temperature in RPMI1640 with 1 mg/ml Collagenase IV, 1 mg/ml Dispase and 1 mg/ml Hyaluronidase. Approximately 20-30 mg tissue fragments in 50 % Matrigel were implanted subcutaneously into the flank region of NMRI-nu (RjOrkNMRI-Foxnlnu /Foxnlnu) mice.
  • the first passage PDX were dissociated in a collagenase/dispase mixture and cells were cultured in low serum conditions (2 %FBS/F12/DMEM/1XB27) in presence 5 ng/ml EGF. Subsequently, 75.104 cells in 50 % Matrigel were implanted subcutaneously into the flank region of NMRI-nu (RjOrl:NMRI-Foxnlnu /Foxnlnu) mice. One week after tumors engraftment, to avoid any interference with tumors uptake, mice were treated with the corresponding inhibitors.
  • Verteporfm (20mg/kg), CB838 (20mg/kg), TFB-TBOA (20mg/kg) or a combination of CB839 (20mg/kg) and TFB-TBOA (20mg/kg) were injected intraperitoneally every days; BAPN (100 mg/kg/day) was dissolve in drinking water. The dose in drinking water was determined using average daily water intake (4 ml) and mouse weight. Tumor volume was measured every day from the beginning of the treatment with the following formula: (small diameter)2 x (large diameter)/2.
  • Aspartate and glutamate concentration were measured using the Aspartate colorimetric assay kit (BioVision; 552) and the Glutamate Colorimetric Assay Kit (Bio vision; K629) following the manufacturer instructions. Briefly, 10 ⁇ g of total protein extracts from whole tumor, as described above, were analysed (Glutamate assay) or were pretreated to remove interfering substances using the serum clean-up Mix and deproteinized by centrifuging 10 min with a 10 kDa spin filter (Aspartate assay). Extracts (glutamate assay) or filtrates (aspartate assay) were incubated with kit reagents for 30 min at 37°C and absorbances were measured at 450 nm and 70nm respectively.
  • kit reagents for 30 min at 37°C and absorbances were measured at 450 nm and 70nm respectively.
  • a primary antibody against SLC1A3 (sc-7757; 1/100), was purchased from Santa Cruz Biotechnology.
  • a primary antibody against PCNA (13-3900, 1/100) was purchased from Thermo Fisher Scientific.
  • color development was achieved by adding streptavidin biotinylated alkaline phosphatase complex (Vector Labs) followed by Vector Red alkaline phosphatase substrate solution (Vector Labs).
  • Levamisole was added to block endogenous alkaline phosphatase activity (Vector Labs).
  • Pictures were obtained using an Olympus Bx51 microscope or ZEISS LSM Exciter confocal microscope. Intensity of staining was quantified using ImageJ software (NIH). All measurements were performed blinded to condition.
  • mice tumors were embedded in OCT, frozen on liquid nitrogen vapor and store at -80°C.
  • Tumor slices (10 ⁇ thickness) were cut out from their glass slide and the fragment of glass containing the sample was glued on the bottom of a 50 mm dish (Willco Glass Bottom Dish). Before measurements the sample was first rinsed and after covered with 4 ml of PBS lx. The mechanical properties of the samples were studied using a BioScope Catalyst atomic force microscope (Bruker) coupled with and optical microscope (Leica DMI6000B) that enables, by phase contrast, to pinpoint the areas of interest. For each sample, at least 3 areas were analyzed using the "Point and Shoot” method, collecting from 80 to 100 force-distance curves at just as many discrete points.
  • Picrosirius Red stain was achieved through the use of D m paraffin sections stained with 0.1% Picrosirius Red (Direct Red80, Sigma- Aldrich) and counterstained with Weigert's hematoxylin to reveal fibrillar collagen. The sections were then serially imaged using with an analyzer and polarizer oriented parallel and orthogonal to each other. Microscope conditions (lamp brightness, condenser opening, objective, zoom, exposure time, and gain parameters) were constant throughout the imaging of all samples. A minimal threshold was set on appropriate control sections for each experiment in which only the light passing through the orthogonally-oriented polarizers representing fibrous structures (i.e., excluding residual light from the black background) was included. The threshold was maintained for all images across all conditions within each experiment. The area of the transferred regions that was covered by the thresholded light was calculated and at least five 20x field per condition were averaged together (Image J software).
  • spheroids were then embedded in a collagen I/Matrigel gel mix at a concentration of approximately 4 mg ml-1 collagen I and 2 mg ml-l Matrigel (BD Bioscience) in 24-well glass-bottomed cell culture plates (MatTek). The gel was incubated for at least 45 min at 37 °C with 5% C02. The gel was covered with DMEM/F12 media. Forty-eight hours later, the spheroids were imaged with an inverted at a magnification of x 4 and x 10. Invasion was quantified using ImageJ.
  • Micrographs are representative of experiments in each relevant cohort. Paired samples were compared by a 2-tailed Student's t test for normally distributed data, while Mann- Whitney U non-parametric testing was used for non-normally distributed data. For comparisons among groups, one-way ANOVA and post-hoc Tukey testing was performed. A P-value less than 0.05 was considered significant. Correlation analyses were performed by Pearson correlation coefficient calculation. The Mantel-Cox log-rank test was used for statistical comparisons in survival analyses.
  • ECM stiffness activates SCC and CAF pro-tumoral activities, as reflected by inducing proliferation and generating contractile forces (assessed by traction force microscopy (TFM). In order to sustain these energy-requiring activities, cells adapt their metabolism accordingly.
  • TBM traction force microscopy
  • LC-MS/MS liquid chromatography-tandem mass spectrometry
  • ECM stiffening also increased release of glutamate and uptake of aspartate in SCC 12 cells while increasing aspartate release and decreasing glutamate release of CAF cells (data not shown).
  • LDHA lactate dehydrogenases A
  • GLS1 glutaminase 1
  • matrix stiffness acts as a mechanical stimulus to increase glycolysis and glutaminolysis as well as to modulate flux of extracellular amino acids.
  • GLSl In order to determine whether GLSl is critical for stiffness-induced metabolic reprogramming in both SCC and CAF, cells were cultivated on stiff matrix and exposed to known pharmacologic inhibitors of GLSl, BPTES (Bis-2-(5-phenylacetamido-l,3,4- thiadiazol-2-yl)ethyl sulfide) and CB839 (data not shown) or siR A (siGLSl).
  • BPTES Bis-2-(5-phenylacetamido-l,3,4- thiadiazol-2-yl)ethyl sulfide
  • CB839 data not shown
  • siR A siR A
  • GLSl inhibition As quantified by LC-MS/MS, inhibition of GLSl in both SCC and CAF cells blunted the stiffness induced processes of glutamine consumption, glutamate production, and aspartate production as well as blunted the secretion of glutamate by the SCC and the secretion of aspartate by CAF (data not shown). GLSl inhibition also decreased glycolysis in stiff matrix, as indicated by decreased lactate/pyruvate ratio (data not shown).
  • GLSl inhibition affected cell proliferation and migration through its effects on glutamate and aspartate metabolism (data not shown). Consistent with prior observations (Gross et al, 2014), GLSl inhibition, achieved via siRNA (data not shown) or pharmacologic means (data not shown), inhibited SCC proliferation and migration as assessed by cell count (data not shown), PCNA staining (data not shown) and microsopic cell migration tracking (data not shown). Importantly, in cells with decreased GLSl activity, cellular proliferation and migration were restored by glutamate and/or aspartate supplementation (data not shown).
  • GLS 1 inhibition controls CAF-dependent ECM remodelling and whether increased glutamate and aspartate levels are central to the actions of GLS 1 (data not shown).
  • GLS 1 inhibition achieved via siRNA (data not shown) or pharmacologic means (data not shown), inhibited CAF-dependent ECM production and remodelling as well as generation of contractile forces as assessed by gel contraction assays (data not shown), and traction force microscopy (data not shown).
  • SLC1A3 enables aspartate/glutamate exchange within the tumor niche to promote tumor progression.
  • Modulation of mechanotransduction controls metabolism reprogramming of tumor niche cells.
  • siYAP/TAZ decreased SCC proliferation and CAF dependent ECM remodelling while addition of aspartate/glutamate resulted in at least partial rescue of these effects (data not shown).
  • inhibition of YAP/TAZ in CAF or SCC was not sufficient to fully impair cell invasion (data not shown).
  • the mechanotransduction cascade controls metabolism reprogramming of tumor niche cells in vivo.
  • verteporfin a known pharmacologic inhibitor of YAP (Park and Guan, 2013), was used to interrogate whether YAP is also essential for activating glutamino lysis and metabolic changes to sustain tumor progression (data not shown).
  • verteporfin decreased YAP-dependent gene expression (data not shown). Consequently, in a similar fashion to BAPN, verteporfin improved the downstream metabolic (GLS land SLC1A3 expression, and GLS activity), proliferative (data not shown), and end- stage manifestations of breast cancer, including reductions of tumor volume, lung and liver metastasis, and survival (data not shown).
  • verteporfin also decreased tumor stiffness and stromal activation (data not shown ), consistent with prior report of YAP-dependent control of ECM remodelling (Bertero et al., 2015a; Calvo et al., 2013).
  • tumor niche stiffening relies on mechanotransduction pathways in order to induce tumor cell glutamino lysis and glycolysis, proliferation, invasion, and overall survival outcome.
  • PDX patient-derived xenograft
  • Aspartate/glutamate exchanges within the tumor niche are crucial to sustain tumor progression in vivo.
  • mice were treated with doxycyline in order to induce depletion of GLS1 and/or SLC1A3 in stromal fibroblast (data not shown). Consistent with the in vitro 3D assay data , while GLS1 or SLC1A3 knockdown slightly decreases intratumoral aspartate (data not shown).) and glutamate (data not shown) concentration, combined treatment led to a greater inhibition. Such metabolic effects further decreased stromal activation as reflected by D-SMA staining (data not shown) and decreased stromal-dependant ECM remodelling as quantified by picrosirius red staining (data not shown). Moreover, these treatments decreased tumor cell invasion (data not shown) and tumor cell proliferation (data not shown), as reflected by in situ staining of the proliferation marker PCNA.
  • mice we wanted to determine whether humans suffering from SCC may also be sensitive to these combined therapies.
  • a PDX model of FTNSCC expansion was tested in vivo (Fig.2 G-M). Three independent FTNSCC tumors were subcutaneously engrafted in the flanks of nude mice. One week later, to avoid any interference with tumor uptake, mice were treated with either vehicle control, CB839, BPTES, TFB-TBOA or a combination of these drugs.
  • Aragona M., Panciera, T., Manfrin, A., Giulitti, S., Michielin, F., Elvassore, N., Dupont,
  • a mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors.
  • Matrix Remodeling Promotes Pulmonary Hypertension through Feedback Mechanoactivation of the YAP/TAZ-miR-130/301 Circuit. Cell Rep. 13, 1016-1032.
  • a YAP/TAZ-miR-130/301 molecular circuit exerts systems-level control of fibrosis in a network of human diseases and physiologic conditions. Sci. Rep. 5, 18277.
  • Vascular stiffness mechanoactivates YAP/TAZ-dependent glutamino lysis to drive pulmonary hypertension. J. Clin. Invest. 126, 3313-3335.
  • Macropinocytosis of protein is an amino acid supply route in Ras-transformed cells. Nature 497, 633-637.
  • Yes-associated protein 1 and transcriptional coactivator with PDZ-binding motif activate the mammalian target of rapamycin complex 1 pathway by regulating amino acid transporters in hepatocellular carcinoma.
  • Glutamine synthetase activity fuels nucleotide biosynthesis and supports growth of glutamine-restricted glioblastoma. Nat. Cell Biol. 17, 1556-1568.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Dans le but d'étudier si l'inhibition pharmacologique de la glutaminolyse et de l'échange aspartate/glutamate à la fois est une thérapie pertinente pour le cancer, les inventeurs ont effectué des polythérapies dans le modèle murin de cancer du sein 4T1 syngénique orthoptique hautement métastatique. C'est-à-dire qu'alors qu'un traitement CB839 ou TFB-TBOA seul réduit la concentration intratumorale d'aspartate et de glutamate, la polythérapie a conduit à une plus grande inhibition. De tels effets métaboliques ont en outre diminué l'activation stromale telle que reflétée par a-SMA et une prolifération de cellules tumorales réduite, telle que reflétée par coloration in situ du marqueur de prolifération PCNA. En accord avec ces observations et leurs résultats in vitro, CB839 ou TFB-TBOA, les traitements ont inhibé la progression tumorale 4T1 telle que quantifiée par le volume tumoral et les métastases pulmonaires et hépatiques. La polythérapie conduit à une plus grande inhibition de la croissance et de l'invasion tumorale et à d'autres résultats de survie améliorés. Par conséquent, l'invention concerne une méthode permettant de traiter le cancer chez un patient en ayant besoin, comprenant une étape d'administration au patient d'une quantité thérapeutiquement efficace d'inhibiteurs de GLS1 et de SLC1A3.
PCT/EP2018/069619 2017-07-20 2018-07-19 Méthodes et compositions de traitement de cancers WO2019016310A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17305961.9 2017-07-20
EP17305961 2017-07-20

Publications (1)

Publication Number Publication Date
WO2019016310A1 true WO2019016310A1 (fr) 2019-01-24

Family

ID=59579564

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/069619 WO2019016310A1 (fr) 2017-07-20 2018-07-19 Méthodes et compositions de traitement de cancers

Country Status (1)

Country Link
WO (1) WO2019016310A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102198705B1 (ko) * 2019-08-22 2021-01-05 건국대학교 산학협력단 줄기세포의 증식 및 전능성 증진용 조성물
CN114560855A (zh) * 2021-03-26 2022-05-31 成都苑东生物制药股份有限公司 环烷基甲酰胺类衍生物、其制备方法及用途
CN116212053A (zh) * 2023-04-14 2023-06-06 徐州医科大学 Eaat1/slc1a3抑制剂在制备治疗肝癌药物的应用

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
EP0368684A1 (fr) 1988-11-11 1990-05-16 Medical Research Council Clonage de séquences d'immunoglobulines de domaines variables.
EP0404097A2 (fr) 1989-06-22 1990-12-27 BEHRINGWERKE Aktiengesellschaft Récepteurs mono- et oligovalents, bispécifiques et oligospécifiques, ainsi que leur production et application
WO1993011161A1 (fr) 1991-11-25 1993-06-10 Enzon, Inc. Proteines multivalentes de fixation aux antigenes
US5981732A (en) 1998-12-04 1999-11-09 Isis Pharmaceuticals Inc. Antisense modulation of G-alpha-13 expression
US6046321A (en) 1999-04-09 2000-04-04 Isis Pharmaceuticals Inc. Antisense modulation of G-alpha-i1 expression
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6107091A (en) 1998-12-03 2000-08-22 Isis Pharmaceuticals Inc. Antisense inhibition of G-alpha-16 expression
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6365354B1 (en) 2000-07-31 2002-04-02 Isis Pharmaceuticals, Inc. Antisense modulation of lysophospholipase I expression
US6410323B1 (en) 1999-08-31 2002-06-25 Isis Pharmaceuticals, Inc. Antisense modulation of human Rho family gene expression
US6566131B1 (en) 2000-10-04 2003-05-20 Isis Pharmaceuticals, Inc. Antisense modulation of Smad6 expression
US6566135B1 (en) 2000-10-04 2003-05-20 Isis Pharmaceuticals, Inc. Antisense modulation of caspase 6 expression
US6982321B2 (en) 1986-03-27 2006-01-03 Medical Research Council Altered antibodies
WO2006003388A2 (fr) 2004-06-30 2006-01-12 Domantis Limited Compositions et procedes pour le traitement de troubles inflammatoires
WO2006030220A1 (fr) 2004-09-17 2006-03-23 Domantis Limited Compositions monovalentes pour la liaison au cd40l et procedes d'utilisation
US7087409B2 (en) 1997-12-05 2006-08-08 The Scripps Research Institute Humanization of murine antibody
US20140068797A1 (en) 2012-05-25 2014-03-06 University Of Vienna Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US6982321B2 (en) 1986-03-27 2006-01-03 Medical Research Council Altered antibodies
EP0368684A1 (fr) 1988-11-11 1990-05-16 Medical Research Council Clonage de séquences d'immunoglobulines de domaines variables.
EP0404097A2 (fr) 1989-06-22 1990-12-27 BEHRINGWERKE Aktiengesellschaft Récepteurs mono- et oligovalents, bispécifiques et oligospécifiques, ainsi que leur production et application
US6075181A (en) 1990-01-12 2000-06-13 Abgenix, Inc. Human antibodies derived from immunized xenomice
US6150584A (en) 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
WO1993011161A1 (fr) 1991-11-25 1993-06-10 Enzon, Inc. Proteines multivalentes de fixation aux antigenes
US7087409B2 (en) 1997-12-05 2006-08-08 The Scripps Research Institute Humanization of murine antibody
US6107091A (en) 1998-12-03 2000-08-22 Isis Pharmaceuticals Inc. Antisense inhibition of G-alpha-16 expression
US5981732A (en) 1998-12-04 1999-11-09 Isis Pharmaceuticals Inc. Antisense modulation of G-alpha-13 expression
US6046321A (en) 1999-04-09 2000-04-04 Isis Pharmaceuticals Inc. Antisense modulation of G-alpha-i1 expression
US6410323B1 (en) 1999-08-31 2002-06-25 Isis Pharmaceuticals, Inc. Antisense modulation of human Rho family gene expression
US6365354B1 (en) 2000-07-31 2002-04-02 Isis Pharmaceuticals, Inc. Antisense modulation of lysophospholipase I expression
US6566131B1 (en) 2000-10-04 2003-05-20 Isis Pharmaceuticals, Inc. Antisense modulation of Smad6 expression
US6566135B1 (en) 2000-10-04 2003-05-20 Isis Pharmaceuticals, Inc. Antisense modulation of caspase 6 expression
WO2006003388A2 (fr) 2004-06-30 2006-01-12 Domantis Limited Compositions et procedes pour le traitement de troubles inflammatoires
WO2006030220A1 (fr) 2004-09-17 2006-03-23 Domantis Limited Compositions monovalentes pour la liaison au cd40l et procedes d'utilisation
US20140068797A1 (en) 2012-05-25 2014-03-06 University Of Vienna Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products

Non-Patent Citations (73)

* Cited by examiner, † Cited by third party
Title
"Genbank", Database accession no. NM_001081081.2
"Genbank", Database accession no. NM_001166696.2
"Genbank", Database accession no. NM-148938.3
"Genbank", Database accession no. NP 001160168.1
"Genbank", Database accession no. NP 055720.3
"Genbank", Database accession no. NP_001074550.1
ALBRENGUES, J.; BERTERO, T.; GRASSET, E.; BONAN, S.; MAIEL, M.; BOURGET, I.; PHILIPPE, C.; HERRAIZ SERRANO, C.; BENAMAR, S.; CROCE: "Epigenetic switch drives the conversion of fibroblasts into proinvasive cancer-associated fibroblasts", NAT. COMMUN., vol. 6, 2015, pages 10204
ARAGONA, M.; PANCIERA, T.; MANFRIN, A.; GIULITTI, S.; MICHIELIN, F.; ELVASSORE, N.; DUPONT, S.; PICCOLO, S.: "A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors", CELL, vol. 154, 2013, pages 1047 - 1059, XP028706404, DOI: doi:10.1016/j.cell.2013.07.042
BARRY-HAMILTON, V.; SPANGLER, R.; MARSHALL, D.; MCCAULEY, S.; RODRIGUEZ, H.M.; OYASU, M.; MIKELS, A.; VAYSBERG, M.; GHERMAZIEN, H.: "Allosteric inhibition of lysyl oxidase-like-2 impedes the development of a pathologic microenvironment", NAT. MED., vol. 16, 2010, pages 1009 - 1017, XP055019972, DOI: doi:10.1038/nm.2208
BAYS, J.L.; CAMPBELL, H.K.; HEIDEMA, C.; SEBBAGH, M.; DEMALI, K.A.: "Linking E-cadherin mechanotransduction to cell metabolism through force-mediated activation of AMPK", NAT. CELL BIOL., vol. 19, 2017, pages 724 - 731
BEN-SAHRA, I.; MANNING, B.D.: "mTORCl signaling and the metabolic control of cell growth", CURR. OPIN. CELL BIOL., vol. 45, 2017, pages 72 - 82, XP085082063, DOI: doi:10.1016/j.ceb.2017.02.012
BERTERO, T.; COTTRILL, K.A.; ANNIS, S.; BHAT, B.; GOCHUICO, B.R.; OSORIO, J.C.; ROSAS, I.; HALEY, K.J.; COREY, K.E.; CHUNG, R.T. E: "A YAP/TAZ-miR-130/301 molecular circuit exerts systems-level control of fibrosis in a network of human diseases and physiologic conditions", SCI. REP., vol. 5, 2015, pages 18277
BERTERO, T.; COTTRILL, K.A.; LU, Y.; HAEGER, C.M.; DIEFFENBACH, P.; ANNIS, S.; HALE, A.; BHAT, B.; KAIMAL, V.; ZHANG, Y.-Y. ET AL.: "Matrix Remodeling Promotes Pulmonary Hypertension through Feedback Mechanoactivation of the YAP/TAZ-miR-130/301 Circuit", CELL REP., vol. 13, 2015, pages 1016 - 1032, XP055441154, DOI: doi:10.1016/j.celrep.2015.09.049
BERTERO, T.; OLDHAM, W.M.; COTTRILL, K.A.; PISANO, S.; VANDERPOOL, R.R.; YU, Q.; ZHAO, J.; TAI, Y.; TANG, Y.; ZHANG, Y.-Y. ET AL.: "Vascular stiffiiess mechanoactivates YAP/TAZ-dependent glutaminolysis to drive pulmonary hypertension", J. CLIN. INVEST., vol. 126, 2016, pages 3313 - 3335, XP055441149, DOI: doi:10.1172/JCI86387
BIRSOY, K.; WANG, T.; CHEN, W.W.; FREINKMAN, E.; ABU-REMAILEH, M.; SABATINI, D.M.: "An Essential Role of the Mitochondrial Electron Transport Chain in Cell Proliferation Is to Enable Aspartate Synthesis", CELL, vol. 162, 2015, pages 540 - 551, XP029248053, DOI: doi:10.1016/j.cell.2015.07.016
CALVO, F.; EGE, N.; GRANDE-GARCIA, A.; HOOPER, S.; JENKINS, R.P.; CHAUDHRY, S.I.; HARRINGTON, K.; WILLIAMSON, P.; MOEENDARBARY, E.: "Mechanotransduction and YAP-dependent matrix remodelling is required for the generation and maintenance of cancer-associated fibroblasts", NAT. CELL BIOL., vol. 15, 2013, pages 637 - 646
CHANG, C.-H.; QIU, J.; O'SULLIVAN, D.; BUCK, M.D.; NOGUCHI, T.; CURTIS, J.D.; CHEN, Q.; GINDIN, M.; GUBIN, M.M.; VAN DER WINDT: "Metabolic Competition in the Tumor Microenvironment Is a Driver of Cancer Progression", CELL, vol. 162, 2015, pages 1229 - 1241
COMMISSO, C.; DAVIDSON, S.M.; SOYDANER-AZELOGLU, R.G.; PARKER, S.J.; KAMPHORST, J.J.; HACKETT, S.; GRABOCKA, E.; NOFAL, M.; DREBIN: "Macropinocytosis of protein is an amino acid supply route in Ras-transformed cells", NATURE, vol. 497, 2013, pages 633 - 637, XP055322083, DOI: doi:10.1038/nature12138
CORDENONSI, M.; ZANCONATO, F.; AZZOLIN, L.; FORCATO, M.; ROSATO, A.; FRASSON, C.; INUI, M.; MONTAGNER, M.; PARENTI, A.R.; POLETTI,: "The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells", CELL, vol. 147, 2011, pages 759 - 772, XP028109263, DOI: doi:10.1016/j.cell.2011.09.048
COX, A.G.; HWANG, K.L.; BROWN, K.K.; EVASON, K.J.; BELTZ, S.; TSOMIDES, A.; O'CONNOR, K.; GALLI, G.G.; YIMLAMAI, D.; CHHANGAWALA,: "Yap reprograms glutamine metabolism to increase nucleotide biosynthesis and enable liver growth", NAT. CELL BIOL., vol. 18, 2016, pages 886 - 896
DAVIDSON, S.M.; JONAS, O.; KEIBLER, M.A.; HOU, H.W.; LUENGO, A.; MAYERS, J.R.; WYCKOFF, J.; DEL ROSARIO, A.M.; WHITMAN, M.; CHIN,: "Direct evidence for cancer-cell-autonomous extracellular protein catabolism in pancreatic tumors", NAT. MED., vol. 23, 2017, pages 235 - 241
DICARLO ET AL., NUCLEIC ACIDS RES., vol. 41, 2013, pages 4336 - 4343
DUPONT, S.; MORSUT, L.; ARAGONA, M.; ENZO, E.; GIULITTI, S.; CORDENONSI, M.; ZANCONATO, F.; LE DIGABEL, J.; FORCATO, M.; BICCIATO,: "Role of YAP/TAZ in mechanotransduction", NATURE, vol. 474, 2011, pages 179 - 183
ELENA PEDRAZ-CUESTA ET AL: "The glutamate transport inhibitor DL-Threo-?-Benzyloxyaspartic acid (DL-TBOA) differentially affects SN38- and oxaliplatin-induced death of drug-resistant colorectal cancer cells", BMC CANCER, BIOMED CENTRAL, LONDON, GB, vol. 15, no. 1, 16 May 2015 (2015-05-16), pages 411, XP021222620, ISSN: 1471-2407, DOI: 10.1186/S12885-015-1405-8 *
ENZO, E.; SANTINON, G.; POCATERRA, A.; ARAGONA, M.; BRESOLIN, S.; FORCATO, M.; GRIFONI, D.; PESSION, A.; ZANCONATO, F.; GUZZO, G.: "Aerobic glycolysis tunes YAP/TAZ transcriptional activity", EMBO J., vol. 34, 2015, pages 1349 - 1370
FABRE ET AL., PLOS NEGL. TROP. DIS., vol. 8, 2014, pages e2671
GAGGIOLI, C.; HOOPER, S.; HIDALGO-CARCEDO, C.; GROSSE, R.; MARSHALL, J.F.; HARRINGTON, K.; SAHAI, E.: "Fibroblast-led collective invasion of carcinoma cells with differing roles for RhoGTPases in leading and following cells", NAT. CELL BIOL., vol. 9, 2007, pages 1392 - 1400
GRATZ ET AL., GENETICS, 2014
GROSS, M.I.; DEMO, S.D.; DENNISON, J.B.; CHEN, L.; CHERNOV-ROGAN, T.; GOYAL, B.; JANES, J.R.; LAIDIG, G.J.; LEWIS, E.R.; LI, J. ET: "Antitumor activity of the glutaminase inhibitor CB-839 in triple-negative breast cancer", MOL. CANCER THER., vol. 13, 2014, pages 890 - 901, XP055243589, DOI: doi:10.1158/1535-7163.MCT-13-0870
GUO ET AL., DEVELOPMENT, vol. 141, 2014, pages 707 - 714
HAI ET AL., CELL RES., 2014
HANAHAN, D.; WEINBERG, R.A.: "Hallmarks of cancer: the next generation", CELL, vol. 144, 2011, pages 646 - 674, XP028185429, DOI: doi:10.1016/j.cell.2011.02.013
HANSEN, C.G.; NG, Y.L.D.; LAM, W.-L.M.; PLOUFFE, S.W.; GUAN, K.-L.: "The Hippo pathway effectors YAP and TAZ promote cell growth by modulating amino acid signaling to mTORCl", CELL RES., vol. 25, 2015, pages 1299 - 1313
HENSLEY, C.T.; FAUBERT, B.; YUAN, Q.; LEV-COHAIN, N.; JIN, E.; KIM, J.; JIANG, L.; KO, B.; SKELTON, R.; LOUDAT, L. ET AL.: "Metabolic Heterogeneity in Human Lung Tumors", CELL, vol. 164, 2016, pages 681 - 694, XP029416798, DOI: doi:10.1016/j.cell.2015.12.034
HENSLEY, C.T.; WASTI, A.T.; DEBERARDINIS, R.J.: "Glutamine and cancer: cell biology, physiology, and clinical opportunities", J. CLIN. INVEST., vol. 123, 2013, pages 3678 - 3684
HWANG ET AL., PLOS ONE, vol. 8, 2013, pages e68708
HYNES, R.O.: "The extracellular matrix: not just pretty fibrils", SCIENCE, vol. 326, 2009, pages 1216 - 1219
JOHNSON, R.; HALDER, G.: "The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment", NAT. REV. DRUG DISCOV., vol. 13, 2014, pages 63 - 79
K. SHIMAMOTO ET AL: "Characterization of Novel L-threo-?-Benzyloxyaspartate Derivatives, Potent Blockers of the Glutamate Transporters", MOLECULAR PHARMACOLOGY, vol. 65, no. 4, 1 April 2004 (2004-04-01), US, pages 1008 - 1015, XP055426844, ISSN: 0026-895X, DOI: 10.1124/mol.65.4.1008 *
KAI, F.; LAKLAI, H.; WEAVER, V.M.: "Force Matters: Biomechanical Regulation of Cell Invasion and Migration in Disease", TRENDS CELL BIOL., vol. 26, 2016, pages 486 - 497, XP029613026, DOI: doi:10.1016/j.tcb.2016.03.007
KALLURI, R.: "The biology and function of fibroblasts in cancer", NAT. REV. CANCER, vol. 16, 2016, pages 582 - 598
LEVENTAL, K.R.; YU, H.; KASS, L.; LAKINS, J.N.; EGEBLAD, M.; ERLER, J.T.; FONG, S.F.T.; CSISZAR, K.; GIACCIA, A.; WENINGER, W. ET: "Matrix crosslinking forces tumor progression by enhancing integrin signaling", CELL, vol. 139, 2009, pages 891 - 906, XP029533710, DOI: doi:10.1016/j.cell.2009.10.027
LU, P.; WEAVER, V.M.; WERB, Z.: "The extracellular matrix: a dynamic niche in cancer progression", J. CELL BIOL., vol. 196, 2012, pages 395 - 406
M. I. GROSS ET AL: "Antitumor Activity of the Glutaminase Inhibitor CB-839 in Triple-Negative Breast Cancer", MOLECULAR CANCER THERAPEUTICS, vol. 13, no. 4, 12 February 2014 (2014-02-12), US, pages 890 - 901, XP055243589, ISSN: 1535-7163, DOI: 10.1158/1535-7163.MCT-13-0870 *
MA ET AL., CELL RES., vol. 24, 2014, pages 122 - 125
MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826
MASHIKO ET AL., DEV. GROWTH DIFFER., vol. 56, 2014, pages 122 - 129
MO, J.-S.; MENG, Z.; KIM, Y.C.; PARK, H.W.; HANSEN, C.G.; KIM, S.; LIM, D.-S.; GUAN, K.-L.: "Cellular energy stress induces AMPK-mediated regulation of YAP and the Hippo pathway", NAT. CELL BIOL., vol. 17, 2015, pages 500 - 510
MOUW, J.K.; OU, G.; WEAVER, V.M.: "Extracellular matrix assembly: a multiscale deconstruction", NAT. REV. MOL. CELL BIOL., vol. 15, 2014, pages 771 - 785
NIU ET AL., CELL, vol. 156, 2014, pages 836 - 843
OLDHAM ET AL., CELL METABO, 2016
ORR, A.W.; HELMKE, B.P.; BLACKMAN, B.R.; SCHWARTZ, M.A.: "Mechanisms of Mechanotransduction", DEV. CELL, vol. 10, 2006, pages 11 - 20
OWEN, O.E.; KALHAN, S.C.; HANSON, R.W.: "The key role of anaplerosis and cataplerosis for citric acid cycle function", J. BIOL. CHEM., vol. 277, 2002, pages 30409 - 30412
PARK, H.W.; GUAN, K.-L.: "Regulation of the Hippo pathway and implications for anticancer drug development", TRENDS PHARMACOL. SCI., vol. 34, 2013, pages 581 - 589, XP055230836, DOI: doi:10.1016/j.tips.2013.08.006
PARK, Y.-Y.; SOHN, B.H.; JOHNSON, R.L.; KANG, M.-H.; KIM, S.B.; SHIM, J.-J.; MANGALA, L.S.; KIM, J.H.; YOO, J.E.; RODRIGUEZ-AGUAYO: "Yes-associated protein 1 and transcriptional coactivator with PDZ-binding motif activate the mammalian target of rapamycin complex 1 pathway by regulating amino acid transporters in hepatocellular carcinoma", HEPATOL. BALTIM. MD, vol. 63, 2016, pages 159 - 172
PERERA, R.M.; STOYKOVA, S.; NICOLAY, B.N.; ROSS, K.N.; FITAMANT, J.; BOUKHALI, M.; LENGRAND, J.; DESHPANDE, V.; SELIG, M.K.; FERRO: "Transcriptional control of autophagy-lysosome function drives pancreatic cancer metabolism", NATURE, vol. 524, 2015, pages 361 - 365
PICKUP, M.W.; MOUW, J.K.; WEAVER, V.M.: "The extracellular matrix modulates the hallmarks of cancer", EMBO REP., vol. 15, 2014, pages 1243 - 1253
QUAIL, D.F.; JOYCE, J.A.: "Microenvironmental regulation of tumor progression and metastasis", NAT. MED., vol. 19, 2013, pages 1423 - 1437, XP055261040, DOI: doi:10.1038/nm.3394
SANZ-MORENO, V.; GAGGIOLI, C.; YEO, M.; ALBRENGUES, J.; WALLBERG, F.; VIROS, A.; HOOPER, S.; MITTER, R.; FERAL, C.C.; COOK, M. ET: "ROCK and JAK1 signaling cooperate to control actomyosin contractility in tumor cells and stroma", CANCER CELL, vol. 20, 2011, pages 229 - 245, XP028263275, DOI: doi:10.1016/j.ccr.2011.06.018
SORRENTINO, G.; RUGGERI, N.; SPECCHIA, V.; MANO, M.; DUPONT, S.; MANFRIN, A.; INGALLINA, E.; SOMMAGGIO, R.; PIAZZA, S. ET AL.: "Metabolic control of YAP and TAZ by the mevalonate pathway", NAT. CELL BIOL., vol. 16, 2014, pages 357 - 366
SOUSA, C.M.; BIANCUR, D.E.; WANG, X.; HALBROOK, C.J.; SHERMAN, M.H.; ZHANG, L.; KREMER, D.; HWANG, R.F.; WITKIEWICZ, A.K.; YING, H: "Pancreatic stellate cells support tumour metabolism through autophagic alanine secretion", NATURE, vol. 536, 2016, pages 479 - 483
SULLIVAN, L.B.; GUI, D.Y.; HOSIOS, A.M.; BUSH, L.N.; FREINKMAN, E.; VANDER HEIDEN, M.G.: "Supporting Aspartate Biosynthesis Is an Essential Function of Respiration in Proliferating Cells", CELL, vol. 162, 2015, pages 552 - 563, XP029248054, DOI: doi:10.1016/j.cell.2015.07.017
SULLIVAN, L.B.; GUI, D.Y.; VANDER HEIDEN, M.G.: "Altered metabolite levels in cancer: implications for tumour biology and cancer therapy", NAT. REV. CANCER, vol. 16, 2016, pages 680 - 693
TARDITO, S.; OUDIN, A.; AHMED, S.U.; FACK, F.; KEUNEN, O.; ZHENG, L.; MILETIC, H.; SAKARIASSEN, P.O.; WEINSTOCK, A.; WAGNER, A. ET: "Glutamine synthetase activity fuels nucleotide biosynthesis and supports growth of glutamine-restricted glioblastoma", NAT. CELL BIOL., vol. 17, 2015, pages 1556 - 1568
VANDER HEIDEN, M.G.; DEBERARDINIS, R.J.: "Understanding the Intersections between Metabolism and Cancer Biology", CELL, vol. 168, 2017, pages 657 - 669, XP029935384, DOI: doi:10.1016/j.cell.2016.12.039
WANG, W.; XIAO, Z.-D.; LI, X.; AZIZ, K.E.; GAN, B.; JOHNSON, R.L.; CHEN, J.: "AMPK modulates Hippo pathway activity to regulate energy homeostasis", NAT. CELL BIOL., vol. 17, 2015, pages 490 - 499
WATSON, I.R.; TAKAHASHI, K.; FUTREAL, P.A.; CHIN, L.: "Emerging patterns of somatic mutations in cancer", NAT. REV. GENET., vol. 14, 2013, pages 703 - 718
YANG ET AL., J. MOL. CELL BIOL., vol. 6, 2014, pages 97 - 99
YANG, J.; MANI, S.A.; DONAHER, J.L.; RAMASWAMY, S.; ITZYKSON, R.A.; COME, C.; SAVAGNER, P.; GITELMAN, I.; RICHARDSON, A.; WEINBERG: "Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis", CELL, vol. 117, 2004, pages 927 - 939, XP002618319, DOI: doi:10.1016/j.cell.2004.06.006
YANG, L.; ACHREJA, A.; YEUNG, T.-L.; MANGALA, L.S.; JIANG, D.; HAN, C.; BADDOUR, J.; MARINI, J.C.; NI, J.; NAKAHARA, R. ET AL.: "Targeting Stromal Glutamine Synthetase in Tumors Disrupts Tumor Microenvironment-Regulated Cancer Cell Growth", CELL METAB., vol. 24, 2016, pages 685 - 700, XP029804640, DOI: doi:10.1016/j.cmet.2016.10.011
YU, F.-X.; ZHAO, B.; GUAN, K.-L.: "Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer", CELL, vol. 163, 2015, pages 811 - 828, XP055481720, DOI: doi:10.1016/j.cell.2015.10.044
ZETSCHE ET AL.: "Cpfl is a Single RNA-guided Endonuclease of a Class 2 CRISPR-Cas System", CELL, vol. 163, 2015, pages 1 - 13
ZHAO, H.; YANG, L.; BADDOUR, J.; ACHREJA, A.; BERNARD, V.; MOSS, T.; MARINI, J.C.; TUDAWE, T.; SEVIOUR, E.G.; SAN LUCAS, F.A. ET A, TUMOR MICROENVIRONMENT DERIVED EXOSOMES PLEIOTROPICALLY MODULATE CANCER C, 2016

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102198705B1 (ko) * 2019-08-22 2021-01-05 건국대학교 산학협력단 줄기세포의 증식 및 전능성 증진용 조성물
WO2021034168A1 (fr) * 2019-08-22 2021-02-25 건국대학교 산학협력단 Composition pour la prolifération de cellules souches et l'amélioration de la pluripotence
CN114560855A (zh) * 2021-03-26 2022-05-31 成都苑东生物制药股份有限公司 环烷基甲酰胺类衍生物、其制备方法及用途
CN114560855B (zh) * 2021-03-26 2023-05-23 成都苑东生物制药股份有限公司 环烷基甲酰胺类衍生物、其制备方法及用途
CN116212053A (zh) * 2023-04-14 2023-06-06 徐州医科大学 Eaat1/slc1a3抑制剂在制备治疗肝癌药物的应用
CN116212053B (zh) * 2023-04-14 2023-10-17 徐州医科大学 Eaat1/slc1a3抑制剂在制备治疗肝癌药物的应用

Similar Documents

Publication Publication Date Title
Duan et al. Desmoplasia suppression by metformin-mediated AMPK activation inhibits pancreatic cancer progression
Ma et al. Long noncoding RNA DANCR mediates cisplatin resistance in glioma cells via activating AXL/PI3K/Akt/NF-κB signaling pathway
Damen et al. Targeting dormant tumor cells to prevent cancer recurrence
Kabir et al. A microRNA‐7/growth arrest specific 6/TYRO3 axis regulates the growth and invasiveness of sorafenib‐resistant cells in human hepatocellular carcinoma
Ding et al. Klotho inhibits angiotensin II-induced cardiac hypertrophy, fibrosis, and dysfunction in mice through suppression of transforming growth factor-β1 signaling pathway
Fang et al. MicroRNA‐29b suppresses tumor angiogenesis, invasion, and metastasis by regulating matrix metalloproteinase 2 expression
KR101786905B1 (ko) 아포토시스 유도제
Dai et al. RhoGDI stability is regulated by SUMOylation and ubiquitination via the AT1 receptor and participates in Ang II-induced smooth muscle proliferation and vascular remodeling
Tu et al. MicroRNA-22 downregulation by atorvastatin in a mouse model of cardiac hypertrophy: a new mechanism for antihypertrophic intervention
JP6896420B2 (ja) 抗癌組成物
CN114525279A (zh) C/EBP α SARNA组合物和使用方法
Wang et al. Hippo kinases regulate cell junctions to inhibit tumor metastasis in response to oxidative stress
JP2021054841A (ja) Ｂｒａｆ遺伝子変異を有する細胞に対する細胞死誘導剤、当該細胞の増殖抑制剤及び当該細胞の増殖異常に起因する疾患の治療用医薬組成物
WO2019016310A1 (fr) Méthodes et compositions de traitement de cancers
KR20180039162A (ko) 간 질환 및 병태를 치료하기 위한 방법 및 조성물
Chen et al. Combination therapy with VEGFR2 and EGFR siRNA enhances the antitumor effect of cisplatin in non-small cell lung cancer xenografts
US10214743B2 (en) Colorectal cancer drug, and method for predicting prognosis of colorectal cancer patient
Mou et al. Macrophage‐targeted delivery of siRNA to silence Mecp2 gene expression attenuates pulmonary fibrosis
Qiu et al. Ghrelin attenuates transforming growth factor-β1-induced pulmonary fibrosis via the miR-125a-5p/Kruppel-like factor 13 axis
Zou et al. Wnt inhibitory factor 1 ameliorated diabetic retinopathy through the AMPK/mTOR pathway‐mediated mitochondrial function
Kimura-Tsuchiya et al. The inhibitory effect of heat treatment against epithelial-mesenchymal transition (EMT) in human pancreatic adenocarcinoma cell lines
EP2723350A1 (fr) Nouvelles utilisations des inhibiteurs de nanog et procédés s'y rapportant
He et al. Co-targeting of ACK1 and KIT triggers additive anti-proliferative and-migration effects in imatinib-resistant gastrointestinal stromal tumors
US9284557B2 (en) Double-stranded nucleic acid molecule, cancer cell proliferation inhibitor and pharmaceutical agent suitable for prevention or treatment of cancer
Ishizuka et al. Involvement of the receptor-associated prorenin system in the pathogenesis of human conjunctival lymphoma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18740239

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18740239

Country of ref document: EP

Kind code of ref document: A1