WO2019014359A2 - Transcription en chaîne par polymérase (pct) : synthèse exponentielle d'arn et d'arn modifié - Google Patents

Transcription en chaîne par polymérase (pct) : synthèse exponentielle d'arn et d'arn modifié Download PDF

Info

Publication number
WO2019014359A2
WO2019014359A2 PCT/US2018/041660 US2018041660W WO2019014359A2 WO 2019014359 A2 WO2019014359 A2 WO 2019014359A2 US 2018041660 W US2018041660 W US 2018041660W WO 2019014359 A2 WO2019014359 A2 WO 2019014359A2
Authority
WO
WIPO (PCT)
Prior art keywords
rna
modified
dna
template
pct
Prior art date
Application number
PCT/US2018/041660
Other languages
English (en)
Other versions
WO2019014359A3 (fr
Inventor
Floyd Romesberg
Tingjian CHEN
Original Assignee
The Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Scripps Research Institute filed Critical The Scripps Research Institute
Publication of WO2019014359A2 publication Critical patent/WO2019014359A2/fr
Publication of WO2019014359A3 publication Critical patent/WO2019014359A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised

Definitions

  • the present disclosure relates to methods and compositions for synthesis of RNA.
  • RNA oligonucleotides have wide ranging applications in biomedical research, biotechnology, and the pharmaceutical industry. Although RNA oligonucleotides are commercially available through chemical synthesis, they are 10- to 15-fold more expensive than the corresponding DNA oligonucleotides. Thus, RNA is usually produced from the inexpensive ribotriphosphates via in vitro transcription using the RNA polymerase from T7 bacteriophage (T7 RNAP). However, while the transcription of longer RNA can result in the production of up to -1000 transcripts per DNA template, shorter oligonucleotides are only inefficiently transcribed, resulting in the production of only -10 to 250 transcripts per template.
  • RNA with modified nucleotides for example 2'-F-modifications
  • 2'-F-modifications has attracted great interest due to its nuclease resistance, greater duplex stability, and unique and often better performance in in vivo applications (e.g. RNAi, CRISPR/Cas9-based genome editing).
  • RNAi CRISPR/Cas9-based genome editing
  • the chemical synthesis of 2'-F RNA is even more cost-prohibitive, with each base being -200 times more expensive than its DNA analog.
  • transcription is possible with 2'-F modified nucleotides, it is less efficient and generally limited to CTP and UTP analogs.
  • RNA RNA
  • the method makes two different types of RNA sequences per DNA template.
  • the sequence of the DNA template is palindromic.
  • two RNA sequences are transcribed simultaneously by using a non-palindromic DNA template sequence.
  • concentration of the DNA template in the reaction mixture is between 0.1 nM and 20 nM.
  • the RNA is generated in an exponential manner.
  • the ratio of the RNA product to the DNA template used is about 10 2 , 10 3 , 10 4 , 10 5 , or 10 6 times.
  • the method of generating a RNA comprises a method of transcribing RNA and/or a method of amplifying RNA.
  • the nucleotides are ribonucleotides, or modified ribonucleotides, or combinations thereof.
  • the thermocy ling step comprises multiple cycles of steps a.-c : (a) denaturating the reaction mixture by heating to about 90°C-95°C; (b) annealing the reaction mixture by cooling to about 35°C-50°C; and (c) transcribing the RNA sequence by heating to 45°C-55°C.
  • the RNA comprises modified RNA.
  • the RNA comprises 2'-modified RNA.
  • the RNA comprises 2'-F modified RNA.
  • the RNA product comprises a DNA-RNA chimera.
  • the DNA of the DNA-RNA chimera is removed by incubation with a DNase.
  • the either or both of the primers are 3 '-labeled with a ribonucleotide, which comprises phosphorylation modifications, attachment chemistry/linker modifications, biotinylation, fluorophores, dark quenchers, spacers, modified bases, phosphorothioate bonds modifications, and/or click chemistry modifications, to generate 5 '-labeled RNA/modified RNA products after DNase digestion of the PCT products.
  • a ribonucleotide which comprises phosphorylation modifications, attachment chemistry/linker modifications, biotinylation, fluorophores, dark quenchers, spacers, modified bases, phosphorothioate bonds modifications, and/or click chemistry modifications
  • RNA generated is a modified RNA.
  • the RNA generated is a 2 '-modified RNA.
  • the RNA generated is a 2'-F modified RNA.
  • the nucleotides are dNTPs, rNTPs, modified dNTPs, modified rNTPs, or combinations thereof.
  • the elevated temperature is between about 45°C-55°C.
  • the primer is 3 '-labeled with a ribonuleotide, which comprise phosphorylation modifications, attachment chemistry/linker modifications, biotinylation, fluorophores, dark quenchers, spacers, modified bases, phosphorothioate bonds modifications, and/or click chemistry modifications, to generate 5'-labled RNA/modified RNA products after DNase digestion of the transcription products.
  • Embodiments of the present disclosure further include a kit for transcribing, synthesizing, and/or amplifying a RNA sequence comprising: SFM4-3 polymerase; and ribonucleotides.
  • the kit further comprises dNTPs, modified dNTPs, modified rNTPs, or combinations thereof.
  • the modified dNTPs or rNTPs comprise phosphorylation modifications, attachment chemistry/linker modifications, biotinylation, fluorophores, dark quenchers, spacers, modified bases, phosphorothioate bonds modifications, and/or click chemistry modifications.
  • the ribonucleotides are isotopically labeled with 1 C, 15 N and/or D isotopes. In one embodiment, the ribonucleotides comprises a 2' modified nucleotide, and/or an isotopically labeled nucleotide. In one embodiment, the kit further comprises a buffer. In one embodiment, the buffer comprises MgC ⁇ , Triton X-100, BSA, and Taq DNA polymerase buffer. In one embodiment, the kit further comprises instructions for using the kit.
  • Embodiments of the present disclosure also include a kit comprising a thermostable mutant DNA polymerase for generating RNA; and instructions for use, and wherein the use comprise use of ribonucleotides as substrate for the polymerase to generate RNA.
  • Figure 1 depicts, in accordance with embodiments herein, SFM4-3 mediated RNA/2'-F-RNA synthesis and R/DNA PCR.
  • A RNA transcription by SFM4-3.
  • DNA template Tl (SEQ ID NO: l) (75 nt) was hybridized to a FAM-labeled DNA primer and transcribed by SFM4-3 or Sf.
  • B 2'-F-C,U-RNA transcription by SFM4-3.
  • DNA template Tl (SEQ ID NO: l) was hybridized to a FAM-labeled RNA primer and transcribed in the presence of ATP, 2'-F-CTP, GTP, and 2'-F-UTP by SFM4-3 or Sf.
  • C Transcription of DNA template T7Ter-T (SEQ ID NO:6) containing a T7 terminator under non-thermocycling (NT) or thermocycling (T) conditions.
  • D Fluorescence of DHFBI-1T bound to 1 ⁇ Broccoli aptamer produced by T7 RNA polymerase (Bro), or T7-terminator-Broccoli aptamer produced by SFM4-3 from 1 ⁇ primer (T7T-Bro).
  • E qPCR curves of RNA/DNA PCR performed with 20 nM or 2 nM template Tl (SEQ ID NO: l).
  • F R/DNA PCR products and digestion by NaOH. h, hybrid of biotinylated DNA template and R/DNA product; p, R/DNA PCR product; d, NaOH degradation product; SA, streptavidin.
  • FIG. 2 depicts, in accordance with embodiments herein, Polymerase Chain
  • PCT Transcription
  • A Illustration of exponential production of chimeric DNA-RNA product by PCT.
  • CI, C2, C3 cycle 1, 2, and 3.
  • B qPCR curves of RNA PCT (20 cycles) with different concentrations of template T2 (SEQ ID NO: 13) (0 nM-20 nM; Table 1) using DNA primers T2-F (SEQ ID NO: 14) and T2-R (SEQ ID NO: 15) (Table 1).
  • RNA PCT products obtained using various templates of n+m composition: T5, 25+18 mer (SEQ ID NO:22); T2, 18+18 mer (SEQ ID NO: 13); T3, 15+15 mer (SEQ ID NO: 16); or T4, 12+12 mer (SEQ ID NO: 19) using primers T2-F/T5-R (SEQ ID NO: 14, 23), T2-F/R (SEQ ID NO: 14-15), T3-F/R (SEQ ID NO: 17-18), or T4-F/R, respectively (Table 1).
  • M DNA ladder.
  • E Different length 2'-F-C,U-RNA PCT products obtained using the same template-primer combinations used in panel c. M: DNA ladder.
  • Figure 3 depicts, in accordance with embodiments herein, transcription of RNA and 2'-F-modified RNA with SFM4-3.
  • A RNA transcription fidelity test by primer extension. All transcription reactions were carried out with 500 nM primer/template, 1 ⁇ SFM4-3 enzyme, and 0.5 mM each rNTPs in l x standard Taq DNA polymerase buffer, and incubated at 50 °C for 12 h.
  • Figure 4 depicts, in accordance with embodiments herein, fidelity of RNA transcription-reverse transcription PCR.
  • A qPCR for integrated fidelity test of RNA transcription-reverse transcription-PCR. 1, SFM4-3 enzyme was excluded in transcription; 2, Superscript III reverse was excluded in reverse transcription; 3, both enzymes were excluded in transcription or reverse transcription, respectively; 4, both enzymes were included in transcription or reverse transcription, respectively.
  • B Gel assay of the PCR products for the integrated fidelity test of RNA transcription-reverse transcription-PCR (14 cycles of PCR).
  • C qPCR for integrated fidelity test of 2'-F-C,U-RNA transcription-reverse transcription- PCR. Conditions 1-4 are the same as in panel A.
  • D Gel assay of the PCR products for integrated fidelity test of 2'-F-C,U-RNA transcription-reverse transcription-PCR (15 cycles of PCR).
  • FIG. 5 depicts, in accordance with embodiments herein, RNA PCR, R/DNA PCR and symmetric PCT.
  • A RNA PCR with all four rNTPs. PCR was carried out with 20 nM template Biotin-Tl (SEQ ID NO:2), primers Tl-F (SEQ ID NO:8) and Tl-R (SEQ ID NO:3) (2 ⁇ each), 1 mM each rNTPs, 0.1 % Triton X-100, 0.1% BSA, 200 nM SFM4-3 enzyme, and 2 mM extra MgC ⁇ in 1 ⁇ standard Taq DNA polymerase buffer, and the following thermocy cling conditions: 94 °C for 2 min; cycled 15 x : 94 °C for 30 s, 49 °C for 1 min, 50 °C for 1 h; and final extension at 50 °C for 2 h.
  • RNA PCR product RNase A digestion of RNA PCR product. Purified RNA PCR product was incubated with RNase A at 37 °C for 2 h, and then incubated with streptavidin at 37 °C for 1 h and assayed with PAGE gel.
  • C R/DNA PCR with different combinations of dNTPs and rNTPs.
  • R/DNA PCR was carried out with 20 nM template Biotin-Tl (SEQ ID NO:2), primers Tl-F and Tl-R (2 ⁇ each), two dNTPs and two rNTPs (1 mM each), 0.1 % Triton X-100, 0.1% BSA, 200 nM SFM4-3 enzyme, and l x standard Taq DNA polymerase buffer supplemented with 2 mM MgC ⁇ , and the following thermocy cling conditions: 94 °C for 2 min; cycled 15 x : 94 °C for 30 s, 49 °C for 1 min, 50 °C for 1 h; final extension at 50 °C for 2 h.
  • Figure 6 depicts, in accordance with embodiments herein, RNA/2'-F-C,U-RNA PCT/qPCT test of various concentrations of template T5 (25+18 mer) (SEQ ID NO:22).
  • A RNA qPCT curves of 25+18 mer template T5 (SEQ ID NO:22) with various concentrations of template.
  • B RNA PCT product of 25+18 mer template T5 (SEQ ID NO:22) with various concentrations of template.
  • C 2'-F-C,U-RNA qPCT curves of 25+18 mer template T5 (SEQ ID NO:22) with various concentrations of template.
  • PCT/qPCT was carried out with a defined concentration of template, 400 nM SFM4-3 protein (200 nM for 2'-F-C,U-RNA PCT), rNTPs or 2'-F-NTPs (1 mM each), 2 mM extra MgCl 2 , 0.1 % Triton X-100, 0.01 % BSA, and l x SYBR green I in l x standard Taq DNA polymerase buffer, and with the following thermocycling program: initial denaturation of 94 °C for 30 s; 20 cycles of (94 °C, 15 s; 49 °C, 1 min; 50 °C, 1 h); final extension of 50 °C for 2 h.
  • Figure 7 depicts, in accordance with embodiments herein, RNA/2'-F-C,U-RNA PCT/qPCT test of various concentrations of template T3 (18+18 mer) (SEQ ID NO: 13).
  • A RNA PCT product of 18+18 mer template T2 (SEQ ID NO: 13) with various concentrations of template.
  • B 2'-F-C,U-RNA PCT product of 18+18 mer template T2 (SEQ ID NO: 13) with various concentrations of template.
  • C 2'-F-A,G-RNA qPCT curves of 18+18 mer template T2 (SEQ ID NO: 13) with various concentrations of template.
  • Figure 8 depicts, in accordance with embodiments herein, RNA/2'-F-C,U-RNA PCT/qPCT test of various concentrations of template T3 (15+15 mer) (SEQ ID NO: 16).
  • A RNA qPCT curves of 15+15 mer template T3 (SEQ ID NO: 16) with various concentrations of template.
  • B RNA PCT product of 15+15 mer template T3 (SEQ ID NO: 16) with various concentrations of template.
  • C 2'-F-C,U-RNA qPCT curves of 12+12 mer template T4 (SEQ ID NO: 19) with various concentrations of template.
  • Figure 9 depicts, in accordance with embodiments herein, RNA/2'-F-C,U-RNA
  • PCT/qPCT was carried out with defined concentration of template, 400 nM SFM4-3 protein, rNTPs or 2'-F-NTPs (1 mM each), 2 mM extra MgCl 2 , 0.1 % Triton X-100, 0.01 % BSA, and 1 ⁇ SYBR green I in 1 ⁇ standard Taq DNA polymerase buffer, and the following thermocy cling program: initial denaturation of 94 °C for 30 s; 15 cycles of (94 °C, 15 s; 35 °C, 1 min; 50 °C, 1 h); final extension of 50 °C for 2 h.
  • Figure 10 depicts, in accordance with embodiments herein, RNA/2'-F-C,U-RNA PCT/qPCT test of various concentrations of template T8 (50+18 mer) (SEQ ID NO:29).
  • A RNA qPCT curves of 50+18 mer template T8 (SEQ ID NO:29) with various concentrations of template.
  • B RNA PCT product of 50+18 mer template T8 (SEQ ID NO:29) with various concentrations of template.
  • C 2'-F-C,U-RNA qPCT curves of 50+18 mer template T8 (SEQ ID NO:29) with various concentrations of template.
  • Figure 11 depicts, in accordance with embodiments herein, a procedure of using PCT to produce RNA/modified RNA oligonucleotides.
  • Blue arrows indicate DNA template and primers; red and green arrows indicate different RNA products.
  • Figure 12 depicts, in accordance with embodiments herein, production of 5 '-labeled (modified) RNA.
  • A Procedure of using PCT to produce 5 '-labeled (modified) RNA. Blue arrows indicate DNA template and primers; red and green arrows indicate different RNA products.
  • B Gel assay of 5 '-labeled RNA generated via PCT.
  • Lane 1 3'-FAM-UTP-labeled DNA primer (19 mer) prepared by terminal transferase; lane 2: PCT product (44 bp) produced with 3'-FAM-UTP labeled primer; lane 3: 5 '-FAM-labeled-RNA (26 mer) produced by degrading the DNA moiety in PCT product with TurboDNase.
  • Figure 13 depicts, in accordance with embodiments herein, a procedure to rapidly separate/purify two different RNA/modified RNA molecules from PCT.
  • Blue arrows DNA
  • red arrows RNA/modified RNA or ribonucleotide incorporated to the 3 '-end of DNA primer
  • purple circles biotin
  • SA streptavidin beads.
  • nucleotide refers to any ribonucleotide triphosphate and deoxyribonucleotide triphosphate with any natural or modified base in that structure that occurs in polymerized form as a component of a nucleic acid.
  • rNTPs and “dNTPs” refer to a mixture of ribonucleotide triphosphates and deoxyribonucleotide triphosphates respectively consisting of at least two different ribonucleotide triphosphates or deoxyribonucleotide triphosphates.
  • NTP is used to refer to a nucleoside triphosphate without reference to its specific sugar (e.g. a ribonucleoside triphosphate (rNTP), a deoxyribonucleoside triphosphate (dNTP), or a modified rNTP or dNTP).
  • polynucleotide refers generally to linear polymers of natural or modified nucleotides, including deoxyribonucleotides, ribonucleotides, alpha-anomeric forms thereof, and the like, usually linked by phosphodiester bonds or analogs thereof ranging in size from a few monomeric units, e.g. 2-4, to several hundreds of monomelic units.
  • ATGCCTG a sequence of letters
  • modifications may be incorporated into a nucleotide or polynucleotide, and use of such modified nucleotide or polynucleotide is contemplated by this disclosure.
  • modifications include, but are not limited to, phosphorylation modifications, attachment chemistry /linker modifications (such as acrydite, adenylation, azide, digoxigenin, cholesteryl- TEG, I-Linker, amino modifiers, alkynes, biotinylation, and/or thiol modifications), fluorophores, dark quenchers, spacers, modified bases, phosphorothioate bonds modifications, and/or click chemistry modifications.
  • nucleotides and/or polynucleotides disclosed herein may also be modified isotopically, such as labeling with 1 C, 15 N and/or D isotopes.
  • compositions, methods, and reactions disclosed herein contemplate the use of modified, labeled, and/or unmodified nucleotides and/or polynucleotides.
  • RNA refers to a nucleic acid molecule comprising at least one ribose sugar as opposed to a deoxyribose sugar as found in DNA.
  • RNA refers to all species of RNA including messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA) as well as small RNA species that have regulatory function.
  • mRNA messenger RNA
  • rRNA ribosomal RNA
  • tRNA transfer RNA
  • RNA as used herein may also refer to modified RNAs as well as DNA/RNA hybrids.
  • primer refers to an oligonucleotide, synthetic or naturally occurring, which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a template strand when placed under conditions in which the synthesis of a complementary strand is catalyzed by a polymerase.
  • primers are composed of nucleic acids and/or ribonucleic acids and prime on DNA templates.
  • primers are composed of nucleic acids and prime on RNA templates.
  • primers are composed of nucleic acids and prime on DNA templates.
  • thermocycimg refers to the entire pattern of changing temperature most often used during an RT-PCR or PGR process. This process is common and well known in the art. See, for example, Sambrook supra; and U.S. Pat. No. 4,683,202 to Miillis et al. and U.S. Pat. No. 4,683,195 to Mullis et al.
  • thermocy cling includes an initial denaturing step at high temperature, followed by a repetitive series of temperature cycles designed to allow template denaturation, primer annealing, and extension of the annealed primers by a polymerase.
  • PCT polymerase chain transcription
  • RNAs were also capable of transcribing RNA and modified RNA.
  • SFM4-3 was also capable of transcribing RNA and modified RNA.
  • generation of RNA using the SFM4-3 polymerase solves many of the problems faced with conventional transcription using T7 RNAP.
  • using SFM4-3 as the polymerase results in more efficient transcription, especially for shorter RNAs comprising -10-250 transcripts; there are no sequence constraints, and allows for exponential production of RNAs, which is about 10 3 to 10 5 fold higher than conventional transcription with T7 RNAP.
  • the inventors found that the thermostability of SFM4-3 allows for the transcription of templates that are difficult or impossible to otherwise transcribe, as well as the PCR amplification of R/DNA, and via PCT, the exponential production of large quantities of RNA or 2'-F modified RNA oligonucleotides from small quantities of DNA templates.
  • Amplification levels with PCT were found to be 10 3 - to 10 5 - fold higher than those obtainable with conventional transcription (Table 4).
  • PCT reduces the challenges associated with template secondary structure and sequence biases, and it also facilitates 5 '-labeling.
  • PCT is more efficient and general than conventional transcription, which would make accessible any RNA or modified RNA oligonucleotide on a scale previously only accessible via chemical synthesis, but at a fraction of the cost.
  • a polymerase chain transcription (PCT) reaction for transcribing, synthesizing, and/or amplifying a RNA sequence
  • PCT polymerase chain transcription
  • the primer comprises a forward primer and a reverse primer.
  • the DNA template sequence is not a palindromic sequence.
  • two RNA sequences are transcribed simultaneously by using a non-palindromic DNA template sequence and two primers.
  • the polymerase is a thermophilic polymerase. In one embodiment, the polymerase is a variant of the Stoffel fragment of Taq DNA polymerase. In one embodiment, the polymerase is SFM4-3. In one embodiment, the thermocyling step comprises multiple cycles of steps a.-c: (a) denaturing the reaction mixture by heating to about 90 °C-95 °C; (b) annealing the reaction mixture by cooling to about 35 °C-50 °C; and (c) transcribing the RNA sequence by heating to 45 °C-55 °C.
  • the RNA sequence is transcribed at a temperature between 45 °C-46 °C, or 46 °C-47 °C, or 47 °C-48 °C, or 48 °C-49 °C, or 49 °C-50 °C, or 51 °C-52 °C, or 52 °C-53 °C, or 53 °C-54 °C, or 54 °C-55 °C.
  • the RNA sequence is a modified RNA sequence.
  • the RNA sequence is a 2'-modified RNA sequence.
  • the RNA sequence is a 2'-F modified RNA sequence.
  • An advantage of the PCT method is that it allows for the production of the RNA or the modified RNA at temperatures greater than 37 °C, where traditional transcription reactions are run.
  • the elevated temperatures are typically about 40-65 °C, such as, for example about 40-65 °C, or more preferably about 42-62 °C, or more preferably about 44-59 °C, or more preferably about 46-56 °C, or more preferably about 48-53 °C, and most preferably about 50 °C.
  • An advantage of PCT thermocy cling is that the transcription process may be converted to one that produces the RNA or modified RNA in an exponential process.
  • RNA sequence is a modified RNA sequence.
  • the RNA sequence is a 2' -modified RNA sequence.
  • the RNA sequence is a 2'-F modified RNA sequence.
  • the NTPs are dNTPs, rNTPs, and/or modified dNTPs or rNTPs.
  • a kit for transcribing, synthesizing, and/or amplifying a RNA sequence comprising: a polymerase; and nucleotides.
  • the nucleotides are dNTPs, rNTPs, and/or modified dNTPs or rNTPs.
  • the modified dNTPs or rNTPs comprise phosphorylation modifications, attachment chemistry/linker modifications, biotinylation, fluorophores, dark quenchers, spacers, modified bases, phosphorothioate bonds modifications, and/or click chemistry modifications.
  • the nucleotides are isotopically labeled with 1 C, 15 N and/or D isotopes.
  • the nucleotide comprises a 2' modified nucleotide, and/or an isotopically labeled nucleotide.
  • the polymerase is a variant of the Stoffel fragment of Taq DNA polymerase.
  • the polymerase is SFM4-3. The inventors have previously reported a Stoffel fragment of Taq polymerase (Sf) as an evolved and thermostable DNA polymerase.
  • a mutant of this polymerase having the mutations V518A, N583S, I614E, E615G, D655N, E681K, E742Q, and M747R has been named SFM4-3.
  • SFM4-3 See, Fa, M et al, Expanding the substrate repertoire of a DNA polymerase by directed evolution. J. Am. Chem. Soc. 2004; 126: 1748-1754, Chen, T et al, "Evolution of Thermophilic DNA Polymerases for the Recognition and Amplification of C2' -Modified DNA," Nat Chem.
  • the kit further comprises a buffer.
  • the buffer comprises MgC ⁇ , Triton X-100, BSA, and Taq DNA polymerase buffer.
  • Embodiments of the present disclosure also include a kit comprising a thermostable mutant DNA polymerase for generating RNA; and instructions for use, and wherein the use comprise use of ribonucleotides as substrate for the polymerase to generate RNA.
  • the kit is useful for practicing the inventive method of transcribing, synthesizing, and/or amplifying a polynucleotide sequence.
  • the kit is an assemblage of materials or components, including at least one of the inventive compositions.
  • the kit contains a composition including a polymerase, such as SFM4-3 and nucleotides, as described above.
  • the exact nature of the components configured in the inventive kit depends on its intended purpose. For example, some embodiments are configured for the purpose of producing a modified RNA.
  • the kit is configured particularly for the purpose of amplifying RNA at a level about 1000-fold more than conventional transcription reaction using T7 RNAP.
  • the kit is configured particularly for the purpose of genetic research, prognosing/diagnosing and/or treating a disease in a mammal, forensic science, and environmental biology.
  • the kit is configured for research purposes, such as identification of new drug targets, drug screening studies and the like.
  • Instructions for use may be included in the kit.
  • “Instructions for use” typically include a tangible expression describing the technique to be employed in using the components of the kit to effect a desired outcome, such as to amplify an oligonucleotide.
  • the kit also contains other useful components, such as, diluents, buffers, pharmaceutically acceptable carriers, syringes, catheters, applicators, pipetting or measuring tools, bandaging materials or other useful paraphernalia as will be readily recognized by those of skill in the art.
  • the materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility.
  • the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures.
  • the components are typically contained in suitable packaging material(s).
  • packaging material refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like.
  • the packaging material is constructed by well-known methods, preferably to provide a sterile, contaminant-free environment.
  • the packaging materials employed in the kit are those customarily utilized in the medical and bio- pharmaceutical field.
  • the term "package” refers to a suitable solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding the individual kit components.
  • the packaging material generally has an external label which indicates the contents and/or purpose of the kit and/or its components.
  • DNA template Tl (SEQ ID NO: 1) (75 nt) was hybridized to a FAM-labeled primer and transcribed by SFM4-3, which yielded full-length product which was virtually devoid of shorter oligonucleotides ( Figure 1A). As expected, under identical conditions wild type Sf produced no product.
  • T2-R SEQ ID NO: 15 5 ' -GCTCGTATGTTGTGTGGA
  • T8-R SEQ ID NO:30 5'- CTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGAT
  • thermostability of SFM4-3 was examined by transcribing the T7Ter- T template (SEQ ID NO:6), which contains a T7 RNAP terminator formed by a 7-nt palindrome that folds into a stem-loop structure followed by four uridines (Table 1) and which represents an efficient block to conventional transcription.
  • T7Ter- T template SEQ ID NO:6
  • Table 1 T7 RNAP terminator formed by a 7-nt palindrome that folds into a stem-loop structure followed by four uridines
  • the inventors examined the transcription of a DNA template that fuses the T7 terminator to the 3' end of DNA encoding the Broccoli aptamer (5' end in the transcript) (SEQ ID NO:39-40). (Table 1 and Figure 3C). The transcription product was incubated with TurboDNase and folded, and the fluorescence observed upon addition of the aptamer' s fluorophore, DFHBI- IT, was comparable to that observed with the same broccoli aptamer produced by conventional T7 RNAP transcription ( Figure ID). This demonstrates that SFM4-3 is able to transcribe through a T7 terminator and produce the functional aptamer.
  • each nicked strand acts as a primer for RNA synthesis using the intact strand as a template.
  • each nicked strand also binds to the complementary RNA sequence of the RNA-DNA chimera produced and primes additional transcription reactions.
  • this process referred to as polymerase chain transcription (PCT)
  • PCT polymerase chain transcription
  • the DNA- RNA chimeric product was exponentially produced with as little as 300 nM enzyme and 0.2 nM template, except with the 12+12 template (SEQ ID NO: 19), which required 2 nM template ( Figure 2B and Figures 6-9). Slight decreases in fluorescence were observed in the qPCT curves at long times, which is likely due to SYBR green I dye instability. Product was confirmed by PAGE ( Figure 2C and Figures 6-9) and the desired RNA oligonucleotide was easily obtained by incubation with TurboDNase ( Figures 2F and 11). In each case, faint additional bands are observed, which likely result from the addition of extra A nucleotides to the terminus, an activity present with SFM4-3's parental enzyme, Sf.
  • SFM4-3 is capable of the efficient transcription of RNA and 2'-F-RNA. While Holliger and coworkers have reported the selection of a mutant Tgo DNA polymerase that is capable of transcribing RNA, (See Cozens, C. et al, Proc. Natl. Acad. Sci. USA 2012, 109, 8067-8072), SFM4-3 represents the first example of thermophilic family- A DNA polymerase mutant that can efficiently transcribe RNA.
  • thermostability of SFM4-3 allows for the transcription of templates that are difficult or impossible to otherwise transcribe, as well as the PCR amplification of R/DNA, and via PCT, the exponential production of large quantities of RNA or 2'-F RNA oligonucleotides from small quantities of DNA templates.
  • Amplification levels with PCT are 10 3 - to 10 5 - fold higher than those obtainable with conventional transcription.
  • PCT reduces the challenges associated with template secondary structure and sequence biases, and it also facilitates 5 '-labeling.
  • PCT is more efficient and general than conventional transcription and should make accessible any RNA or modified RNA oligonucleotide on a scale previously only accessible via chemical synthesis, but at a fraction of the cost. While the fidelity of PCT is somewhat reduced relative to conventional transcription, it should be sufficient for many practical applications, especially to quickly and cheaply explore the activity of multiple oligonucleotides, with the best then prepared via chemical synthesis if higher fidelity is required. While, in some embodiment, the DNA of the DNA-RNA chimeras initially produced by PCT were removed, its presence may prove useful for different applications, including purification or as the 'sticky bridge' of oligonucleotide assemblies.
  • rNTPs Ribonucleoside triphosphates
  • dNTPs deoxyribonucleoside triphosphates
  • TdT terminal transferase
  • 2'-Fluoro-2'- deoxyribonucleoside triphosphates (2'-F-NTPs) were obtained from TriLink Biotechnologies (San Diego, CA).
  • Biotin-l l-UTP was obtained from Biotium (Fremont, CA).
  • 5-FAM-X-UTP was obtained from GeneCopoeia (Rockville, MD).
  • Zymo ssDNA/RNA purification kits were obtained from Zymo Research (Irvine, CA).
  • Qiaquick Nucleotide Removal Kit was obtained from Qiagen (Hilden, Germany). Centrifugal filtration was accomplished with Amicon devices obtained from EMD Millipore (Darmstadt, Germany). Thermocycling was accomplished with an MJ Research PTC-200 DNA Engine, or in the case of reactions containing SYBR green I, with a CFX Connect Real-Time PCR Detection System (Bio-Rad; Hercules, CA). Fluorescence was measured in a 96-well plate format with an EnVision 2103 Multilabel Reader (PerkinElmer).
  • the culture was then transferred to room temperature and grown with shaking overnight. Cells from the resulting culture were collected by centrifugation, and lysed by sonication. The cell lysate was incubated at 70 °C for 30 min to denature cellular proteins. The supernatant was then collected, and subjected to nickel affinity chromatography and ion exchange (DEAE) chromatography. The resulting purified protein was then dialyzed into 50 mM Tris-HCl (pH 8.5), 0.5 mM EDTA, concentrated with an Amicon Ultra Centrifugal Filter (MWCO 30 kDa), and stored at - 20 °C as a 50% glycerol solution.
  • MWCO 30 kDa Amicon Ultra Centrifugal Filter
  • FAM-labeled DNA primer FAM-T1-R was annealed to 2 ⁇ DNA template Tl (SEQ ID NO: l) in 2* standard Taq DNA polymerase buffer using the following thermocycling program: 95 °C, 5 min; 0.1 °C/s to 25 °C; incubate on ice, 5 min.
  • the annealed product 500 nM was then mixed with 1 ⁇ SFM4-3, and 0.5 mM each rNTPs or rNTPs with one or two replaced with their 2'-F-modified analogs in l x standard Taq DNA polymerase buffer.
  • the reaction was incubated at 50 °C for defined times (up to 12 h), or subjected to the following thermocycling transcription program: 3 x (50 °C, 3 h; 72 °C, 1 h); 50 °C, 3 h.
  • the reaction was then quenched by the addition of 2 volumes of quenching buffer (95% formamide, 18 mM EDTA, 0.025% SDS, xylene cyanol and bromophenol blue), and heated to 98 °C for 10 min.
  • the product was then analyzed on an 18% denaturing PAGE gel (supplemented with 8 M urea), and scanned with a Typhoon 9410 scanner (GE Amersham Molecular Dynamics).
  • thermocycling program was performed: 3 x (50 °C, 3 h; 72 °C, 1 h); 50 °C, 3 h.
  • 5 mL 10' TurboDNase buffer and 2.5 mL TurboDNase were added, and the resulting mixtures were incubated at 37 °C for 1 h to digest DNA primers and templates.
  • the RNA products were then purified with the Zymo ssDNA/RNA purification kit, and each product was eluted into 40 mL DNase/RNase free water.
  • a transcription template was prepared by PCR with T7T-Broccoli-T (SEQ ID NO:7) as the template and T7P-Bro-F (SEQ ID NO:39) and T7P-Bro-R (SEQ ID NO:40) as primers (Table 1).
  • the PCR product was purified by spin column (Zymo DNA purification kit), and subjected to transcription with T7 RNA polymerase according to the manufacturer's instructions.
  • the DNA template was then removed by incubating the product with TurboDNase, and the RNA transcript was purified by spin column (Zymo ssDNA/RNA purification kit).
  • RNA concentration was determined with a Qubit fiuorometer using the reagents and assay parameters for RNA.
  • a 10-mL aliquot of 5' binding buffer (100 mM HEPES, pH 7.5, supplemented with 750 mM NaCl, 30 mM KC1, and 10 mM MgCl 2 ) was then added to each RNA product (40 mL of 1.25 mM stock solution), and the RNA was folded by heating at 75 °C for 5 min, and rapidly cooling down on ice.
  • DHFBI-1T was added to a final concentration of 200 mM.
  • T-L The longer template T-L (SEQ ID NO:9) (90 nt, Table 1) was annealed to DNA primer PI, and subjected to a transcription reaction mediated with SFM4-3 as described above with rNTPs, or ATP, GTP, 2'-F-CTP and 2'-F-UTP.
  • the transcription products were then incubated with TurboDNase at 37 °C for 2 h to remove the DNA tem-plate and primer, and after adding 20 mM EDTA into the reaction, TurboDNase was inactivated by heating the reaction to 75 °C for 30 min.
  • RNA or 2'-F- RNA products were then purified with a Zymo ssDNA/RNA column, and annealed to reverse primer Tl-F in a solution containing dNTPs (1 mM each) by heating to 65 °C for 5 min, and rapidly cooling on ice.
  • the annealed products were then mixed with lx Superscript III buffer, 5 mM MgC ⁇ , 10 mM DTT, and Superscript III reverse transcriptase (1 mL for 20 mL reaction), and dNTP (0.5 mM each).
  • the reverse transcription reaction was incubated at 50 °C for 1-2 h.
  • SFM4-3, or Super-Script III, or both were not included in transcription or/and reverse transcription respectively.
  • the transcription-reverse transcription products were then analyzed by qPCR with Q5 Hot Start DNA polymerase, and the PCR products were analyzed by PAGE gel to confirm that the product is reverse transcribed from the transcription product mediated by SFM4-3.
  • the transcription-reverse transcription products were then amplified using Q5 Hot Start DNA polymerase with cloning primers Tl- CL-F (SEQ ID NO: 10) and Tl-CL-R (SEQ ID NO: 11) (Table 1).
  • the products were then purified, digested with EcoRI-HF and Hindlll-HF, purified again, inserted into digested vector pUC19, transformed into E. coli XLl-Blue cells, and plated onto LB plates supplemented with X-gal, IPTG, and ampicillin. Positive clones were picked for sequencing.
  • thermocycling program was performed for R/DNA (or RNA) PCR or qPCR: 94 °C, 2 min; 10-20 cycles of (94 °C, 30 s; 49 °C, 1 min; 50 °C, 1 h); 50 °C, 2 h.
  • the products were analyzed with a native PAGE gel.
  • Product fraction containing the biotin-labeled template was visualized by gel assay of PCR products (5-10 ⁇ ) that had been incubated with excess amount of streptavidin (2 of 1 mg/mL).
  • qPCT progress was monitored by tracking the fluorescence with a qPCR instrument (Bio-Rad), and all PCT products were assayed with PAGE.
  • concentration of the PCT product was measured with a Qubit fluorometer (Thermo Fisher Scientific) using the reagents and assay option for dsDNA.
  • Transcription of templates with T7 RNAP Transcription templates were prepared by annealing the oligonucleotides T7-25-F/T7-25-R (SEQ ID NO:31 -32), T7-18-F/T7-18-R (SEQ ID NO:33-34), T7-15-F/T7-15-R (SEQ ID NO:35-36), or T7-12-F/T7-12-R (SEQ ID NO:37-38) (Table 1), respectively, using the following thermocycling program: 95 °C, 5 min; 0.1 °C/s to 25 °C; incubate on ice, 5 min.
  • RNA polymerase Transcription with T7 RNA polymerase was then carried out according to the manufacturer's instructions with optimal template concentration (2 mM) for the longest recommended transcription time (16 h). DNA templates in the resulting transcription product were removed via incubation with TurboDNase. The concentrations of RNA products were then determined with a Qubit fluorometer (Thermo Fisher Scientific) using the reagents and assay parameters for RNA, and the ratio of RNA product and DNA template was calculated.
  • RNA from PCT product For analysis of the PCT product and demonstration of RNA generation with a small amount of PCT product, l x TurboDNase buffer and TurboDNase were added directly into the PCT reaction, and the mixture was incubated at 37 °C, the product was then directly analyzed with PAGE. For larger scale PCT, one biotinylated primer was used in the PCT reaction. The PCT product was incubated with magnetic streptavidin beads at 37 °C for 2 h.
  • the beads were then washed 3-6 times with BWBS buffer (10 mM Tris » HCl pH 7.4, 1 M NaCl, 0.1 % Tween20, 1 mM EDTA), and the RNA product was cleaved off the beads by incubating with TurboDNase at 37 °C for 2 h.
  • the product was then purified with Zymo ssDNA/RNA purification kit or Amicon centrifugal filter.
  • DNA primer T2-F was 3 '-labeled with 5-X-FAM-UTP or Biotin-l l-UTP by terminal transferase (TdT).
  • TdT terminal transferase
  • 20 ⁇ DNA primer T2-F was mixed with 100 ⁇ 5-X-FAM-UTP or Biotin-l l-UTP, 0.25 mM CoCl 2 , and 0.4 ⁇ ]/ ⁇ , terminal transferase (TdT) in l TdT buffer, and incubated at 37 °C overnight.
  • the labeled primer was then purified with the Qiaquick Nucleotide Removal Kit.
  • DNA primer was also 3 '-labeled with labeled ribonucleotides during solid-phase synthesis, for more efficient and homogeneous labeling.
  • the 3 '-labeled primer was then used to PCT amplify template T7 (SEQ ID NO:27) (Table 1), which contains an extra "A" in the n+1 site of the primer extension to pair with the 3 '-end labeled UTP using PCT conditions and program as described above.
  • the PCT product was then treated with TurboDNase to remove DNA in the PCT product.
  • the 5'-FAM-labeled RN A/modified RNA product was assayed with 15% PAGE gel, and imaged with the Typhoon 9410 scanner using FAM channel.
  • the 5'-Biotin-labeled RNA/modified RNA was then incubated with an excess amount of streptavidin (0.17 ⁇ g/ ⁇ L) at 37 °C for 1 h, and assayed with 10% PAGE gel.
  • Thrombin binding assay with 2'-F-RNA aptamer generated by PCT was subjected to PCT as described above. The PCT product was then treated with TurboDNase to degrade DNA, and then purified with the Zymo ssDNA/RNA purification kit.
  • the purified 2'-F-C,U- RNA was then folded in lx binding buffer (20 mM HEPES, pH 7.5, supplemented with 150 mM NaCl, 6 mM KC1, and 2 mM MgCl 2 ) by heating at 75 °C for 5 min, and rapidly cooling on ice.
  • the folded 2'-F-C,U-RNA was then incubated with 10 ⁇ human a-thrombin at room temperature for 2 h, and the binding product was analyzed with 8% native PAGE gel.
  • PCT Separation and purification of PCT products (Figure 13).
  • PCT was carried out as described above with one DNA primer labeled with 3 '-biotinylated rNTP (in this case, Biotin-l l-UTP) and one regular DNA primer.
  • the PCT product was then incu-bated with magnetic streptavidin CI beads at 37 °C for 2 h.
  • the beads were then washed 6 times with BWBS buffer (10 mM Tris » HCl pH 7.4, 1 M NaCl, 0.1 % Tween20, 1 mM EDTA), and resuspended in 1 ⁇ TurboDNase buffer and TurboDNase, and incubated at 37 °C for 2 h to degrade DNA and release the first RNA or modified RNA oligonucleotide which is not biotinylated.
  • the beads were washed 6 times with BWBS buffer.
  • To release the second RNA or modified RNA product, which is biotinylated the beads were suspended in 98% formamide supplemented with 10 mM EDTA (pH 8.0), and heated to 90 °C for 10 min.
  • the two RNA/modified RNA products were then analyzed by 18% denaturing PAGE gel containing 8 M urea.
  • an advantage of the present disclosure and methods is the exponential production of orders of magnitude more RNA or modified RNA than is available by conventional transcription.
  • the inventors have demonstrated the ability of PCT reaction to exponentially synthesize large quantities of RNA and 2'-F-modified RNA, and at a fraction of the cost of conventional synthesis.
  • other modifications, besides 2'-F may also be incorporated by the PCT reaction, and the disclosure herein is in no way limited to 2'-F-modified RNA.
  • PCT unlike conventional RNA transcription, PCT has no sequence constraints and it facilitates purification and 5 '-labeling.
  • SFM4-3 polymerase is thermostable, and thus the RNA/modified RNA synthesis can be carried out at a much higher temperature than that used in conventional transcription, which allows efficient melting of secondary structures in the template or product, thus allows for the transcription of templates that are difficult or impossible to otherwise transcribe, and will significantly decrease sequence bias of transcription.
  • Thermostability of SFM4-3 also allows the PCR amplification of R/DNA, and via PCT, the exponential production of large quantities of RNA or modified RNA from only the requisite triphosphates and from small quantities of a DNA template.
  • PCT is more efficient and general than conventional transcription and can produce large amounts of any RNA or modified RNA oligonucleotide at a fraction of the cost of chemical synthesis, and would be useful in quick and cheap exploration of the activity of multiple oligonucleotides.
  • the RNA/modified RNA products have no sequence limitation, and 5 '-end can be labeled with a desired tag. While the DNA of the DNA-RNA chimeras initially produced by PCT was removed in the PCT reaction, its presence might prove useful for different applications, including purification or as the 'sticky bridge' of oligonucleotide assemblies.
  • the PCT reaction is optimized for palindromic substrates.
  • the broad substrate tolerance of SFM4-3 indicating that modifications other than 2'-F are likely to be accommodated.
  • the thermophilic DNA polymerase mutant SFM4-3 is further evolved to increase the efficiency of synthesizing RNA or modified RNA, as well as for the ability to PCT amplify linger RNA or modified RNA.
  • PCT reaction conditions are also further optimized to further enhance yield and generality.
  • the numbers expressing quantities of ingredients, properties such as concentration, reaction conditions, temperatures, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term "about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values presented in some embodiments of the invention may contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés destinés à produire un ARN, consistant : à obtenir un mélange de réaction comprenant une matrice d'ADN, une amorce sens, une amorce antisens, une polymérase SFM4-3 et des ribonucléotides ; et à produire l'ARN par thermocyclage du mélange de réaction. L'invention concerne également des procédés destinés à produire un ARN ou un ARN modifié à une température élevée, consistant : à mettre en contact un mélange de réaction comprenant une matrice d'ADN, une amorce, une polymérase SFM4-3 et des ribonucléosides triphosphates ; et à produire l'ARN par incubation à la température élevée ou à soumettre le mélange de réaction à des cycles répétés de chauffage et de refroidissement. L'invention concerne également des kits servant à transcrire, synthétiser et/ou amplifier une séquence d'ARN comprenant : une polymérase ; et des ribonucléosides triphosphates.
PCT/US2018/041660 2017-07-12 2018-07-11 Transcription en chaîne par polymérase (pct) : synthèse exponentielle d'arn et d'arn modifié WO2019014359A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762531603P 2017-07-12 2017-07-12
US62/531,603 2017-07-12

Publications (2)

Publication Number Publication Date
WO2019014359A2 true WO2019014359A2 (fr) 2019-01-17
WO2019014359A3 WO2019014359A3 (fr) 2019-02-21

Family

ID=65001793

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/041660 WO2019014359A2 (fr) 2017-07-12 2018-07-11 Transcription en chaîne par polymérase (pct) : synthèse exponentielle d'arn et d'arn modifié

Country Status (1)

Country Link
WO (1) WO2019014359A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112813120A (zh) * 2020-12-31 2021-05-18 华南理工大学 一种使用dna聚合酶突变株高效合成5’标记rna的方法

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5916777A (en) * 1995-06-07 1999-06-29 Gen-Probe Incorporated Enzymatic synthesis of oligonucleotides using 3'-ribonucleotide primers
CZ293215B6 (cs) * 1996-08-06 2004-03-17 F. Hoffmann-La Roche Ag Rekombinantní tepelně stálá DNA polymeráza, způsob její přípravy a prostředek, který ji obsahuje
US20080242627A1 (en) * 2000-08-02 2008-10-02 University Of Southern California Novel rna interference methods using dna-rna duplex constructs
US6902914B2 (en) * 2001-09-28 2005-06-07 Sigma-Aldrich, Co. Recombinant DNA processes using a dNTP mixture containing modified nucleotides
EP1597388A4 (fr) * 2002-12-20 2006-06-07 Q Rna Inc Techniques et kits de preparation d'acides ribonucleiques double brin
FR2857013B1 (fr) * 2003-07-02 2005-09-30 Commissariat Energie Atomique Petits arn interferents specifiques des sous-unites alpha, alpha prime et beta de la proteine kinase ck2 et leurs applications
EP1796732B1 (fr) * 2004-10-01 2013-10-30 Novartis Vaccines and Diagnostics, Inc. Molecules de petits arn interferants modifiees et methodes d'utilisation de celles-ci
US20070048741A1 (en) * 2005-08-24 2007-03-01 Getts Robert C Methods and kits for sense RNA synthesis
GB2474225A (en) * 2009-07-21 2011-04-13 Biotec Pharmacon Asa DNase for decontamination of reverse transcription and amplification reactions

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112813120A (zh) * 2020-12-31 2021-05-18 华南理工大学 一种使用dna聚合酶突变株高效合成5’标记rna的方法

Also Published As

Publication number Publication date
WO2019014359A3 (fr) 2019-02-21

Similar Documents

Publication Publication Date Title
US11692213B2 (en) Compositions and methods for targeted depletion, enrichment, and partitioning of nucleic acids using CRISPR/Cas system proteins
Glökler et al. Isothermal amplifications–a comprehensive review on current methods
US10870848B2 (en) Methods for preparing a next generation sequencing (NGS) library from a ribonucleic acid (RNA) sample and compositions for practicing the same
US20220195415A1 (en) Nucleic Acid Constructs and Methods for Their Manufacture
US8039214B2 (en) Synthesis of tagged nucleic acids
EP1871897B1 (fr) Procédés de production d'oligonucléotides
JP6745599B2 (ja) 分子の作製
CN116732145A (zh) 闭合线性dna的生产
KR20160057470A (ko) Dna 단부 수복, 아데닐화, 인산화를 위한 효소 조성물
WO1997004131A1 (fr) Amplification d'epingles a cheveux de polynucleotide avec une seule amorce
US20120021460A1 (en) Materials and methods for isothermal nucleic acid amplification
JP2013524841A (ja) 一本鎖オーバーハングを有する二本鎖核酸を生成するための方法
CN113832216A (zh) 使用发卡寡核苷酸扩增核酸的方法
WO2019014359A2 (fr) Transcription en chaîne par polymérase (pct) : synthèse exponentielle d'arn et d'arn modifié
JP7333171B2 (ja) Ｒｎａ検出方法、ｒｎａ検出用核酸及びｒｎａ検出用キット
CN104955962B (zh) 核酸扩增方法
AU2022407332B2 (en) A method of capturing crispr endonuclease cleavage products
US20230122979A1 (en) Methods of sample normalization
Bian et al. Xeno Nucleic Acids as Functional Materials: From Biophysical Properties to Application

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18832568

Country of ref document: EP

Kind code of ref document: A2