WO2019004346A1 - Méthode de détermination de la gingivite et biomarqueur - Google Patents

Méthode de détermination de la gingivite et biomarqueur Download PDF

Info

Publication number
WO2019004346A1
WO2019004346A1 PCT/JP2018/024550 JP2018024550W WO2019004346A1 WO 2019004346 A1 WO2019004346 A1 WO 2019004346A1 JP 2018024550 W JP2018024550 W JP 2018024550W WO 2019004346 A1 WO2019004346 A1 WO 2019004346A1
Authority
WO
WIPO (PCT)
Prior art keywords
bacteria
abundance ratio
gingivitis
marker
risk
Prior art date
Application number
PCT/JP2018/024550
Other languages
English (en)
Japanese (ja)
Inventor
丸山　真達
Original Assignee
ライオン株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ライオン株式会社 filed Critical ライオン株式会社
Publication of WO2019004346A1 publication Critical patent/WO2019004346A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M1/00—Apparatus for enzymology or microbiology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a method and biomarker for determining the morbidity or risk of gingivitis.
  • Periodontal disease is roughly classified into gingivitis in which inflammation is localized to the gums (gum) and periodontitis in which inflammation progresses from gum to alveolar bone to form a periodontal pocket.
  • Periodontal disease is also generally referred to as lifestyle-related disease, and it is mainly in adults and later that progress to periodontitis.
  • gingivitis it is known that even young people suffer from gingivitis. Therefore, it is important to accurately know the condition of the gum from a young age and to educate the practice and lifestyle of oral hygiene that does not progress to periodontitis.
  • Probing using a dental probe is common as a test for periodontal disease.
  • Probing is a method of examining the condition of gum by measuring the presence or absence of bleeding from gum and the depth of periodontal pocket by a probe.
  • probing by probing involves psychological anxiety because the thin tip of the tip is inserted between the gums and the teeth.
  • examination by probing is essential for examination by a dentist or a dental hygienist, and since it takes time for examination, it is unsuitable for screening of a patient suffering from periodontal disease by mass examination. Therefore, a method that can easily evaluate the condition of the gum is desired.
  • saliva can be collected easily without being invasive to the collection. Therefore, it is noted that saliva can be used as a method for measuring pathogen ratio in blood, occult blood, biomarkers such as cytokines and alkaline phosphatase, and the like.
  • Patent Document 1 discloses a method of simultaneously measuring the risk of periodontal disease and the risk of dental caries.
  • Periodontal disease is a multimicrobial infection, and the presence of pathogens does not necessarily lead to the onset of periodontal disease. Therefore, it is considered that it is insufficient to estimate the condition of the gum by measuring the pathogen ratio alone.
  • Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Aggregatibacter actinomycetemcomitans, Prevotella intermedia, Fusobacterium nucleatum etc. are known as causative bacteria of periodontal disease, but these causative bacteria are mainly causative bacteria of periodontitis, It is not necessarily the cause of gingivitis.
  • An object of the present invention is to provide a method which can be used for mass screening and can easily determine the morbidity or risk of gingivitis.
  • the present inventors find out that said subject can be solved by measuring the abundance ratio or quantity of the predetermined
  • the present inventor provides the following [1] to [17].
  • [1] A method of measuring the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a subject to determine the morbidity or risk of gingivitis, wherein the marker bacteria is a bacterium belonging to the genus Russia , TM7 spp.
  • the abundance ratio of the above-mentioned Russian bacteria is 7% or less, the abundance ratio of the above TM7 bacteria is 0.2% or more, the abundance ratio of the above Eubacterium bacteria is 0.1% or more,
  • the abundance ratio of umium bacteria is 0.05% or more, the abundance ratio of the paraprebotella bacteria is 0.03% or more, the abundance ratio of the megasphaera bacteria is 0.03% or more, and the abundance ratio of the atopobium bacteria is 0 .5% or more
  • the abundance ratio of the Alloprebotella bacteria is 0.1% or more, the abundance ratio of the Cardiobacterium bacteria is 0.03% or more, and the abundance ratio of the Diarister bacteria is 0.03% At least one of the above.
  • [5] A method of measuring the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a subject to determine the morbidity or risk of gingivitis, wherein said marker bacteria is a bacterium belonging to the genus Russia , TM7 bacteria, Eubacteria, Sorobacter bacteria, Paraprebotella bacteria, Megapfaella bacteria, Atopovium bacteria, Alloprebotella bacteria, Cardiobacterium bacteria, Dialister bacteria, Campylobacter bacteria, Actinos A method which is a combination of two or more selected from the group consisting of Myces bacteria, Fusobacterium bacteria, Bayonella bacteria, Corynebacterium bacteria, and Ternerella bacteria.
  • the amount of the bacteria of the genus Russia is small compared to the proportion or amount of marker bacteria to total bacteria in a biological sample collected from a healthy subject, or the TM7 bacterium, the eubacteria bacterium, the solo Bacteria, said paraprevotella bacteria, said Megagasphaella bacteria, said atopobium bacteria, said alloprevotella bacteria, said cardiobacterium bacteria, said dialyster bacteria, said campylobacter bacteria, said actinomyces bacteria.
  • the method according to the above [5] wherein it is determined that the incidence of gingivitis or the risk thereof is high when there is a large amount of the Fusobacterium bacteria, the Bayyonella bacteria, the Corynebacterium bacteria, or the Tanerella bacteria.
  • the marker bacteria are the bacteria of the genus Russia, the bacterium of the genus Sorbobacterium, the bacterium of the genus Bacillus bacteria, the bacterium of the genus Tanerella, the bacterium of the genus Paraprebotella, the bacterium of the genus Campylobacter, the bacterium of the genus TM7, It is a combination of two or more species selected from the group consisting of Atopobium bacteria, and when there are four or more marker bacteria that satisfy the abundance ratio defined in the condition (2), the incidence of gingivitis or the risk thereof is high.
  • the method according to the above [7], which determines [9] The method according to any one of the above [1] to [8], wherein the biological sample is a sample collected from the oral cavity. [10] The method according to [9] above, wherein the sample is saliva, plaque, tartar, tongue or gum exudate. [11] The method according to any one of the above [1] to [10], wherein the subject is a minor.
  • a biomarker for determining gingivitis or risk of gingivitis in a subject which is a bacterium belonging to the genus Russia, TM7 bacteria, Eubacterium bacteria, Sorobacterium bacteria, Paraprebotella bacteria, Megasphaella bacteria, Atopobium
  • a biomarker comprising at least one marker bacterium selected from the group consisting of bacteria, Alloprebotella bacteria, Cardiobacterium bacteria, and Diaristor bacteria, or a component derived from the marker bacteria.
  • a biomarker for determining gingivitis or risk of gingivitis in a subject which comprises a genus of bacteria of the genus Russia, TM7 bacteria, Eubacterium bacteria, Sorobacterium bacteria, Paraprebotella bacteria, Megasphaella bacteria, Atopobium From the group consisting of bacteria, Arroprevella bacteria, Cardiobacterium bacteria, Dialister bacteria, Campylobacter bacteria, Actinomyces bacteria, Fusobacterium bacteria, Fusobacterium bacteria, Bayonella bacteria, Corynebacterium bacteria, and Ternerella bacteria
  • a marker bacterium which is a combination of two or more selected, or a biomarker comprising a component derived from the marker bacterium.
  • a detection kit comprising one or more selected from the group consisting of two or more primer pairs, a probe, and a microarray on which the probe is immobilized, which can detect the 16S rRNA gene of two or more marker bacteria.
  • the "sensitivity” refers to a ratio in which a gingivitis patient is determined to have gingivitis by dental diagnosis.
  • specificity refers to a ratio that determines a healthy person by dentist diagnosis as non-gingivitis.
  • the “bacterial abundance ratio” refers to the abundance ratio (number basis number / number) of bacteria to be evaluated relative to all bacteria contained in a biological sample.
  • the method of the present invention is a method of measuring the abundance ratio or amount of marker bacteria in a biological sample collected from a subject for determining the morbidity or risk of gingivitis.
  • the method of the present invention also measures the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a subject, and the ratio or amount of marker bacteria to total bacteria in a biological sample collected from a healthy subject It is also a method of determining the morbidity or risk of gingivitis in comparison with
  • the method of the present invention can be used as a method for determining the morbidity or risk of gingivitis which a dentist or dental hygienist performs prior to examination by probing using a dental probe.
  • a dentist or a dental hygienist performs a subsequent examination by probing for a subject determined to have gingivitis, thereby shortening the time required for screening of periodontitis patients in mass screening It can.
  • psychological anxiety can be alleviated.
  • the subject is not gender-distinct, and may be either a minor or an adult. However, as the progress of periodontal disease, it is preferable to target minors who usually have gingivitis and do not progress to periodontitis.
  • a minor is usually a person under the age of 20 and a person under the age of 20 is usually a person over the age of 20.
  • the biological sample is preferably a sample collected from the oral cavity, more preferably saliva, plaque, tartar, tongue or gum exudate, and even more preferably saliva.
  • the saliva includes non-stimulatory saliva and stimulating saliva, either of which may be used. However, non-stimulating saliva is preferred in view of performing a mass examination.
  • non-stimulated saliva for example, there is a method of collecting saliva as it is, a method of containing distilled water or the like in the mouth, lightly rinsing, and collecting it as a discharge liquid containing saliva.
  • a method of collecting stimulated saliva for example, there is a method of promoting secretion of saliva by collecting paraffin gum or the like to collect it. After taking a biological sample, if it is not used immediately for analysis, it needs to be stored at low temperature (eg, ice temperature). If left at room temperature, bacteria grow and it becomes impossible to analyze the proportion and amount of bacteria correctly.
  • the abundance ratio or amount of marker bacteria to total bacteria in a biological sample can be relatively determined using the abundance ratio or amount of components specific to each bacterium.
  • the specific component is not particularly limited, and examples thereof include genes, proteins and peptides, with genes being preferred.
  • Examples of the gene include DNA and RNA, DNA is preferable, and ribosomal RNA (rRNA) gene is more preferable.
  • rRNA 16SrRNA, 5SrRNA, 26SrRNA is mentioned, for example.
  • rRNA is a small subunit of ribosome, this ribosome is a vital organ for protein synthesis, so it is resistant to evolutionary mutation and has a gene sequence common to all bacteria.
  • rRNA also contains a sequence more specific to bacteria, not only the total number of bacteria but also bacteria-specific quantification and identification of bacterial species can be performed by using the 16S rRNA gene. Sequence information of the 16S rRNA gene of each marker bacterium can be obtained from public databases such as DDBJ, NCBI, and Ribosomal Database Project.
  • the number of marker bacteria in the biological sample and the number of total bacteria is more specific than 16 S rRNA genes Measurement by quantitative PCR of a region (target region) including a dynamic region (V1 to V9 region, preferably V1 or V2 region), or using a gene amplification product of the target region (preferably V1 or V2 region), There are a method of analyzing and measuring by a microarray and a next-generation sequencer, and a method of hybridizing a probe to 16S rRNA specific to each marker bacteria and measuring the amount thereof.
  • any primer designed from a conserved region of 16S rRNA for example, a primer set comprising a combination of a primer having the base sequence of SEQ ID NO: 1 and a primer having the base sequence of SEQ ID NO: 2
  • a method of analyzing and measuring a gene amplification product of a region including a target region (for example, V1, V2 region) with a next-generation sequencer is preferable.
  • the method of extracting DNA is not particularly limited, and may be a chemical or biochemical lysis method or a method of physically disrupting the cell wall, or a combination thereof.
  • saliva is collected as a spouted liquid which has been rinsed for about 10 seconds with 3 mL of distilled water.
  • the collected saliva is immediately ice-cooled.
  • bacteria contained in saliva are centrifuged at 10000 G for 10 minutes and collected as a centrifugal sedimentation.
  • Bacterial DNA is extracted from the collected bacteria using a DNA extraction kit (next tec 1- Step DNA Isolation Kit for Bacteria, manufactured by Toho).
  • the collected DNA is stored at -80.degree. C. as required.
  • the sequence of the amplified gene was analyzed targeting the V1 to V2 region of the 16S ribosomal DNA of the extracted bacterial DNA, and the sequence of 3000 bacterial DNAs was analyzed. Can be analyzed to identify the type of bacteria, and the abundance ratio can be determined.
  • marker bacteria that can be used as biomarkers of gingivitis are: Russia bacteria, TM7 bacteria, Eubacterium bacteria, Sorobacterium bacteria, Paraprebotella bacteria, Megasphaella bacteria, Atopovium bacteria, Alloprebotella bacteria And at least one member selected from the group consisting of Cardiobacterium bacteria, and Diarister bacteria.
  • the method of the present invention measures the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a subject, and compares it to the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a healthy subject.
  • the genus TM7 bacteria bacteria of the genus Eubacterium, bacteria of the genus Sorobacterium, bacteria of the genus Paraprebotella, bacteria of the genus Megasphaella, bacteria of the genus Atopovium, bacteria of the genus Alloprebotella, bacteria of the genus Cardiobacterium, or It can be determined that the incidence of gingivitis or the risk thereof is high when there is a large amount of Dialister bacteria.
  • these markers bacteria show a significant difference in the existence ratio between the subject recognized as a healthy person and the subject recognized as gingivitis positive by the method of the Example mentioned later. .
  • the method of the present invention can be used as a method for determining the morbidity or risk of gingivitis, it is preferable to reduce the oversight of a subject who falls under gingivitis. Therefore, at least one marker selected from the group consisting of Russian bacteria, Sorobacterium bacteria, Cardiobacterium bacteria, and Paraprevotera bacteria, whose sensitivity values are found to be high in Examples described later, is a marker. It is preferable to use as bacteria.
  • the above marker bacteria are used as a biomarker for gingivitis, for example, it can be determined that the incidence of gingivitis or the risk thereof is high as follows. First, the abundance ratio of marker bacteria to all bacteria (individuals / individual, the same applies hereinafter) is measured. Next, the threshold value set for each marker bacterium is compared with the measured ratio of marker bacteria. Then, when the measured presence ratio of marker bacteria satisfies the condition below or above the threshold value set for each marker bacteria, it is determined as “positive”. Finally, depending on the number of marker bacteria that became positive, it can be determined that the morbidity or risk of gingivitis is high. In addition, the number of marker bacteria which corresponded to positive can be arbitrarily changed according to sensitivity or specificity.
  • the threshold of the abundance ratio of marker bacteria set for each marker bacterium is, for example, the abundance ratio of marker bacteria of a healthy person who has been measured in advance (for example, a person who is previously confirmed to be a non-gingivitis patient) Alternatively, it can be specified by amount (normal control). More specifically, examples of the range of the threshold include the following condition (1A).
  • the threshold value of the abundance ratio is set in the following range; the abundance ratio of Russian bacteria is 6-8%, the abundance ratio of TM7 bacteria is 0.15-0.35%, Eubacteria Of 0.05% to 0.2%, the proportion of Sorobacterium bacteria of 0.03 to 0.1%, the proportion of Paraprevotera bacteria of 0.03 to 0.1%, Megasphaella bacteria Of 0.03 to 0.1% of Atopobium bacteria, 0.3 to 0.9% of Atopovium bacteria, 0.05 to 0.4% of Alloprevotela bacteria, Cardiobacteria
  • the abundance ratio of bacteria is 0.01 to 0.1%, and the abundance ratio of Diarister bacteria is 0.01 to 0.1%.
  • the range of the threshold is outside the range of the condition (1A)
  • the sensitivity and specificity may be lowered, which may affect the reliability of the test.
  • the marker bacteria for the bacteria belonging to the genus Russia, the case of presence ratio below the threshold is determined as “positive”, and for the other bacteria, the case of presence ratio above the threshold is determined as “positive”.
  • the control may be a gingivitis person instead of a healthy person (a gingivitis person control). In that case, positive and negative criteria will be exchanged.
  • the abundance ratio of Russian bacteria is 7% or less, the abundance ratio of TM7 microbes is 0.2% or greater, and the abundance ratio of Eubacteria is 0.1%
  • the abundance ratio of Sorobacter bacteria is 0.05% or more
  • the abundance ratio of Paraprebotella bacteria is 0.03% or more
  • the abundance ratio of Megasphaella bacteria is 0.03% or more
  • the abundance ratio of Atopovium bacteria is 0.5% or more
  • the abundance ratio of Aloprevolate bacteria is 0.1% or more
  • the abundance ratio of Cardiobacterium bacteria is 0.03% or more
  • the abundance ratio of Diarister bacteria is 0.03% or more
  • the number of marker bacteria corresponding to positive may be at least one, and may be set to determine gingivitis when two or more, three or more, four or more, and the like.
  • the method of the present invention can be used as a method for determining the morbidity or risk of gingivitis, it is preferable to reduce oversight of a subject who falls under gingivitis. Therefore, it is preferable to set the number of marker bacteria corresponding to positive so that the sensitivity value can be increased.
  • marker bacteria that can be used as biomarkers of gingivitis are: Russia bacteria, TM7 bacteria, Eubacterium bacteria, Sorobacterium bacteria, Paraprebotella bacteria, Megasphaella bacteria, Atopovium bacteria, Alloprevotera Selected from the group consisting of genus bacteria, cardiobacteria, dialister bacteria, campylobacter bacteria, actinomyces bacteria, fusobacterium bacteria, baionella bacteria, corynebacterium bacteria, and ternerella bacteria It is a combination of two or more.
  • the method of the present invention measures the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a subject, and compares it to the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a healthy subject.
  • TM7 bacteria Eurobacterium bacteria, Sorobacterium bacteria, Paraprebotella bacteria, Megfafaella bacteria, Atopovium bacteria, Alloprebotella bacteria, Cardiobacterium bacteria.
  • Alisteria bacteria Campylobacter bacteria, Actinomyces bacteria, Fusobacterium bacteria, Bayonella bacteria, Corynebacterium bacteria, or Tanerella bacteria, it can be determined that the disease or risk of gingivitis is high. .
  • marker bacteria may include marker bacteria as defined in one example.
  • other examples may include, as marker bacteria, Campylobacter bacteria, Actinomyces bacteria, Fusobacterium bacteria, Bayonella bacteria, Corynebacterium bacteria, and Ternerella bacteria, and two or more of them must It is different to judge by the combination of marker bacteria.
  • the marker bacteria of the other example as a biomarker of gingivitis, for example, it can be determined that the morbidity or risk of gingivitis is high as follows. First, the abundance ratio of marker bacteria to total bacteria is measured. Next, the threshold value set for each marker bacterium is compared with the measured ratio of marker bacteria. Then, when the measured presence ratio of marker bacteria satisfies the condition below or above the threshold value set for each marker bacteria, it is determined as “positive”. Finally, depending on the number of marker bacteria that became positive, it can be determined that the morbidity or risk of gingivitis is high. In addition, the number of marker bacteria which corresponded to positive can be arbitrarily changed according to sensitivity or specificity.
  • the threshold value set for each marker bacterium is, for example, the abundance ratio or amount of marker bacteria of a healthy person (for example, a person who is previously confirmed to be a non-gingivitis patient) (healthy person control) Can be identified by More specifically, the range of the threshold includes, for example, the following condition (2A).
  • the threshold value of the abundance ratio is set in the following range; the abundance ratio of Russian bacteria is 6-8%, the abundance ratio of TM7 bacteria is 0.15-0.35%, Eubacteria Of 0.05% to 0.2%, the proportion of Sorobacterium bacteria of 0.03 to 0.1%, the proportion of Paraprevotera bacteria of 0.03 to 0.1%, Megasphaella bacteria Of 0.03 to 0.1% of Atopobium bacteria, 0.3 to 0.9% of Atopovium bacteria, 0.05 to 0.4% of Alloprevotela bacteria, Cardiobacteria Probability of 0.01 to 0.1% of bacteria, Proportion of 0.01 to 0.1% of Diarister bacteria, 0.2 to 0.4% of Campylobacter bacteria, Actinomyces 2 to 4% of the bacteria belonging to the genus
  • the abundance ratio is 2-3%, the abundance ratio of Bayyonella bacteria is 1.5-3%, the abundance ratio of Corynebacterium bacteria is 0.2-0.5%, and the abundance ratio of Ternerella bacteria is 0.
  • the range of the threshold is out of the range of the condition (2A), the sensitivity and specificity may be low, which may affect the reliability of the test.
  • the marker bacteria for the bacteria belonging to the genus Russia, the case of presence ratio below the threshold is determined as “positive”, and for the other bacteria, the case of presence ratio above the threshold is determined as “positive”.
  • the control may be a gingivitis patient instead of a healthy person (gum inflammation patient control). In that case, positive and negative criteria will be exchanged.
  • the abundance ratio of Russian bacteria is 7% or less, the abundance ratio of TM7 microbes is 0.2% or greater, and the abundance ratio of Eubacteria is 0.1%
  • the abundance ratio of Sorobacter bacteria is 0.05% or more
  • the abundance ratio of Paraprebotella bacteria is 0.03% or more
  • the abundance ratio of Megasphaella bacteria is 0.03% or more
  • the abundance ratio of Atopovium bacteria is 0.5% or more
  • the abundance ratio of Alloprebotella bacteria is 0.1% or more
  • the abundance ratio of Cardiobacterium bacteria is 0.03% or more
  • the abundance ratio of Diarister bacteria is 0.03% or more
  • Campylobacter Existence ratio of genus bacteria is 0.25% or more
  • Existence ratio of Actinomyces bacteria is 2.5% or more
  • Existence ratio of Fusobacterium bacteria is 2.5% or more
  • Bayionella genus bacteria Abundance ratio is 2.25% or more
  • the number of marker bacteria corresponding to positive may be at least two, and may be set to determine gingivitis when three or more, four or more, five or more, and the like.
  • the method of the present invention can be used as a method for determining the morbidity or risk of gingivitis, it is preferable to reduce oversight of a subject who falls under gingivitis. Therefore, it is preferable to set the number of marker bacteria corresponding to positive so that the sensitivity value can be increased.
  • the biomarker of the present invention is a marker bacterium or a component derived therefrom, which is used for determining the morbidity or risk of gingivitis in a subject. By measuring the abundance ratio or amount of the biomarker of the present invention in a biological sample collected from a subject, it is possible to determine the subject's gingivitis or its risk. [1. Methods] are preferably used. For example, DNA specific to each bacterium is extracted, and rRNA gene is analyzed, and artificial manipulation is added to measure the identification of bacteria and the abundance ratio or amount of bacteria in a biological sample.
  • the biomarker of the present invention may be used as an indicator for determining gingivitis as compared with the abundance ratio or amount of marker bacteria to total bacteria in a biological sample collected from a healthy subject, using the measurement results. It was found. Also, the subject may be a subject having gingivitis or a risk of developing it.
  • biomarker is a bacterium belonging to the genus Russia, TM7 bacteria, bacteria belonging to the genus Eubacterium, bacteria belonging to the genus Sorobacterium, bacteria belonging to the genus Parabrevotera, bacteria belonging to the genus Megasphaella, bacteria belonging to the genus Atopovium, bacteria belonging to the genus Alloprebotella, bacteria belonging to the genus Cardiobacterium And at least one marker bacterium selected from the group consisting of Diarister bacteria, or a component derived therefrom.
  • biomarkers include Russian bacteria, TM7 bacteria, Eurobacterium bacteria, Sorobacterium bacteria, Paraprebotella bacteria, Megasphaella bacteria, Atopovium bacteria, Alloprebotella bacteria, Cardiobacterium
  • a marker that is a combination of two or more species selected from the group consisting of bacteria, Dialister bacteria, Campylobacter bacteria, Actinomyces bacteria, Fusobacterium bacteria, Bayonella bacteria, Corynebacterium bacteria, and Ternerella bacteria Contains bacteria, or components derived from it. The details of each bacterium are described below.
  • TM7 bacteria are not isolated and cultured, but are species classified on the basis of gene sequences, and examples thereof include TM7 oral taxon 351, TM7 oral taxon 352, and the like.
  • Eubacterium bacteria examples include Eubacterium infilumum, Eubacterium brachi, Eubacterium safenum, Eubacterium juliui, Eubacterium proutei, Eubacterium desmorans, and Eubacterium rectorale. .
  • Solobacterium (Solobacterium) bacteria
  • Examples of the species of the bacteria belonging to the genus Sorcobacterium include Sorbobacterium muley.
  • Paraprevotella bacteria examples of species of Paraprebotella bacteria include Paraprevotera clara, Paraprevotera xylaniphila.
  • Megasphaella bacteria examples include Megasphaella cerevisae, Megasfaela elsdenii, Megasfaera micronusiformis, Megasfaela suesiensis, Megasfaera pavis bolanus.
  • Atopobium bacteria examples of the species of Atopobium bacteria include, for example, Atopobium parvum, Atopobium limae, and Atopobium vaginae.
  • Alloprevotella bacteria As species of Alloprevella spp. Bacteria, for example, alloprevella teraneae, Alloprevella araba are mentioned.
  • Cardiobacterium (Cardiobacterium) bacteria)
  • examples of the species of Cardiobacterium bacteria include, for example, Cardiobacterium hominis.
  • diaryster bacteria examples include, for example, Diarister Invisus and Diarister pneumocinsus.
  • Campylobacter bacteria examples include Campylobacter rectus, Campylobacter gracillas, Campylobacter consiss, Campylobacter shoae, Campylobacter jejuni, Campylobacter coli, Campylobacter fetus.
  • Actinomyces bacteria examples include Actinomyces naeslandy, Actinomyces viscosus, Actinomyces odontriticus, Actinomyces oris.
  • Fusobacterium genus bacteria examples include, for example, Fusobacterium periodon ticum, Fusobacterium nucleatum, and Fusobacterium lusii.
  • Bacillus spp. Bacteria include Bacillus sp. Bayonera atipica, bay yonella parvula, bay yonella alcareces, and bay yonella dispar.
  • Corynebacterium genus bacteria examples include, for example, Corynebacterium matrichoti, Corynebacterium durum, Corynebacterium argentatinus, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium carnae And Corynebacterium glutamicum, Corynebacterium melasecola, Corynebacterium ammoniagenes, and Corynebacterium efficiens.
  • Ternerella bacteria examples of the species of the genus Ternerella bacteria include, but are not limited to, Tanerella Forsythia, and Tanerella Forsytensis.
  • the component derived from the marker bacterium is a component specific to each marker bacterium, and may be a component capable of measuring the type, presence ratio, and amount of the marker bacterium from the amount thereof, for example, nucleic acid (eg, DNA or RNA), proteins, peptides, DNA is preferred, and ribosomal RNA (rRNA) gene is more preferred.
  • nucleic acid eg, DNA or RNA
  • proteins e.g., proteins, peptides, DNA
  • rRNA ribosomal RNA
  • rRNA ribosomal RNA
  • 16SrRNA, 5SrRNA, 26SrRNA etc. are mentioned, for example.
  • the 16S rRNA gene is preferable, at least one of the V1 to V9 regions of the 16S rRNA gene is more preferable, and either or both of the V1 and V2 regions are more preferable because analysis is easy.
  • the detection kit is a group consisting of a primer pair, a probe, and a microarray on which the probe is immobilized, which can detect 16S rRNA of each marker bacterium which is a biomarker for disease or risk judgment of gingivitis.
  • a kit or means comprising one or more selected.
  • the primer pair may be at least one and is preferably designed from a conserved region of 16S rRNA of bacteria.
  • the base length and the sequence may be appropriately determined according to the gene amplification method such as PCR used for detection.
  • the probe may be an oligonucleotide complementary to the base sequence of at least a part of the specific region (V1 to V9) of the 16S rRNA of each marker bacterium, and may be modified with a fluorescent substance or the like as necessary. .
  • the probes may be immobilized on a substrate (the material is not limited).
  • the detection kit may contain other reagents for use in detection of marker bacteria. For example, reagents (eg, DNA polymerase, enzymes such as restriction enzymes, fluorescent reagents, substrates such as dNTPs, coenzymes such as ATP), positive / negative control (eg, housekeeping gene) used according to amplification methods are mentioned.
  • reagents eg, DNA polymerase, enzymes such as restriction enzymes, fluorescent reagents, substrates such as dNTPs, coenzymes such as ATP
  • positive / negative control eg, housekeeping gene
  • saliva After rinsing with 3 mL of distilled water for about 10 seconds, saliva was collected as a discharge liquid. The collected saliva was immediately ice-cooled. On the day of collection, the saliva was centrifuged at 10000 G for 10 minutes, and the bacteria contained in the saliva were recovered as a centrifugal sedimentation. Bacterial DNA was extracted from the recovered bacteria. The collected DNA was stored at -80.degree. In addition, extraction of bacterial DNA was performed according to the protocol of the kit using "nexttec 1- Step DNA Isolation Kit for Bacteria" (made by Toho) which is a DNA extraction kit.
  • composition ratio of bacteria was performed using "GS Junior bench top system” (manufactured by Roche Life Science). Analyze the sequence of the amplified gene targeting the V1 to V2 region of the 16S ribosomal RNA gene of the extracted bacterial DNA according to the manual of the instrument, analyze the sequence of 3000 bacterial DNA to identify the bacterial type, and its composition The ratio (%) was determined.
  • CCATCTCCATCCCTGCGTGTTCTCCGACTCAGNNNNNNNNNNNNANNGT TYGTGGTCTCAG (SEQ ID NO: 1) as a forward primer (wherein N means A, C, G or T, M means A or C) , R means G or A, Y means T or C), and CCTATCCCCTGTGTCCTTGGCAGTCTCAGTGCTGCCTCCCGTAGGAGT (SEQ ID NO: 2) was used as a reverse primer.
  • public databases CORE and RDP
  • the difference between the mean values of the component ratio between the two groups of healthy people and gingivitis patients was tested for significant difference by Welch's t-test. The results are shown in Table 2.
  • the bacterial component ratio between groups was compared and analyzed, and the bacteria having different bacterial component ratios depending on the condition of gums, such as Rothia bacteria, TM7 bacteria, Campylobacter bacteria, Eubacterium bacteria, Sorobacterium bacteria, Sorobacter bacteria, Paraprevotella bacteria, Megasphaera Extract the genus bacteria Actinomyces, Fusobacterium, Veillonella, Atopobium, Corynebacterium, Alloprevotella, Cardiobacterium, Tannerella, Dialister (p value 0 in Table 2) Less than 1) bacteria, were selected as biomarkers of gingivitis. In addition, bacteria with a composition ratio of bacteria less than 0.01% were judged to be unreliable in data, and were not included in the analysis.
  • the threshold value of the bacterial composition ratio (ratio) of each bacterium is set to the value shown in Table 3, and for Rothia bacteria, the case where the composition ratio is equal to or less than the threshold value is determined as “x”, and the case where it is larger than the threshold value It was judged as "o.” For other types of bacteria, the case where the composition ratio was smaller than the threshold was determined as “o”, and the case where the composition ratio was more than the threshold was determined as “x”.
  • the sensitivity and specificity are indexes indicating how accurate the test is.
  • the sensitivity is an index for determining a gingivitis patient as gingivitis, and is a ratio of a subject who is determined to have gingivitis among subjects who are diagnosed as having gingivitis by a dentist.
  • the specificity is an index for determining a healthy subject as non-gingivitis, and is a ratio of subjects determined as healthy among subjects diagnosed as healthy by a dentist. As a method of examining the condition of gums, the closer the sensitivity and the specificity are to 1, the more accurate the evaluation method.
  • the purpose of determining gingivitis is to know the condition of the gum and keep the gum healthy.
  • the threshold value of the bacterial composition ratio of each bacterium is 7% for Rothia bacteria, 0.03% for Tannerella bacteria, 0.05% for Sorobacterium bacteria, 0.03% for Cardiobacterium bacteria, and Paraprevotella bacteria. 0.03%, Campylobacter spp. 0.25%, TM7 spp. 0.2%, Atopobium spp. 0.5%, Dialister spp. 0.03%, Actinomyces spp.
  • the combination of bacteria targeted by the biomarker is preferably one having a sensitivity of 0.9 or more, more preferably a combination having a sensitivity of 0.9 or more and a specificity of 0.7 or more.
  • the examination results are shown in Table 5.
  • the threshold value of the bacterial component ratio of each bacterium is set to a value shown in Table 5. With regard to the proportion of Rothia bacteria, when the component ratio is less than or equal to the threshold value, it is determined as "x". It was determined that About the ratio of bacteria of other types, the case where composition ratio was smaller than a threshold was determined as "O", and the case more than a threshold was determined as "x".
  • bacteria of the genus Rothia among the bacteria of the genus Rothia, bacteria of the genus Sorobacterium, bacteria of the genus Cardiobacterium, bacteria of the genus Tannerella, bacteria of the genus Paraprevotella, bacteria of the genus Campylobacter, bacteria of the genus TM7, bacteria of the genus Atopobium, bacteria which may be determined to be gingivitis.
  • the number is calculated and the number is 4 or more, when it is determined to be gingivitis, it is understood that the sensitivity is 0.94 and the specificity is as high as 1.00.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Sustainable Development (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne une méthode avec laquelle il est facile de déterminer la contraction ou le risque de contracter une gingivite, et qui peut être utilisée dans le depistage de masse. Cette méthode consiste à mesurer le rapport d'abondance ou la quantité de bactéries marqueurs par rapport aux bactéries totales dans un échantillon biologique prélevé chez un sujet afin de déterminer la contraction ou le risque de contracter une gingivite. Les bactéries marqueurs sont au moins une bactérie sélectionnée dans le groupe constitué par les bactéries Moschata, les bactéries TM7, les bactéries Eubacterium, les bactérie Solobacterium, les bactéries Paraprevotella, les bactéries Megasphaera, les bactéries Atopobium, les bactéries Alloprevotella, les bactéries Cardiobacterium et les bactéries Dialister.
PCT/JP2018/024550 2017-06-30 2018-06-28 Méthode de détermination de la gingivite et biomarqueur WO2019004346A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2017128346 2017-06-30
JP2017-128346 2017-06-30

Publications (1)

Publication Number Publication Date
WO2019004346A1 true WO2019004346A1 (fr) 2019-01-03

Family

ID=64742862

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2018/024550 WO2019004346A1 (fr) 2017-06-30 2018-06-28 Méthode de détermination de la gingivite et biomarqueur

Country Status (1)

Country Link
WO (1) WO2019004346A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014179965A1 (fr) * 2013-05-09 2014-11-13 The Procter & Gamble Company Procédé et système d'identification d'un marqueur biologique

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014179965A1 (fr) * 2013-05-09 2014-11-13 The Procter & Gamble Company Procédé et système d'identification d'un marqueur biologique

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LEE, HJ. ET AL.: "Quantification of subgingival bacterial pathogens at different stages of periodontal diseases", CURR. MICROBIOL., vol. 65, no. 1, 2012, pages 22 - 27, XP035075123, ISSN: 0343-8651, DOI: 10.1007/s00284-012-0121-8 *
SAITO, TAMAMI ET AL.: "P-2-66 Regarding detection situation of periodontopathic bacteria in childhood-relation to gingivitis (non-official translation)", THE JAPANESE JOURNAL OF PEDODONTICS, vol. 47, no. 2, 2009, pages 394, XP009519351 *
TANNER, AC. ET AL.: "Anaerobic culture to detect periodontal and caries pathogens", J. ORAL BIOSCI., vol. 57, no. 1, February 2015 (2015-02-01), pages 18 - 26, XP055676148, ISSN: 1349-0079, DOI: 10.1016/j.job.2014.08.001 *

Similar Documents

Publication Publication Date Title
Cortelli et al. Prevalence of periodontal pathogens in Brazilians with aggressive or chronic periodontitis
Nyvad et al. Dental caries from a molecular microbiological perspective
Cortelli et al. Frequency of periodontal pathogens in equivalent peri-implant and periodontal clinical statuses
CN105209918B (zh) 生物标记鉴定方法和系统
US20190153518A1 (en) Intraoral examination method
CN105324670B (zh) 用于评估健康状况的方法和系统
JP2017023093A (ja) 歯周病及び齲蝕のリスクの判定方法
Shi et al. Metagenomic analysis of the salivary microbiota in patients with caries, periodontitis and comorbid diseases
Sugano et al. Detection of Streptococcus anginosus and 8-hydroxy-deoxyguanosine in saliva
Doğan et al. Occurrence and serotype distribution of Aggregatibacter actinomycetemcomitans in subjects without periodontitis in Turkey
JP4917815B2 (ja) 歯周病菌の検出方法
Li et al. Comparison of real-time quantitative PCR with a chairside test for Streptococcus mutans assessment
WO2019004346A1 (fr) Méthode de détermination de la gingivite et biomarqueur
JP4878186B2 (ja) 歯周病菌の検出方法
JP5885910B2 (ja) 齲蝕に関連する口腔内細菌の特定方法
KR102225447B1 (ko) 구강 세균의 군집을 이용한 알츠하이머 진단용 바이오마커 및 이의 용도
WO2019004347A1 (fr) Procédé de détermination de gingivite et biomarqueur
WO2019004400A1 (fr) Procédé de jugement de présence/absence ou de risque d'apparition de carie, et marqueur biologique
JP6288758B2 (ja) 唾液の細菌叢の解析方法
RU2607046C2 (ru) Способ оценки обсемененности пародонта патогенными бактериями с применением полимеразной цепной реакции в реальном времени
Childers et al. Potential risk for localized aggressive periodontitis in African American preadolescent children
KR101768955B1 (ko) 에볼라 바이러스 진단용 프라이머 세트 및 이의 용도
Kodrat et al. Quantitative Analysis of Selenomonas noxia in Periodontitis Patients via Two Different Sample Collection Methods
WO2008137506A2 (fr) Procédés et trousses de lutte contre la parodontopathie chez les chiens
JP2014023434A (ja) デンタルプラークの細菌叢の解析方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18825435

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18825435

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP