WO2019002581A1 - IDENTIFICATION AND ELIMINATION OF DAMAGED AND / OR SENESCENT CELLS - Google Patents
IDENTIFICATION AND ELIMINATION OF DAMAGED AND / OR SENESCENT CELLS Download PDFInfo
- Publication number
- WO2019002581A1 WO2019002581A1 PCT/EP2018/067655 EP2018067655W WO2019002581A1 WO 2019002581 A1 WO2019002581 A1 WO 2019002581A1 EP 2018067655 W EP2018067655 W EP 2018067655W WO 2019002581 A1 WO2019002581 A1 WO 2019002581A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- damaged
- cells
- antagonist
- senescent cells
- interaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2827—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- This invention relates to damaged and/or senescent cells and the ways of detecting them and/or eliminating them. More specifically, the invention relates to a novel method of detecting and/or identifying damaged and/or senescent cells, as well as to method of eliminating such cells and, through it, treating or ameliorating pathologies where such cells are involved, even some aging effects, which are also produced as a result of exposure to toxic substances.
- the invention extends to methods of detecting cells expressing PD-L2, in particular, although not exclusively, damaged and/or senescent cells.
- This invention also relates to antagonists of Programmed Death Ligand 2 (PD-L2) and Programmed Cell Death Protein 1 (PD-1) interaction. The invention also extends to the use of these antagonists to eliminate damaged and/or senescent cells.
- PD-L2 Programmed Death Ligand 2
- PD-1) Programmed Cell Death Protein 1
- Cellular senescence is characterized by three properties: (1) an epigenetic reorganization that prevents further cell proliferation; (2) an intense secretory program or Senescent Associated Secretory Phenotype (SASP) that includes cytokines that recruit inflammatory cells; and (3) up-regulation of lysosomal-associated ?-galactosidase activity (SA- ⁇ gal) and lysosomal-associated -fructose (SA- -fuc) activity. These properties are not necessarily linked.
- SASP Senescent Associated Secretory Phenotype
- cellular damage and cellular senescence are closely associated concepts; damaged cells often become senescent cells.
- cellular senescence (initiated by means that do not necessarily imply cellular damage) is characterized by aberrant mitochondrial function that results in high levels of reactive oxygen species (ROS) that self-inflict damage to the cell, thereby ensuring that senescent cells are indeed themselves damaged cells (Ziegler et al., 2015).
- ROS reactive oxygen species
- Damaged and/or senescent cells are present in many human pathologies (Munoz- Espin and Serrano, 2014), including, but not restricted to, pulmonary fibrosis, type 2 diabetes, sarcopenia, cataracts, radiation-induced oral mucositis, brain and heart aneurysms, glaucoma, Alzheimer's and Parkinsons' disease, cystic fibrosis, intestinal bowel disease, osteoarthritis and intervertebral disc degeneration (Munoz-Espin and Serrano, 2014).
- the list of diseases associated with damaged and/or senescent cells keeps growing steadily and it would not be unreasonable to assume that senescence is implicated in further pathologies. Therefore, the development of reliable methods for the identification of damaged and/or senescent cells could be of prognostic value for these pathologies.
- Senescence can also be induced in response to therapy-induced genotoxic stress.
- tumor cells are severely damaged and subsequently a fraction of these cells die by apoptosis, while others undergo senescence (Ewald et al., 2010; Sanoff et al., 2014; Wood et al., 2016).
- the presence of surviving damaged and/or senescent cells may promote metastasis (Ruhland et al., 2016) and may also have a negative effect on the full regression of the tumor concerned (Sun et al., 2012; Zacarias-Fluck et al., 2015), thus facilitating tumor relapse.
- cancer survivors that have been exposed to chemotherapy are known to develop, years after their treatment, a higher frequency of chronic health conditions compared to their non-exposed counterparts and have an increased mortality rate (Ness et al., 2015). This is thought to be caused by the persistence of damaged and/or senescent cells that arise throughout the entire organism as a consequence of systemic exposure to the chemotherapeutic agents (Ewald et al., 2010). Similarly, in a related aspect, exposure to environmental toxicants has also been found to result in the accumulation of damaged/senescent cells in mice (Sorrentino et al., 2014).
- CDK4 and CDK6 kinases have been developed.
- these inhibitors induce a senescent response in most tumor cells, and, as a consequence, they offer great promise as a treatment for cancer.
- Palbociclib PD-0332991
- Palbociclib has been approved for clinical use in combination with Letrozole for the treatment of ER-positive and HER2 -negative breast cancer.
- the occurrence of the aforementioned senescent cells, and the existence of side-effects associated with these cells are a cause of concern for these senescent-inducing therapies and could reduce the efficacy of these drugs in treating cancer patients.
- Senescent cells also accumulate in aged organisms and negatively influence lifespan. In fact, the selective elimination of senescent cells from transgenic progeroid mice and naturally-aged mice has been shown to delay tumorigenesis and lead to greater resistance to aging-associated disorders (Baker et al., 2011, 2016; Childs et al., 2016; Zhu et al, 2015).
- these senolytic drugs include Dasatinib, a tyrosine kinase inhibitor developed by Bristol-Myers Squibb for the treatment of chronic leukemia, and Quercetin, a flavonol that has phosphatidyl inositol 3 kinase (PI3K) inhibitory activity. Used in combination, these drugs reduced the number of damaged and/or senescent cells in chronologically aged mice, in progeroid mice, and in irradiation-exposed mice, thereby resulting in improved cardiac and vascular function, delayed aged-related symptoms and extended lifespan (Zhu et al., 2015; Roos et al., 2016).
- PI3K phosphatidyl inositol 3 kinase
- ABT-737 an inhibitor of the anti-apoptotic proteins BCL-W and BCL-XL, both of which are up-regulated by senescent cells, has been shown to selectively eliminate senescent cells and, as a result, rejuvenate hematopoietic stem cells in irradiated or naturally-aged mice (Yosef et al.,
- ABT-263 Another inhibitor of the Bcl-2 family, Navitoclax (ABT-263), has also been shown to efficiently eliminate senescent cells in vitro and in vivo (Chang et al., 2016; Zhu et al., 2016). Pharmacological elimination of senescent cells has also been shown to alleviate atherosclerosis symptoms (Childs et al., 2016; Roos et al., 2016) and disc degeneration (Chen et al., 2016) in mice.
- ABT-263 Another inhibitor of the Bcl-2 family
- ABT-263 Navitoclax
- Pharmacological elimination of senescent cells has also been shown to alleviate atherosclerosis symptoms (Childs et al., 2016; Roos et al., 2016) and disc degeneration (Chen et al., 2016) in mice.
- the methods that are currently used for detecting the presence of senescent cells in biological samples are not specific to senescent cells or, as happens with the method based on the up-regulation of lysosomal- associated ?-galactosidase activity (SA- ⁇ gal), they require that cells or tissues are fixed before applying the method, what hinders its applicability and makes almost impossible their use for in vivo detection methods.
- such method for the detection of damaged and/or senescent cells could be of prognostic value for one or more pathologies associated to the presence of said cells, especially for human beings, even when the method of detection is carried out on one or more biological sample taken from the subject.
- the present inventors have found a way of overcoming said problems.
- T cells require at least two signals: the first signal, which confers specificity to the immune response, is transduced via the T cell receptor (TCR) following recognition of a foreign antigen presented by the major histocompatibility complex (MHC).
- MHC major histocompatibility complex
- co stimulation induces T cells to proliferate and become functional.
- Costimulation of T cells is neither antigen-specific, nor MHC-restricted, and is, instead, caused by distinct cell surface molecules expressed by antigen presenting cells (APCs).
- APCs antigen presenting cells
- inhibitory receptors have also been identified on T cells.
- One of these inhibitory receptors is Programmed Cell Death Protein 1 (PD-1).
- PD-1 Programmed Death-Ligands 1 and 2
- PD-L1 and PD-L2 also known as CD274 or B7-H1 and CD273 or B7-DC, respectively
- cytokine production and reduced T cell survival results in reduced cytokine production and reduced T cell survival, thus reducing autoimmunity and promoting self- tolerance (Fagarasan and Honjo, 2000).
- Manipulation of the T cell costimulatory/inhibitory pathways therefore, offers great potential to stimulate or suppress immune responses in humans and animals.
- the PD-1 receptor is also expressed by natural killer cells (NK) and its blockade by specific antibodies against this protein induces their expansion and enhances their cytotoxic activity (Guo et al., 2016).
- NK natural killer cells
- therapeutic anti-PD-1 antibodies are Nivolumab (Bristol- Myers Squibb), Pembrolizumab (Merck) and Pidilizumab (Medivation), which are clinically approved for the treatment of metastatic melanoma, non-small cell lung cancer (NSCLC) and diffuse large cell lymphomas (DLBCL), respectively.
- NSCLC non-small cell lung cancer
- DLBCL diffuse large cell lymphomas
- PD-L2 in the induction of immune tolerance in the tumour microenvironment has received less attention, probably due to its low constitutive basal expression and its restricted expression, which initially was thought to be restricted to antigen-presenting cells such as macrophages and dendritic cells (DCs), although some groups have subsequently reported that PD-L1 expression can be induced in a wider variety of other immune cells and nonimmune cells depending on microenvironmental stimuli among which Th2 cytokines seem to be particularly important.
- Th2 cytokines seem to be particularly important.
- the present inventors are the first to identify that senescent tumor cells and non- apoptotic damaged cells highly increase their transcriptional levels of PDCD1LG2 gene (the gene of PD-L2 ligand) and the levels of its encoded protein, PD-L2. They have observed that in vivo procedures that result in DNA damage and/or senescence also lead to the up-regulation of PD-L2 protein and its associated mRNA levels. They have also observed the upregulation of PD-L2 in aging. The inventors conclude that damaged and/or senescent cells induce an immunosuppressive environment and evade the detection of the immune system via the inhibition of PD-1 mediated signaling, through the upregulation of PD-L2.
- the present inventors propose to take advantage of such finding to detect and/or identify damaged and/or senescent cells and, even, to eliminate them avoiding cytotoxic side-effects associated with the current therapies above referred. It should be possible to achieve this desired advantage by breaching the immunotolerance generated by these damaged and/or senescent cells through the inhibition of the PD-L2/PD-1 signaling.
- a method based on the decrease or inhibition or the PD-L2/PD-1 signaling would result in the re-activation of immune cells and the clearance of damaged and/or senescent cells by the immune system, what should lead to an amelioration of pathologies where damaged and/or senescent cells are involved.
- the detection of damaged and/or senescent cells could also be useful in the prognostic/ diagnostic of the pathologies that are associated to the presence of said cells.
- the present inventors propose that a) the up-regulation of PD-L2 in damaged and/or senescent cells allows the detection and/or the identification of these cells; b) the detection of the presence of damaged and/or senescent cells that could be of prognostic value for the pathologies that are associated to the presence of these cells; c) the inhibition of PD-L2/PD-1 signaling may enhance immunity and contribute to the immunoclearance/elimination of damaged cells and senescent cells; and d) the clearance/elimination of damaged cells through the inhibition of the PD-L2/PD-1 signaling pathway should have a therapeutic effect on pathologies associated with the presence of damaged and/or senescent cells.
- a method for the detection of the presence of damaged and/or senescent cells in a sample wherein the levels of a product (mRNA or protein) of the PD-L2 gene are determined and the presence of damaged and/or senescent cells is acknowledged when the levels are higher than a reference value.
- a method for the prognostic/diagnostic of a disease associated to the presence of damaged and/or senescent cells wherein the presence of damaged and/or senescent cells is determined by the method of the first aspect of the invention.
- a method of eliminating damaged and/or senescent cells comprising contacting the cells with an antagonist of the PD- L2/PD-1 interaction.
- the invention refers to an antagonist of the PD-L2/PD-1 interaction for use in eliminating damaged and/or senescent cells.
- the invention relates to an antagonist of the PD- L2/PD-1 interaction for use in treating, ameliorating or preventing a disease associated to the presence of damaged and/or senescent cells.
- a method of treating, ameliorating or preventing a disease characterised by the presence of damaged and/or senescent cells comprising administering to a subject in need of such treatment, a therapeutically effective amount of antagonist/inhibitor of the PD-L2/PD-1 interaction.
- An additional aspect is a method for cosmetic improvement of the skin, including the removal of moles from the skin of a subject, which method comprises administering to the subject an antagonist of the PD-L2/PD-1 interaction.
- an additional aspect is a method for increasing lifespan and/or ameliorating or removing non-pathological effects of biological ageing in a subject, which method comprises administering to the subject an antagonist of the PD-L2/PD-1 interaction.
- a method of identifying damaged and/or senescent cells comprising administering a molecule that binds to PD-L2 protein or PD-L2 mRNA, detecting whether the binding of the molecule to PD-L2 or PD- L2 mRNA and identifying as damaged or senescent cells those cells where the binding of the molecule to PD-L2 or PD-L2 mRNA can be detected or where the level of bound molecule is higher than a control value.
- composition which may advantageously be used in treating damaged and/or senescent cells, the composition, comprising an antagonist of the PD-L2/PD-1 interaction and a pharmaceutically acceptable vehicle.
- the invention also provides in another aspect, a process for making the damaged and/or senescent cell-treatment composition according to the fourth aspect, the process comprising contacting a therapeutically effective amount of an antagonist of the PD- L2/PD-1 interaction and a pharmaceutically acceptable vehicle.
- a monoclonal antibody that is an antagonist of the PD-12/PD-1 interaction.
- the antibody is an antibody or an antigen-binding fragment thereof that specifically binds to PD-L2 and/or PD-1 and interferes with the interaction between these two proteins .
- the antibody is an antibody or an antigen-binding fragment thereof that specifically binds to PD-L2 and blocks its binding to its receptor PD-1.
- a molecule that binds to PD-L2 or to PD-L2 mRNA for use in identifying damaged and/or senescent cells is provided.
- a PD-L2-specific oligonucleotide pair as qRT-PCR primers for detecting the presence of damaged and/or senecescent cells in an assayed sample, preferably when the pair of oligonucleotides is the pair of SEQ ID NO:9 and SEQ ID NO: 10 or SEQ ID NO: 19 and SEQ ID NO:20.
- Fig. 1 illustrates that PD-L2 mRNA is up-regulated in senescent head and neck squamous cell carcinoma (HNSCC) cells.
- HNSCC head and neck squamous cell carcinoma
- PD-L1 and PD-L2 mRNA levels were assessed by quantitative RT-PCR and normalised to the mRNA levels of the housekeeping gene ⁇ - actin.
- the data corresponds to the average +/- SD of five independent experiments and shows the fold change in PD-L1 mRNA levels and PD-L2 mRNA levels relative to untreated cells.
- Statistical t-test analysis was performed to calculate significance (* ⁇ 0.05; *** ⁇ 0.001);
- Fig. 2 illustrates that PD-L2 mRNA is up-regulated in senescent melanoma cells.
- A Representative images illustrating the SA- ⁇ galactosidase activity of human melanoma SK-Mel-103 cells treated with either the CDK4/CDK6 inhibitor Palbociclib, the genotoxic drug Bleomycin or the Mdm2 inhibitor Nutlin for 7 days. Senescent cells showed a dramatically increased cellular size and accumulation of peri-nuclear granule that displayed a blue colour as a consequence of the increased SA galactosidase activity (arrows). Scale bar, 100 ⁇ .
- Fig. 3 illustrates that DNA damage is a potent inducer of PD-L2 expression.
- the mouse myoblast cell line C2C12 (A) and the mouse melanoma cell lines HcMel3 (B) and HcMell2 (C) were treated with the genotoxic drugs Bleomycin and Doxorubicin at the indicated concentrations.
- 48 hours later PD-Ll and PD-L2 mRNA levels were analysed by quantitative RT-PCR. Data was normalised to the mRNA levels of the housekeeping gene ⁇ -actin.
- the graph shows the fold change in PD-Ll and PD-L2 mRNA levels relative to untreated cells. In each group of three, the left bar corresponds to control, the middle one to bleomycin and the right one to doxorubicin. This experiment has been done once.
- Fig. 4 illustrates that PD-L2 expression is up-regulated in kidney fibrosis. Fibrosis was induced in C57BL6 mice kidneys by unilateral ureteral obstruction (UUO).
- UUO unilateral ureteral obstruction
- OCT optimal cutting temperature
- senescent cells were evaluated by SA- ? galactosidase staining of optimal cutting temperature (OCT) compound impregnated tissue sections. In addition, cell nuclei were stained with Nuclear Red Fast (NRF). Senescent cells displayed a blue colour as a consequence of the increased SA- ? galactosidase activity (arrows).
- Fig. 5 illustrates that PD-L2 is up-regulated in lung fibrosis.
- A Fibrosis was induced in C57BL6 mice lungs by intra-tracheal delivery of a single dose of bleomycin. Fourteen days post injury, SA- ? galactosidase activity was analysed in whole organs. Senescent lungs (right image) presented the blue staining consequence of an increased SA- ? galactosidase activity
- B PD-Ll and PD-L2 mRNA levels were evaluated by quantitative RT-PCR in lung tissue samples and normalised to the mRNA levels of glyceraldehyde-3 -phosphate dehydrogenase (GAPDH). The data corresponds to the average +/- SD of three to five lungs. Statistical t-test analysis was performed to calculate significance (*P ⁇ 0.05).
- Fig. 6 illustrates that SK-Mel-103 mouse xenografts halt growth and become senescent upon treatment with vehicle or palbociclib.
- A Human melanoma SK-Mel-103 cells were inoculated subcutaneously in immunedeficient nu/nu mice. When tumours had a volume of about 200 mm , mice were treated with palbociclib by oral gavage and tumour progression was analysed by caliper measurement. The data represents the average +/- SEM of 9-1 1 control (continuous line) and 10-14 palbociclib-treated (dashed line) independent xenografts.
- B SA- ⁇ galactosidase activity was analysed in whole tumours.
- Senescent tumours presented the blue staining consequence of an increased SA- ⁇ galactosidase activity.
- C SA- ⁇ galactosidase activity was analysed on tumour sections (upper images). Expression of the proliferation marker Ki67 was evaluated on the same tumours by immunohistochemistry (bottom images). Xenografts from palbociclib-treated mice presented the blue staining consequence of an increased SA- ⁇ galactosidase activity revealing the presence of senescent cells (upper right image).
- Fig. 7 illustrates that senescent SK-Mel-103 mouse xenografts up-regulate PD-L2.
- A PD-Ll and PD-L2 mRNA levels were evaluated by quantitative RT-PCR of human melanoma SK-Mel-103 cells inoculated subcutaneously in immune-deficient nu/nu mice treated with either vehicle or palbociclib. Values were normalised to the housekeeping gene TATA-box binding protein (TBP) and represented relative to vehicle-treated tumours. The graphs depict the average +/- SD of six to seven independent xenografts. Statistical t-test analysis was performed to calculate significance (*** ⁇ 0.001).
- B PD- L2 levels were analysed in vehicle and palbociclib treated tumours by Western blotting. The protein levels of anti- Structural Maintenance of Chromosomes (anti-SMC l) were used as loading control.
- Fig. 8 illustrates PD-L2 upregulation in aged individuals ; .
- PD-L2 (left) and PD-Ll (right) mRNA levels were evaluated by quantitative RT-PCR in livers from young mice (10 weeks of age) (grey bars) and old mice (75 weeks of age) (white bars). Values were normalised to the housekeeping gene ⁇ -actin. The graphs represent the average +/- SD of four mice. Statistical t-test analysis was performed to calculate significance (*P ⁇ 0.05).
- Fig. 9 illustrates the effect of enzymatic inhibitors and TLRs agonists in the transcriptional regulation of PD-L2 and PD-Ll .
- PD-L2 mRNA levels were evaluated by quantitative RT-PCR in C2C12 cells treated with 500 nM doxorubicin for 48 hours in the presence or absence of commercial inhibitors against enzymes known to be involved in senescence/SASP/DNA-damage responses: IK i ( 50 ⁇ ), PIMi (1 ⁇ ), rotenone (1 ⁇ ), JAKi (3 ⁇ ), rapamycin (50 nM) and metformin (5 mM) or cultured in pyruvate- depleted media.
- TLR1/2 agonist Pam3CSK4, 300 ng/ml
- TLR2 agonist HKLM, 10 8 cells/ml
- TLR3 agonist Poly (I:C) HMW and LMW, 10 ⁇ g/ml
- TLR4 agonist LPS-EK, 10 ug/ml
- TRL5 agonist FLA-ST, 1 ⁇ g/ml
- TRL6/2 agonist FSL-1, 100 ng/ml
- TRL7 agonist ssRNA40, 5 ⁇ g/ml
- TLR9 agonist ODN1826, 5 ⁇ .
- Fig. 10 shows the DNA sequence (A) and the protein sequence (B) of Programmed Cell Death Protein 1 (PD-1).
- Fig. 11 shows the DNA sequence (A) and the protein sequence (B) of Programmed Death Ligand 2 (PD-L2).
- the present invention is based on the unexpected finding that the expression of the products of the gene of PD-L2 (both the mRNA and the protein) is upregulated in damaged and/or senescent cells.
- PD-L2 upregulation seems to result in an increase of the signalling coming mediated by its known receptor, PD-1, so that damaged and/or senescent cells induce an immunosuppressive environment which favours that said cells are not eliminated by the immune system.
- a first application is that PD-L2 upregulation can be used to identify damaged and/or senescent cells and/or to detect the presence of damaged and/or senescent cells in a sample.
- PD-L2 upregulation can be used to identify damaged and/or senescent cells and/or to detect the presence of damaged and/or senescent cells in a sample.
- Both the method for identifying damaged and/or senescent cells and the method of detecting the presence of damaged and/or senescent cells in a sample are both based on the same principle: detecting the expression of a product of the PD-L2 gene (which gene is usually denominated PDCD1LG2) and observing an increase in the level of said product with regard to a reference value.
- the method for identifying damaged and/or senescent cells can be considered a specific embodiment of the method for detecting the presence of damaged and/or senescent cells in a sample, wherein the cells of the sample maintain their integrity throughout the performance of the method and can be observed or treated as individual entities, identifiable with regard to other cells present in the same sample (for instance, due to their position in the sample, as could be the case in the analysis of cell cultures, tissue samples or cells fixed to any kind of support such as, for instance, a membrane or a polymeric support).
- the detection of the presence of damaged and/or senescent cells in a sample from the level of the PD-L2 mR A can be done by qRT-PCR, as in some assays of Examples of the present application.
- the reference value can be the PD-L2 mRNA level detected in a control sample which is considered not to contain damaged/senescent cells that is submitted to the same steps that the assayed sample, as in the assays shown in the present application, which control sample should preferable be selected so that it shares as many features as possible with the assayed sample other that the presence of damaged/senescent cells, for instance, same tissue, extracted from a subject of the same age or sex, a sample taken from the same individual but extracted from a tissue or a part of organ where the presence of damaged/senescent cells has been previously discarded.
- the reference value can also be a value previously obtained, for instance as the average value of a previous study of samples where a number of control samples has been analyzed; this latter alternative could be of particular use in clinical practice.
- the use of a PD-L2- specific oligonucleotide pair as qRT-PCR primers for detecting the level of damaged and/or senecescent cells in an assayed sample is also an aspect of the present invention, particularly (preferably) when the pair of oligonucleotides of SEQ ID NO: 9 and SEQ ID NO: 10 or the pair of oligonucleotides of SEQ ID NO: 19 and SEQ ID NO:20 are used.
- a Western blot and the visual identification of the corresponding band might be considered enough to decide that damaged/senescent cells were present in the assayed sample.
- a control sample will have been included in the same assayed and it will be concluded that damaged/senescent cells are present in the assayed sample when the signal corresponding to the assayed sample is higher than the signal corresponding to the control sample (which signal in the control sample can have a value of 0, because its intensity might be not high enough to be detected).
- detecting the levels of the PD-L2 protein in a biological sample such as a sample of kidney or lung, or in a culture of cells of such organs, as assayed samples, comparing the levels of PD-L2 protein with those of a control sample and determining that PD-L2 is overexpressed in the assayed sample might be a possible example of how to perform the method of detection of damaged and/or senescent cells of the invention where the presence of damaged and/or senescent cells would be acknowledged in the assayed sample.
- the determination by Western blot can be considered a particular embodiment of the methods wherein molecules that bind to PD-L2 mRNA or protein are added to the assayed sampled and the binding of said molecule is determined in order to decide if damaged/senescent cells are present in the assayed sample and/or to identify a cell as a damaged/senescent cell.
- the molecule that binds to PD-L2 mRNA or PD-L2 protein will be labelled, that is, it will contain, as a part of the molecule, a chemical group, residue or moiety, whose presence will be easy to detect and quantify; typical examples of such molecules are those with a moiety that can be visualized by a coloured signal detectable in the range of frequencies of visual light, or those that emit a signal in frequency after being excited with light of a different frequency, as happened with fluorophores.
- the molecule is selected so that its presence can be determined by the addition of a second molecule that is labelled or that can give rise to a reaction where a molecule easy to detect appears or disappears.
- immunoassays where a primary antibody is used and its binding is revealed by a secondary antibody liked to a label such as a fluorophore or to an enzyme which can give rise to a coloured molecule, such as horseradish peroxidase or alkaline phosphatase, are well known by those skilled in the art and be easily adapted both to immunohistochemical assays or ELIS A.
- the molecule that binds to PD-L2 mRNA or PD-L2 protein will be selected in accordance to the product of the PD-L2 gene to detect and, preferably, taken into account the species of the subject.
- the molecule to add can be a molecule complementary to said mRNA, preferably carefully selected so that the binding is specific.
- the added molecule can be an oligonucleotide complementary to a fragment of said mRNA and capable to bind to it, including natural siRNAs and analogues thereof chemically modified to increase the binding or to facilitate the entrance into the cells.
- oligonucleotides and analogues thereof from the cDNA sequences, that are available in public databases, such as the reference sequences NM_025239.3 (SEQ ID NO:3) and NM_021396.2 (SEQ ID NO:25) mentioned below and that correspond to Homo sapiens and Mus musculus PD- L2 cDNA, respectively.
- both the method of determination of the presence of damaged and/or senescent cells and the method of identification of damaged/senescent cells are compatible with a broad meaning of the concept of "assayed sample", that includes not only biological samples taken from a subject (such as biopsies or samples of biological fluids such as blood, urine, saliva or even cerebrospinal fluid) but also whole organisms, even living beings. This is an advantage with regard to methods such as the one of the determination of ⁇ -gal signal.
- But carrying out the determination of the presence of damaged and/or senescent cells in whole living animals preferably implies to provide means for easily detecting a signal associated to PD-L2 presence/level, such as imaging it, and determining the possible presence of damaged/senescent cells from such images. That will usually involve administering to the living organism at least a molecule capable to bind to PD-L2 mRNA or PD-L2 protein, which molecule emits a signal that is easy to transform in an image that can be used for the determination or, in small animals, a signal that can be visualized easily.
- sample will be restricted to samples previously obtained, taken or extracted from the body of the subject (the human or other mammal), such as biopsies or samples of physiological fluids such as blood, saliva, urine, lacrimal secretion, cerebrospinal fluid or the like, cell obtained from said samples, cultures of said cells, cultures of established cell lines or cells individualized form any of said samples.
- the detection of the presence of damaged/senescent cells (or the identification of said cells) in a whole animal might be particularly useful, specially once the animal is dead, so that the variant of the method of the present invention of determining the presence of damaged and/or senescent cells that is carried out in a whole animal model, especially after its death, can be considered an embodiment of the present invention.
- the molecule that binds to PD-L2 mRNA or PD-L2 protein may comprise a conventional contrast material that can be used to enhance the contrast of structures or fluids within the body during medical imaging.
- a conventional contrast material may be visible using Magnetic Resonance Imaging (MRI), Computed Tomography (CT) and/or Optical Imaging (OI).
- MRI Magnetic Resonance Imaging
- CT Computed Tomography
- OI Optical Imaging
- the contrast material which is visible using MRI, CT or 01, may comprise a metallic or non-metallic material.
- the contrast material may comprise a magnetic or nonmagnetic material.
- the contrast material may comprise an MRI contrast material.
- the contrast material may comprise a paramagnetic or superparamagnetic material.
- the contrast material may comprise iron, nickel, cobalt or dysprosium or a compound, such as oxide or alloy, which contain one or more of these elements.
- the contrast material comprises magnetite (Fe 3 0 4 ).
- the contrast material may comprise a MRI, CT or OI contrast material.
- the contrast material may comprise gadolinium, gold, iodine or boro-sulphate. Each of these materials may be used as either MRI, CT or OI contrast materials.
- the contrast material comprises gadolinium.
- the molecule that binds to PD-L2 mRNA or PD-L2 protein might be a biomolecule (that is, a molecule that can be naturally found in a living being) or an analogue thereof that comprises one or more artificially done modifications with regard to the natural molecule, while maintaining, partially or completely, its biological activity.
- the molecule, biomolecule of analogue thereof may comprise a protein, peptide, antibody, chemical compound, genetic material, small molecule, drug or RNAi reagent.
- the biomolecule is an antibody or an antigen-binding fragment thereof that specifically binds to PD-L2 protein, which antibody or fragment thereof comprises any kind of label, as defined above, that facilitates its detection, such as a contrast material as referred to above.
- anti-PD-L2 antibodies that could be adapted for that purpose, such as several commercially available anti-PD-L2 antibodies, particularly those already used of Western blots or other immunodetection or immunohistochemistry techniques such as, for example, the anti-human antibodies PD-L2 (D7U8CTMXP) (cat. #82723, Cell Signal Technologies), MABC969 anti-PD-L2 antibody, clone 24F.10C12 (cat.
- the molecule can comprise a part that facilitates its isolation because it binds to a second added molecule, for instance by affinity chromatography, or thanks to a property of the second added molecule, as happens with the magnetic beads.
- the contrast material is covalently linked to the biomolecule.
- the construct will usually be part of an expression vector or, in the case of animal models for research, can also be integrated in the genome.
- the expression vector can be directly administered to a particular organ of interest, or can be designed so that it is preferentially address to a particular tissue.
- This approach is particularly useful when the protein expressed from the gene is a reporter protein with a feature that facilitates its detection, such as light emission upon excitation, like the green fluorescent protein (GFP) or the like.
- GFP green fluorescent protein
- Such approach also allows the expression of fused proteins, where the additional part of the protein has a different feature with facilitates additional assays or its purification, as happens with tagged proteins with a tail.
- the method for the detection of damaged and/or senescent cells can be of use in the prognosis of a disease or condition characterised by the presence of damaged and/or senescent cells.
- the detection of the damaged and/or senescent cells will be done as it has been explained above, that is, by the method of the invention, so that the method can be also set forth as a method for the prognostic/diagnostic of a disease associated of damaged and/or senescent cells, wherein the presence of damaged and/or senescent cells is determined by the method of detection or the method of identification of said cells of the present invention.
- the samples where the prognostic or diagnostic method is carried out will be restricted to samples previously obtained, taken or extracted from the body of the subject where the disease is to be diagnosed or prognosed, such as biopsies or samples of physiological fluids such as blood, saliva, urine, lacrimal secretion, cerebrospinal fluid or the like or cells obtained from said samples or processed samples obtained from the samples originally taken from the subject.
- the subject will be preferably a human or another mammal.
- the method for the detection of damaged and/or senescent cells does not allow directly predicting or diagnosing a particular disease or condition characterised by the presence of damaged and/or senescent cells
- the presence of damaged and/or senescent cells indicates that the subject from which the assayed samples originates is a subject in risk of developing one of such diseases or conditions (a clear example of that being the risk of tumor regression or metastasis promotion associated with the presence of damaged and/or senescent cells after radio/chemotherapy) or that is a subject probably suffering from a disease associated to the presence of damaged and/or senescent cells, which disease should be, preferably, subsequently identified or confirmed, as a part of the diagnostic process, in order to provide proper treatment.
- determining that damaged and/or senescent cells are present because PD-L2 overexpression has been detected in a sample of kidney or lung might be an indication that the subject suffers or will suffer from fibrotic kidney or fibrotic lung (depending on the assayed sample), which will have to be confirmed, preferably, but, at the same time, is also an indication that a PD-L2 antagonist, such as an antibody, could be advantageously added as a part of the therapy in order to eliminate damaged and/or senescent cells; similarly, determining by PD-L2 overexpression assessment that damaged and/or senescent cells are present in a sample taken from a subject suffereing or who has suffered from cancer and who has undergone chemotherapy or radiotherapy can be considered an indication that the subject is in risk of developing metastasis or showing tumor regression and that a more careful follow-up and frequent monitorization must be performed.
- a method for predicting or diagnosing a disease or condition characterised by the presence of damaged and/or senescent cells wherein the method of the present invention for the detection of the presence of damaged and/or senescent cells in an assayed sample is carried out, that is, a method wherein the levels of a product (mRNA or protein) of the PD-L2 gene or a product of a gene operatively linked to the PD-L2 promoter are determined and the presence of damaged and/or senescent cells is acknowledged when the levels are higher than a reference value.
- the reference value as explained above and below, can be 0.
- the assayed sample will be a biological sample that has been obtained or taken out from a subject, such as blood, urine, a biopsy...
- linking the molecule that binds PD-L2 mRNA or PD-L2 protein (an antibody, for instance) to a maker that allows the detection of PD-L2 mRNA or PD-L2 protein visually or upon making the molecule visible by an applied technique makes feasible to take images of the assayed sample and to determine the presence or absence of damaged and/or senescent cells by simple observation of said images, simply by observing if the signal of the marker is present or not, so that the decision of the presence of damaged and/or senescent cells can be taken from the observation of the images, without the need of observing directly the sample or having it present in the moment of taking a decision, and even without the need of having technical knowledges.
- Antagonists of the interaction between PD-L2 and PD-1 can be biomolecules (for example antibodies or peptides) that specifically bind to PD-L2 and/or PD-1 and inhibit/block/suppress the ability of PD-L2 to interact with or bind to PD-1.
- PD-1/PD-L2 As a decrease in the expression of PD-1 or, preferably, PD-L2, will also decrease PD-1/PD-L2 interaction and the level of the biological activity of PD-L2, also encompassed within the definition of antagonists, as used herein, are those compounds that are capable to diminish PD-1 and/or PD-L2 expression, such as chemical compounds, drugs, small molecules and RNA interference reagents like microRNAs or siRNAs, analogs thereof, and even genetic material.
- the antagonists of the present invention increase immune responses to damaged and/or senescent cells.
- the inventors conclude that subversion of immune pathways that normally serve to temper T cell mediated immune responses and control autoimmunity, provide a mechanism by which damaged and/or senescent cells are able to evade a host's immune responses. Therefore, they propose that interfering in such mechanism will be of use for treating, ameliorating or preventing a disease associated to the presence of damaged and/or senescent cells.
- the method of administering antagonists of the PD-L2/PD-1 interaction has, as a possible embodiment, a method for treating, ameliorating or preventing a disease associated to the presence of damaged and/or senescent cells wherein a therapeutically affective amount of an antagonist of the PD-L2/PD-1 interaction is administered to a subject in need thereof.
- the present invention provides an antagonist of the PD-L2/PD-1 interaction for treating, ameliorating or preventing a disease associated to the presence of damaged and/or senescent cells.
- Antagonists turn on a single cellular response by binding to a receptor, thus initiating a biochemical mechanism for change within a cell.
- Antagonists turn off that response by inhibiting/blocking/suppressing the interaction of the receptor with the agonist.
- inhibitors of the expression of the ligand or the receptor can be also considered antagonists, because they inhibit/supress the interaction of the receptor with the ligand that acts as agonist.
- the antagonist of the PD-L2/PD-1 interaction is an antibody or an antigen-binding fragment thereof that specifically binds PD-L2 and/or PD-1.
- inhibitor can refer to any statistically significant decrease in biological activity, including full blocking of the activity.
- inhibitor can refer to a decrease of at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or about 100% in biological activity.
- the term refers to, for example, the ability of an antagonist such as, an anti-PD-L2 antibody and/or anti-PD-1 antibody, to statistically significantly decrease the activity of the antigen to which the antagonist binds.
- inhibit, block or suppress may be used to refer to the ability of an anti-PD-L2 antibody and/or an anti-PD-1 antibody to decrease the activity of PD-L2 or PD-1 and/or the ability of the antibody to increase T cell mediated cytolytic activity vitro in or in vivo, relative to expression and/or T cell mediated cytolytic activity in an untreated cell population (i.e. control).
- inhibit, block or supress is also used herein to refer to the ability of an antagonist (e.g. anti-PD-L2 or anti-PD-1 antibody or antigen-binding fragment thereof) to decrease the ability of PD-L2 to interact with (i.e. bind to) PD-1.
- a blocking antibody, an antagonist or a blocking agent is one which inhibits or reduces biological activity of the antigen it binds to, e.g. inhibiting or reducing the ability of PD-L2 to interact with or bind to PD-1.
- blocking antibodies or antagonist antibodies substantially or completely inhibit the biological activity of the antigen. Desirably, the biological activity is reduced by at least 10%, 20%, 30%>, 50%>, 70%, 80%, 90%, 95%, or about 100%.
- antibody as used in the present context means an immunoglobulin molecule that recognizes and specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid or combination of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule.
- the term "antibody” encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments, such as Fab, Fab', F(ab;)2, and Fv fragments, single chain mutants, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as that antibody exhibits the desired biological activity.
- the antibody can be of any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, or subclasses (isotypes) thereof (e.g.
- IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively.
- the different classes of immunoglobulin have different and well known subunit structures and three-dimensional configurations.
- Antibodies used in the invention can be naked or conjugated to other molecules such as toxins, radioisotopes, to form Antibody Drug Conjugates (ADC).
- ADC Antibody Drug Conjugates
- antibody or “immunoglobulin” are used interchangeably herein, and include whole antibodies and any antigen binding fragment or single chains thereof.
- a typical whole antibody comprises at least two heavy (H) chains and two light (L) chains interconnected by disulphide bonds.
- Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
- the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
- Each light chain is comprised of a light chain variable region (abbreviated as VL) and a light chain constant region.
- the light chain constant region is comprised of one domain, CL.
- VH and VL regions can be further subdivided into regions of hypervariability, termed Complementary Determining Regions (CDR), interspersed with regions that are more conserved, termed framework regions (FW).
- CDR Complementary Determining Regions
- FW framework regions
- Each VH and VL is composed of three CDRs and four FWs, arranged from amino-terminus to carboxy-terminus in the following order: FWl, CDRl, FW2, CDR2, FW3, CDR3, FW4.
- the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues and factors, including various cells of the immune system (e.g. effector cells) and the first component (Clq) of the classical complement system.
- Exemplary antibodies of the present disclosure include typical antibodies, scFvs, and combinations thereof where, for example, an scFv is covalently linked (for example, via peptidic bonds or via a chemical linker) to the N- terminus of either the heavy chain and/or the light chain of a typical antibody, or intercalated in the heavy chain and/or the light chain of a typical antibody.
- Additional exemplary antibodies herein include fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen recognition site.
- the term antibody also encompasses Fc fusion proteins containing immunoglobulin-derived naturally occurring and/or synthetic amino acid sequences (e.g. peptibodies) that bind an expressed peptide on a cell of interest to be targeted (e.g. PD-L2).
- antigen binding fragment refers to a portion of an intact antibody and/or refers to the antigenic determining variable regions of an intact antibody. It is known that the antigen binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2 and Fv fragments, linear antibodies, single chain antibodies, diabodies, and multispecific antibodies formed from antibody fragments.
- the antibodies used according to the disclosed methods have reduced effector function.
- the antibodies contain mutations in the Fc region responsible for effector function.
- the antagonist is an anti-PD-L2 antibody or antigen binding fragment thereof.
- PD-L2 Compared to PD-L1, constitutive basal expression of PD-L2 is low and it was initially believed to be restricted to professional APCs such as macrophages and dendritic cells, although in recent years it has been found that PD-L2 is also expressed in a variety of non-professional APCs including keratinocytes, endothelial cells, astrocytes, fibroblast and oligodendrocytes (Rozali et al., 2012). As a result, no therapeutic uses for anti-PD-L2 antibodies have previously been described.
- the present invention offers an unprecedented non-cytotoxic solution for the elimination of damaged and/or senescent cells and provides a therapeutic indication for antagonists of the PD-L2/PD-1 interaction, particularly anti-PD-L2 antibodies: to break the immunotolerance that prevents the elimination of senescent and/or damaged cells by the immune system in multiple human diseases.
- antagonists of the PD-L2/PD-1 interaction can be readily identified and prepared using techniques known in the art and then used for eliminating damaged and/or senescent cells now that the inventors have shown that such cells upregulate their expression of PD-L2.
- Other antagonists that could be used in the present invention include proteins, peptides, chemical compounds, genetic material, small molecules, drugs or RNAi reagents; anything that is able to disrupt or prevent the ligand/receptor interaction.
- the antagonists are antibodies, previously known antibodies against PD-1 or preferably PD-L2, particularly commercially available antibodies, can be used, provided that it is previously confirmed that the inhibit the interaction of PD-L2 and PD-1.
- the commercial antibodies anti-mouse PD-L2 (clone TY25) (cat. #BE0112, Bio X Cell, USA) or the anti-human antibodies MABC969 anti-PD-L2 antibody, clone 24F.10C12 (cat.
- Antibodies against PD-1 or, preferably, PD-L2 can be raised according to known methods, such as those mentioned in classic laboratory manuals as "Antibodies: A Laboratory Manual, Second edition", edited by E.A. Greenfield in 2014, by administering PD-1 or PD-L2 whole protein or a fragment or epitope thereof to a host animal which is a different from the mammal where the therapeutic effect is sought.
- Monoclonal antibodies in particular can be prepared and isolated by any technique that provides for the production of antibody molecules by continuous cell lines in culture, such as the hybridoma technique originally described by Kohler and Milstein (1975), the human B-cell hybridoma technique (Cote et al., 1983), or the EBV-hybridoma technique (Cole et al, 1985).
- Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to the PD-1 receptor or PD-L2 ligand.
- the DNA sequence (2115 base pairs) corresponding to the mRNA of human Programmed Cell Death Protein 1 (PD-1) (GenBank accession no. NM 005018, version NM 005018.1) is provided in SEQ ID NO: l and is also shown in Fig. 10A.
- the protein sequence (288 amino acids) of human Programmed Cell Death Protein 1 (PD-1) is shown in SEQ ID NO:2 and Fig. 10B, and can be also found using NCBI accession no. NP 005009, version NP 005009.1).
- the DNA sequence (2418 base pairs) of human Programmed Death Ligand 2 (PD- L2) (GenBank accession no. NM 025239, version NM 025239.2) is provided in SEQ ID NO: 3 and is also shown in Fig. 11 A.
- the protein sequence (288 amino acids) of or human Programmed Death Ligand 2 (PD-L2) or human Programmed Cell Death 1 ligand 2 (PDCD1LG2) is shown in SEQ ID NO:4 and in Fig. 11B, and can be also found using NCBI accession no. NP 0079515, version NP_079515.2.
- Antibodies that are intended for use in human beings can have been generated in a non-human immune system, such as in mice, but humanization can be necessary to enable their administration to human beings, in order to avoid adverse reactions.
- Humanized antibodies are antibodies, usually monoclonal antibodies, initially generated in a non- human species and whose protein sequences have been modified to increase their similarity to antibody variants produced naturally in humans, so that minimal sequence derived from non-human immunoglobulins remain. Even after humanization, the amino acid sequence of humanized antibodies is partially distinct from antibodies occurring naturally in human beings.
- kidney fibrosis the animal model of kidney fibrosis might be used both for confiming PD-L2 overexpression before treatment and, thereafter, verifying that the administration of the PD-L2 antagonist, such as an antibody, ameliorates the symptoms of the disease, including a decrease of damaged and/or senescent cells.
- the PD-L2 antagonist such as an antibody
- xenografts for instance, melanoma grafts
- animal models for instance, rats
- a chemotherapeutic agent such as, for instance, doxorubicin
- a PD-L2 antagonist such as an anti-PD-L2 antibody (previously known, even commercially available, or newly developed)
- observing a reduction of tumour volume including the elimination of senescent cells, will be a good support for the antagonist being considered a candidate for clinical trials where its therapeutic effect in the treatment of cancer, particularly in combination with a chemotherapeutic agent, is finally confirmed.
- Such antagonists may be suitable for use in treating any condition where it is desired to eliminate damaged and/or senescent cell, or to treat, ameliorate or prevent a disease characterised by the presence of damaged and/or senescent cells.
- diseases include, for example, degenerative diseases, type 2 diabetes, sarcopenia, cataracts, radiation-induced oral mucositis, brain and heart aneurysms, glaucoma, Alzheimer's disease, Parkinson's disease, cystic fibrosis, intestinal bowl disease, osteoarthritis and inverted disc degeneration.
- Fibrotic diseases are an example of degenerative diseases characterized by the abnormal deposition of extracellular matrix proteins, most notably collagen, that obliterate the architecture and function of the underlying organ or tissue. These diseases affect a large number of people but presently no current treatment has proven to be effective in preventing their progression.
- Fibrosis can occur in many tissues within the body, typically as a result of inflammation or damage.
- fibrotic diseases are systemic sclerosis, pulmonary fibrosis, kidney fibrosis, heart fibrosis and liver fibrosis, brain glial scar and atherosclerosis.
- SASP secreted factors
- senescent cells cause chronic inflammation that is largely responsible for the symptoms and progression of these pathologies. Consequently, targeting senescent cells offers the potential of a promising therapeutic approach for fibrotic diseases.
- Damaged and/or senescent cells are also present in benign lesions such as nevi and skin scars post-wound healing.
- the present invention also relates to cosmetic improvements in skin, for example, the removal of moles, which contain melanocytic nevi that have undergone senescence.
- an additional aspect of the invention is a method for cosmetic improvement of the skin, including the removal of moles from the skin of a subject, which method comprises administering to the subject an antagonist of the PD-L2/PD-1 interaction.
- Damaged and/or senescent cells also accumulate in aged organisms and negatively influence lifespan; thus, the use of the antagonist of the PD-L2/PD-1 interaction (and, consequently, the methods of eliminating damaged and/or senescent cells of an organism which comprise contacting the cells with an antagonist of the PD-L2/PD-1 interaction) can have a double effect with regard to ageing: a therapeutic effect, mainly with regard to diseases, disorders or conditions closely associated to ageing, such as degenerative diseases, an also a non-therapeutic effect, related to the increase of lifespan, reducing biological ageing and/or the amelioration or removal of ageing effects such as aesthetic effects or mobility that do not reach a pathological level; which double effect is also inherent in the use of a compound as a senolytic, in accordance with the definition of senolytic given herein.
- an aspect of the invention is also a method for increasing lifespan and/or ameliorating or removing non-pathological effects of biological ageing in a subject, which method comprises administering to the subject an antagonist of the PD- L2/PD-1 interaction, particularly when the subject is an adult (older than 18 years in the case of human subjects) or an aged adult (an individual who is older than the period of life during which the individuals of its species are generally healthy and free of chronic illness, which, in the case of human beings, means usually at least older than 25 and, more frequently, at least older than 40).
- the present invention can, therefore, also be used for the alleviation of the side effects of and/or accelerated ageing caused by treatment with chemotherapy or radiotherapy, which inflicts damage on non-cancerous, healthy tissue and drives cellular senescence in these tissues, which play a pathological role in these side effects.
- the invention also encompasses the use of PD-L2/PD-1 antagonists in combination with other compounds, treatments or agents that are known to drive cellular damage or senescence, including any kind of radiation, both the non-medical radiation and the "medical" radiation applied with a medical purpose (such as a diagnostic objective, as X-rays, or a therapeutic objective, as radiotherapy applied in cancer or in some skin disorders).
- an antagonist of the PD-L2/PD-1 interaction for use in combination with chemotherapy, radiotherapy and/or any other drugs, treatments or agents that promote damaged and/or senescent cells, such as anti- retroviral drugs, corticoids, PPAR gamma agonists and/or exposure to radiation non- intended for cancer therapy.
- “combination” comprises the simultaneous administration of the drug, treatment or agent together with the antagonist of the PD-L2/PD-1 interaction, but also the administration of the antagonist of the PD- L2/PD-1 interaction subsequently.
- Damaged and/or senescent cells are also produced in response to cancer therapy- induced genotoxic stress produce by, for example, standard radiotherapy and chemotherapy used to treat cancer, and have been shown to have a negative impact on tumour regression and a detrimental effect on the health of cancer survivors.
- Chemotherapeutic drugs such as palbociclib, ribociclib and abemaciclib, which are selective inhibitors against CDK4 and CDK6 kinases, induce a senescent response in most tumor cells.
- additional senescence-inducing chemotherapies are likely to be developed in the future.
- the present invention can, therefore, also be used for the treatment of cancer, and in particular the selective elimination of residual cancer cells which have survived prior chemotherapy treatment. Residual cancer cells that have survived prior chemotherapy treatment may experience elevated ?-galactosidase and/or a- fucosidase activity, as a result of DNA damage that triggers the cellular senescence program.
- the present invention can, therefore, be used in relation to the above diseases and conditions, and could even be used in combination with chemotherapies in order to increase their therapeutic efficacy.
- the present invention can also be used for the removal of senescent cells following treatment with anti-retroviral drugs, which can cause subcutaneous lipolysis, metabolic dysfunction, and accelerated ageing.
- anti-retroviral drugs may include abacavir, azacytidine, azidothymidine (AZT), dideoxycytidine, efavirenz, invirase, ixabepilone, lamivudine (3TC), lopinavir, nevirapine, ritonavir, stavudine, tenofovir, tipranavir, or thiotepa.
- the present invention can also be used for the removal of senescent cells following treatment with corticoids including Cortisol, prednisone, prednisolone, dexamethasone, triamcinolone, beclometasone, fludrocortisone, deoxycorticosterone, and aldosterone.
- corticoids including Cortisol, prednisone, prednisolone, dexamethasone, triamcinolone, beclometasone, fludrocortisone, deoxycorticosterone, and aldosterone.
- Treatment with these corticoids can lead to cellular senescence and tissue degeneration, for example in tendons following dexamethasone administration, metabolic dysfunction such as obesity and insulin resistance.
- the present invention can also be used for the removal of senescent cells following long term use of PPAR gamma agonists, including thiazolidinediones such as rosiglitazone, pioglitazone, and troglitazone.
- PPAR gamma agonists including thiazolidinediones such as rosiglitazone, pioglitazone, and troglitazone.
- the present invention can also be used for the treatment of cellular hypertrophy, including cardiac hypertrophy. Senescent cells retain growth factor signaling, but being unable to undergo division, continue to enlarge and undergo hypertrophy. Senescent cells frequently experience constitutive mammalian target of rapamycin (mTOR) complex activation.
- mTOR mammalian target of rapamycin
- the present invention can also be used for the treatment of chronic inflammation, caused by cytokines released as part of the SASP from senescent cells.
- the present invention also relates to reducing the side effects of an accelerated ageing caused by exposure to radiation (both medical and non-medical radiation), which causes DNA damage and cellular senescence, with subsequent release of SASP cytokines.
- Senescence may be caused by various forms of radiation including alpha radiation, beta radiation, gamma radiation. Examples include exposure to medical x-rays, PET scans, CT scans; nuclear radiation such as from nuclear fallout or nuclear accidents, UV radiation from sun exposure or other UV sources, cosmic radiation from extended time at high altitudes (e.g. pilots and aeroplane attendants, frequent aeroplane travelers, astronauts), and medical radiotherapy.
- a method of eliminating damaged and/or senescent cells comprising administering to a subject a therapeutically effective amount of an antagonist of the PD- L2/PD-1 interaction.
- a method of treating, ameliorating or preventing a disease or condition characterized by the presence of damaged and/or senescent cells comprising administering to a subject in need thereof such treatment, a therapeutically effective amount of an antagonist of the PD- L2/PD-1 interaction.
- antagonists according to the invention may be used in a medicament, which may be a monotherapy (i.e. the sole use of that antagonist or medicament), for eliminating damaged and/or senescent cells or for treating, ameliorating or preventing a disease characterized by the presence of damaged and/or senescent cells.
- antagonists according to the invention may be used as an adjunct to, or in combination with, known therapies for eliminating damaged and/or senescent cells or for treating, ameliorating or preventing a disease characterized by the presence of damaged and/or senescent cells.
- the antagonist may be used in combination with known agents for treating pulmonary fibrosis, such as corticosteroids.
- the antagonists of the invention may be used in combination with known techniques for treating cancer, such as chemotherapy and/or radiotherapy.
- compositions having a number of different forms depending, in particular, on the manner in which the composition is to be used.
- the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposome suspension or any other suitable form that may be administered to a person or animal in need of treatment.
- vehicle of medicaments according to the invention should be one which is well-tolerated by the subject to whom it is given.
- Medicaments comprising antagonists according to the invention may be used in a number of ways.
- oral administration may be required, in which case the antagonists may be contained within a composition that may, for example, be ingested orally in the form of a tablet, capsule or liquid.
- Compositions comprising antagonists of the invention may be administered by inhalation (for example, intranasally).
- Compositions may also be formulated for topical use. For instance, creams or ointments may be applied to the skin, for example, adjacent the treatment site.
- Antagonists according to the invention may also be incorporated within a slow- or delayed-release device.
- Such devices may, for example, be inserted on or under the skin, and the medicament may be released over weeks or even months.
- the device may be located at least adjacent the treatment site.
- Such devices may be particularly advantageous when long-term treatment with antagonists used according to the invention is required and which would normally require frequent administration (for example, at least daily injection).
- antagonists and compositions according to the invention may be administered to a subject by injection into the blood stream or directly into a site requiring treatment. Injections may be intravenous (bolus or infusion) or subcutaneous (bolus or infusion), or intradermal (bolus or infusion).
- the amount of antagonist that is required is determined by its biological activity and bioavailability, which in turn depends on the mode of administration, the physio chemical properties of antagonist, and whether it is being used as a monotherapy or in a combined therapy.
- the frequency of administration will also be influenced by the half-life of the antagonist within the subject being treated.
- Optimal dosages to be administered may be determined by those skilled in the art, and will vary with the particular antagonist in use, the strength of the pharmaceutical composition, the mode of administration, and the advancement of the disease or condition being treated. Additional factors depending on the particular subject being treated will result in a need to adjust dosages, including subject age, weight, gender, diet and time of administration.
- a daily dose of between 0.001 ⁇ g/kg of body weight and 10 mg/kg of body weight of the antagonist according to the invention may be used for eliminating damaged and/or senescent cells or for treating, ameliorating or preventing a disease characterized by the presence of damaged and/or senescent cells, depending upon which antagonist is used. More preferably, the daily dose is between 0.01 ⁇ g/kg of body weight and 1 mg/kg of body weight, more preferably between 0.1 ⁇ g/kg and 100 ⁇ g/kg body weight, and most preferably between approximately 0.1 ⁇ g/kg and 10 ⁇ g/kg body weight.
- the antagonists may be administered before, during or after onset of the condition or disease characterized by the presence of damaged and/or senescent cells.
- Daily doses may be given as a single administration (for example, a single daily injection).
- the antagonists may require administration twice or more times during a day.
- antagonists may be administered as two (or more, depending upon the severity of the bacterial infection being treated) daily doses of between 0.07 ⁇ g and 700 mg (i.e. assuming a body weight of 70 kg).
- a patient receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two-dose regime) or at 3- or 4-hourly intervals thereafter.
- a slow release device may be used to provide optimal doses of antagonists according to the invention to a patient without the need to administer repeated doses.
- a damaged and/or senescent cells-treatment composition comprising an antagonist of the PD-L2/PD-1 interaction and a pharmaceutically acceptable vehicle.
- damaged and/or senescent cells-treatment composition can mean a pharmaceutical formulation used in the therapeutic amelioration, prevention or treatment of any disease or condition characterised by the presence of damaged and/or senescent cells in a subject.
- the invention also provides, in an additional aspect, a process for making the damaged and/or senescent cells-treatment composition according to the fourth aspect, the process comprising contacting a therapeutically effective amount of an antagonist of the PD-L2/PD-1 interaction and a pharmaceutically acceptable vehicle.
- a “therapeutically effective amount” of an antagonist of the invention is any amount which, when administered to a subject, is the amount of antibody that is needed to eliminate damaged and/or senescent cells, or produce the desired effect.
- the therapeutically effective amount of antagonist used may be from about 0.001 mg to about 1000 mg, and preferably from about 0.01 mg to about 500 mg. It is preferred that the amount of agent is an amount from about 0.1 mg to about 100 mg, and most preferably from about 0.5 mg to about 50 mg. As a guide, the dose of antibody used in the Examples described herein was 40 mg/kg.
- a "pharmaceutically acceptable vehicle” as referred to herein, is any known compound or combination of known compounds that are known to those skilled in the art to be useful in formulating pharmaceutical compositions.
- compositions and medicaments according to the invention may be used to treat any mammal, for example livestock (for example, cattle), pets, or may be used in other veterinary applications. Most preferably, though, the subject is a human being.
- the pharmaceutically acceptable vehicle may be a solid, and the composition may be in the form of a powder or tablet.
- a solid pharmaceutically acceptable vehicle may include one or more substances which may also act as flavoring agents, lubricants, solubilisers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, dyes, coatings or tablet-disintegrating agents.
- the vehicle may also be an encapsulating material.
- the vehicle is a finely divided solid that is in admixture with the finely divided active agents according to the invention.
- the active agent may be mixed with a vehicle having the necessary compression properties in suitable proportions and compacted in the shape and size desired.
- the powders and tablets preferably contain up to 99% of the active agents.
- Suitable solid vehicles include, for example calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low melting waxes and ion exchange resins.
- the pharmaceutical vehicle may be a gel and the composition may be in the form of a cream or the like.
- the pharmaceutical vehicle may be a liquid, and the pharmaceutical composition is in the form of a solution.
- Liquid vehicles are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions.
- the active agent according to the invention may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats.
- the liquid vehicle can contain other suitable pharmaceutical additives such as solubilisers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickening agents, colours, viscosity regulators, stabilisers or osmo-regulators.
- liquid vehicles for oral and parenteral administration include water (partially containing additives as above, for example, cellulose derivatives, preferably sodium carboxymethyl cellulose solution), alcohols (including monohydric alcohols and polyhydric alcohols, for example, glycols) and their derivatives, and oils (for example, fractionated coconut oil and arachis oil).
- the vehicle can also be an oily ester such as ethyl oleate and isopropyl myristate.
- Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration.
- the liquid vehicle for pressurised compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.
- Liquid pharmaceutical compositions which are sterile solutions or suspensions, can be utilised by, for example, intramuscular, intrathecal, epidural, intraperitoneal, intravenous and particularly subcutaneous injection.
- the antagonist may be prepared as a sterile solid composition that may be dissolved or suspended at the time of administration using sterile water, saline or other appropriate sterile injectable medium.
- the antagonists and compositions of the invention may be administered orally in the form of a sterile solution or suspension containing other solutes or suspending agents (for example, enough saline or glucose to make the solution isotonic), bile salts, acacia, gelatin, sorbitan monoleate, polysorbate 80 (oleate esters of sorbitol and its anhydrides copolymerized with ethylene oxide) and the like.
- the antagonists used according to the invention can also be administered orally either in liquid or solid composition form.
- Compositions suitable for oral administration include solid forms, such as pills, capsules, granules, tablets and powders, and liquid forms, such as solutions, syrups, elixirs and suspensions.
- Forms useful for parenteral administration include sterile solutions, emulsions and suspensions.
- nucleic acid or peptide or variant, derivative or analogue thereof which comprises substantially the amino acid or nucleic acid sequences of any of the sequences referred to herein, including functional variants or functional fragments thereof.
- substantially the amino acid/nucleotide/peptide sequence can be a sequence that has at least 40% sequence identity with the amino acid/nucleotide/peptide sequences of any one of the sequences referred to herein, for example 40%> identity with the sequences referred to herein.
- amino acid/nucleotide/peptide sequences with a sequence identity which is greater than 50%, more preferably greater than 65%, 70%, 75%, and still more preferably greater than 80%) sequence identity to any of the sequences referred to herein are also envisaged.
- the amino acid/nucleotide/peptide sequence has at least 85% identity with any of the sequences referred to, more preferably at least 90%>, 92%, 95%, 97%, 98%, and most preferably at least 99% identity with any of the sequences referred to herein.
- the percentage identity for two sequences may take different values depending on: (i) the method used to align the sequences, for example, ClustalW, BLAST, FASTA, Smith- Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local versus global alignment, the pair-score matrix used (for example, BLOSUM62, PAM250, Gonnet etc.) and gap-penalty, for example, functional form and constants.
- the method used to align the sequences for example, ClustalW, BLAST, FASTA, Smith- Waterman (implemented in different programs), or structural alignment from 3D comparison
- the parameters used by the alignment method for example, local versus global alignment, the pair-score matrix used (for example, BLOSUM62, PAM250, Gonnet etc.) and gap-penalty, for example, functional form and constants.
- percentage identity between the two sequences. For example, one may divide the number of identities by: (i) the length of shortest sequence; (ii) the length of alignment; (iii) the mean length of sequence; (iv) the number of non-gap positions; or (iv) the number of equivalenced positions excluding overhangs. Furthermore, it will be appreciated that percentage identity is also strongly length-dependent. Therefore, the shorter a pair of sequences is, the higher the sequence identity one may expect to occur by chance.
- calculation of percentage identities between two amino acid/nucleotide/peptide sequences may then be calculated from such an alignment as (N/T)*100, where N is the number of positions at which the sequences share an identical residue, and T is the total number of positions compared including gaps but excluding overhangs.
- Alternative methods for identifying similar sequences will be known to those skilled in the art.
- a substantially similar nucleotide sequence will be a sequence which hybridises to a nucleotide sequence encoding a peptide according to the first aspect, or a functional fragment or functional variant thereof, or their complements, under stringent conditions.
- stringent conditions is meant that the nucleotide hybridises to filter-bound DNA or RNA in 3x sodium chloride/sodium citrate (SSC) at approximately 45 °C followed by at least one wash in 0.2x SSC/0.1% SDS at approximately 20-65 °C.
- a substantially similar peptide may differ by at least 1, but less than 3, 4, 5, 6, 7, 8, 9 or 10 amino acids from the sequences shown.
- nucleic acid sequence described herein could be varied or changed without substantially affecting the sequence of the peptide, polypeptide or protein encoded thereby, to provide a functional variant thereof.
- Suitable nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent change.
- Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change.
- small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine.
- Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine.
- the polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine.
- the positively charged (basic) amino acids include lysine, arginine and histidine.
- the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will know the nucleotide sequences encoding these amino acids.
- a monoclonal antibody that is an antagonist of the PD-12/PD-1 interaction.
- the antibody is an antibody or an antigen-binding fragment thereof that specifically binds to PD-L2 and/or PD-1 and interferes with the interaction between these two proteins. Even more preferably, the antibody is an antibody or an antigen-binding fragment thereof that specifically binds to PD-L2 and blocks its binding to its receptor PD-1.
- damaged and/or senescent cells upregulate their expression of PD-L2
- a biomolecule that binds to PD-L2 and/or by analyzing mRNA levels This in turn facilitates the diagnosis of chronic diseases and conditions that result from the accumulation of such cells, such as, for example, those referred to above.
- biomolecule that binds to PD-L2 or to PD-L2 mRNA for use in identifying damaged and/or senescent cells.
- a method of identifying damaged and/or senescent cells comprising administering a biomolecule that binds to of PD-L2 or PD-L2 mRNA and detecting whether the agent has bound to PD-L2 or PD-L2 mRNA.
- the inventors have consistently observed the up- regulation of PD-L2 in damaged and/or senescence cell found in a variety of primary and tumor cell lines as well as in in vivo models of senescence. These observations imply that PD-L2 mRNA or protein levels could be used as biomarkers for the identification of damaged and/or senescent cells. Moreover, these observations strongly suggest that damaged and/or senescent cells may evade the immune system by inducing the expression of PD-L2, thus inhibiting immune cell activation via PD-1 receptors.
- SK-Mell03 human melanoma
- C2C12 mouse myoblasts
- HcMe and HcMell2 (mouse melanoma metastatic cells from B57BL6 mice) described in (Landsberg et al, 2012) were provided by Dr. Thomas Tilting (University of Bonn, Germany).
- UT-SCC-38 and UT-SCC42-B cell lines (human HNSCC cells derived from primary lesions) were provided by Dr. Reidar Grenman (University of Turku, Finland) and have been previously described (Grenman et al, 1991; Pekkola-Heino et al, 1994, 1995).
- HcMel3 and HcMell2 cells were maintained in RPMI (Gibco). The rest of the cell lines were maintained in DMEM (Gibco). All media were supplemented with 10% fetal bovine serum (Gibco) with antimicotic-antibiotic (Gibco), and incubated in 20% 0 2 sand 5% C0 2 at 37 °C.
- the anti-53BPl antibody was purchased to Abeam (abl72580), anti-PD-L2 (D7U8CTM) antibody was obtained from Cell Signaling (cat# 82723), anti-SMC 1 antibody was from Bethyl laboratories (A300-056A) and Ki67 antibody from Master Diagnostica (0003110QD).
- Palbociclib (PD 0332991) was purchased to Selleckchem (#S1 116); Nutlin was obtained from Sigma (NG287); Doxorubicin was purchased to Pharmacia and Upjohn. Bleomycin was obtained from Sigma (B8416). Rapamycin, rotenone and metformin were obtained from Sigma (53123-88-9, 83-79-4 and 1115-70-4 respectively); IKK inhibitor (BAY 11-7082) was obtained from Selleck Chemicals (cat# S2913); JAK2 inhibitor (NVP-BSK805) was from ApexBio (cat# A3675) and PIM inhibitor (ETP-47995) was synthesized in the CNIO. Mouse TLR agonists were purchased from InvivoGen (Mouse TLR 1-9 agonist kit).
- the cDNA synthesis was performed with the "iScript Advanced cDNA Synthesis kit" from BIO-RAD (#1725037).
- the quantitative real-time PCR reaction was carried out with "GoTaq qPCR Master Mix” (Promega #A6002) in a 7500 Fast Real-Time PCR System (Applied Biosystems) using "MicroAmp Fast Optical 96-well reaction plate with barcode” (Thermo Fisher #4346906) and "MicroAmp Optical adhesive film” (Thermo Fisher #4311971).
- ⁇ -actin forward (SEQ ID NO:5): 5 -CAAGGCCAACCGCGAGAAGAT-3
- ⁇ -actin reverse (SEQ ID NO:6): 5 -CCAGAGGCGTACAGGGATAGCAC-3 '
- PD-L1 forward (SEQ ID NO:7): 5 -TGGCATTTGCTGAACGCATTT-3 '
- PD-L1 reverse (SEQ ID NO:8): 5 -TGCAGCCAGGTCTAATTGTTTT-3 '
- PD-L2 forward (SEQ ID NO:9): 5 -ATTGCAGCTTCACCAGATAGC-3 '
- PD-L2 reverse (SEQ ID NO: 10): 5 -AAAGTTGCATTCCAGGGTCAC-3 '
- TBP forward (SEQ ID NO: l 1): 5 -ATCAGTGCCGTGGTTCGT-3
- TBP reverse (SEQ ID NO: 12): 5 -TTCGGAGAGTTCTGGGATTG-3 '
- GAPDH forward (SEQ ID NO: 15): 5 -TTCACCACCATGGAGAAGGC-3
- GAPDH reverse (SEQ ID NO: 16): 5 -CCCTTTTGGCTCCACCCT-3 '
- PD-L1 forward (SEQ ID NO: 17): 5 ' - AGTCAATGCCCCATACCGC -3 '
- PD-L1 reverse (SEQ ID NO: 18): 5 '- TTCTGGATAACCCTCGGCCT -3 ' PD-L2 forward (SEQ ID NO: 19): 5 ' - CAAGCCTCAGCCTAGCAGAA -3 '
- PD-L2 reverse (SEQ ID NO:20): 5 ' - TCCATCCGACTCAGAGGGTC -3
- IL-6 forward (SEQ ID NO:21): 5 -GTTCTCTGGGAAATCGTGGA -3 '
- IL-6 reverse (SEQ ID NO:22): 5 -GGTACTCCAGAAGACCAGAGGA -3 '
- SK-Mel-103, UT-SCC-38 and UT-SCC-42B the cell lines were maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (Gibco) with antimycotic- antibiotic (Gibco), and incubated in 20% 0 2 sand 5% C0 2 at 37 °C.
- SK-Mel-103 and UT- SCC-42B cells were split 1 :10 every 3-4 days.
- UT-SCC-38 were split 1 :3 every 3-4 days.
- UT-SCC-42B cells were seeded into 6 well tissue culture plates (Falcon). The next day cells were treated with 2 ⁇ Palbociclib. SK-Mel-103 cells were also treated with 10 nM Doxorubicin, 1 ⁇ Nutlin or 6x10 " units/ml Bleomycin. All the cells were incubated in the presence of the senescence-inducing agents for at least 7 days without changing the media. Control cells were seeded in 6 well plates 24-48 hours prior the SA- ? gal assay.
- Embedded cryosections of control and palbociclib treated tumors were stained using the Senescence ⁇ -Galactosidase Staining Kit (Cell Signaling #9860). Tumors were fixed with a solution containing 2 % formaldehyde and 0.2 % glutaraldehyde in PBS for 10 minutes. Next, samples were washed three times with PBS and stained with X-gal staining solution (adjusted to pH 6.0) over night (16 hours).
- SK-Mel-103, UT-SCC-38 and UT-SCC-42B were seeded in 10 cm dishes and incubated with the indicated senescence-inducing agents at the following concentrations: 2 ⁇ Palbociclib, 10 nM Doxorrubicin, 1 ⁇ Nutlin and 6x10 " units/ml Bleomycin. Treated cells were not further split and their media was not changed for the duration of the treatment. Control cells were split every 3-4 days as previously described. One week after the start of the treatment, total RNA was isolated from control and treated cells with TRI Reagent (Sigma- Aldrich #T9424) following the manufacturer instructions.
- C2C12 cells (Fig. 9) were treated with 500 nM doxorubicin for 48 hours in the presence or absence of the following inhibitors at the indicated concentrations: IKKi ( 50 ⁇ ), PIMi (1 ⁇ ), rotenone (1 ⁇ ), JAKi (3 ⁇ ), rapamycin (50 nM) and metformin (5 mM) or cultured in pyruvate-depleted media (Fig. 9A).
- C2C12 cells were incubated for 6 hours in the presence or absence of TLRs agonists (Mouse TLR1-9 Agonist kit.
- TLR1/2 agonist Pam3CSK4, 300 ng/ml
- TLR2 agonist HKLM, 10 8 cells/ml
- TLR3 agonist Poly (I:C) HMW and Poly (I:C) LMW, 10 ⁇ g/ml
- TLR4 agonist LPS-EK, 10 ⁇ g/ml
- TRL5 agonist FLA-ST, 1 ⁇ g/ml
- TRL6/2 agonist FSL-1, 100 ng/ml
- TRL7 agonist ssRNA40, 5 ⁇ g/ml
- TLR9 agonist ODN1826, 5 ⁇ .
- Total RNA was isolated using TRI Reagent (Sigma-Aldrich #T9424) according to the manufacturer's instructions.
- Reactions were performed in triplicate in a 15 ⁇ volume reaction mix prepared as follow: 7.5 ⁇ 2X GoTaq qPCR Master Mix; 0.6 ⁇ of pre-mixed primers (10 ⁇ forward primer and 10 ⁇ reverse primer); 1.9 ⁇ nuclease-free water and 5 ⁇ template cDNA (previously diluted 1 : 10).
- the qRT-PCR reaction was performed on a 7500 Fast Real-Time PCR System (Applied Biosystems) using "MicroAmp Fast Optical 96-well reaction plate with barcode” (Thermo Fisher #4346906) and "MicroAmp Optical adhesive film” (Thermo Fisher #4311971).
- the reaction consisted in two holding stages (50 °C for 2:00 min and 95°C for 10:00 min) and 40 amplification reactions (95 °C for 00 : 15 min/ 60°C for 01 : 00 min/ 72 °C for 00:30 min) followed by a Melt Curve Stage.
- the Ct values of the genes of interest were averaged and normalized to the housekeeping gene ⁇ -actin. For each cell line and condition at least two independent experiments were performed.
- RNA was synthesized using 2 ⁇ g of total RNA. cDNA synthesis and RT-qPCR were performed as previously described. The Ct values of the genes of interest were averaged and normalized to the housekeeping gene ⁇ -actin.
- Fig. 5B For gene expression analysis lungs were isolated and embedded in optimal cutting temperature (OCT) compound (Leica Biosystems). To obtain total RNA of OCT embedded tissue samples, 10 cryostat sections of 10 ⁇ thickness were cut and excess OCT were removed. Cryosections were lysed in TRI Reagent (Sigma-Aldrich #T9424), pooled and processed according to manufacturer's instructions. cDNA was synthesized using 2 ⁇ g of total RNA. cDNA synthesis and RT-qPCR were performed as previously described. The Ct values of the genes of interest were averaged and normalized to the housekeeping gene Gapdh.
- OCT optimal cutting temperature
- RNA Tumours were isolated and embedded in optimal cutting temperature (OCT) compound (Leica Biosystems). To obtain total RNA 10 cryosections of 10 ⁇ thickness were cut and the excess OCT was removed. Cryosections were then pooled and lysed in TRI Reagent (Sigma-Aldrich #T9424) for total RNA and processed according to manufacturer's instructions. Two ⁇ g of total RNA was used to synthesize cDNA and RT- qPCR was performed as previously described. Human specific primers for PD-L1 and PD- L2 were used. The Ct values of the genes of interest were averaged and normalized to the housekeeping gene TPB.
- OCT optimal cutting temperature
- RNA samples from young mice (10 weeks of age) and old mice (75 weeks of age) were collected and embedded in optimal cutting temperature (OCT) compound (Leica Biosystems).
- OCT optimal cutting temperature
- 10 cryostat sections of 10 ⁇ thickness were cut and excess OCT were removed.
- Cryosections were lysed in TRI Reagent (Sigma-Aldrich #T9424), pooled and processed according to manufacturer's instructions.
- cDNA was synthesized using 2 ⁇ g of total RNA.
- cDNA synthesis and RT- qPCR were performed as previously described. The Ct values of the genes of interest were averaged and normalized to the housekeeping gene ⁇ -actin.
- OCT optimal cutting temperature
- 10 cryosections of 10 ⁇ thickness were cut and the excess OCT was removed. Cryosections were then pooled and lysed in RIPA lysis buffer (150 mM sodium chloride, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) containing protease inhibitors for protein lysates. Samples were sonicated 5 minutes (30 sec. on/off), resuspended in sample buffer and denatured for 5 minutes at 95 °C. Equal amounts of protein lysates were separated on 4-12% NuPAGE gels (Invitrogen).
- Proteins were transferred to nitrocellulose membrane (GE Healthcare) and membranes were incubated with the anti- PD-L2 (1 : 1000) (D7U8CTM; Cell Signaling cat# 82723) or anti-SMCl (1 : 1000) (Bethyl laboratories, A300-056A).
- SK-Mel-103 cells were seeded at 50% confluency on round 12 mm diameter coverslips (Marienfeld #0111520) previously placed inside 24 well plates. The following day, cells were treated with the senescence-inducing agents: 2 ⁇ Palbociclib, 10 nM, 1 ⁇ Nutlin and 6x10 " units/ml Bleomycin. Treated cells were not further split and their media was not changed for the duration of the treatment (7 days). Control cells were seeded similarly to treated, cells 24-48 hours prior the beginning of the procedure. Seven days after addition of the senescence-inducing agents, control and treated cells were washed with IX PBS and Fixed on 2% paraformaldehyde-PBS for 10 minutes.
- the cells were then permeabilized with 0.25% Triton-PBS for 5 minutes, washed twice with lx PBS and blocked with 5% BSA-PBS for 30 minutes. Next, the cells were incubated for 30 minutes with anti-53BPl antibody (Abeam #abl72580) previously diluted 1 : 100 in blocking buffer (5% BSA-PBS), washed 3 times for 10 minutes with IX PBS and incubated in the dark for 30 additional minutes with the secondary antibody: goat anti- rabbit Alexa Fluor 546 (ThermoFisher #A-11010) diluted 1 :400 in blocking buffer.
- anti-53BPl antibody Abeam #abl72580
- the cells were washed again 3 times for 10 minutes with IX PBS and incubated with DAPI (Sigma # D9542) 300 nM in IX PBS for 10 minutes. All the incubations and washed were performed at room temperature in 24 well plates.
- the coverslips were carefully removed from the 24 well plates and placed outside down on glass slides (Menzel-Glaser #0111520) over a drop of ProLong Gold anti-fade reagent (Invitrogen # P36930). The glass slides were stored in the dark at room temperature for at least 24 hours to allow the anti-fade to dry and subsequently images of the immunostained nuclei were acquired with a SP5-MP Confocal microscope (Leica).
- tumours were fixed in formalin and embedded in paraffin blocks. Sections were then stained with Ki67 following standard procedures. Animal procedures
- UUO Unilateral ureteral obstruction
- Kidney fibrosis was induced in C57BL6 mice (EN VIGO) by the surgical obstruction of the left ureteral conduct (UUO). Briefly, mice were anesthetized and surgical incisions were made to access the abdominal cavity. Subsequently, two ligations of the left ureter were made with a 6/0 silk (LA BOUVET) close to the renal hilum. Next, the peritoneum was sutured with 3/0 silk (B. Braun Aesculap) and the skin with surgical staples. Non-operated (control) mice and mice with ligated kidneys (fibrotic) were sacrificed 10 days (Fig. 4 A) or 12-13 days (Fig. 4B) post- ligation, to analyze SA- ? galactosidase activity and gene expression respectively.
- Lung fibrosis was induced in C57BL6 mice (ENVIGO) by intratracheal delivery of a single dose of bleomycin (1.5U/kg) or vehicle (PBS). 14 days after intratracheal injection, lung samples of vehicle (control) or bleomycin (fibrotic)-treated mice were collected for the analysis of SA- ?gal activity and gene expression.
- Example 1 Evidence in cultured cells that PD-L2 is highly and preferentially expressed in damaged and or senescent cells
- the inventors have observed that prolonged treatment of tumor cell lines with palbociclib, a CDK4/CDK6 specific inhibitor developed by Pfizer, induced phenotypic changes consistent with a senescent response (increased size and flat morphology, cell cycle arrest and increased SA- ⁇ gal activity) in a variety of human tumor cells such as the melanoma SK-Mel-103 and head and neck squamous cell carcinoma (FINSCC) SCC38 and SCC42B cell lines (Figs. 1 A and 2A). Under these conditions, senescent cells showed up-regulation of PD-L2 but not PD-L1 mRNA levels (Figs. IB and 2C).
- PD-L2 mRNA up-regulation in the mouse melanoma cell lines B16F1 and B16F10 upon treatment with palbociclib or bleomycin found that short time (48 hours) treatment with the genotoxic drugs bleomycin or doxorubicin resulted in a dramatic increase in PD-L2 mRNA in the mouse myoblast cell line C2C12 (Fig. 3 A) and the mouse melanoma cell lines HcMeB and HcMell3 (Fig. 3B and 3C).
- Example 2 Evidence in preclinical models of lung and kidney fibrosis that PD-L2 is highly and preferentially expressed in damaged and or senescent cells
- Fibrotic pathologies including lung and kidney fibrosis have been recently linked to the occurrence of senescence.
- the inventors used mice models of these diseases to study the regulation of PD-L2 in vivo.
- Lung fibrosis was induced in mice by intratracheal delivery of a single dose of bleomycin.
- Kidney fibrosis was caused by the surgical obstruction of the ureteral conduct. Both lung and kidney fibrosis resulted in the accumulation of senescent cells as revealed by the detection of SA- ? galactosidase positive staining in tissue samples from fibrotic kidneys (Figs. 4A) and in whole fibrotic lungs (Fig. 5 A).
- Example 3 Evidence in preclinical models of chemotherapy that PD-L2 is highly and preferentially expressed in damaged and or senescent cells
- PD-L2 mRNA was selectively up-regulated in xenografts from palbociclib-treated mice (Fig. 7A). Accordingly, PD-L2 protein levels are also increased in senescent tumors (Fig. 7B).
- Example 4 Evidence in animal models that PD-L2 is upregulated in aged individuals
- tissue including liver
- PD-L2 mR A compared to equivalent samples from young mice (10 weeks of age)
- Fig. 8 This demonstrates in a physiological setting that PD-L2 levels are associated to the accumulation of senescent cells that is characteristic of aging.
- Example 5 Evidence of the molecular mechanism responsible for PD-L2 up- regulation in damaged/senescent cells
- the inventors prevented PD-L2 induction in vitro using commercial inhibitors against enzymes known to be involved in senescence/DNA-damage responses, such as rapamycin, rotenone, metformin, and JAK and NFkB inhibitors (Fig. 9A). They also used agonists of TLRs that activate NFkB and may mediate the autocrine and paracrine effects of the SASP (Fig. 9B).
- This experimental approach gave the inventors a first insight into the mechanism responsible for the transcriptional induction of PD-L2.
- the inventors will implement appropriate knock-do wn/activating strategies.
- Example 6 Evidence that the expression of PD-L2 ligand by damaged and/or senescent cells interferes with T cell activation in vitro
- the inventors observe the activation of human T cells (Jurkat) in the presence of control/senescent human tumor cells.
- Jurkat cells can be activated in vitro by the combination of 12-0-Tetradecanoylphorbol-13-acetate (TPA), that activates the enzyme protein kinase C, and phytohemagglutinin (PHA), a lectin that binds glycosylated proteins on the surface of immune cells.
- TPA 12-0-Tetradecanoylphorbol-13-acetate
- PHA phytohemagglutinin
- Activated T cells strongly induce IL-2; thus by analyzing IL-2 mRNA levels or by immunodetection of secreted IL-2 by ELISA, the inventors can infer the effect of co-cultured control and senescent cells in T lymphocyte activation.
- the inventors observe that PD-L2 up-regulation interferes with T cell activation and thus reduces IL2 induction. In addition, the inventors observe that the inhibitory effect of senescent cells is reversed by the presence of blocking anti-PD-1 or anti-PD-L2, but not of anti-PD-Ll, antibodies. Finally, the inventors observe from knocking-down PD-L2 using lentiviral shR A plasmids that PD-L2 is directly involved in the inhibition of T cell activation.
- Example 7 Evidence that interference with PD-L2/PD-1 interaction increases T cell activation and promotes the immunoclearance of damaged/senescent cells in vivo.
- fibrotic mice are treated with blocking anti-PD-1 and anti-PD-L2 antibodies and the progression of these diseases analyzed.
- these antibodies potentiate T cell immunity and improve the clearance of senescent cells by the immune system, facilitating the regression of the fibrotic areas.
- the effect of blocking PD-1/PD-L2 interaction on infiltrating T lymphocytes is analyzed in the senescent organs. Flow cytometry is used to analyze and characterize the number and activation status of infiltrating T cells.
- PD-L2 DNA damage is a potent inducer of PD-L2 (Fig. 3).
- a dramatic up-regulation of PD-L2 occurs before the onset of senescence.
- This effect is authenticated in vivo by generating xenografts with the mouse melanoma cell lines HcMeB and HcMel 12. These cell lines are isogenic and can induce tumors in mice with a competent immune system.
- PD-L2 up-regulation follows the treatment of these xenografts with the genotoxic drugs doxorubicin or irradiation, and tumor progression in the presence of blocking anti-PD-1 or anti-PD-L2 antibodies is then analyzed.
- the present inventors have shown for the first time that PD-L2 is expressed not only on antigen-present cells and other immune cells, but also on damaged and/or senescent cells. This finding is of great importance as it provides a method for the identification of damaged and/or senescent cells that could be of prognostic value for those conditions associated to the presence of damaged and/or senescent cells and, even more importantly, provides a therapeutic strategy for the elimination of, and the treatment of diseases and conditions associated with, damaged and/or senescent cells.
- Metformin protects against apoptosis and senescence in nucleus pulposus cells and ameliorates disc degeneration in vivo. Cell Death Dis. 7, e2441.
- Senescence-associated secretory phenotypes reveal cell- nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, 2853-2868.
- pl6INK4a reporter mice reveal age -promoting effects of environmental toxicants. J. Clin. Invest. 124, 169-173.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Cosmetics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3068363A CA3068363A1 (en) | 2017-06-29 | 2018-06-29 | Identification and elimination of damaged and/or senescent cells |
| JP2019572038A JP2020525021A (ja) | 2017-06-29 | 2018-06-29 | 損傷および/または老化細胞の同定および排除 |
| US16/627,034 US20200123607A1 (en) | 2017-06-29 | 2018-06-29 | Identification and elimination of damaged and/or senescent cells |
| EP18735568.0A EP3645746A1 (en) | 2017-06-29 | 2018-06-29 | Identification and elimination of damaged and/or senescent cells |
| US18/750,834 US20240344128A1 (en) | 2017-06-29 | 2024-06-21 | Identification and elimination of damaged and/or senescent cells |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP17382417.8 | 2017-06-29 | ||
| EP17382417.8A EP3421607A1 (en) | 2017-06-29 | 2017-06-29 | Identification and elimination of damaged and/or senescent cells |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/627,034 A-371-Of-International US20200123607A1 (en) | 2017-06-29 | 2018-06-29 | Identification and elimination of damaged and/or senescent cells |
| US18/750,834 Continuation US20240344128A1 (en) | 2017-06-29 | 2024-06-21 | Identification and elimination of damaged and/or senescent cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019002581A1 true WO2019002581A1 (en) | 2019-01-03 |
Family
ID=59315550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2018/067655 Ceased WO2019002581A1 (en) | 2017-06-29 | 2018-06-29 | IDENTIFICATION AND ELIMINATION OF DAMAGED AND / OR SENESCENT CELLS |
Country Status (5)
| Country | Link |
|---|---|
| US (2) | US20200123607A1 (https=) |
| EP (2) | EP3421607A1 (https=) |
| JP (2) | JP2020525021A (https=) |
| CA (1) | CA3068363A1 (https=) |
| WO (1) | WO2019002581A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023166210A1 (en) | 2022-03-04 | 2023-09-07 | Rejuveron Senescence Therapeutics Ag | Anti pd-l2 antibody |
Families Citing this family (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112996805A (zh) | 2018-08-30 | 2021-06-18 | Hcw生物科技公司 | 多链嵌合多肽和其用途 |
| EP3843788A1 (en) | 2018-08-30 | 2021-07-07 | HCW Biologics, Inc. | Single-chain chimeric polypeptides and uses thereof |
| JP7713393B2 (ja) | 2019-06-21 | 2025-07-25 | イミュニティーバイオ インコーポレイテッド | 多鎖キメラポリペプチドおよびその使用 |
| US12115191B2 (en) | 2020-02-11 | 2024-10-15 | Immunitybio, Inc. | Methods of treating age-related and inflammatory diseases |
| KR20220140535A (ko) | 2020-02-11 | 2022-10-18 | 에이치씨더블유 바이올로직스, 인크. | 크로마토그래피 수지 및 이의 용도 |
| EP4103599A1 (en) | 2020-02-11 | 2022-12-21 | HCW Biologics, Inc. | Methods of activating regulatory t cells |
| EP4143231A1 (en) | 2020-04-29 | 2023-03-08 | HCW Biologics, Inc. | Anti-cd26 proteins and uses thereof |
| US12024545B2 (en) * | 2020-06-01 | 2024-07-02 | HCW Biologics, Inc. | Methods of treating aging-related disorders |
| EP4431102A4 (en) * | 2021-11-10 | 2025-10-29 | Lifeceutix Co Ltd | Senescent Cell Elimination Compositions and Their Uses |
| CN114836508A (zh) * | 2021-12-08 | 2022-08-02 | 上海锐翌医学检验实验室有限公司 | 慢性阻塞性肺病标志微生物及其应用 |
| EP4507711A1 (en) | 2022-04-13 | 2025-02-19 | ImmunityBio, Inc. | Multi-chain chimeric polypeptide for use in the treatment of treating neuroinflammatory disorder |
| JPWO2023238845A1 (https=) * | 2022-06-07 | 2023-12-14 | ||
| CN115154611B (zh) * | 2022-06-23 | 2023-11-17 | 中山大学孙逸仙纪念医院 | 免疫检查点抑制剂与抗衰老药物联合在制备肿瘤治疗产品中的用途 |
| WO2024063109A1 (ja) * | 2022-09-20 | 2024-03-28 | 国立大学法人東京大学 | 老化細胞除去剤 |
| KR20260008114A (ko) * | 2023-05-04 | 2026-01-15 | (주)라이프신약 | 노화세포 제거 또는 억제용 조성물 및 이의 용도 |
| WO2024249938A1 (en) * | 2023-05-31 | 2024-12-05 | Mayo Foundation For Medical Education And Research | Methods and materials for identifying and treating senescence/age-related diseases |
| WO2025051889A1 (en) * | 2023-09-06 | 2025-03-13 | Rejuveron Senescence Therapeutics Ag | Anti pd-l2 antibodies for use in treating fibrotic diseases |
| CN120960439A (zh) * | 2025-10-14 | 2025-11-18 | 中南大学湘雅医院 | Usp51的抑制剂与pd-l1/pd-1单抗药物联用在制备肿瘤免疫治疗药物中的应用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US6054297A (en) | 1991-06-14 | 2000-04-25 | Genentech, Inc. | Humanized antibodies and methods for making them |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2005248958A1 (en) * | 2000-06-28 | 2006-02-02 | Brigham And Women's Hospital | PD-L2 molecules: novel PD-1 ligands and uses therefor |
| EP1320599A2 (en) * | 2000-06-28 | 2003-06-25 | Genetics Institute, LLC | Pd-l2 molecules: pd-1 ligands and uses therefor |
| SG11201606428UA (en) * | 2014-02-04 | 2016-09-29 | Incyte Corp | Combination of a pd-1 antagonist and an ido1 inhibitor for treating cancer |
| WO2016134416A1 (en) * | 2015-02-23 | 2016-09-01 | The University Of Queensland | A method for assessing prognosis of lymphoma |
| JP2018515474A (ja) * | 2015-04-28 | 2018-06-14 | ブリストル−マイヤーズ スクイブ カンパニーBristol−Myers Squibb Company | 抗pd−1抗体を使用するpd−l1陽性黒色腫の処置 |
| RU2733033C2 (ru) * | 2015-06-24 | 2020-09-28 | Иммодьюлон Терапьютикс Лимитед | Ингибитор контрольных точек и целые клетки микобактерий для применения в терапии рака |
| WO2017053250A1 (en) * | 2015-09-21 | 2017-03-30 | Merck Sharp & Dohme Corp. | Antibody that binds to human programmed death ligand 2 (pd-l2) and uses thereof |
-
2017
- 2017-06-29 EP EP17382417.8A patent/EP3421607A1/en not_active Withdrawn
-
2018
- 2018-06-29 US US16/627,034 patent/US20200123607A1/en not_active Abandoned
- 2018-06-29 JP JP2019572038A patent/JP2020525021A/ja active Pending
- 2018-06-29 EP EP18735568.0A patent/EP3645746A1/en not_active Withdrawn
- 2018-06-29 WO PCT/EP2018/067655 patent/WO2019002581A1/en not_active Ceased
- 2018-06-29 CA CA3068363A patent/CA3068363A1/en active Pending
-
2023
- 2023-04-05 JP JP2023061595A patent/JP2023098947A/ja active Pending
-
2024
- 2024-06-21 US US18/750,834 patent/US20240344128A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US6054297A (en) | 1991-06-14 | 2000-04-25 | Genentech, Inc. | Humanized antibodies and methods for making them |
Non-Patent Citations (42)
| Title |
|---|
| "Antibodies: A Laboratory Manual", 2014 |
| ALMAGRO J.C.; FRANSSON J.: "Humanization of antibodies", FRONTIERS IN BIOSCIENCE, vol. 13, 2008, pages 1619 - 1633 |
| ALTHUBITI, M.; LEZINA, L.; CARRERA, S.; JUKES-JONES, R.; GIBLETT, S.M.; ANTONOV, A.; BARLEV, N.; SALDANHA, G.S.; PRITCHARD, C.A.;: "Characterization of novel markers of senescence and their prognostic potential in cancer", CELL DEATH DIS., vol. 5, 2014, pages e1528, XP055203343, DOI: doi:10.1038/cddis.2014.489 |
| BAKER, D.J.; CHILDS, B.G.; DURIK, M.; WIJERS, M.E.; SIEBEN, C.J.; ZHONG, J.; A. SALTNESS, R.; JEGANATHAN, K.B.; VERZOSA, G.C.; PEZ: "Naturally occurring p16Ink4a-positive cells shorten healthy lifespan", NATURE, vol. 530, 2016, pages 184 - 189 |
| BAKER, D.J.; WIJSHAKE, T.; TCHKONIA, T.; LEBRASSEUR, N.K.; CHILDS, B.G.; VAN DE SLUIS, B.; KIRKLAND, J.L.; VAN DEURSEN, J.M.: "Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders", NATURE, vol. 479, 2011, pages 232 - 236, XP055074325, DOI: doi:10.1038/nature10600 |
| CHANG, J.; WANG, Y.; SHAO, L.; LABERGE, R.-M.; DEMARIA, M.; CAMPISI, J.; JANAKIRAMAN, K.; SHARPLESS, N.E.; DING, S.; FENG, W. ET A: "Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice", NAT. MED., vol. 22, 2016, pages 78 - 83 |
| CHEN, D.; XIA, D.; PAN, Z.; XU, D.; ZHOU, Y.; WU, Y.; CAI, N.; TANG, Q.; WANG, C.; YAN, M. ET AL.: "Metformin protects against apoptosis and senescence in nucleus pulposus cells and ameliorates disc degeneration in vivo", CELL DEATH DIS., vol. 7, 2016, pages e2441 |
| CHIKU VANESSA MARIM ET AL: "PD-1 function in apoptosis of T lymphocytes in canine visceral leishmaniasis", IMMUNOBIOLOGY, URBAN UND FISCHER VERLAG, DE, vol. 221, no. 8, 18 March 2016 (2016-03-18), pages 879 - 888, XP029557089, ISSN: 0171-2985, DOI: 10.1016/J.IMBIO.2016.03.007 * |
| CHILDS, B.G.; BAKER, D.J.; WIJSHAKE, T.; CONOVER, C.A.; CAMPISI, J.; VAN DEURSEN, J.M.: "Senescent intimal foam cells are deleterious at all stages of atherosclerosis", SCIENCE, vol. 80, no. 354, 2016, pages 472 - 477 |
| CHILDS, B.G.; DURIK, M.; BAKER, D.J.; VAN DEURSEN, J.M.: "Cellular senescence in aging and age-related disease: from mechanisms to therapy", NATURE MEDICINE, vol. 21, 2015, pages 1424 - 1435 |
| COLE, S.P.C. ET AL.: "Monoclonal Antibodies and Cancer Therapy", 1985, ALAN R. LISS, INC., pages: 77 - 96 |
| COPPE, J.-P.; PATIL, C.K.; RODIER, F.; SUN, Y.; MUNOZ, D.P.; GOLDSTEIN, J.; NELSON, P.S.; DESPREZ, P.-Y.; CAMPISI, J.: "Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor", PLOS BIOL., vol. 6, 2008, pages 2853 - 2868 |
| COTE, R. J. ET AL.: "Generation of human monoclonal antibodies reactive with cellular antigens", PROC NATL ACAD SCI U S A, vol. 80, no. 7, 1983, pages 2026 - 2030, XP000650373, DOI: doi:10.1073/pnas.80.7.2026 |
| EWALD, J.A.; DESOTELLE, J.A.; WILDING, G.; JARRARD, D.F.: "Therapy-Induced Senescence in Cancer", JNCI J. NATL. CANCER INST., vol. 102, 2010, pages 1536 - 1546 |
| FAGARASAN, S.; HONJO, T.: "T-Independent immune response: new aspects of B cell biology", SCIENCE, vol. 290, 2000, pages 89 - 92 |
| HE, Y.F.; ZHANG, G.M.; WANG, X.H. ET AL.: "Blocking programmed death-1 ligand-PD-1 interactions by local gene therapy results in enhancement of antitumor effect of secondary lymphoid tissue chemokine", JOURNAL OF IMMUNOLOGY, vol. 173, no. 8, 2004, pages 4919 - 4928 |
| HOBO, W.; MASS, F.; ADISTY, N.; DEWITTE, T.; SCHAPP, N.; VAN DER VOORT, R.; DOLSTRA, H.: "siRNA silencing of PD-L1 and PD-L2 on dendritic cells augments expansion and function of minor histocompatibility antigen-specific CD8+ T cells", BLOOD, vol. 116, 2010, pages 4501 - 4511, XP055298201, DOI: doi:10.1182/blood-2010-04-278739 |
| KOHLER, G.; MILSTEIN, C.: "Continuous cultures of fused cells secreting antibody of predefined specificity", NATURE, vol. 256, 1975, pages 495 - 497, XP002024548 |
| LAURA R. DULGERIAN ET AL: "Programmed death ligand 2 regulates arginase induction and modifies Trypanosoma cruzi survival in macrophages during murine experimental infection : Role of PD-L2 in T. cruzi infection", IMMUNOLOGY, vol. 133, no. 1, 1 May 2011 (2011-05-01), GB, pages 29 - 40, XP055494975, ISSN: 0019-2805, DOI: 10.1111/j.1365-2567.2011.03406.x * |
| MUÑOZ-ESPIN, D.; SERRANO, M.: "Cellular senescence: from physiology to pathology", NAT. REV. MOL. CELL BIOL., vol. I5, 2014, pages 482 - 496 |
| NAIDOO, J.; PAGE, D.B.; LI, B.T.; CONNELL, L.C.; SCHINDLER, K.; LACOUTURE, M.E.; POSTOW, M.A.; WOLCHOK, J.D.: "Toxicities of the anti-PD-1 and anti-PD-L1 immune checkpoint antibodies", ANN. ONCOL., vol. 26, 2015, pages 383 |
| NESS, K.K.; ARMSTRONG, G.T.; KUNDU, M.; WILSON, C.L.; TCHKONIA, T.; KIRKLAND, J.L.: "Frailty in childhood cancer survivors", CANCER, vol. 121, 2015, pages 1540 - 1547 |
| OHAEGBULAM, K.C.; ASSAL, A.; LAZAR-MOLNAR, E.; YAO, Y.; ZANG, X.: "Human cancer immunotherapy with antibodies to the PD-1 and PD-L1 pathway", TRENDS MOL. MED., vol. 27, 2015, pages 24 - 33, XP055249717, DOI: doi:10.1016/j.molmed.2014.10.009 |
| PARDOLL, D.M.: "The blockade of immune checkpoints in cancer immunotherapy", NAT. REV. CANCER, vol. 72, 2012, pages 252 - 264, XP055415943, DOI: doi:10.1038/nrc3239 |
| PAREKH, V.V.; LALANI, S.; KIM, S. ET AL.: "PD-1/PD-L blockade prevents anergy induction and enhances the anti-tumor activities of glycolipid-activated invariant NKT cells", JOURNAL OF IMMUNOLOGY, vol. 182, no. ( 5, 2009, pages 2816 - 2826, XP002552134, DOI: doi:10.4049/jimmunol.0803648 |
| RAYESS, H.; WANG, M.B.; SRIVATSAN, E.S.: "Cellular senescence and tumor suppressor gene pl6", INT J CANCER, vol. 130, no. 8, 15 April 2012 (2012-04-15), pages 1715 - 1725, XP055282399, DOI: doi:10.1002/ijc.27316 |
| ROOS, C.M.; ZHANG, B.; PALMER, A.K.; OGRODNIK, M.B.; PIRTSKHALAVA, T.; THALJI, N.M.; HAGLER, M.; JURK, D.; SMITH, L.A.; CASACLANG-: "Chronic senolytic treatment alleviates established vasomotor dysfunction in aged or atherosclerotic mice", AGING CELL, vol. 15, 2016, pages 973 - 977 |
| ROZALI, E.N.; HATO, S. V; ROBINSON, B.W.; LAKE, R.A.; LESTERHUIS, W.J.: "Programmed death ligand 2 in cancer-induced immune suppression", CLIN. DEV. IMMUNOL., 2012, pages 656340 |
| RUHLAND, M.K.; LOZA, A.J.; CAPIETTO, A.-H.; LUO, X.; KNOLHOFF, B.L.; FLANAGAN, K.C.; BELT, B.A.; ALSPACH, E.; LEAHY, K.; LUO, J. E: "Stromal senescence establishes an immunosuppressive microenvironment that drives tumorigenesis", NAT. COMMUN., vol. 7, 2016, pages 11762 |
| SANOFF, H.K.; DEAL, A.M.; KRISHNAMURTHY, J.; TORRICE, C.; DILLON, P.; SORRENTINO, J.; IBRAHIM, J.G.; JOLLY, T.A.; WILLIAMS, G.; CA: "Effect of cytotoxic chemotherapy on markers of molecular age in patients with breast cancer", J. NATL. CANCER INST., vol. 106, 2014, pages 057 |
| SHARMA, P.; ALLISON, J.P.: "Immune checkpoint targeting in cancer therapy: toward combination strategies with curative potential", CELL, vol. 161, 2015, pages 205 - 214, XP055427087, DOI: doi:10.1016/j.cell.2015.03.030 |
| SORRENTINO, J.A.; KRISHNAMURTHY, J.; TILLEY, S.; ALB, J.G.; BURD, C.E.; SHARPLESS, N.E.: "pl6INK4a reporter mice reveal age-promoting effects of environmental toxicants", J. CLIN. INVEST., vol. 124, 2014, pages 169 - 173 |
| SUN, Y.; CAMPISI, J.; HIGANO, C.; BEER, T.M.; PORTER, P.; COLEMAN, I.; TRUE, L.; NELSON, P.S.: "Treatment-induced damage to the tumor microenvironment promotes prostate cancer therapy resistance through WNT16B", NAT. MED., vol. 18, 2012, pages 1359 - 1368, XP055319225, DOI: doi:10.1038/nm.2890 |
| THOMPSON, J.D.; HIGGINS, D.G.; GIBSON, T.J.: "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice", NUCLEIC ACIDS RES, vol. 22, 1994, pages 4673 - 4680, XP002956304 |
| WANG XUN ET AL: "Inflammatory cytokines IL-17 and TNF-[alpha] up-regulate PD-L1 expression in human prostate and colon cancer cells", IMMUNOLOGY LETTERS, ELSEVIER BV, NL, vol. 184, 14 February 2017 (2017-02-14), pages 7 - 14, XP029947215, ISSN: 0165-2478, DOI: 10.1016/J.IMLET.2017.02.006 * |
| WOOD, W.A.; KRISHNAMURTHY, J.; MITIN, N.; TORRICE, C.; PARKER, J.S.; SNAVELY, A.C.; SHEA, T.C.; SERODY, J.S.; SHARPLESS, N.E.: "Chemotherapy and Stem Cell Transplantation Increase pl6INK4a Expression, a Biomarker of T-cell Aging", EBIOMEDICINE, vol. 11, 2016, pages 227 - 238 |
| XU, M.; PALMER, A.K.; DING, H.; WEIVODA, M.M.; PIRTSKHALAVA, T.; WHITE, T.A.; SEPE, A.; JOHNSON, K.O.; STOUT, M.B.; GIORGADZE, N.: "Targeting senescent cells enhances adipogenesis and metabolic function in old age", ELIFE, vol. 4, 2015, pages e12997, XP055347154, DOI: doi:10.7554/eLife.12997 |
| YOSEF, R.; PILPEL, N.; TOKARSKY-AMIEL, R.; BIRAN, A.; OVADYA, Y.; COHEN, S.; VADAI, E.; DASSA, L.; SHAHAR, E.; CONDIOTTI, R. ET AL: "Directed elimination of senescent cells by inhibition of BCL-W and BCL-XL", NAT. COMMUN., vol. 7, 2016, pages 11190 |
| ZACARIAS-FLUCK, M.F.; MORANCHO, B.; VICARIO, R.; LUQUE GARCIA, A.; ESCORIHUELA, M.; VILLANUEVA, J.; RUBIO, I.T.; ARRIBAS, J.: "Effect of Cellular Senescence on the Growth of HER2-Positive Breast Cancers", JNCI J. NATL. CANCER INST., vol. 107, 2015, pages djv020 - djv020 |
| ZHU, Y.; TCHKONIA, T.; FUHRMANN-STROISSNIGG, H.; DAI, H.M.; LING, Y.Y.; STOUT, M.B.; PIRTSKHALAVA, T.; GIORGADZE, N.; JOHNSON, K.O: "Identification of a novel senolytic agent, navitoclax, targeting the Bcl-2 family of anti-apoptotic factors", AGING CELL, vol. 15, 2016, pages 428 - 435 |
| ZHU, Y.; TCHKONIA, T.; PIRTSKHALAVA, T.; GOWER, A.C.; DING, H.; GIORGADZE, N.; PALMER, A.K.; IKENO, Y.; HUBBARD, G.B.; LENBURG, M.: "The Achilles' heel of senescent cells: from transcriptome to senolytic drugs", AGING CELL, vol. 14, 2015, pages 644 - 658, XP055342891, DOI: doi:10.1111/acel.12344 |
| ZIEGLER, D. V.; WILEY, C.D.; VELARDE, M.C.: "Mitochondrial effectors of cellular senescence: beyond the free radical theory of aging", AGING CELL, vol. 14, 2015, pages 1 - 7 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023166210A1 (en) | 2022-03-04 | 2023-09-07 | Rejuveron Senescence Therapeutics Ag | Anti pd-l2 antibody |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2020525021A (ja) | 2020-08-27 |
| US20240344128A1 (en) | 2024-10-17 |
| JP2023098947A (ja) | 2023-07-11 |
| EP3421607A1 (en) | 2019-01-02 |
| CA3068363A1 (en) | 2019-01-03 |
| EP3645746A1 (en) | 2020-05-06 |
| US20200123607A1 (en) | 2020-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240344128A1 (en) | Identification and elimination of damaged and/or senescent cells | |
| JP7853352B2 (ja) | 多発性骨髄腫を治療すること及び4-(4-(4-(((2-(2,6-ジオキソピペリジン-3-イル)-1-オキソイソインドリン-4-イル)オキシ)メチル)ベンジル)ピペラジン-1-イル)-3-フルオロベンゾニトリルのバイオマーカーの使用 | |
| EP4129336B1 (en) | Anti-cd47 agent-based treatment of cd20-positive cancer | |
| JP6564408B2 (ja) | S100a4抗体およびその治療上の使用 | |
| US20200155675A1 (en) | Methods and compositions for cancer treatment and treatment selection | |
| KR102644408B1 (ko) | 암의 치료를 위한 항-pd-l1 항체 및 dna-pk 억제제의 병용 | |
| JP2020517640A (ja) | 併用療法 | |
| KR20140024914A (ko) | 예측인자로 세레브론을 사용하는 암 및 염증성 질환의 치료를 위한 방법 | |
| JP7402691B2 (ja) | 抗cd25抗体薬物複合体による併用療法 | |
| HK1252272A1 (zh) | 使用抗ox40抗体治疗癌症的方法 | |
| CA3091859A1 (en) | Kir3dl3 as an hhla2 receptor, anti-hhla2 antibodies, and uses thereof | |
| US12173042B2 (en) | Methods of treating cancers with CT45 targeted therapies | |
| AU2013222185A1 (en) | Prediction of responsiveness to treatment with immunomodulatory therapeutics and method of monitoring abscopal effects during such treatment | |
| JP2020517629A5 (https=) | ||
| JP2018158919A (ja) | Ckap4を標的分子とした抗腫瘍剤 | |
| EP4215211A1 (en) | Tumor immune microenvironment regulator, and preventive, diagnostic or therapeutic use thereof | |
| WO2008046529A1 (en) | Treatment of chemotherapy- or radiotherapy-resistant tumors using an l1 interfering molecule | |
| WO2008046459A1 (en) | Treatment of chemotherapy- or radiotherapy-resistant tumors using an l1 interfering molecule | |
| AU2024351102A1 (en) | Treatment of cancers associated with beta-catenin | |
| WO2025212653A1 (en) | Methods including bh3 profiling of car t cells | |
| JP2022544567A (ja) | インテグリンの化学的活性化と標的細胞免疫療法を含む併用癌治療 | |
| EA041126B1 (ru) | Антитела и полипептиды, направленные против cd127 | |
| NZ750663A (en) | Compositions and methods for cancer immunotherapy | |
| HK40028190A (en) | Methods for modulating regulatory t cells and immune responses using cdk4/6 inhibitors | |
| NZ750663B2 (en) | Compositions and methods for cancer immunotherapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18735568 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3068363 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019572038 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018735568 Country of ref document: EP Effective date: 20200129 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2018735568 Country of ref document: EP |