WO2019000152A1

WO2019000152A1 - Cho cell expressing rhbdd1 gene and use thereof

Info

Publication number: WO2019000152A1
Application number: PCT/CN2017/089932
Authority: WO
Inventors: 毛吉炎
Original assignee: 深圳市博奥康生物科技有限公司
Priority date: 2017-06-26
Filing date: 2017-06-26
Publication date: 2019-01-03

Abstract

Disclosed is a CHO cell expressing the RHBDD1 gene. The eukaryotic expression vector pCAG(m)-IRESblast-RHBDD1 of the full-length RHBDD1 gene is constructed using the eukaryotic expression vector pCAG(m)-IRESblast, and is further used to transfect CHO cells. Blasticidin is used to screen for the engineered cell line CHO/RHBDD1 highly expressing the full-length RHBDD1 gene, and it is confirmed that the cell line can significantly increase the expression of full-length RHBDD1.

Description

Title: A CHO Cell Expressing the RHBDD1 Gene and Its Application

[0001] The present invention belongs to the field of recombinant cell technology, and relates to a CHO cell expressing an RHBDD1 gene and an application thereof.

Background technique

[0002] RHBDD1 is the 18th member of the tumor necrosis factor receptor (TNFR) superfamily and is a thymus-derived CD4+

A surface molecule on CD25+ Treg cells with a ligand of RHBDD1L. Studies have shown that RHBDD1/RHBDD1L has many important biological activities, including cell proliferation, differentiation and survival. Since RHBDD 1 is mainly expressed on resting Treg cells, anti-RHBDD 1 antibody (DTA-1) can eliminate the immunosuppressive effects of Tre g cells.

technical problem

[0003] The HBDD1/RHBDD1L system is involved in the regulation of Treg cells and has a good clinical transformation prospect. However, the lack of cells expressing the RHBDD1 gene in the prior art has hindered the progress of related research.

Problem solution

Technical solution

[0004] The object of the present invention is to provide a CHO cell expressing the RHBDD1 gene, which is achieved by the following technical solutions:

[0005] A CHO cell expressing the RHBDD1 gene, the recombinant CHO cell with high expression of RHBDD1 is CH

The 0 cell is a host cell, and the exogenous expression vector for transfecting the host cell is an expression vector comprising the full-length gene of RHBDD1.

The nucleotide sequence of the full-length RHBDD1 gene is shown in SEQ ID No: 1.

[0007] The expression vector comprising the full-length gene of RHBDD1 is pCAG(m)-IRESblast, and the expression vector is through EcoR

The full-length gene of RHBDD 1 was cloned into the eukaryotic expression vector pCAG(m)-IRESblast by I and Spel restriction sites. Advantageous effects of the invention

Beneficial effect

[0008] The present invention constructs the eukaryotic expression vector pCAG(m)-IRESblast of human RHBDD1, which is confirmed by clone sequencing to be identical to the human RHBDD1 sequence in the NCBI database; transfected CHO cells by liposome method, blasticidal A cell line capable of stably growing and surviving was obtained by restriction enzyme screening, and a recombinant CHO/RHBDD1 cell line stably and highly expressing RHBDD1 was selected by quantitative PCR detection; a recombinant CHO/RHBDD1 cell line containing the full length of RHBDD1 gene constructed by the present invention was constructed. It can stably express RHBDD1 and has a complete molecular structure.

[0009] CHO cells as host cells have many advantages, including relatively low expression of the cells themselves, and exogenous recombinant genes have higher amplification and expression ability, and RHBDD1 expressed by recombinant CHO/RHBDD1 cells. The relative expression level was significantly higher than that of CHO, and R HBDD1 occupied the dominant expression level compared with other expression products.

[0010] By quantitative PCR detection technology, it was proved that the expression level of RHBDD1 was significantly higher than that of CHO, and its expression on the cell membrane was significantly higher than that of CHO cells.

Brief description of the drawing

DRAWINGS

1 is a schematic representation of the results of detection of RHBDD1 expression levels by fluorescent quantitative PCR after screening of CHO cells by blasticidin.

BEST MODE FOR CARRYING OUT THE INVENTION

The present invention is based on the construction of the eukaryotic expression vector pCAG(m)-IRESblast-RHBDD1 of the full-length RHBDD1 gene, and transfects CHO cells to obtain a stable CHO/RHBDD1 cell line stably expressing RHBDD1. The explanation of the embodiments of the invention is not to be construed as limiting.

[0013] In this example, the pCAG(m)-IRESblast-based vector was used, and the EcoR I and Spel cleavage sites were specifically selected as the multiple cloning site for the foreign gene.

Example 1 Cloning of the RHBDD1 gene

[0015] Using the cDNA of A375 cells as a template, using the Primer Primer 6.0 software to design the corresponding specific bow| And add EcoRI and Spel restriction sites at both ends: RHBDD1-F: 5'- GGAATTCATGCAACGGAGATCAAGAG -3'; RHBDD1-R: 5'- GACTAGTTCACTGGCTATCGAATCTGTG -3,.

[0016] Amplification was carried out by using the PrimeSTAR enzyme of Dalian Bao Biotech Co., Ltd., and the PCR reaction system was: upstream primer 4 μί, downstream primer 4 L, 2×Premix PrimeSTAR 25 L, cDNA: 1 μΙ^, plus ddH20 to 50 L; 98 ° C for 2 min, After 30 cycles (denaturation at 98 °C for 10 s, annealing at 60 °C for 10 s, extension at 72 °C for 1 min), and finally extension at 72 °C for 5 min, a large number of target fragments were obtained, and the product was expanded using a commercial PCR purification kit. The product is purified.

[0017] Example 2 Construction of Recombinant Expression Vector

[0018] The EcoC I, Spe I double-digested eukaryotic expression vector pCAG(m)-IRESblast and RHBDD1 gene purification products: The enzyme digestion system is: EcoRIl L, Spel

1.5 L, DNA/plasmid: 2 g, lOxFastDigest Buffer 2 L, supplement ddH20 to 2 (^L; reaction at 37 ° C for 30 min, and the product was purified by commercial PCR product purification kit.

[0019] The linearized vector and the digested RHBDD1 amplified fragment were ligated overnight under the action of T4 DNA ligase at 4 ° C, and the reaction system was: linear pCAG(m)-IRESblast after digestion

2μί, digested RHBDD1 fragment 5μί, T4DNA ligase 1μί, 10xT4

The DNA ligase Buffer Ιμί, obtained the recombinant pCAG(m)-IRESblast-RHBDD1 expression vector.

[0020] 5 recombinant pCAG (m)-IRESblast-RHBDDl plasmid was added to 5 (L ToplO competent cells, ice bath for 30 min, heat shock at 42 ° C for 60 s, ice bath for 2 min, added 50 non-resistant LB liquid culture Base, shake at 37 ° C for 1 h, take all the bacterial solution, apply to LB solid medium containing ampicillin resistance (final concentration 100 g / mL), culture overnight at 37 ° C, pick monoclonal in the presence of ampicillin The resistance to mycin (final concentration 100 g/mL) was expanded in LB liquid medium and sent to Shanghai Biotech for sequencing to verify the sequence bases, ensuring that the sequencing results were consistent with those in the GenBank.

Example 3 Recombinant Vector Transduction CHO Cells

[0022] CHO cells were seeded in 6-well plates at 10 ⁶ cells per well, 18

After h, the cell density is about 60 < 3⁄4. Take pCAG(m)-IRESblast-RHBDDl plasmid 1

g, Lipofectamine3000 was transduced into CHO cells, and after continuing to culture for 24 h, blasticidin was added to a final concentration of 5 g/mL, and the cells were selected. [0023] Example 4 Detection of RHBDD1 gene expression by real-time PCR

[0024] CHO cells and CHO/RHBDD1 cells were seeded separately into 6-well plates. Cell density reached 80<3⁄4-90<3⁄4吋, total RNA was extracted from each group using RNeasy Mini Kit, using PrimeScrip RT reagent

Kit reverse transcribes mRNA into cDNA and stores at -20 °C.

[0025] taking cDNA 1 of each group of cells

As a template, GAPDH was used as an internal reference, and the relative expression of RHBDD1 was detected by real-time fluorescent quantitative PCR. The reaction conditions were set: 95. C 30s, 1 cycle, 58. C 30s 40 cycles, 95. C 5s, 60 ° C lmin, 95. C 15s , the results are shown in Figure 1. It can be seen that the expression level of RHBDD1 gene of CHO/RHBDD1 cells is 140 times higher than that of C HO cells, indicating that the cDNA sequence of RHBDD1 gene provided by the present invention is successfully inserted into the pCAG(m)-IRESblast vector, and can specifically and efficiently promote the RHBDD1 gene. High expression.

Industrial applicability

The present invention constructs the eukaryotic expression vector pCAG(m)-IRESblast of human RHBDD1, which is confirmed by cloning and sequencing to be identical to the human RHBDD1 sequence in the NCBI database; transfected CHO cells by liposome method, and killed by rice blast fungus A cell line capable of stably growing and surviving was obtained by restriction enzyme screening, and a recombinant CHO/RHBDD1 cell line stably and highly expressing RHBDD1 was selected by quantitative PCR detection; a recombinant CHO/RHBDD1 cell line containing the full length of RHBDD1 gene constructed by the present invention was constructed. It can stably express RHBDD1 and has a complete molecular structure.

[0027] CHO cells as host cells have many advantages, including a relatively low level of protein expression in the cell itself, and a higher amplification and expression ability of the foreign recombinant gene, and RHBDD1 expressed by the recombinant CHO/RHBDD1 cells. The relative expression level was significantly higher than that of CHO, and R HBDD1 occupied the dominant expression level compared with other expression products.

[0028] By quantitative PCR detection technology, it was proved that the expression level of RHBDD1 was significantly higher than that of CHO, and its expression on the cell membrane was significantly higher than that of CHO cells.

[0029]

Claims

Claims [Claim 1] A CHO cell expressing an RHBDD1 gene, characterized in that the recombinant CHO cell with high expression of RHBDD1 is a CHO cell as a host cell, and the exogenous expression vector for transfecting the host cell comprises RHBDD1. An expression vector for the full-length gene. [Claim 2] The CHO cell expressing the RHBDD1 gene according to claim 1, wherein the nucleotide sequence of the full-length RHBDD1 gene is represented by SEQ ID No: 1. [Claim 3] The CHO cell expressing the RHBDD1 gene according to claim 1, wherein: the expression vector comprising the full-length gene of RHBDD 1 is pCAG(m)-IRESbla st, and the expression vector is The full-length RHBDD 1 gene was cloned into the eukaryotic expression vector pCAG(m)-IRESblast by EcoR I and Spe I restriction sites. [Claim 4] The method for constructing RHBDD1 high expression recombinant C HO cells according to any one of claims 1 to 3, comprising the following steps:

(1) Cloning of the RHBDD1 gene

Using the cDNA of A375 cells as a template, the corresponding primers were designed using Premier Primer 6.0 software, and EcoR I and Spe I restriction sites were added at both ends: RHBDD1-F : 5, - GGAATTCATGCAACGGAGATCAAGAG -3';

RHBDD 1-R: 5, - GACTAGTTCACTGGCTATCGAATCTGTG -3 '. The amplification was carried out by the PrimeSTAR enzyme of Dalian Bao Biotech Co., Ltd. The PCR reaction system was: upstream primer 4 L, downstream primer 4 L, 2xPremix PrimeSTAR 25μ^ cDNA: Ιμί, plus ddH20 to 50μί; 98°C 2 min, then 30 Cycling (denaturation at 98 °C for 10 s, annealing at 60 °C for 10 s, extension at 72 °C for 1 min), and finally extension at 72 °C for 5 min, a large number of target fragments were obtained, and the product was amplified using a commercial PCR purification kit. The product was purified.

(2) Construction of recombinant expression vector

Use EcoR I, Spe

I double-digested eukaryotic expression vector pCAG(m)-IRESblast and RHBDD 1 gene purified product: The enzyme digestion system is: EcoR I l L, Spe l

1.5 L, DNA/plasmid: 2 g, lOxFastDigest Buffer 2μ^ plus ddH20 to 20 μί; 37 °C reaction for 30 min, commercial digestion product using pure PCR product purification kit Chemical.

The linearized vector and the digested RHBDD1 amplified fragment were ligated overnight under the action of T4 DNA ligase at 4 ° C. The reaction system was: linear pCAG(m)-IRESbla st 2 L after digestion, after digestion The RHBDD1 fragment 5 μί, T4 DNA ligase 1 μί, 10×T4 DNA ligase Buffer Ιμί, obtained recombinant pCAG(m)-IRESblast-RHBDD1 expression vector.

5 recombinant pCAG(m)-IRESblast-RHBDDl plasmid was added to 5 (L ToplO competent cells, ice bath for 30 min, heat shock at 42 °C for 60 s, ice bath for 2 min, add 50

Non-resistant LB liquid medium, shaken at 37 ° C for 1 h, take all the bacterial solution, apply to LB solid medium containing ampicillin resistance (final concentration 100 g / mL), culture overnight at 37 ° C, pick Monoclonal cultures were expanded in LB liquid medium containing ampicillin resistance (final concentration 100 g/mL) and sent to Shanghai Biotech for sequencing to verify sequence bases, ensuring sequencing results and gene banks (GenBank) Consistent.

(3) Recombinant vector transduction CHO cells

CHO cells were seeded in 6-well plates at 10 ⁶ cells per well, and the cell density was approximately 60% after 18 h. 1 g of pCAG(m)-IRESblast-RHBDD1 plasmid was transfected into CHO cells using Lipofectamine 3000. After 24 hours of culture, blasticidin was added to a final concentration of 5 cells.

(4) Fluorescence quantitative PCR detection of RHBDD1 gene expression

CHO cells and CHO/RHBDD1 cells were inoculated separately into 6-well plates. The cell density reached 80% -90% 吋, the total RNA of each group was extracted with RNeasy Mini Kit, and the mRNA was reverse transcribed into cDNA using the PrimeScrip RT reagent Kit, -20. C save.

Take cDNA 1 from each group of cells

As a template, GAPDH was used as an internal reference, and the relative expression of RHBDD1 was detected by real-time fluorescent quantitative PCR. The reaction conditions were set: 95. C 30s, 1 cycle, 58. C 30s 40 cycles, 95 ° C 5s, 60 ° C lmin, 95 ° C 15s, the results shown in Figure 1. It can be seen that the expression level of RHBDD 1 gene in CHO/RHBDD1 cells is 140 times higher than that of CHO cells.