WO2018170709A1

WO2018170709A1 - Vector for expressing human tnlg5a gene and application thereof

Info

Publication number: WO2018170709A1
Application number: PCT/CN2017/077396
Authority: WO
Inventors: 毛吉炎
Original assignee: 深圳市博奥康生物科技有限公司
Priority date: 2017-03-20
Filing date: 2017-03-20
Publication date: 2018-09-27

Abstract

Provided is a method for constructing a human TNLG5A gene expression vector, comprising the following steps: (1) cloning of a TNLG5A gene; and (2) construction of an overexpression vector pEGFP-Cl/TNLG5A.

Description

Title of Invention: A Vector for Expressing Human TNLG5 A Gene and Application Thereof

[0001] The present invention belongs to the field of biotechnology, and relates to a method for constructing a human TNLG5A gene expression vector and an application thereof.

Background technique

[0002] ILA belongs to the TNFR superfamily and is mainly expressed in activated T cells and is an inducible T cell surface receptor; TNLG5A belongs to the TNF superfamily and is mainly expressed in concentrated antigen presenting cells (APC). IL A/TNLG5A is another important costimulatory molecule other than CD28/B7, which may or may not be dependent on CD28/

The B7 pathway mediates the production of costimulatory signals that induce T cell activation, proliferation, and cytokine secretion. technical problem

[0003] ILA and its ligand system have two-way signal transduction, which can transmit cells to T cells through TNLG5A, and can transmit signals to cells expressing ligands, which plays an important role in tumor immunotherapy, and needs to be done. A large number of studies can achieve clinical transformation, but the lack of recombinant vectors with high expression of TNLG5A gene in the prior art has hindered the progress of related research.

Problem solution

Technical solution

[0004] The object of the present invention is to overcome the deficiencies in the prior art and to provide a method for constructing a human TNLG5A gene expression vector. Based on the cDNA sequence of human TNLG5A gene, the expression vector pEGFP-Cl/TNLG5A was constructed, which laid a foundation for the subsequent study of human TNLG5A gene function.

[0005] The specific technical solution thereof is:

[0006] A method for constructing a human TNLG5A gene overexpression vector, comprising the steps of:

[0007] (1) TNLG5A gene cloning

[0008] The total RNA of Jurkat cells was extracted and reverse transcribed into cDNA, and primers TNLG5A-F and TNLG5A-R were designed. The cDNA was used as a template, and primers and PrimeStar high-fidelity DNA polymerase were used for PCR amplification according to a conventional method. The reaction conditions were : 98 ° C 2 min; 98 ° C 10 s, 58 ° C 10 s, 72 ° C 50 s, 30 cycles; 72 ° C 5 min. The PCR amplification products were identified by agarose gel electrophoresis. (2) Construction of overexpression vector pEGFP-Cl/TNLG5A

[0010] The purified PCR product and the eukaryotic expression vector pEGFP-Cl were digested with restriction enzymes Xho I and EcoR I, identified and recovered by 1% agarose gel electrophoresis; The target gene fragment was ligated with the same double-digested expression vector pEGFP-Cl; the reaction system was: 10XT4 DNA ligase Buffer 1 μί, linearized pEGFP-Cl vector 1 μί, PCR product 3 μί, T4 DNA ligase 1 Μί, dH20 4 L, 4 °C ligation overnight; the ligation product was transformed into E. coli DH5ot competent cells, ice bath for 30 min, heat shock at 42 °C for 90 s, immediately transferred to ice for 2 min, then added to 500 37 The pre-warmed non-resistant LB medium was incubated at 37 °C for 1 h. Finally, the bacterial solution was uniformly coated on LB solid medium containing kanamycin, and placed in a 37 ° C incubator for overnight culture. Positive colonies were screened; 3 monoclonal colonies were randomly picked. After the colony PCR was positive, the bacterial liquid was sent to Shanghai Biotech for sequencing. The obtained recombinant eukaryotic expression plasmid was named pEGFP-Cl/TNLG5A.

Advantageous effects of the invention

Beneficial effect

[0011] The present invention constructs the overexpression vector pEGFP-Cl/TNLG5A of the TNLG5A gene. Subsequent development of the TNLG5A gene will play an important role in TNLG5A-related drug research and development.

Brief description of the drawing

DRAWINGS

1 is the relative level of the TNLG5 A gene of 293T cells transfected with pEGFP-C 1/TNLG5 A vector.

BEST MODE FOR CARRYING OUT THE INVENTION

[0013] The present invention will be further described below in conjunction with the drawings and specific embodiments.

[0014] Jurkat cells and 293T cells were purchased from ATCC, Premix PrimeSTAR

HS enzyme was purchased from Takara, RNeasy Mini Kit was purchased from QIAGEN, Endo-Free Plasmid

Mini Kit II was purchased from Omega bio-tek.

Example 1 Cloning of the TNLG5A gene.

[0016] Extracting total RNA from Jurkat cells, reverse transcription into cDNA, designing primers (TNLG5A-F, TNLG5A-R), using cDNA as a template, using primers and PrimeStar high-fidelity DNA polymerase, according to conventional methods. PCR amplification. The reaction conditions were: 98 ° C 2 min; 98. C 10 s, 58. C 10 s, 72. C 50 s, 30 cycles; 72 ° C for 5 min. The PCR amplification products were identified by agarose gel electrophoresis. The nucleotide sequence of TNLG5A-F is shown in SEQ ID No: 1, and the nucleotide sequence of TNLG5A-R is shown in SEQ ID No: 2.

Example 2 Construction of overexpression vector pEGFP-Cl/TNLG5A

[0018] The purified PCR product and the eukaryotic expression vector pEGFP-Cl were digested with restriction enzymes Xho I and EcoR I, identified and recovered by 1% agarose gel electrophoresis; The target gene fragment was ligated with the same double-digested expression vector pEGFP-Cl; the reaction system was: 10XT4 DNA ligase Buffer 1 μί, linearized pEGFP-Cl vector 1 μί, PCR product 3 μί, T4 DNA ligase 1 Μί, dH20 4 L, 4 °C ligation overnight; the ligation product was transformed into E. coli DH5ot competent cells, ice bath for 30 min, heat shock at 42 °C for 90 s, immediately transferred to ice for 2 min, then added to 500 37 The pre-warmed non-resistant LB medium was incubated at 37 °C for 1 h. Finally, the bacterial solution was uniformly coated on LB solid medium containing kanamycin, and placed in a 37 ° C incubator for overnight culture. Positive colonies were screened; 3 monoclonal colonies were randomly picked. After the colony PCR was positive, the bacterial liquid was sent to Shanghai Biotech for sequencing. The obtained recombinant eukaryotic expression plasmid was named pEGFP-Cl/TNLG5A.

Example 3 Transduction of 293T cells

[0020] A large amount of Escherichia coli containing pEGFP-Cl/TNLG5A plasmid was cultured, and Endo-Free Plasmid Mini Kit II was used to extract pEGFP-Cl/TNLG5A plasmid. 293T cells with good growth were inoculated into six wells with 1000000 cells per well. After 18 h of culture, the pEGFP-Cl/TNLG5A plasmid was transfected into 293T cells with Lipofectamine 2000, and culture was continued for 48 h.

[0021] Example 4 Fluorescence quantitative PCR detection of TNLG5A gene expression

[0022] According to the GAPDH and TNLG5A gene mRNA sequences, the primer design software Oligo 7.0 was used to design bows [0023] , CR production of the country

Too (Bp)

: TCTGACTf GAACAOCGACACC

119

GGGTCGG: GA@CTTTGeCCeG

T LG'5A,

GTGTCGTGTTTGTAGCTCAG

[2932] 293T cells transfected with 293T cells and transfected with pEGFP-Cl/TNLG5A plasmid into 6-well plates, respectively. Cell density reaches δΟ^^Ο^吋, with RNeasy Mini

Kit extracts total RNA from each group of cells, using PrimeScrip RT reagent

Kit reverse transcribes mRNA into cDNA and stores at -20 °C.

[0025] taking cDNA 1 of each group of cells

As a template, GAPDH was used as an internal reference, and the relative expression of TNLG5A was detected by real-time PCR. The reaction conditions were set: 95 ° C for 30 s, 1 cycle, 95 ° C for 10 s, and 54 ° C for 30 s for 40 cycles. The relative expression of TNLG5A gene in each group was detected by SYBR Primescript RT-PCR Kit. The results are shown in Figure 1. It can be seen that the expression level of TNLG5A gene in 293T cells transfected with pEGFP-Cl/TNLG5A plasmid is 170-fold higher than that of normal 293T cells, indicating that the pEGFP-Cl/TNLG5A plasmid can be specific, sustained and efficient. , stably promote high expression of TNLG5A gene.

[0026]

[0027]

[0028].

Industrial applicability

The present invention constructs the overexpression vector pEGFP-Cl/TNLG5A of the TNLG5A gene. Subsequent development of the TNLG5A gene will play an important role in TNLG5A-related drug research and development.

Claims

Claims [Claim 1] A method for constructing a human TNLG5A gene expression vector, comprising the steps of:

(1) TNLG5A gene cloning

The total RNA of Jurkat cells was extracted and reverse transcribed into cDNA. Primers TNLG5A-F and TNLG5A-R were designed. The cDNA was used as a template, and primers and PrimeStar high-fidelity DNA polymerase were used for PCR amplification according to the conventional method. The reaction conditions were: 98°. C 2 min; 98. C 10 s, 58. C 10 s, 72. C 50 s, 30 cycles; 72. C 5 min. The PCR amplification products were identified by agarose gel electrophoresis.

(2) Construction of overexpression vector pEGFP-Cl/TNLG5A

Use of restriction enzymes Xho I and EcoR

I purified the PCR product and the eukaryotic expression vector pEGFP-Cl were digested and identified by 1% agarose gel electrophoresis; the recovered target gene fragment and the same double digestion The expression vector pEGFP-Cl was ligated; the reaction system was: 10xT4 DNA ligase Buffer 1 μί, linearized pEGFP-Cl vector 1 μί, PCR product 3 μί, T4 DNA ligase 1 μί, dH20 4 μί, 4 ° C overnight; The ligation product was transformed into E. coli DH5ot competent cells, incubated in ice bath for 30 min, heat shocked at 42 °C for 90 s, immediately transferred to ice for 2 min, and then added to 500 L 37 ° C pre-warmed non-resistant LB medium. After incubating at 37 °C for 1 h, finally, the bacterial solution was uniformly coated on LB solid medium containing kanamycin, placed in a 37 ° C incubator for overnight culture, and positive colonies were screened; 3 monoclonal clones were randomly picked. Colonies, colony PCR was positive, and the bacterial liquid was sent to Shanghai Biotech for sequencing; the obtained recombinant eukaryotic expression plasmid was named pEGFP-Cl/TNLG5A.