CN109504748A

CN109504748A - A method of it is specific in SNPs detection to improve RAA technology

Info

Publication number: CN109504748A
Application number: CN201811409926.0A
Authority: CN
Inventors: 程奇; 孙文丽
Original assignee: Zhejiang Shan Shi Wo Knight Biotechnology Co Ltd
Current assignee: Zhejiang Shan Shi Wo Knight Biotechnology Co Ltd
Priority date: 2018-11-23
Filing date: 2018-11-23
Publication date: 2019-03-22

Abstract

The invention discloses a kind of raising RAA technology methods specific in SNPs detection, specifically include design detection primer, the preparation of detection architecture, amplification and agarose gel electrophoresis detection.The present invention provides a kind of raising RAA technology methods specific in SNPs detection, klenow (exo-) albumen of high-purity can be obtained easily using escherichia expression system, destination protein expression quantity in E. coli system is higher, purifying process is simple, production cost is extremely low, and klenow (exo-) protein binding RAA rapid amplifying technology can be increased substantially and identified to the specificity of SNP site.

Description

A method of it is specific in SNPs detection to improve RAA technology

Technical field

The present invention relates to protein engineering fields, special in SNPs detection more particularly to a kind of raising RAA technology Anisotropic method.

Background technique

As the continuous development people of sequencing technologies have the importance of single base polymorphisms deep understanding, as A kind of molecular labeling of hereditary variation, for hereditary disease research, the medical treatments such as drug development field and biology, agronomy etc. Basic subject suffers from wide influence.It is quickly grown at present about the detection technique of SNPs.

Recombinase-mediated chain replaces nucleic acid amplification technologies (RAA technology), is that a kind of internal amplification technique of utilization is realized in core The novel amplification technique of sour external rapid amplifying, using the recombinase obtained from bacterium or fungi, at normal temperature, formed enzyme and The condensate of primer, when primer searches the complementary series exactly matched therewith on template DNA, in single stranded DNA combination egg With the help of white, the duplex structure of template DNA is opened, and under the action of archaeal dna polymerase, form new DNA complementary strand, expanded Product is increased with exponential.RAA technology can realize that nucleic acid rapid amplifying, amplified production can lead at normal temperature with the shorter time It crosses agarose gel electrophoresis or the quick detection of target gene is realized in real-time fluorescence detection.

Klenow (exo-) is that a kind of medium temperature polymerase enzyme using mutational formats eliminates calibration nucleic acid enzymatic activity (3 '- 5 ') and (5 ' -3 ') nick translation enzymatic activity has strand-displacement activity.

Therefore a kind of method that klenow albumen is applied to RAA technology is provided, increased substantially in SNPs detection The problem of specificity is those skilled in the art's urgent need to resolve.

Summary of the invention

In view of this, a kind of method specific in SNPs detection the present invention provides raising RAA technology, utilizes large intestine Bacillus expression system can obtain klenow (exo-) albumen of high-purity easily, and destination protein is expressed in E. coli system Amount is higher, and purifying process is simple, and production cost is extremely low, can be substantially by klenow (exo-) protein binding RAA rapid amplifying technology Degree, which improves, identifies the specificity of SNP site.

To achieve the goals above, the present invention adopts the following technical scheme:

Klenow (exo-) albumen is applied in RAA detection architecture.

Further, it using klenow (exo-) albumen as the polymerase in the RAA detection architecture, can effectively mention Specific detection of the height to SNP site.

A method of it is specific in SNPs detection to improve RAA technology, the specific steps are as follows:

(1) plasmid template is SEQ ID NO.12, and design detection primer is as follows:

Sal F:GATTAATGAGATCCGTGTTGAACAATTTACGGTCT；SEQ ID NO.1；

Sal R:GAGCGCTTCCATAATTAATTTCATATTACGCACGG；SEQ ID NO.2；

SalmF_{It is double}: GATTAATGAGATCCGTGTTGAACAATTTACGGTAG；SEQ ID NO.3；

SalmF_{It is single}: GATTAATGAGATCCGTGTTGAACAATTTACGGTCG；SEQ ID NO.4；

(2) preparation of detection architecture

50ul amplification reaction system includes 50pm upstream and downstream primer, 5%PEG 35K, 1ul template, and reaction solution adds water to 50ul；Wherein, the group of reaction solution is divided into 55mM Tris；12mM dithiothreitol (DTT)；12mM disodium creatine phosphate, 114ng/uL Creatine phosphokinase, 75mM potassium acetate, 490uM dNTPs, 3.5mM ATP, 6% trehalose, 7% mannitol, 5%PEG35000, 0.28ug/uL recombinase, 0.08ug/uL auxilin, 0.3ug/uL single strand binding protein, 0.11ug/uL klenow (exo-) Albumen, 105MmKAc and 200nMPro-U；

(3) it expands

In the amplification system of step (2), 100mmol/L magnesium acetate activating reaction is added, and under the conditions of 37 DEG C, After reacting 30min, adding the phenol-chloroform solution that 50ul volume ratio is 1:1, reaction was completed；

(4) agarose gel electrophoresis detects

Reaction solution after amplification in step (3) is centrifuged, wherein top layer's supernatant is amplified production, will be described Product is detected after amplification with 1% agarose gel electrophoresis.

Further, step (4 centrifugal methods are as follows: 12000rpm is centrifuged 5min.

It can be seen via above technical scheme that compared with prior art, the present invention provides a kind of raising RAA technologies to exist Specific method in SNPs detection, has following technological merit:

The present invention provides a kind of raising RAA technology methods specific in SNPs detection, utilize Bacillus coli expression System can obtain klenow (exo-) albumen of high-purity easily, and destination protein expression quantity in E. coli system is higher, Purifying process is simple, and production cost is extremely low, and klenow (exo-) protein binding RAA rapid amplifying technology can be increased substantially pair The specificity of SNP site identifies.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this The embodiment of invention for those of ordinary skill in the art without creative efforts, can also basis The attached drawing of offer obtains other attached drawings.

Fig. 1 attached drawing is pTrc99a-klenow provided by the invention (exo-) plasmid construction schematic diagram；

Fig. 2 attached drawing is the mutational site that PCR method provided by the invention obtains；

Wherein swimming lane 1-4 is PCR fragment 1；Swimming lane 5-8 is PCR fragment 2；Swimming lane M is 2000bp nucleic acid Marker；

Fig. 3 attached drawing is that overlapPCR provided by the invention obtains target fragment；

Wherein swimming lane 1-7 is overlapPCR result；Swimming lane M is 2000bp nucleic acid Marker；

Fig. 4 attached drawing is that the double digestion of recombinant plasmid provided by the invention is identified；

Wherein swimming lane 1 is after recombinant plasmid double digestion；Swimming lane 2 is before recombinant plasmid double digestion；Swimming lane M is 2000bp core Sour Marker；

Fig. 5 attached drawing is engineered strain inducing expression provided by the invention detection；

Wherein swimming lane 1 is that control is not induced to precipitate；Swimming lane 2 is not induce control supernatant；Swimming lane 3 is No. 1 bacterium precipitating of induction； Swimming lane 4 is No. 2 bacterium supernatants of induction；Swimming lane 5 is No. 2 bacterium precipitatings of induction；Swimming lane 6 is No. 1 bacterium supernatant of induction；Swimming lane M is albumen Marker；

Fig. 6 attached drawing is destination protein ni-sepharose purification provided by the invention；

Wherein swimming lane 1 is to precipitate after being crushed；Swimming lane 2 is to flow through；Swimming lane 3 is the elution of 20mM imidazoles；Swimming lane 4 is 40mM imidazoles Elution；Swimming lane 5 is the elution of 100mM imidazoles；Swimming lane 6 is the elution of 500mM imidazoles；Swimming lane M is albumen Marker；

Fig. 7 attached drawing is that destination protein provided by the invention is heparin column purified；

Wherein swimming lane 1-4 is Heparine column linear elution destination protein；

Fig. 8 attached drawing is amplification after 3 end double alkali yl of primer provided by the invention mutation；

Wherein swimming lane 1-2 is template 10ng/ul, primer Sal F and primer Sal R；

Swimming lane 3-4 is template 1ng/ul, primer Sal F and primer Sal R；

Swimming lane 5-6 is template 100pg/ul, primer Sal F and primer Sal R；

Swimming lane 7-8 is template 10pg/ul, primer Sal F and primer Sal R；

Swimming lane 9-10 is template 10ng/ul, primer Salm F_{It is single}With primer Sal R；

Swimming lane 11-12 is template 1ng/ul, primer Sal F_{It is single}With primer Sal R；

Swimming lane 13-14 is template 100pg/ul, primer Salm F_{It is single}With primer Sal R；

Swimming lane 15-16 is template 0.1fg/ul, primer Sal F_{It is single}With primer Sal R；

Swimming lane M is 2000Bbp nucleic acid Marker；

Fig. 9 attached drawing is amplification after 3 end double alkali yl of primer provided by the invention mutation；

Swimming lane 1-2 is template 10ng/ul, primer Salm F_{It is double}With primer Sal R；

Swimming lane 3-4 is template 10ng/ul, primer Sal F and primer Sal R；

Swimming lane 5-6 is template 100pg/ul, primer Salm F_{It is double}With primer Sal R；

Swimming lane 7-8 is template 100pg/ul, primer Sal F and primer Sal R；

Swimming lane 9-10 is template 100fg/ul, primer Salm F_{It is double}With primer Sal R；

Swimming lane 11-12 is template 100fg/ul, primer Sal F and primer Sal R；

Swimming lane 13 is template 0.1fg/ul, primer Salm F_{It is double}With primer Sal R；

Swimming lane 14 is template 0.1fg/ul, primer Sal F and primer Sal R；

Swimming lane M is 2000Bbp nucleic acid Marker.

Specific embodiment

Below in conjunction in the embodiment of the present invention, technical solution in the embodiment of the present invention is clearly and completely retouched It states, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based on the present invention In embodiment, every other implementation obtained by those of ordinary skill in the art without making creative efforts Example, shall fall within the protection scope of the present invention.

Embodiment 1

The expression and purifying of klenow (exo-) albumen

(1) amplification of target fragment

Genome of E.coli is that template uses primers F 1, R1 and F2 respectively, and R2 carries out PCR amplification, target fragment after amplification Carry out glue recycling.Then to recycle large fragment (klenow (exo-) protease I) SEQ ID NO.9 and small fragment SEQ ID Large fragment and small fragment equal proportion are mixed into template by NO.10 (a bit of sequence comprising two amino acid mutations), with F1 and R2 is target fragment SEQ ID NO.11 needed for upstream and downstream primer carries out Over-lap PCR acquisition.Reaction system is 25ul, product is after reaction with 1.5% agarose gel electrophoresis, and result recycles target fragment with plastic recovery kit after electrophoresis PCR product.Large fragment Amplification is 94 DEG C of 5min, 94 DEG C of 40s, 57 DEG C of 40s, 72 DEG C of 2min, 72 DEG C of 10min of totally 32 circulations. Small fragment Amplification is 94 DEG C of 5min, 94 DEG C of 40s, 57 DEG C of 40s, 72 DEG C of 30s, 72 DEG C of 10min of totally 32 circulations.Over-lap PCR amplification parameter 94 DEG C of 5min, 94 DEG C of 40s, 54 DEG C of 40s, 72 DEG C of 2min 72 DEG C of 10min of totally 32 circulations.Drawn by PCR mode Enter mutational site, when design primer makes two segments with the homologous recombination region of 20bp or so, and PCR amplification obtains size difference The destination protein band of about 1900bp, 120bp, are shown in Fig. 2.Size about 2000bp target fragment is obtained by overlapPCR to see Fig. 3.

1 template amplification primer of table

(2) building and inducing expression of recombinant expression plasmid

Ptrc99a plasmid vector is extracted then with NcoI, HindIII restriction enzymes double zyme with plasmid extraction kit Cut plasmid vector and glue recycling target fragment.Digestion system is as follows: plasmid 1ug, restriction enzyme each 1ul, 10 × Buffer2ul adds deionized water to total volume 20ul.Product is after digestion with Purification Kit.By klenow (exo-) mesh Genetic fragment and linearisation after plasmid vector with the ratio of 2:1 carry out prepare 10ul linked system.Connecting reaction condition is 25 DEG C of connection 3h.

Connection product converts escherichia coli cloning bacterial strain: after reaction 100ul competence is added in connection product by connection In, 500ulLB culture medium is added in 42 DEG C of heat shock 90s after ice bath 30min, ice bath 2min.37 DEG C of 200r/min shaking table culture 1h take 200ul bacterium solution is coated on 37 DEG C of constant incubators on the LB plate of the resistance of benzyl containing ammonia and is incubated overnight.Pass through carrier and target fragment The carrier containing target fragment is obtained after double digestion connection conversion, wherein pTrc99a-klenow (exo-) plasmid construction such as Fig. 1 It is shown.

Picking monoclonal is cultivated into LB culture medium to OD₆₀₀It is 0.6 or so.Take 1ul bacterium solution carry out bacterium colony be template with F1, R2 be primer carry out PCR identification, as a result as shown in figure 4, positive colony snippet extraction plasmid after double digestion it is clearly visible about 2000bp destination protein band and 4000bp linearization plasmid band, and positive plasmid is further sent to Hangzhou and holds up biology section, section Skill Co., Ltd sequence verification, by sequencing, correctly the positive colony bacterial strain without mutation freezes seed and extracts plasmid, by extraction Plasmid converts to Escherichia coli Rosetta (DE3) and expresses bacterial strain.

Single colonie, which is seeded in 5mlLB culture medium, after picking conversion cultivates to OD₆₀₀It is added for 0.6 final concentration of 0.5mmol/L IPTG collects a small amount of thallus in 37 DEG C of induction 4h, and centrifuge separation supernatant and precipitating after ultrasonication thallus will After broken supernatant precipitating carry out SDS-PAGE identification inducing expression after loadingbuffer boiling water bath 3-5min is added as a result, As a result as shown in figure 5, having apparent destination protein band and expected Klenow (exo-) albumen size one at about 65KDa It causes.

(3) purifying of shake flask fermentation and klenow (exo-) albumen of positive colony bacterium

It chooses monoclonal bacterium 37 DEG C of 200r/min into 100ml LB culture medium to be incubated overnight as first order seed, then by one Grade seed is seeded in the LB culture medium of 6 bottles of culture mediums of LB containing 600ml with 2% ratio.37 DEG C of 200r/min are cultivated to OD₆₀₀ Final concentration of 0.5mmol/L IPTG is added in 37 DEG C of induction 4h for 0.6.

It is centrifuged 30min at 4 DEG C, under the conditions of 6000rpm and abandons supernatant collection thallus.With disruption buffer (buffer solution A: 30mMPB (pH7.4), 20mM imidazoles, 500mM sodium chloride) thallus is resuspended.Bacterium solution is after being resuspended with ATS high pressure homogenizer (800Mpa, 4 DEG C) is 3 times broken.It opens after centrifuge pre-cooling with 4 DEG C, 16000rpm centrifugal breaking liquid, liquid nickel column after centrifugation Do affinity chromatography.Respectively with buffer (B:30mMPB (pH7.4), 40mM imidazoles, 500mM sodium chloride, C:30mMPB (pH7.4), 100mM imidazoles, 500mM sodium chloride, D:30mM PB (pH7.4), 300mM imidazoles, 500mM sodium chloride).By purpose egg after elution White dialysis is into buffer E (E:20mM Tris, 50mM potassium chloride 1Mm DTT, 1mM EDTA)

Using buffer E as equilibrium liquid after dialysis, with buffer F (E:20mMTris, 2M potassium chloride 1MmDTT, 1Mm EDTA) For eluent linear elution.Destination protein is dialysed again into E buffer after elution.It freezes into -80 DEG C of refrigerators stand-by.

The destination protein of the preliminary purification after affinity chromatography is subjected to SDS-PAGE detection, as a result such as Fig. 6, There is apparent destination protein in 40Mm at 65KDa, 100mM imidazole elution and position is correct, wherein 100mM imidazoles elutes Destination protein purity is higher, can be used for being further purified for destination protein.

(4) the further polishing purification of destination protein

By GE company prepacked column Heparine HP removing unit divide in destination protein remaining nucleic acid and to destination protein into The further polishing purification of row.The relatively high destination protein of purity is obtained after two-step purifying can be used for further activity Detection, is shown in Fig. 7.

Embodiment 2

Amplification is shown after preparing new system according to RAA system, 3 end of primer when template concentrations are 100pg/ul or more Target fragment cannot be effectively expanded after single mutation and double mutation occurs, template concentrations are lower than 100pg mutation and not mutated primer It cannot effectively expand target fragment and see Fig. 8, Fig. 9.New system is obvious for the detection effect of SNP as can be seen from the results however it is clever It is still necessary to further improve for sensitivity.

The present invention is by disclosing a kind of method that raising RAA technology is specific in SNPs detection, thus to LPOR- The structure of Y193F mutant protein crystal is parsed, and is laid the foundation for the structure elucidation of LPOR albumen and the determination of phase；Together When to thoroughly illustrating and determine that the catalytic mechanism or be engineered of photaesthesia hypervelocity albumen lays a good foundation.

Each embodiment in this specification is described in a progressive manner, the highlights of each of the examples are with other The difference of embodiment, the same or similar parts in each embodiment may refer to each other.For device disclosed in embodiment For, since it is corresponded to the methods disclosed in the examples, so being described relatively simple, related place is said referring to method part It is bright.The foregoing description of the disclosed embodiments enables those skilled in the art to implement or use the present invention.It is right A variety of modifications of these embodiments will be readily apparent to those skilled in the art, and as defined herein one As principle can realize in other embodiments without departing from the spirit or scope of the present invention.Therefore, the present invention will It will not be intended to be limited to the embodiments shown herein, and be to fit to consistent with the principles and novel features disclosed herein Widest scope.

Sequence table

<110>Zhejiang Shan Cehe knight Biotechnology Co., Ltd

<120>a kind of to improve RAA technology method specific in SNPs detection

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

gattaatgag atccgtgttg aacaatttac ggtct 35

<210> 2

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

gagcgcttcc ataattaatt tcatattacg cacgg 35

<210> 3

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

gattaatgag atccgtgttg aacaatttac ggtag 35

<210> 4

<211> 35

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

gattaatgag atccgtgttg aacaatttac ggtcg 35

<210> 5

<211> 57

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

catgccatgg atcatcatca ccatcaccac atgattctta tgacaactac gtcacca 57

<210> 6

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

aaatgcaaat accggcgctt ttccag 26

<210> 7

<211> 45

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

aagcgccggt atttgcattt gctaccgcaa ccgacagcct tgata 45

<210> 8

<211> 34

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

cccaagcttt tagtgcgcct gatcccagtt ttcg 34

<210> 9

<211> 1725

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

accgacagcc ttgataacat ctctgctaac ctggtcgggc tttcttttgc tatcgagcca 60

ggcgtagcgg catatattcc ggttgctcat gattatcttg atgcgcccga tcaaatctct 120

cgcgagcgtg cactcgagtt gctaaaaccg ctgctggaag atgaaaaggc gctgaaggtc 180

gggcaaaacc tgaaatacga tcgcggtatt ctggcgaact acggcattga actgcgtggg 240

attgcgtttg ataccatgct ggagtcctac attctcaata gcgttgccgg gcgtcacgat 300

atggacagcc tcgcggaacg ttggttgaag cacaaaacca tcacttttga agagattgct 360

ggtaaaggca aaaatcaact gacctttaac cagattgccc tcgaagaagc cggacgttac 420

gccgccgaag atgcagatgt caccttgcag ttgcatctga aaatgtggcc ggatctgcaa 480

aaacacaaag ggccgttgaa cgtcttcgag aatatcgaaa tgccgctggt gccggtgctt 540

tcacgcattg aacgtaacgg tgtgaagatc gatccgaaag tgctgcacaa tcattctgaa 600

gagctcaccc ttcgtctggc tgagctggaa aagaaagcgc atgaaattgc aggtgaggaa 660

tttaaccttt cttccaccaa gcagttacaa accattctct ttgaaaaaca gggcattaaa 720

ccgctgaaga aaacgccggg tggcgcgccg tcaacgtcgg aagaggtact ggaagaactg 780

gcgctggact atccgttgcc aaaagtgatt ctggagtatc gtggtctggc gaagctgaaa 840

tcgacctaca ccgacaagct gccgctgatg atcaacccga aaaccgggcg tgtgcatacc 900

tcttatcacc aggcagtaac tgcaacggga cgtttatcgt caaccgatcc taacctgcaa 960

aacattccgg tgcgtaacga agaaggtcgt cgtatccgcc aggcgtttat tgcgccagag 1020

gattatgtga ttgtctcagc ggactactcg cagattgaac tgcgcattat ggcgcatctt 1080

tcgcgtgaca aaggcttgct gaccgcattc gcggaaggaa aagatatcca ccgggcaacg 1140

gcggcagaag tgtttggttt gccactggaa accgtcacca gcgagcaacg ccgtagcgcg 1200

aaagcgatca actttggtct gatttatggc atgagtgctt tcggtctggc gcggcaattg 1260

aacattccac gtaaagaagc gcagaagtac atggaccttt acttcgaacg ctaccctggc 1320

gtgctggagt atatggaacg cacccgtgct caggcgaaag agcagggcta cgttgaaacg 1380

ctggacggac gccgtctgta tctgccggat atcaaatcca gcaatggtgc tcgtcgtgca 1440

gcggctgaac gtgcagccat taacgcgcca atgcagggaa ccgccgccga cattatcaaa 1500

cgggcgatga ttgccgttga tgcgtggtta caggctgagc aaccgcgtgt acgtatgatc 1560

atgcaggtac acgatgaact ggtatttgaa gttcataaag atgatgttga tgccgtcgcg 1620

aagcagattc atcaactgat ggaaaactgt acccgtctgg atgtgccgtt gctggtggaa 1680

gtggggagtg gcgaaaactg ggatcaggcg cactaaaagc ttggg 1725

<210> 10

<211> 132

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

catgccatgg atcatcatca ccatcaccac atgatttctt atgacaacta cgtcaccatc 60

cttgatgaag aaacactgaa agcgtggatt gcgaagctgg aaaaagcgcc ggtatttgca 120

tttgctaccg ca 132

<210> 11

<211> 1857

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

catgccatgg atcatcatca ccatcaccac atgatttctt atgacaacta cgtcaccatc 60

cttgatgaag aaacactgaa agcgtggatt gcgaagctgg aaaaagcgcc ggtatttgca 120

tttgctaccg caaccgacag ccttgataac atctctgcta acctggtcgg gctttctttt 180

gctatcgagc caggcgtagc ggcatatatt ccggttgctc atgattatct tgatgcgccc 240

gatcaaatct ctcgcgagcg tgcactcgag ttgctaaaac cgctgctgga agatgaaaag 300

gcgctgaagg tcgggcaaaa cctgaaatac gatcgcggta ttctggcgaa ctacggcatt 360

gaactgcgtg ggattgcgtt tgataccatg ctggagtcct acattctcaa tagcgttgcc 420

gggcgtcacg atatggacag cctcgcggaa cgttggttga agcacaaaac catcactttt 480

gaagagattg ctggtaaagg caaaaatcaa ctgaccttta accagattgc cctcgaagaa 540

gccggacgtt acgccgccga agatgcagat gtcaccttgc agttgcatct gaaaatgtgg 600

ccggatctgc aaaaacacaa agggccgttg aacgtcttcg agaatatcga aatgccgctg 660

gtgccggtgc tttcacgcat tgaacgtaac ggtgtgaaga tcgatccgaa agtgctgcac 720

aatcattctg aagagctcac ccttcgtctg gctgagctgg aaaagaaagc gcatgaaatt 780

gcaggtgagg aatttaacct ttcttccacc aagcagttac aaaccattct ctttgaaaaa 840

cagggcatta aaccgctgaa gaaaacgccg ggtggcgcgc cgtcaacgtc ggaagaggta 900

ctggaagaac tggcgctgga ctatccgttg ccaaaagtga ttctggagta tcgtggtctg 960

gcgaagctga aatcgaccta caccgacaag ctgccgctga tgatcaaccc gaaaaccggg 1020

cgtgtgcata cctcttatca ccaggcagta actgcaacgg gacgtttatc gtcaaccgat 1080

cctaacctgc aaaacattcc ggtgcgtaac gaagaaggtc gtcgtatccg ccaggcgttt 1140

attgcgccag aggattatgt gattgtctca gcggactact cgcagattga actgcgcatt 1200

atggcgcatc tttcgcgtga caaaggcttg ctgaccgcat tcgcggaagg aaaagatatc 1260

caccgggcaa cggcggcaga agtgtttggt ttgccactgg aaaccgtcac cagcgagcaa 1320

cgccgtagcg cgaaagcgat caactttggt ctgatttatg gcatgagtgc tttcggtctg 1380

gcgcggcaat tgaacattcc acgtaaagaa gcgcagaagt acatggacct ttacttcgaa 1440

cgctaccctg gcgtgctgga gtatatggaa cgcacccgtg ctcaggcgaa agagcagggc 1500

tacgttgaaa cgctggacgg acgccgtctg tatctgccgg atatcaaatc cagcaatggt 1560

gctcgtcgtg cagcggctga acgtgcagcc attaacgcgc caatgcaggg aaccgccgcc 1620

gacattatca aacgggcgat gattgccgtt gatgcgtggt tacaggctga gcaaccgcgt 1680

gtacgtatga tcatgcaggt acacgatgaa ctggtatttg aagttcataa agatgatgtt 1740

gatgccgtcg cgaagcagat tcatcaactg atggaaaact gtacccgtct ggatgtgccg 1800

ttgctggtgg aagtggggag tggcgaaaac tgggatcagg cgcactaaaa gcttggg 1857

<210> 12

<211> 419

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

gattaatgag atccgtgttg aacaatttac ggtctacttt gatttgatgc gcgtggtaaa 60

ttattcggat gaagtcgctt cctttggcat taatccaacg acctatcatc aaggtagtag 120

tcagtatttc tgggtaacgc atgaagaagg agaaaaactt cgggagcttg gttacgtgct 180

gcgaaatgcg cttgacgagc tttatcattg tctggcggtg acactcgcgc gtaacgtcaa 240

tgaatatttc ggtattcagg aaacaaaaca tatgctggat cagctggagg cgaaatttcc 300

tgatttactt aaagaagtgc tcagacatgc cacggtgcaa cgtatctctg aagttttgca 360

ccctttgtta agcgaacgtg tttccgtgcg taatatgaaa ttaattatgg aagcgctcg 419

Claims

1.klenow (exo-) albumen is applied in RAA detection architecture.

2. klenow (exo-) albumen according to claim 1 is applied in RAA detection architecture, which is characterized in that utilize Klenow (exo-) albumen can effectively improve the specificity inspection to SNP site as the polymerase in the RAA detection architecture It surveys.

3. a kind of improve RAA technology method specific in SNPs detection, which is characterized in that specific step is as follows:

Sal F:GATTAATGAGATCCGTGTTGAACAATTTACGGTCT；SEQ ID NO.1；

Sal R:GAGCGCTTCCATAATTAATTTCATATTACGCACGG；SEQ ID NO.2；

SalmF_{It is double}: GATTAATGAGATCCGTGTTGAACAATTTACGGTAG；SEQ ID NO.3；

SalmF_{It is single}: GATTAATGAGATCCGTGTTGAACAATTTACGGTCG；SEQ ID NO.4；

(2) preparation of detection architecture

50ul amplification reaction system includes 50pm upstream and downstream primer, 5%PEG 35K, 1ul template, and reaction solution adds water to 50ul； Wherein, the group of reaction solution is divided into 55mM Tris；12mM dithiothreitol (DTT)；12mM disodium creatine phosphate, 114ng/uL phosphoric acid flesh Enzyme, 75mM potassium acetate, 490uM dNTPs, 3.5mM ATP, 6% trehalose, 7% mannitol, 5%PEG35000,0.28ug/uL Recombinase, 0.08ug/uL auxilin, 0.3ug/uL single strand binding protein, 0.11ug/uL klenow (exo-) albumen, 105Mm KAc and 200nM Pro-U；

(3) it expands

In the amplification system of step (2), 100-120mmol/L magnesium acetate activating reaction is added, and under the conditions of 37 DEG C, After reacting 25-45min, adding the phenol-chloroform solution that 50-60ul volume ratio is 1:1, reaction was completed；

(4) agarose gel electrophoresis detects

Reaction solution after amplification in step (3) is centrifuged, wherein top layer's supernatant is amplified production, by the amplification Product is detected afterwards with 1% agarose gel electrophoresis.

4. a kind of raising RAA technology according to claim 3 method specific in SNPs detection, which is characterized in that Step (4) described centrifugal method are as follows: 12000rpm is centrifuged 5-10min.