WO2019036870A1

WO2019036870A1 - Method for constructing high-expression vector of human arntl gene, and applications

Info

Publication number: WO2019036870A1
Application number: PCT/CN2017/098368
Authority: WO
Inventors: 毛吉炎
Original assignee: 深圳市博奥康生物科技有限公司
Priority date: 2017-08-21
Filing date: 2017-08-21
Publication date: 2019-02-28

Abstract

Provided are a method for constructing a high-expression vector of a human ARNTL gene, and applications. The method comprises the steps of: firstly, amplifying and purifying a target gene : designing an upper primer and a lower primer, extracting a cell RNA, and carrying out PCR amplification by using a reversely-transcribed cDNA as a template, and after a target band is cut, carrying out recycling and purification by using a reagent kit; and secondly, constructing and verifying a recombinant plasmid pCDNA3.1-ARNTL: after double enzyme digestion is carried out on the purified PCR product and a vector pCDNA3.1 by using Xba I and EcoR I, respectively recycling and purifying the enzyme digestion products by using reagent kits, connecting segments, carrying out screening, culture, cloning and sequencing, and detecting the gene expression condition by using a QPCR.

Description

Method for constructing human ARNTL gene high expression vector and application thereof

[0001] The present invention relates to a method and application for constructing a human ARNTL gene high expression vector.

Background technique

[0002] Biological rhythm refers to the cyclical changes in the process of long-term biological evolution, in order to adapt to the cycle of nature. The living organisms from single cells to higher animals and plants and human life all form a regular life. Activity phenomenon. The ARNTL gene is an important circadian clock gene involved in the regulation of the biological rhythm of the organism and is closely related to the occurrence and development of tumors.

technical problem

[0003] The study found that the ARNTL gene has a tumor suppressing function, so the destruction of the gene will lose the inhibition of the tumor and make the tumor cells more aggressive. Therefore, the study of the ARNTL gene is very important, but the lack of a plasmid that promotes the expression of the ARNTL gene in the prior art has caused some obstacles to the progress of related research.

Problem solution

Technical solution

[0004] The object of the present invention is to provide a method for constructing a human ARNTL gene high expression vector, and to explore ARNT.

The effect of L on cell proliferation and apoptosis.

[0005] In order to achieve the above object, the present invention discloses a method for constructing a human ARNTL gene high expression vector.

, characterized by: using pCDNA3.1 as an intermediate vector, designing a pair of primers, introducing Xba l and EcoR into the primers

I cleavage site, PCR amplification of cDNA obtained by reverse transcription of RNA containing the gene of interest, and the target band is excised, and then recovered and purified by a kit, and the purified PCR product and vector pCDNA3.1 are used. After digestion with Xba l and EcoR I, the purified product is recovered by a kit, and then ligated, screened, and cloned to obtain a human ARNTL gene high expression vector. The steps of the construction method are as follows:

[0006] 1) Design primers

[0007] According to the gene sequence of interest to be amplified, a pair of primers are designed as follows: [0008] ARNTL-F: 5,- GTCTAGAATGGCAGACCAGAGAATGGAC -3' (SEQ ID No: 1

[0009] ARNTL-R: 5, - GGAATTCTTACAGCGGCCATGGCAAGTC -3' (SEQ ID No: 2

[0010] 2) using reverse transcription of RNA containing the gene of interest as a template, PCR amplification using the above pair of primers and DNA polymerase, and purification by a kit to obtain an amplification product;

[0011] 3) The pCDNA3.1 vector was double digested with Xba I and EcoR I;

[0012] 4) Gene recombination

[0013] The amplified product obtained in the step 2) is ligated with the double-digested pCDNA3.1 vector obtained in the step 3), and then cultured and cloned to obtain the human ARNTL gene high expression vector pCDNA. 3.1-ARNTL.

Advantageous effects of the invention

Beneficial effect

The human ARNTL gene high expression vector provided by the invention has the advantages of high transfection efficiency, low dosage, and can promote the high expression of ARNTL gene specifically and efficiently, and can be used as a powerful tool for drug research related to ARNTL and 幵Hair.

Brief description of the drawing

DRAWINGS

1 is a schematic diagram showing the results of ARFTL expression level detection by transcytometry of pCDNA3.1-ARNTL vector.

BEST MODE FOR CARRYING OUT THE INVENTION

[0016] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0017] Example 1 Design of ARNTL Gene Primers

[0018] According to the ARNTL gene coding sequence, it was analyzed using 01igo7 to find upstream primers and downstream primers (requiring as little primer-free dimer as possible and the annealing temperature difference is small), and then at the 5' end of the upstream primer and the downstream primer. Adding protective bases and restriction sites Xba I and EcoR, respectively I, The designed primer sequences are shown in SEQ ID No: 1 and SEQ ID No: 2.

[0019] Example 2 Construction of ARNTL gene high expression vector

[0020] After diluting the synthetic antibody, the coding sequence of the ARNTL gene was amplified by Premix PrimeSTAR HS enzyme, and Xba I and EcoR were used after electrophoresis recovery.

The enzyme I is digested, and the double-cut product is recovered by electrophoresis. The pcDNA3.1 vector was electrophoresed and recovered by Xba l and EcoR I enzyme.

[0021] The double-digested PCR product and the pcDNA3.1 vector were ligated with T4 DNA ligase, transformed into competent E. coli DH50C, uniformly coated onto an ampicillin-containing LB medium plate, and cultured at 37 ° C. After h, pick a single colony culture and send it to Shanghai Yingjun for sequencing. The recombinant E. coli was sequenced and the recombinant plasmid pCDNA3.1-ARNTL was extracted with Endo-Free Plasmid Mini Kit II.

Example 3 pCDNA3.1-ARNTL plasmid transduction A375 cells

[0023] A375 cells were seeded into six-well plates, cultured 18

h After the degree of fusion reached 80%, pCDNA3.1-ARNTL was transduced into A375 cells by PEI and cultured for 48 h.

Example 4 Quantitative PCR was used to detect the expression level of ARNTL gene.

[3752] A375 cells and ARNTL high expressing cells were inoculated separately into 6-well plates. Cell density reached 80<3⁄4-90<3⁄4吋, total RNA was extracted from each group using RNeasy Mini Kit, using PrimeScrip RT reagent

Kit reverse transcribes mRNA into cDNA, reverse transcription conditions: 37 ° C, 15 min; 85 ° C, 5 s; 4 ° C, ∞. After the end of the reverse transcription, 9 (L of RNase Free dH ₂₀ diluted cDNA was added and stored at -20 ° C for later detection.

[0026] Take cDNA 1 of each group of cells

Μΐ was used as a template, and GAPDH was used as an internal reference. Real-time quantitative PCR (QPCR) was used to detect the relative expression of ARNTL, and the reaction conditions were set: 95. C 30s, 1 cycle, 54. C 30s 40 cycles, 95. C 5s, 60 ° C lmin, 95 ° C 15 s, the results shown in Figure 1. It can be seen that the ARNTL gene expression level of ARNTL high expression cells is more than 160 times higher than that of normal A375 cells, indicating that the ARNTL gene cDNA sequence provided by the present invention is successfully inserted into the PCDNA3.1 expression vector, which can be specific, sustained and efficient. Promote high expression of ARNTL gene.

[0027] Industrial applicability

The human ARNTL gene high expression vector provided by the invention has the advantages of high transfection efficiency, low dosage, and can promote the high expression of ARNTL gene specifically and efficiently, and can be used as a powerful tool for drug research and development related to ARNTL.

Claims

Claim

[Claim 1] A method for constructing a human ARNTL gene high expression vector, characterized in that: pCDN is selected

A3.1 is an intermediate vector, a pair of primers are designed, Xba l and EcoR I cleavage sites are introduced into the primers, and RNA containing the gene of interest is reverse-transcribed as a template for PCR amplification, and the target band is cut and used. The kit is recovered and purified, and the purified PCR product and the vector pCDNA3.1 are digested with Xba I and EcoR I, and the purified product is recovered by a kit, and then ligated, cultured, cloned, and obtained. ARNTL gene high expression vector, the specific operation is as follows:

1) Design primers

According to the gene sequence of interest to be amplified, a pair of primers were designed as follows: ARNTL-F: 5'- GTCTAGAATGGCAGACCAGAGAATGGAC

-3' (SEQ ID No: 1);

ARNTL-R: 5, - GGAATTCTTACAGCGGCCATGGCAAGTC

-3' (SEQ ID No: 2).

2) using reverse transcription of RNA containing the gene of interest as a template, PCR amplification using the above pair of primers and DNA polymerase, and purification by a kit to obtain an amplification product;

3) The pCDNA3.1 vector was double digested with Xba I and EcoR I;

4) Gene recombination

The amplified product obtained in the step 2) is ligated to the double-digested pCDNA3.1 vector obtained in the step 3), and then cultured and cloned to obtain the human ARNTL gene high expression vector pCDNA3.1- ARNTL.