WO2018230731A1 - Région de commande de transcription d'oncogène - Google Patents

Région de commande de transcription d'oncogène Download PDF

Info

Publication number
WO2018230731A1
WO2018230731A1 PCT/JP2018/023028 JP2018023028W WO2018230731A1 WO 2018230731 A1 WO2018230731 A1 WO 2018230731A1 JP 2018023028 W JP2018023028 W JP 2018023028W WO 2018230731 A1 WO2018230731 A1 WO 2018230731A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
dna
binding
runx3
present
Prior art date
Application number
PCT/JP2018/023028
Other languages
English (en)
Japanese (ja)
Inventor
公成 伊藤
Original Assignee
国立大学法人 長崎大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人 長崎大学 filed Critical 国立大学法人 長崎大学
Priority to JP2019525586A priority Critical patent/JP7212943B2/ja
Publication of WO2018230731A1 publication Critical patent/WO2018230731A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/74—Synthetic polymeric materials
    • A61K31/785—Polymers containing nitrogen
    • A61K31/787—Polymers containing nitrogen containing heterocyclic rings having nitrogen as a ring hetero atom
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/18—Water

Definitions

  • the present invention relates to an antitumor agent containing a substance that specifically recognizes the transcriptional regulatory region of the c-Myc gene and inhibits the binding of Runx3 to the sequence.
  • anticancer agents regulate body immunity, such as molecular targeting agents that target cancer-specific mutations and anti-PD-1 antibodies.
  • immunotherapeutic agents that cause the immune mechanism to attack cancer.
  • conventional anticancer drugs are susceptible to normal cells, and molecular targeting agents may be very effective depending on the target, but may not be very effective, and immunotherapeutic agents are among the patients undergoing treatment. There is a problem that effective people are limited.
  • mutations Even if mutations accumulate in a cell, in most cases, the mutation is repaired, or the cell is killed by apoptosis or immune attack, but if 3 to 10 mutations accumulate, it is said to cause cancer. Yes.
  • mutations there are mutations that occur in common factors, and there is a common molecular basis for complex malignant tumors.
  • inactivation of p53 and increased expression of c-Myc are most widely confirmed.
  • p53 is the most famous and considered “cancer suppressor gene”.
  • the main role of p53 is to check for genetic abnormalities in cells and to induce apoptosis if there are abnormalities. It is known that p53 has some kind of mutation (dysfunction, decreased expression level) in about 50% to 80% of all tumors. It is also considered to correlate with malignancy and anticancer resistance.
  • anticancer drugs have been developed for p53 and its surrounding molecules by a great number of methods, it has not been successful to date. It is technically difficult to increase normal p53, and when it exceeds a certain amount, apoptosis is induced. Therefore, when it is excessively expressed, apoptosis is also induced in normal cells (ie, “normal” Difficult to adjust to "amount”). For this reason, many anticancer agents targeting upstream and downstream of p53 are under development, but none has been successful.
  • C-Myc has a role of regulating proteins for cell proliferation.
  • c-Myc When c-Myc is knocked down, no growth preparation occurs and the cell cycle stops. Apoptosis is most easily induced at the moment of proliferation, but becomes resistant to apoptosis when the cell cycle stops. Therefore, c-Myc is also difficult to be a direct target for drug discovery.
  • the Runx family has an evolutionarily conserved Runt domain, and binds to the transcriptional regulatory region of the target gene via the domain.
  • the Runx family also has a region on the C-terminal side that interacts with various transcription factors (cofactors) to form heterodimers and controls transcription of downstream target genes (Non-patent Document 1).
  • the mammalian Runx family consists of Runx1, Runx2, and Runx3, but these abnormalities are closely associated with various diseases.
  • Runx1 is a target for chromosomal translocation in acute myeloid leukemia, and lack of one allele of Runx2 due to chromosomal instability (LOH) has been attributed to clavicular skull dysplasia.
  • LH chromosomal instability
  • Runx3 is a tumor suppressor gene for gastric cancer (Non-patent Document 2). Furthermore, it has been suggested that Runx3 binds to p53 in the nucleus and positively regulates the transcription of the target gene group of p53 (Non-patent Document 2). In addition, since a mouse in which Runx3 is knocked down is lethal and a mouse whose expression level is halved also has a short life span, it is considered that Runx3 has an essential function for survival and is not suitable as a target for anticancer agents. It seems.
  • Runx binding sequences (ACCCACA, TGCGGT) exist upstream from the transcription start site of the c-Myc gene, and endogenous Runx1 binds to these Runx binding sequences through interaction with cofactors. Have been reported to suppress the expression of the c-Myc gene (Non-patent Document 1).
  • Non-patent Document 3 discloses PI pyramide (Chb-50) that targets TGCGGT, although not used in experiments.
  • PI pyramide Chob-50
  • Runx binding sequences there are a large number of Runx binding sequences in the transcriptional regulatory region of the c-Myc gene, and it is not known which part of the Runx recognition sequence is important.
  • any mouse knocked out of Runx1, Runx2 or Runx3 is embryonic lethal, the PI pyramide targeting a large number of Runx binding sequences is expected to cause very strong side effects.
  • an object of the present invention is to identify a factor that can be a realistic target for cancer suppression from a molecular basis common to cancers, and to target an effective and safe cancer treatment or target. It is to provide a preventive measure.
  • the present inventor first paid attention to the relationship between p53 and Runx3 in osteosarcoma, and mice in which p53 was knocked out specifically for osteoblasts almost certainly became osteosarcoma. It has been found that the onset of tumors can be remarkably suppressed by knocking out to the junction.
  • the analysis of NIH database revealed that there was a positive correlation between the expression levels of Runx3 and c-Myc in human osteosarcoma, so we analyzed the molecular mechanism in osteosarcoma cells of p53 conditional knockout mice. However, it was found that Runx3 excessively induces c-Myc expression in the situation where p53 was deleted.
  • the present inventor has found that in p53 conditional knockout mice, the Runx binding sequence 5′-TGCGGT-3 ′ located in the vicinity of the transcription start point upstream of the transcription start point of the c-Myc gene. (In the present specification, unless otherwise specified, nucleotide sequences are written in the 5 ′ to 3 ′ direction, from left to right.) By simply introducing mutations to destroy the Runx binding sequence, Runx3 or c -It was found that the tumor suppressor effect is higher than that of suppressing the expression of the Myc protein itself. In addition, it was confirmed that mice having the mutation grew inferior to wild-type mice.
  • the present inventor specifically inhibits the binding of Runx3 to the Runx binding sequence located closest to the transcription start site in the transcriptional regulatory region of the c-Myc gene by some means.
  • the present invention is as follows. [1] Specifically recognizes a continuous target region of 12 nucleotides or more containing at least part of the Runx binding sequence TGCGGT in the upstream of the transcription start point of the c-Myc gene, An antitumor agent comprising a substance that inhibits binding of Runx3 to a Runx binding sequence. [2]
  • the Runx binding sequence is a nucleotide sequence from ⁇ 309 to ⁇ 304 from the transcription start point of the human c-Myc gene, or a sequence (counterpart) corresponding to the nucleotide sequence in other mammalian orthologs. 1].
  • [3] The agent according to [1] or [2], which is applied to a subject in which p53 is inactivated.
  • [4] The agent according to any one of [1] to [3], wherein the substance is an antigene for a DNA sequence in the target region.
  • the antigene is pyrrole-imidazole polyamide.
  • [6] The agent according to any one of [1] to [3], wherein the substance is a nucleic acid sequence recognition module that specifically binds to the target region.
  • the nucleic acid sequence recognition module is CRISPR-Cas, zinc finger motif, TAL effector or PPR motif.
  • nucleic acid sequence recognition module is CRISPR-dCas.
  • nucleic acid sequence recognition module is CRISPR-dCas.
  • the substance comprises a nuclease that forms a complex with the nucleic acid sequence recognition module.
  • the substance further comprises donor DNA capable of causing homologous recombination at a site cleaved by the nuclease.
  • nucleic acid sequence recognition module forms a complex with a transcription repressing factor.
  • Runx binding sequence TGCGGT nearest to the transcription start point upstream of the transcription start point of the c-Myc gene for use in inhibiting tumor formation and / or inhibiting the growth of already formed tumors A substance that specifically recognizes a target region of 12 nucleotides or more that contains at least a part of and binds Runx3 to the Runx binding sequence.
  • the tumorigenic ability of an extremely large number of types of tumor cells can be suppressed only by inhibiting a specific sequence at a specific position on the genome (binding sequence of Runx3 of c-Myc promoter; 6 bp).
  • a substance that specifically introduces a mutation into the specific sequence and a substance that specifically binds to the specific sequence and can inhibit the binding between the sequence and Runx3 brings about a revolutionary anticancer effect.
  • FIG. 1 is a diagram showing the positions of Runx binding sequences ACCACA and TGCGGT existing in the upstream region of the transcription start sites of mouse c-Myc gene and human c-Myc gene.
  • FIG. 2 shows that as a result of introducing a mutation into the Runx binding sequence TGCGGT (mR1) located closest to the transcription start site of c-Myc, the expression level of c-Myc was reduced and tumorigenicity was suppressed.
  • FIG. FIG. 3 is a graph showing that the introduction of mutations into mR1 had a greater tumorigenic effect suppressing effect than that of Runx3 knockdown or c-Myc knockdown.
  • FIG. 4-1 is a diagram showing an outline of genetic modification by homologous recombination using ES cells in the production of a genetically modified mouse in which a mutation is introduced into mR1.
  • FIG. 4-2 is a diagram showing an outline of genome editing in the production of a genetically modified mouse in which a mutation is introduced into mR1.
  • FIG. 5 shows that as a result of introducing a mutation into mR1, the tumorigenic ability was greatly suppressed. On the other hand, even if there is a deletion in a part other than the 6 bases of mR1, the tumorigenic ability does not change so much.
  • FIG. FIG. 6 is a diagram showing that tumorigenicity is suppressed as a result of introducing mutations (base deletion or insertion) into mR1.
  • FIG. 7 is a diagram showing that lymphoma formation by p53 knockout is rescued by combining systemic p53 knockout and mR1 m / m .
  • the present invention includes at least a part of a Runx binding sequence (TGCGGT; also referred to as “the cis element of the present invention”) nearest to the transcription start point upstream of the transcription start point of the c-Myc gene.
  • An antitumor agent comprising a substance that specifically recognizes a continuous target region of 12 nucleotides or more and inhibits Runx3 binding to the Runx binding sequence (hereinafter also referred to as “binding inhibitor of the present invention”)
  • binding inhibitor of the present invention hereinafter, it is also referred to as “the antitumor agent of the present invention”.
  • the term “antitumor agent” means an agent that can suppress tumor formation and / or growth of an already formed tumor, and preferably has an effect of inhibiting tumor formation and / or tumor regression. .
  • c-Myc gene examples include, for example, human c-Myc (NCBI Gene ID: 4609), mouse c-Myc (NCBI Gene ID: 17869), rat c-Myc (NCBI Gene ID: 24577) or others Orthologs thereof in mammals (eg, rabbits, sheep, pigs, cattle, cats, dogs, monkeys), or their natural allelic variants or gene polymorphisms.
  • the nucleotide sequence of the c-Myc gene is the nucleotide sequence of chromosome 8 (NCBI Reference Reference: NC_000008.11) registered in the NCBI database for humans, and the chromosome sequence of chromosome 15 for mice. It is expressed based on the nucleotide sequence (NCBI Reference Reference Sequence: NC_000081.6).
  • the transcription start point of human c-Myc gene is nucleotide G at position 127736069 in the nucleotide sequence of NC_000008.11
  • the transcription start point of mouse c-Myc gene is nucleotide C at position 61985341 in the nucleotide sequence of NC_000081.6. is there.
  • the nucleotide sequence of 3 kb upstream of the transcription start site of human c-Myc gene is SEQ ID NO: 1, and 3 kb upstream of the transcription start site of mouse c-Myc gene (from 61982341 of NC_000081.6)
  • the nucleotide sequence at position 61985340 is shown in SEQ ID NO: 2, respectively.
  • the position of the nucleotide in the transcription regulatory region upstream from the transcription start point of the c-Myc gene is represented by the distance from the nucleotide, with the nucleotide immediately before the transcription start point being -1.
  • the Runx binding sequence TGCGGT closest to the transcription start point upstream of the transcription start point of the human c-Myc gene is represented by the -309 to -304th positions (represented by SEQ ID NO: 1). In the nucleotide sequence at nucleotide numbers 2692 to 2697).
  • the Runx binding sequence TGCGGT closest to the transcription start point upstream of the transcription start point of the mouse c-Myc gene is the position ⁇ 315 to ⁇ 310 (the nucleotide number in the nucleotide sequence represented by SEQ ID NO: 2). 2686-2691).
  • the c-Myc gene of the present invention has a nucleotide sequence other than those registered in the NCBI database, for example, a natural allelic variant (allele when the registered nucleotide sequence is a wild type). Naturally, a frequency of 1% or more) or a gene polymorphism (allele frequency of less than 1%) is also included.
  • the positional relationship with the transcription start point may differ from the above definition due to the insertion or deletion of one or more nucleotides, but the position is easily specified by alignment with the reference sequence. be able to.
  • the position of the cis element of the present invention in the c-Myc gene of mammals other than humans and mice can also be specified in the same manner.
  • the cis element of the present invention is the nucleotide sequence from -309 to -304 from the transcription start point of the human c-Myc gene, or other mammalian orthologs or their natural allelic variants or gene polymorphisms.
  • the “cis element” is present on the regulatory region of a gene, is involved in the control of the transcription level of the gene, and is an important element that determines the expression level of the gene product encoded by the gene. This is a region of double-stranded DNA.
  • the cis element of the present invention is a Runx binding region that is closest to the transcription start point of the c-Myc gene, that is, a double-stranded DNA region consisting of a normal strand: TGCGGT and a reverse strand: ACCGCA. It is.
  • a region of 12 nucleotides or more that includes at least a part of the cis element TGCGGT of the present invention means all of the cis elements (TGCGGT), Includes TGCGG, TGCG, TGC, TG or T from which the nucleotide is removed from the 3 ′ side of the element, or GCGGT, CGGT, GGT, GT or T from which the nucleotide is removed from the 5 ′ side of the cis element And a region consisting of a partial nucleotide sequence containing 12 or more consecutive nucleotides in the upstream sequence of the transcription start site of the c-Myc gene. For example, when the length of the region is 20 nucleotides, taking the human c-Myc gene as an example, the region surrounded by the box in Table 1 is included in the target region of the present invention.
  • a region containing only one terminal nucleotide of the cis element is sufficient, but preferably 2 nucleotides, more preferably 3 nucleotides, still more preferably 4 nucleotides, particularly preferably 5 from the end of the cis element of the present invention.
  • the target regions of the present invention are preferably the regions (2) to (24), more preferably the regions (3) to (23), and further the regions (4) to (22).
  • regions (5) to (21) are particularly preferable, and regions (6) to (20) are most preferable.
  • the length of the target region of the present invention is not particularly limited as long as the binding inhibitor of the present invention can specifically recognize and bind to the region, but is preferably 12 nucleotides or more, more preferably 15 nucleotides or more, Preferably it is 17 nucleotides or more.
  • the upper limit of the length is not particularly limited, but is, for example, 30 nucleotides or less, preferably 25 nucleotides or less, more preferably 22 nucleotides or less. Accordingly, the range of the length of the target region includes, for example, 12 to 30 nucleotides, preferably 15 to 25 nucleotides, and more preferably 17 to 22 nucleotides.
  • the binding inhibitor of the present invention comprises the target of the present invention comprising all or part of the cis element of the present invention, which is the Runx binding sequence nearest to the transcription start site upstream of the transcription start site of the c-Myc gene.
  • the binding inhibitor of the present invention is preferably applied to a subject in which p53 is inactivated (at least binds to Runx3 and lacks the activity of suppressing the transcriptional activation of c-Myc gene by Runx3).
  • the binding inhibitor of the present invention may be any substance as long as it can block the binding of Runx3 to the cis element of the present invention by specifically recognizing and binding to the target region of the present invention,
  • a protein that can specifically bind to the target region of the present invention, a nucleic acid that specifically hybridizes with the target region of the present invention, and can form a triplex (Hoogsteen-type recognition) or an analog thereof examples include a broad sense antigene such as a substance (for example, PI polyamide) capable of specifically binding to a minor groove having a double helical structure of the target region of the present invention.
  • a component used for genome editing that can specifically destroy a cis element by introducing a mutation into the cis element of the present invention can also be included in the binding inhibitor of the present invention.
  • genome editing technology involving genome sequence modification particularly double-strand DNA breakage; modification involving DSB
  • TALEN CRISPR / Cas nucleic acid sequence recognition modules
  • Antigene triplex DNA formation type oligonucleotide (TFO)
  • TFO triplex DNA formation type oligonucleotide
  • the position of the 1'-position carbon of the base of the third nucleic acid is outward (Hoogsteen binding type) (SEQ ID NO: 13) and the opposite (reverse Hoogsteeen binding type) ) (SEQ ID NO: 14), the former being parallel orientation (the same orientation as the strand on which DNA double-stranded base pairs are formed) and the latter being anti-parallel orientation (DNA double-stranded base pairs The orientation is opposite to that of the side chain to be formed).
  • the sequence of each strand of the DNA duplex is represented by SEQ ID NO: 15 or 16.
  • the parallel oriented TFO has T (T: AT base pair) and protonated C (C) for the AT base pair and the GC base pair A and G in the DNA duplex, respectively. + : GC base pair) is bound.
  • the anti-parallel orientation TFO has T (T: AT base pair) and G (G: G: G) for AT base pair and GC base pair A and G in the DNA duplex, respectively. GC base pairs).
  • C In order for C to be protonated, it must be under acidic conditions, so its use under physiological conditions is limited, but methylcytidine that is protonated even in neutrality or a derivative that does not require protonation ( This problem can be avoided by using the example 5-methyl-6-oxocytidine).
  • a typical triplex is a DNA duplex with one homopurine (G or A) strand and the other homopyrimidine (C or T) strand, while TFO binds to the homopurine strand in the major groove. It is formed by doing.
  • TFO is limited to those that target purine-rich (pyrimidine-rich in the reverse strand) DNA duplex.
  • a 10-nucleotide AGGA C AAGGA SEQ ID NO: 4 immediately before the cis element of the present invention may be mentioned as a purine-rich sequence in the target region of the present invention.
  • an antigene is designed for 10 nucleotides AGGACAAGGA (SEQ ID NO: 4) immediately before the cis element of the present invention, and a PI polyamide capable of specifically recognizing the cis element of the present invention described later is used as an appropriate linker.
  • the specificity for the target region of the present invention can also be increased by linking via (eg, amino acid linkers such as proline, lysine, glycine, peptide linkers, etc.).
  • the nucleotide molecule constituting TFO may be natural DNA or RNA, and various chemical modifications may be performed to improve stability (chemical and / or enzyme) and specific activity (affinity with DNA). It may be an applied nucleotide molecule or a nucleic acid analogue.
  • the phosphate residue (phosphate) of each nucleotide constituting the oligonucleotide is replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, boranophosphate, etc. Modification to be mentioned.
  • Another example of the chemical modification is a modification in which the 2′-position hydroxyl group of each nucleotide sugar is substituted with another functional group.
  • a halogen atom eg, fluorine atom
  • a C 1-6 alkyl group eg, methyl group
  • a C 1-6 alkyl group eg, methyl group
  • Good amino group; -OR (R is for example CH 3 (2'-O-Me), CH 2 CH 2 OCH 3 (2'-O-MOE), CH 2 CH 2 NHC (NH) NH 2 , CH 2 CONHCH 3 and CH 2 CH 2 CN are shown).
  • nucleic acid analog examples include UNA (unlocked nucleic acid), HNA, morpholino oligo and the like.
  • the hydroxyl group of the hexopyranose part may be deoxylated.
  • the hydroxyl group of the hexopyranose part may be substituted with a fluorine atom.
  • TFO can be chemically synthesized by, for example, a method known per se described in International Publication No. 2005/021570, International Publication No. 03/068695, International Publication No. 2001/007455, or a method analogous thereto.
  • the desired modified oligonucleotide is available by consignment synthesis.
  • PI polyamide In PI polyamide, a pyrrole (Py) / imidazole (Im) pair recognizes a CG base pair, a Py / Py pair recognizes an AT or TA base pair, and an Im / Py pair recognizes a GC base pair.
  • Hp 3-hydroxypyrrole
  • the Hp / Py pair recognizes the TA base pair
  • the Py / Hp pair recognizes the AT base pair.
  • the ⁇ -aminobutyric acid moiety becomes a linker and is folded entirely to take a U-shaped conformation (hairpin type). In the U-shaped conformation, two chains containing Py and Im are arranged in parallel across the linker.
  • PI polyamide enters the minor groove of the DNA duplex and binds to any DNA duplex in a base sequence-specific manner, thereby inhibiting the binding of transcription factors to the DNA duplex.
  • the PI polyamide of the present invention comprises the target region of the present invention (ie, all of the cis elements of the present invention (TGCGGT), TGCGG, TGCG, TGC, TG or T, wherein one nucleotide is removed from the 3 ′ side of the cis element.
  • nucleotides in the upstream sequence of the transcription start point of the c-Myc gene including GCGGT, CGGT, GGT, GT or T from which 5 nucleotides have been removed from the 5 ′ side of the cis element (for example, , 12 to 30 nucleotides, preferably 15 to 25 nucleotides, more preferably 17 to 22 nucleotides), a region consisting of a partial nucleotide sequence of the c-Myc gene regulatory region). Inhibits Runx3 binding to the element and activates c-Myc gene transcription Control to.
  • PI polyamides do not have a nucleic acid structure unlike existing antisense nucleic acids and siRNAs, and therefore are not easily degraded by nucleolytic enzymes in vivo, and do not require a drug delivery system such as a vector or chaotic lipid, or an electroporation method.
  • PI polyamide can be synthesized using, for example, Fmoc peptide solid-phase synthesis technology using Py and Im derivatives having the Fmoc-protected amino group (following formula) as synthesis raw materials, but is not limited thereto.
  • X represents a carbon or nitrogen atom.
  • a suitable linker such as ⁇ -aminobutyric acid is introduced into the molecule between the paired pyrrole-imidazole chains so that the PI polyamide can form the desired hairpin structure.
  • an appropriate spacer molecule that does not contribute to the binding with a target DNA sequence such as ⁇ -alanine can be inserted into a complementary position of both pyrrole-imidazole pairs to be paired.
  • the terminal amino group is capped with an acyl group or the like, and then used as a carboxylic acid using trifluoroacetic acid (TFA) or N, N-dimethylaminopropylamine (Dp) Can be used to cut PI polyamide from the solid phase as an amine.
  • TFA trifluoroacetic acid
  • Dp N, N-dimethylaminopropylamine
  • pyrrole-imidazole polyamide derivatives can be prepared by introducing various functional groups into the molecular ends.
  • various functional groups for example, seco-CBI, chlorambucil, bleomycin, nitrogen mustard, pyrrolobenzodiazepine, duocarmycin, enediyne compounds, derivatives of these, etc. that have the ability to alkylate DNA (alkylating agents) are introduced as necessary can do.
  • the alkylating agent introduces an alkyl group at the guanine N-7 position or the adenine N-3 position of DNA, and causes an adduct formation or a cross-linking reaction between guanines or adenines.
  • Double-stranded DNA that has undergone a cross-linking reaction or double-stranded DNA that has been formed as an adduct is difficult to repair by the repair mechanism. As a result, DNA cannot be transcribed or replicated, resulting in cell growth arrest or cell death due to apoptosis. Is induced.
  • the obtained PI polyamide can be isolated and purified by a known purification method.
  • the purification method include solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, and combinations thereof.
  • Purified PI polyamide can be lyophilized by a method known per se and stored at room temperature. When used, it can be dissolved in an organic solvent such as DMSO and then diluted to an appropriate concentration with water or a water / organic solvent mixture. it can.
  • a design method and a production method of PI polyamide are described in, for example, Japanese Patent No. 3045706, Japanese Patent Application Laid-Open No. 2001-136974, and WO 03/000683.
  • PNA Peptide nucleic acid
  • the third antigene includes peptide nucleic acid (PNA).
  • PNA is a molecule having a peptide structure in the main chain and a structure similar to DNA or RNA.
  • PNA has a main chain in which N- (2-aminoethyl) glycine is bonded by an amide bond instead of sugar.
  • a purine ring or pyrimidine ring corresponding to a nucleobase is bonded to the main chain via a methylene group and a carbonyl group.
  • PNA does not have a phosphate site charge that is present in DNA or RNA
  • the PNA / DNA duplex forms a stronger bond than the DNA / DNA duplex due to a decrease in electrostatic repulsion. Therefore, PNA penetrates into a DNA duplex to form a D-loop and forms a Watson-Crick base pair with a complementary DNA strand, thereby binding a transcription factor to the DNA duplex. Can be inhibited.
  • Accurate molecular recognition is also performed when PNA strands bind to complementary DNA, and PNA / DNA duplexes containing mismatched base pairs are less likely than DNA / DNA duplexes with similar mismatches. It is known to become stable. Therefore, it is expected that the off-target effect can be further reduced by using PNA.
  • PNA is not easily recognized by nucleases and proteases in vivo, has resistance to enzymatic degradation, and can exist stably in a wider pH range.
  • the PNA of the present invention comprises the target region of the present invention (ie, all of the cis elements of the present invention (TGCGGT), TGCGG, TGCG, TGC, TG or T from which 3 nucleotides have been removed from the 3 ′ side of the cis element, Alternatively, it includes GCGGT, CGGT, GGT, GT or T from which 5 nucleotides are removed from the 5 ′ side of the cis element, and 12 or more consecutive nucleotides in the upstream sequence of the transcription start site of the c-Myc gene (for example, A cis element of the present invention by specifically binding to a region consisting of a partial nucleotide sequence of the c-Myc gene regulatory region comprising 12-30 nucleotides, preferably 15-25 nucleotides, more preferably 17-22 nucleotides) Inhibits binding of Runx3 to c-Myc gene and suppresses transcriptional activation
  • PNA can be produced using a peptide solid phase synthesis technique known per se.
  • Binding Inhibitor of the Present Invention Utilizing Genome Editing Technology
  • (a) Binding Inhibitor without Encoding Genomic Sequence The present invention also inhibits binding of Runx3 to the cis element of the present invention using genome editing technology.
  • an antitumor agent characterized by suppressing the transcriptional activation of the c-Myc gene is provided.
  • a method using an artificial nuclease in which a molecule having a sequence-independent DNA cutting ability and a molecule having a sequence recognition ability are combined is well known.
  • ZFN zinc finger nuclease
  • TAL transcriptional activator-like effector
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • CRISPR-associated nuclease Cas
  • a specific target nucleotide sequence is recognized by a protein (ZF, TAL effector, PPR) or a complex of RNA and protein (CRISPR-Cas9). Therefore, it is possible to inhibit the binding of Runx3 to the cis element of the present invention by binding to the target region of the present invention using these substances (nucleic acid sequence recognition modules) that impart sequence specificity to the artificial nuclease. it can.
  • nucleic acid sequence recognition module means a molecule or molecular complex having the ability to specifically recognize and bind to a specific nucleotide sequence (ie, target nucleotide sequence) on a DNA strand. Binding of the nucleic acid sequence recognition module to the target nucleotide sequence allows the effector linked to the module to specifically act on the targeted site of DNA.
  • the nucleic acid sequence recognition module includes a CRISPR-Cas system.
  • the CRISPR-Cas system is a complex of short CRISPR RNA (crRNA) with a target nucleotide sequence and trans-activated crRNA (tracrRNA), or a single synthetic RNA (guide RNA, gRNA that combines crRNA and tracrRNA) ) Recognizes the sequence of the target DNA, so that any sequence can be targeted simply by synthesizing an oligo DNA that can specifically hybridize with the complementary sequence of the target nucleotide sequence.
  • Nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of Cas protein and RNA molecule (guide RNA) consisting of target nucleotide sequence and tracrRNA necessary for Cas protein recruitment.
  • a nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of crRNA containing RNA having the same sequence as the target nucleotide sequence, tracrRNA, and Cas.
  • the Cas protein used in the present invention is not particularly limited as long as it belongs to the CRISPR system, but is preferably Cas9.
  • Cas9 include, but are not limited to, Cas9 (SpCas9) derived from Streptococcus pyogenes, Cas9 (StCas9) derived from Streptococcus thermophilus, and the like. SpCas9 is preferable. In consideration of use in human clinical practice, it is not preferable to generate DSB, and therefore, Cas that has inactivated DNA cleavage activity (dCas) is preferable.
  • dCas DNA cleavage activity
  • the 10th Asp residue is converted to an Ala residue
  • a D10A mutant lacking the ability to cleave the opposite strand that forms a complementary strand with the guide RNA
  • the 840th His residue is the Ala residue.
  • Double mutants of the H840A mutant lacking the ability to cleave the guide RNA and the complementary strand converted with the group can be used, but other mutant Cass can be used as well.
  • CRISPR-Cas When CRISPR-Cas is used as a nucleic acid sequence recognition module, when a complex of guide RNA and Cas is bound to the target nucleotide sequence, the cis element of the present invention is blocked by the complex, and Runx3 cannot bind
  • the target nucleotide sequence that is, CTGCGTATATCAGTCACCGC; SEQ ID NO: 12
  • CTGCGTATATCAGTCACCGC SEQ ID NO: 12
  • CGG in the cis element of the present invention is PAM
  • the reverse strand sequence of 20 nucleotides upstream ie, ATACTCACAGGACAAGGATG; SEQ ID NO: 6
  • crRNA can be designed.
  • the nucleic acid sequence recognition module includes a zinc finger motif, a TAL effector, a PPR motif, etc., as well as DNA of a protein that can specifically bind to DNA such as a restriction enzyme, transcription factor, RNA polymerase, etc.
  • DNA of a protein that can specifically bind to DNA such as a restriction enzyme, transcription factor, RNA polymerase, etc.
  • a fragment that contains a binding domain and does not have the ability to cleave DNA double strands can be used.
  • the zinc finger motif is a linkage of 3 to 6 different zinc finger units of the Cys2His2 type (one finger recognizes about 3 bases), and can recognize a target nucleotide sequence of 9 to 18 bases.
  • Zinc finger motifs are: Modular assembly method (Nat Biotechnol (2002) 20: 135-141), OPEN method (Mol Cell (2008) 31: 294-301), CoDA method (Nat Methods (2011) 8: 67-69) In addition, it can be prepared by a known method such as E. coli one-hybrid method (Nat Biotechnol (2008) 26: 695-701). Japanese Patent No. 4968498 can be referred to for details of the production of the zinc finger motif.
  • the TAL effector has a repeating structure of modules of about 34 amino acids, and the binding stability and base specificity are determined by the 12th and 13th amino acid residues (called RVD) of one module.
  • RVD 12th and 13th amino acid residues
  • the PPR motif consists of 35 amino acids, and is constructed to recognize a specific nucleotide sequence by a series of PPR motifs that recognize one nucleobase.
  • the 1st, 4th, and ii (-2) th amino acids of each motif Only recognize the target base. Since there is no dependence on the motif structure and there is no interference from the motifs on both sides, it is possible to produce a PPR protein specific to the target nucleotide sequence by linking the PPR motifs just like the TAL effector. JP, 2013-128413, A can be referred to for details of preparation of a PPR motif.
  • DNA-binding domain of these proteins is well known, so it is easy to design a fragment that contains this domain and does not have the ability to cleave DNA double strands. And can be built.
  • target region of the present invention that is, all of the cis elements of the present invention (TGCGGT), TGCGG in which one nucleotide is removed from the 3 ′ side of the cis elements.
  • TGCG, TGC, TG or T, or GCGGT, CGGT, GGT, GT or T from which the nucleotides are removed from the 5 ′ side of the cis element, and in the upstream sequence of the transcription start site of the c-Myc gene
  • a region consisting of a partial nucleotide sequence containing 12 or more consecutive nucleotides can be targeted.
  • the nuclease is sterically formed by combining an inactivated nuclease (eg, FokI) with a nucleic acid sequence recognition module such as a zinc finger motif, a TAL effector, and a PPR motif.
  • a nucleic acid sequence recognition module such as a zinc finger motif, a TAL effector, and a PPR motif.
  • the cis element of the present invention can be blocked, thereby inhibiting Runx3 binding.
  • two nucleic acid sequence recognition modules that specifically recognize a normal nucleotide sequence upstream of the cis element of the present invention and a reverse nucleotide sequence downstream of the cis element are designed, and the end of the module is designed.
  • the cis element of the present invention can be blocked by forming a complex with a nuclease inactivated at (eg, C-terminal).
  • Nucleic acid sequence recognition modules such as zinc finger motif, TAL effector and PPR motif can be provided as fusion proteins with the above nucleases, and protein binding domains such as SH3 domain, PDZ domain, GK domain, GB domain and their The binding partner may be fused to a nucleic acid sequence recognition module and a nuclease, respectively, and provided as a protein complex through the interaction between the protein binding domain and the binding partner.
  • the intein can be fused to the nucleic acid sequence recognition module and the nuclease, and both can be linked by ligation after synthesis of each protein.
  • the nucleic acid sequence recognition module of the present invention further inhibits the transcription of the c-Myc gene while blocking the binding of Runx3 to the cis element of the present invention by forming a complex with a transcription repressing factor instead of a nuclease.
  • the “transcription repressing factor” means a protein or protein domain having transcription repressing activity of a target gene.
  • the transcription repressing factor used in the present invention is not particularly limited as long as it can suppress the transcriptional activation of the c-Myc gene.
  • the protein derived therefrom is not particularly limited.
  • the contact between the nucleic acid sequence recognition module and the c-Myc gene in which the target region of the present invention is present is the target mammal (eg, human, mouse, rat, cow, dog, cat, monkey, etc., preferably human Alternatively, it is carried out by introducing a nucleic acid encoding the module (or an effector protein when used in combination with an effector such as a nuclease or a transcription repressing factor) into a mouse, more preferably a human cell. Therefore, the nucleic acid sequence recognition module, or the nucleic acid sequence recognition module and the effector, can be used as a nucleic acid encoding their fusion protein or in a form that can be complexed in the host cell after being translated into the protein.
  • a nucleic acid encoding the module or an effector protein when used in combination with an effector such as a nuclease or a transcription repressing factor
  • the nucleic acid may be DNA or RNA.
  • DNA it is preferably double-stranded DNA, and is provided in the form of an expression vector capable of expressing each constituent element under the control of a functional promoter in mammalian cells.
  • RNA it is preferably a single-stranded RNA.
  • CRISPR-Cas When CRISPR-Cas is used as a nucleic acid sequence recognition module, an expression vector encoding guide RNA and Cas protein is introduced into the cell, and the guide RNA and Cas protein are expressed in the cell, so that the guide RNA and Cas protein are expressed in the cell. Form a complex.
  • the guide RNA and Cas protein may be encoded on the same expression vector, or may be encoded on different expression vectors.
  • the DNA encoding Cas can be cloned from cells that produce Cas by methods well known in the art.
  • the obtained Cas-encoding DNA can be inserted downstream of the promoter of an expression vector for mammalian cells.
  • the DNA encoding the guide RNA is chemically designed using a DNA / RNA synthesizer by designing an oligo DNA sequence in which a target nucleotide sequence and a known tracrRNA sequence (for example, gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgctttt; Can be synthesized.
  • the nucleotide sequence is described as a DNA sequence unless otherwise specified. However, when the polynucleotide is RNA, thymine (T) is appropriately replaced with uracil (U).
  • DNA that encodes guide RNA can also be inserted into an expression vector for mammalian cells.
  • the guide RNA and Cas may be encoded on the same expression vector, or may be encoded on different expression vectors.
  • the DNA encoding Cas and the DNA encoding guide RNA are inserted downstream of separate promoters in the same expression vector.
  • the RNA encoding Cas can also be prepared by, for example, transcribing it to mRNA using an in vitro transcription system known per se using the above-described DNA encoding Cas as a template.
  • the guide RNA can also be chemically synthesized using a DNA / RNA synthesizer by designing an oligo RNA sequence in which a target nucleotide sequence and a known tracrRNA sequence are linked. In this case, various modifications for improving stability and membrane permeability can be imparted to the ribonucleotide constituting the guide RNA.
  • crRNA and tracrRNA can be synthesized separately and annealed for use.
  • DNA encoding nucleic acid sequence recognition modules such as zinc finger motifs, TAL effectors, and PPR motifs can be obtained by any of the methods described above for each module.
  • DNA encoding sequence recognition modules such as restriction enzymes, transcription factors, RNA polymerase, etc. covers the region encoding the desired part of the protein (part containing the DNA binding domain) based on the cDNA sequence information.
  • oligo DNA primers can be synthesized and cloned by amplifying by RT-PCR using total RNA or mRNA fraction prepared from cells producing the protein as a template.
  • oligo DNA primers are synthesized based on the cDNA sequence information of the effector used, and total RNA or mRNA fractions prepared from cells producing the effector. And can be cloned by amplification by RT-PCR.
  • DNA encoding FokI can be cloned from mRNA derived from Flavobacterium okeanokoites (IFO 12536) by RT-PCR by designing appropriate primers upstream and downstream of CDS based on the cDNA sequence.
  • the DNA encoding the cloned nucleic acid sequence recognition module can be digested as it is or with a restriction enzyme if desired, or an appropriate linker and / or nuclear translocation signal can be added.
  • an effector such as a nuclease or transcription repressor
  • the DNA encoding the cloned nucleic acid sequence recognition module is ligated with the DNA encoding the cloned nucleic acid sequence recognition module to encode a fusion protein.
  • DNA can be prepared.
  • a complex may be formed after the nucleic acid sequence recognition module and the effector are translated in the host cell.
  • a linker and / or a nuclear translocation signal can be linked to an appropriate position of one or both of DNAs as desired.
  • DNA encoding nucleic acid sequence recognition modules and DNA encoding effectors chemically synthesize DNA strands, or synthesize partially overlapping oligo DNA short strands using the PCR method or Gibson Assembly method.
  • PCR method or Gibson Assembly method By connecting, it is possible to construct a DNA encoding the full length.
  • the advantage of constructing full-length DNA in combination with chemical synthesis or PCR method or Gibson Assembly method is that the codon used can be designed over the entire CDS according to the host into which the DNA is introduced.
  • an increase in protein expression level can be expected by converting the DNA sequence into a codon frequently used in the host organism.
  • Data on the frequency of codon usage in the host to be used is, for example, the genetic code usage frequency database (http://www.kazusa.or.jp/codon/index.html) published on the Kazusa DNA Research Institute website. ) May be used, or references describing the frequency of codon usage in each host may be consulted.
  • the obtained data and the DNA sequence to be introduced and converting the codon used in the DNA sequence that is not frequently used in the host into a codon that encodes the same amino acid and is frequently used Good.
  • an animal virus vector such as a retrovirus, vaccinia virus, adenovirus, or the like is used.
  • Promoters include SR ⁇ promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, etc.
  • a promoter that can function in mammalian cells is used, but is not limited thereto.
  • the expression vector may contain an enhancer, a splicing signal, a terminator, a poly A addition signal, a selection marker such as a drug resistance gene, a replication origin, and the like as desired.
  • nucleic acid sequence recognition module By introducing an expression vector encoding a nucleic acid sequence recognition module (and optionally an effector further) into target mammalian target cells (eg, cancer cells, precancerous cells inactivated p53), A nucleic acid sequence recognition module or a complex of the module and an effector is expressed and formed in the cell, and can be brought into contact with a target nucleotide sequence on the c-Myc gene.
  • target mammalian target cells eg, cancer cells, precancerous cells inactivated p53
  • DSB Binding Inhibitor with Genomic Sequence Modification
  • a wild-type enzyme having DSB activity as a nuclease
  • DSB is generated in the cis element of the present invention, and the cis element of the present invention
  • the cis element can be disrupted by deletion of one or more nucleotides or substitution of other nucleotides, or insertion of one or more nucleotides into the cis element.
  • the c-Myc gene is cleaved within the cis element of the present invention and then repaired by non-homologous end joining (NHEJ), but due to a repair error, deletion of one or more nucleotides of the cis element or Substitution for other nucleotides, or insertion of one or more nucleotides within the cis element occurs.
  • NHEJ non-homologous end joining
  • a DNA comprising a sequence homologous to each of the upstream and downstream sequences adjacent to the cis element of the present invention and having the mutation introduced into the cis element part (
  • the donor DNA is introduced into the target mammalian cell together with the DNA encoding the complex of the nucleic acid sequence recognition module and the nuclease, so that the region containing the target region of the present invention is homologous with the donor DNA.
  • a desired mutation can be introduced into the cis element of the present invention.
  • the sequence homologous to the upstream and downstream sequences adjacent to the cis element contained in the donor DNA is not particularly limited as long as it is long enough to cause homologous recombination. It may be a short sequence (see FIG. 4-2) or a long homology arm extending over several kb (see FIG. 4-1). In the latter case, the donor DNA can be provided in the form of a targeting vector into which it has been inserted. “Targeting vector into which donor DNA has been inserted” is not limited to a targeting vector into which the same sequence as the above donor DNA is inserted, but has a selection marker and / or a recombinase target sequence between or outside the donor DNA. Including.
  • the vector serving as the basic skeleton of the targeting vector is not particularly limited as long as it is capable of self-replication in a cell to be transformed (for example, E. coli).
  • a cell to be transformed for example, E. coli
  • pBluescript manufactured by Stratagene
  • pZErO1.1 Invitrogen
  • pGEM-1 Promega
  • Donor DNA can be introduced into cells in any form of double-stranded DNA (circular double-stranded DNA, linear double-stranded DNA) or single-stranded DNA.
  • an enzyme capable of genome modification without DSB as an effector can be used in combination with a nucleic acid sequence recognition module.
  • an enzyme for example, an enzyme that substitutes a different base by converting a nucleobase substituent to another substituent (eg, deaminase), catalyzes an abasic reaction, and has an intrinsic repair mechanism.
  • An enzyme that introduces a mutation into an abasic site using an error eg, DNA glycosylase, etc. can be mentioned, but is not limited thereto.
  • the nucleic acid sequence recognition module is CRISPR-Cas, as Cas
  • a mutant (nCas) in which at least one DNA cleavage ability is inactivated preferably a mutant in which both DNA cleavage ability is inactivated (nCas) dCas) is used.
  • deaminase as the effector are described in, for example, International Publication No. 2015/133554, and details of using DNA glycosylase are described in, for example, International Publication No. 2016/072399.
  • a sequence containing at least part of the target Runx binding sequence TGCGGT or ACCGCA What is necessary is just to implement the method similar to the above by making the area
  • CRISPR-Cas is used as the nucleic acid sequence recognition module, it is only necessary to design the guide RNA for each target nucleotide sequence, which is simpler than using a ZF motif or a TAL effector.
  • binding inhibitor of the present invention (a) Antitumor agent
  • the binding inhibitor of the present invention specifically recognizes and binds to the target region of the present invention, thereby binding Runx3 to the cis element of the present invention.
  • the phenomenon of p53 inactivation and c-Myc increased expression that are commonly observed in many cancers is caused by the fact that Runx3, which has been derepressed by p53, is a specific c-Myc gene. It is based on the discovery that it activates transcription of the gene by binding to the Runx binding sequence. Therefore, there is no particular limitation on the cancer with which the binding inhibitor of the present invention can exert an antitumor effect, as long as p53 is inactivated.
  • chronic lymphocytic leukemia cervical cancer, glioma , Hodgkin lymphoma, non-Hodgkin lymphoma, malignant mesothelioma, osteosarcoma, melanoma, multiple myeloma, acute lymphocytic cancer, chronic myelogenous cancer, skin cancer, thyroid cancer, pharyngeal cancer, larynx Cancer, lung cancer, esophageal cancer, stomach cancer, liver cancer, pancreatic cancer, kidney cancer, prostate cancer, small intestine cancer, colon cancer, rectal cancer, colon cancer, testicular cancer, ovarian cancer Cervical cancer, ureteral cancer, bladder cancer.
  • pancreatic cancer with high p53 mutation rate and high malignancy, and osteosarcoma, especially pediatric osteosarcoma, which has a treatment period of 1 year and is often difficult to cure.
  • Useful for. treatment of pancreatic cancer with high p53 mutation rate and high malignancy, and osteosarcoma
  • the binding inhibitor of the present invention is an antigene (eg, TFO, PI polyamide, PNA, etc.), an effective amount of the binding inhibitor alone or with a pharmaceutically acceptable carrier as a pharmaceutical composition, It can be formulated.
  • the binding inhibitor of the present invention is a nucleic acid sequence recognition module (and an effector that forms a complex with the module) used in genome editing technology, preferably the binding inhibitor is a DNA encoding the same.
  • vector of the present invention In the form of an expression vector (hereinafter also referred to as “vector of the present invention”).
  • Examples of the expression vector of the present invention include a detoxified retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, poliovirus, Sindbis virus, Sendai virus, SV40, immunodeficiency virus (HIV). ) And the like can be used.
  • adenovirus or an adeno-associated virus vector is used.
  • Examples of pharmaceutically acceptable carriers include excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, lubricants such as magnesium stearate and aerosil, citric acid, Fragrances such as menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspensions such as methylcellulose and polyvinylpyrrolide, dispersants such as surfactants, water, Although diluents, such as physiological saline, base wax, etc. are mentioned, it is not limited to them.
  • the antitumor agent of the present invention can further contain a reagent for nucleic acid introduction.
  • the nucleic acid introduction reagent include atelocollagen; liposome; nanoparticle; lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polybrene, or poly (ethyleneimine) (PEI) Cationic lipids such as can be used.
  • the antitumor agent of the present invention can be a pharmaceutical composition in which an antigene molecule or the vector of the present invention is encapsulated in liposomes.
  • Liposomes are fine closed vesicles having an inner phase surrounded by one or more lipid bilayers, and can usually retain a water-soluble substance in the inner phase and a fat-soluble substance in the lipid bilayer.
  • the antigene molecule and the vector of the present invention may be retained in the liposome internal phase or in the lipid bilayer.
  • the liposome used in the present invention may be a monolayer membrane or a multilayer membrane, and the particle size can be appropriately selected, for example, in the range of 10 to 1000 nm, preferably 50 to 300 nm. In consideration of deliverability to the target tissue, the particle size can be, for example, 200 nm or less, preferably 100 nm or less.
  • Examples of the encapsulation method of the antigene or the vector of the present invention in the liposome include a lipid film method (vortex method), a reverse phase evaporation method, a surfactant removal method, a freeze-thaw method, a remote loading method, and the like. Without limitation, any known method can be appropriately selected.
  • the antitumor agent of the present invention can be administered orally or parenterally to mammals (eg, human, rat, mouse, guinea pig, rabbit, sheep, horse, pig, cow, monkey). However, it is desirable to administer parenterally.
  • mammals eg, human, rat, mouse, guinea pig, rabbit, sheep, horse, pig, cow, monkey.
  • parenterally it is desirable to administer parenterally.
  • sustained-release preparation such as a mini-pellet preparation
  • embed it in the vicinity of the affected area or to gradually and continuously administer the affected area using an osmotic pump or the like.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions, which include antioxidants Further, a buffer solution, an antibacterial agent, an isotonic agent and the like may be contained. Aqueous and non-aqueous sterile suspensions are also included, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives and the like.
  • the preparation can be enclosed in a container in unit doses or multiple doses like ampoules and vials.
  • the active ingredient and a pharmaceutically acceptable carrier can be lyophilized and stored in a state that may be dissolved or suspended in a suitable sterile vehicle immediately before use.
  • the content of the antigene molecule and the vector of the present invention in the pharmaceutical composition is, for example, about 0.1 to 100% by weight of the whole pharmaceutical composition.
  • the dose of the antitumor agent of the present invention varies depending on the administration method, the type of cancer to be treated, the severity, and the situation (sex, age, weight, etc.) of the administration target.
  • a single dose of antigene molecule is preferably 2 nmol / kg or more and 50 nmol / kg or less, and when administered locally, 1 pmol / kg or more and 10 nmol / kg or less is desirable. It is desirable to administer such dose 1 to 10 times, more preferably 5 to 10 times.
  • the vector of the present invention when the vector of the present invention is administered as viral vector particles, it can be administered at a time, for example, in the range of about 1 ⁇ 10 3 pfu to 1 ⁇ 10 15 pfu as the virus titer.
  • the antitumor agent of the present invention is applied to cells or tissues (eg, cancer cells) collected from the administration subject. It may be an ex ⁇ ⁇ vivo preparation that is added to introduce the expression vector into the cell and return it to the body of the administration target, preferably the cancer lesion.
  • examples of the method for introducing a gene into a cell include a lipofection method, a phosphate-calcium coprecipitation method, and a direct injection method using a micro glass tube.
  • gene transfer methods to tissues include gene transfer methods using encapsulated liposomes, gene transfer methods using electrostatic liposomes, HVJ-liposome method, improved HVJ-liposome method (HVJ-AVE liposome method), receptor-mediated Examples thereof include a gene introduction method, a method of transferring an active ingredient together with a carrier (metal particles) with a particle gun, a direct introduction method of naked-DNA, and a introduction method using a positively charged polymer.
  • the antitumor agent of the present invention can be used in combination with other drugs, for example, existing anticancer drugs depending on the cancer type.
  • the binding inhibitor of the present invention and the other drug can be mixed according to a method known per se to form a mixture, but each is separately It may be formulated and administered to the same subject at the same time or with a time difference.
  • the dose of the other drug for example, the dose usually used when the drug is administered alone can be applied as it is.
  • the antitumor agent of the present invention is particularly effective because p53 is inactivated. Therefore, it is desirable to test whether the cancer patient to be administered has a p53 mutation in order to predict the therapeutic efficacy of the antitumor agent of the present invention. Therefore, the present invention also provides a medicament comprising a combination of the antitumor agent of the present invention and a reagent for assaying p53 inactivation.
  • a method for detecting a mutation in the p53 gene a method in which an exon of the p53 gene is amplified by a PCR method, and sequencing or SSCP analysis is widely used.
  • a set of primers designed to amplify a region containing each exon of the p53 gene is commercially available.
  • binding inhibitor of the present invention is a component of genome editing that involves modification of the genome sequence (eg, nucleic acid sequence recognition module, nuclease, nucleobase modifying enzyme, donor DNA), these are used.
  • a non-human animal having a mutation in the cis element of the present invention and lacking the function of the cis element can be produced.
  • non-human warm-blooded animals non-human mammals and birds
  • Mammals include, for example, laboratory animals such as mice, rats, hamsters, guinea pigs and rabbits, domestic animals such as pigs, cows, goats, horses and sheep, pets such as dogs and cats, primates such as monkeys, orangutans and chimpanzees. Is mentioned. Examples of birds include chickens.
  • the genetically modified animal of the present invention can be obtained by introducing NHEJ or homologous recombination by introducing the binding inhibitor of the present invention into, for example, a pluripotent stem cell derived from a p53 conditional knockout non-human animal (eg, ES cell, iPS cell).
  • a pluripotent stem cell derived from a p53 conditional knockout non-human animal (eg, ES cell, iPS cell).
  • a chimeric embryo or a chimeric animal is produced by a method known per se, and a progeny is obtained from the chimeric animal subjected to germline transmission.
  • genome editing technology the functions of both alleles can be deleted at once, and homozygous genetically modified animals can be easily obtained.
  • the genetically modified animal of the present invention thus obtained is useful for analyzing the molecular mechanism of transcriptional regulation of the c-Myc gene and the molecular mechanism related to the onset and progression of cancer by p53, c-Myc and Runx3. is there.
  • the present invention also provides a method for screening a substance having antitumor activity, using as an index the ability to specifically bind to a specific region in the regulatory region of the c-Myc gene, which contains the cis element of the present invention.
  • the method includes the following steps (1) to (3). (1) A step of bringing Runx3 into contact with a double-stranded DNA having a partial nucleotide sequence of 12 nucleotides or more that contains the cis element of the present invention in the presence or absence of a test substance, (2) a step of measuring the binding between the DNA and Runx3, and (3) a step of selecting a test substance that inhibits the binding between the DNA and Runx3 as a candidate for a substance having antitumor activity.
  • the double-stranded DNA used in (2) the double-stranded DNA constituting the target region of the present invention described above is preferable.
  • test substance used in the screening method of the present invention may be any known compound and novel compound, for example, using nucleic acids, carbohydrates, lipids, proteins, peptides, low molecular weight organic compounds, combinatorial chemistry techniques.
  • examples thereof include a compound library prepared, a random peptide library prepared by solid phase synthesis or a phage display method, or natural components derived from microorganisms, animals and plants, marine organisms, and the like.
  • the screening method of the present invention further comprises the following steps (1 ′) to (3 ′).
  • a step of selecting a test substance having a lower inhibitory activity on binding as a candidate for a substance having antitumor activity The double-stranded DNA used in the step (1 ′) is preferably a gene other than the c-Myc gene, preferably Includes a partial nucleotide sequence including a Runx binding sequence, which is present in a gene related to survival.
  • Runx3 protein can be prepared by a method known per se.
  • the Runx3 protein can be isolated and purified from the expression tissue of the Runx3 gene.
  • a recombinant protein by a gene recombination technique.
  • the recombinant protein may be prepared in either a cell system or a cell-free system.
  • step (2) (2 ') the degree of inhibition of the test substance against the binding is assayed by measuring the degree of binding between the double-stranded DNA and Runx3 by the test substance.
  • the binding between the double-stranded DNA and Runx3 can be performed by a method known per se, for example, by measuring the results of gel shift assay, affinity chromatography, etc. with an image analyzer, a spectrophotometer or the like.
  • step (3) a test substance that inhibits the binding between the cis element of the present invention and Runx3 is selected. Furthermore, by the step (3 ′), a Runx binding sequence other than the cis element of the present invention, for example, a gene containing a Runx binding sequence in the regulatory region other than the c-Myc gene, preferably a gene associated with survival, A test substance that does not inhibit the binding of Runx3 to the Runx binding sequence or has a weak inhibitory activity is selected.
  • test substance selected by the above screening method is administered to, for example, a p53 conditional knockout animal (for example, a mammal such as a mouse, rat, hamster, guinea pig, rabbit, dog, monkey).
  • a p53 conditional knockout animal for example, a mammal such as a mouse, rat, hamster, guinea pig, rabbit, dog, monkey.
  • the c-Myc gene expression inhibitory effect and / or antitumor effect of the substance and the degree of side effects can be confirmed.
  • FIG. 1 shows 3 kb upstream from the transcription start site as a mouse / human c-Myc promoter region.
  • the runx site (TGCGGT) present closest to the transcription start point of the c-Myc gene was noted as mR1.
  • mR1 is located in a highly conserved region with high homology in mammals, and mouse mR1 is located near -360 bp, and human mR1 is located near -310 bp.
  • Example 2 Mouse osteosarcoma cells in which mutations were introduced into the mouse mR1 sequence using the CRISPR / Cas9 system were prepared.
  • a TGG (antisense side sequence) PAM sequence located at positions of -365 to -363 was added.
  • the cells (83-1-T7 cells and 83-1-T13 cells) into which two types of homo-deficient mutations (T7 and T13-deficient mutations) were introduced by inducing the indel using the CRISPR / Cas9 system were produced.
  • EMSA Electrode-Mobility-Shift-Assay
  • probe DNA having T7 and T13 deletion mutations (T7: GTCCACC GCGGT GACTGAT (SEQ ID NO: 8), T13: CGTTCCCACC GGT GACTGAT (SEQ ID NO: 9); both were clearly reduced (5 ′ terminal biotin label) (detected by 4% polyacrylamide gel electrophoresis after 20 minutes of reaction at room temperature).
  • T13 deletion mutation completely inhibited the binding of Runx3 and Runx2 proteins.
  • the protein amount of Runx3 is not changed in 83-1-T7 cells and 83-1-T13 cells compared to control 83-1-C cells, but clearly In addition, the amount of c-Myc protein was decreased.
  • the tumorigenicity of 83-1-T7 cells and 83-1-T13 cells was examined in a tumor bearing experiment using nude mice together with 83-1-C cells. 2.5 ⁇ 10 6 mice were injected subcutaneously on the dorsal side of nude mice (BALB / c nu / nu ⁇ 6 weeks old), and the weight of the tumor formed after 30 days was measured and compared (right diagram in FIG. 2). . In mice injected with 83-1-T7 cells and mice injected with 83-1-T13 cells, the tumorigenicity was clearly suppressed as compared to mice injected with control 83-1-C cells. .
  • Example 3 83-1 cells in which Runx3 and c-Myc were knocked down using specific shRNA were prepared, and the results of cancer-bearing experiments in which their tumorigenicity was examined were obtained in [Example 2]. It compared with the result of the cancer experiment (FIG. 3). The cancer bearing experiment was carried out in the same manner as in [Example 2].
  • siRNA-specific sequences of Runx3 and c-Myc are incorporated into Clontech's pSIREN retrovirus shRNA expression vector, and HEK29 is incorporated into TEK29.
  • Retroviruses were produced by transfection. By infecting the 83-1 cell with the retrovirus, the shRNA expression system was inserted into the genome of the 83-1 cell so that the shRNA was constitutively expressed by the U6 promoter.
  • Infected cells were selected by culturing in a culture medium supplemented with 5 ⁇ g / ml of puromycin using the activity of the puromycin resistance gene encoded in the pSIREN vector, and the surviving cells were divided into 2.5 ⁇ 10 6 nude mice. Injected. The introduction of mutations into mR1 showed a higher tumorigenic effect suppressing effect than that of Runx3 knockdown or c-Myc knockdown.
  • Example 4-1 The mR1: TGCGGT upstream from the transcription start point of the c-Myc gene is replaced with the BglII sequence (AGATCT) (FIG. 4-1).
  • targeting vectors were introduced into C57BL / 6-derived ES cells (TT2) by electroporation, and neomycin (G418) was selected using the neomycin-resistant gene activity derived from the Neo cassette.
  • chimeric mice were prepared from ES cells that had undergone homologous recombination as expected, and F1 mice were obtained. Thereafter, F1 mice were crossed with CAG-FLP mice (a mouse systemically expressing yeast-derived FLP recombinase), and mice from which the Neo cassette had been removed were selected from their offspring. The activity of FLP recombinase that excises DNA in an FRT sequence-specific manner was used.
  • Genome editing was applied to fertilized eggs to produce mice that specifically mutated mR1 (FIG. 4-2).
  • a complex of crRNA and tracrRNA targeting CTGCGTATATCAGTCACCGC constitutes a guide RNA and induces Cas9 nuclease.
  • the induced Cas9 nuclease cleaves the genomic DNA into double strands at a position 5 ′ to several bases from the PAM sequence (AGG).
  • the double-stranded genomic DNA is repaired by HDR (Homology-directed repair) using a single-stranded DNA in which mR1 is replaced with a restriction enzyme BglII site (AGATCT) as a donor.
  • HDR Homology-directed repair
  • the single-stranded DNA has a homologous sequence of about 70 bases in both the 5 ′ and 3 ′ directions from the cleavage site.
  • mR1 is specifically substituted with a restriction enzyme BglII site (AGATCT).
  • Example 5-1 Mouse osteosarcoma cells in which mutations were introduced in the vicinity of the mouse mR1 sequence using the CRISPR / Cas9 system were prepared.
  • Example 5-2 Except for using not only 83-1 cells (mOS4 cl.1) but also osteosarcoma-derived cell lines that developed in OS mice (mOS3 cl.2 and 97-3 cells) as cells to be introduced with mutations [
  • Example 2 Using the CRISPR / Cas9 system, mouse osteosarcoma cells (parent cells (Parental), T7 cells, T14 cells, in which homozygous mutations having deletions or insertions were introduced into the mouse mR1 sequence) were introduced in the same manner as in Example 2.
  • T13 cells, T18 cells, T16 cells, T3 cells, A5 cells, A3 cells; however, T7 cells and T14 cells have the same homozygous mutation but derived from different clones) were prepared, and a tumor bearing experiment was performed (FIG. 6). . All cells had suppressed tumorigenicity as compared to the control parental cells.
  • C57B6 strain systemic p53 gene knockout mice (# 002101; Current Biology Vol. 4 p1-7, 1994; p53 ⁇ / ⁇ mice) were purchased from The Jackson Laboratory (USA). Since most of p53 ⁇ / ⁇ mice develop T cell lymphoma and die in about 3 to 4 months (Current Biology Vol.4 p1-7, 1994), they can be used as a T cell lymphoma onset model.
  • Systemic Runx3 gene knockout mice of C57B6 strain mice in which Exon3 of Runx3 gene was replaced with LacZ; Cell Vol.109 p113-124, 2002 were used for mating to generate p53 ⁇ / ⁇ Runx3 +/ ⁇ mice. .
  • C57B6 strain Runx3 ⁇ / ⁇ mice died immediately after birth, p53 ⁇ / ⁇ Runx3 ⁇ / ⁇ mice could not be examined.
  • the full-length Runx3 generates two types of full-length proteins due to the difference in promoters. One of them, the full-length Runx3 derived from the P1 promoter, was knocked out systemically by deleting Exon0 (Runx3 (P1) ⁇ / ⁇ mouse) ) Was produced.
  • the C57B6 strain Runx3 (P1) ⁇ / ⁇ mouse expresses the full-length Runx3 derived from the P2 promoter, and is healthy with a lifespan comparable to that of the wild type, and can be mated.
  • mice By repeating the mating, p53 ⁇ / ⁇ Runx3 (P1) ⁇ / ⁇ mice were generated.
  • p53 ⁇ / ⁇ mR1 m / m mice were generated.
  • mice survival rates were evaluated for these generated mice. The results are shown in FIG. Mice lacking mR1 systemically were healthy and mating without inferiority to the wild type, indicating that there was no concern about side effects even when mR1 was inhibited. Although p53 ⁇ / ⁇ mice developed lymphoma in the thymus and died early, p53 ⁇ / ⁇ mR1 m / m mice survived for a long time. Therefore, it was shown that tumorigenicity by p53 ⁇ / ⁇ is rescued by mR1 mutation. Moreover, surprisingly, this rescue effect was significantly higher than the effect of Runx3 +/ ⁇ and Runx3 (P1) ⁇ / ⁇ .
  • the present invention it is possible to suppress the tumorigenicity of an extremely large number of types of tumor cells only by inhibiting the binding of Runx3 to a specific region (target region of the present invention) on the c-Myc gene.
  • a substance that can specifically inhibit the binding does not affect the action of Runx3 on gene expression other than the c-Myc gene, it is very useful as a safe antitumor agent with reduced side effects.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention concerne un agent antitumoral contenant une substance qui reconnaît spécifiquement une région cible de 12 nucléotides consécutifs ou plus comprenant au moins une partie de la séquence de liaison TGCGGT de Runx la plus proche du site d'initiation de transcription en amont du site d'initiation de transcription d'un gène c-Myc et inhibe la liaison de Runx3 à la séquence de liaison Runx.
PCT/JP2018/023028 2017-06-16 2018-06-15 Région de commande de transcription d'oncogène WO2018230731A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2019525586A JP7212943B2 (ja) 2017-06-16 2018-06-15 がん遺伝子の転写調節領域

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2017-119159 2017-06-16
JP2017119159 2017-06-16

Publications (1)

Publication Number Publication Date
WO2018230731A1 true WO2018230731A1 (fr) 2018-12-20

Family

ID=64659123

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2018/023028 WO2018230731A1 (fr) 2017-06-16 2018-06-15 Région de commande de transcription d'oncogène

Country Status (2)

Country Link
JP (1) JP7212943B2 (fr)
WO (1) WO2018230731A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019189147A1 (fr) * 2018-03-26 2019-10-03 国立大学法人神戸大学 Procédé de modification d'un site cible dans un adn double brin dans une cellule

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JACOBS, PAEJONETTE T. ET AL.: "Runx Transcription Factors Repress Human and Murine c-Myc Expression in a DNA-Binding and C-Terminally Dependent Manner", PLOS ONE, vol. 8, no. 7, 2013, pages 1 - 16, XP055460173, ISSN: 1932-6203 *
LEE, CECILIA WEI LIN ET AL.: "Role of RUNX3 in Bone Morphogenetic Protein Signaling in Colorectal Cancer", CANCER RESEARCH, vol. 70, no. 10, 2010, pages 4243 - 4252, XP055570505, ISSN: 0008-5472 *
MORITA, KEN ET AL.: "Genetic regulation of the RUNX transcription factor family has antitumor effects", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 127, no. 7, 22 May 2017 (2017-05-22), pages 2815 - 2828, XP055460190, ISSN: 0021-9738 *
SHIN, MIN-HWA ET AL.: "A RUNX2-Mediated Epigenetic Regulation of the Survival of p53 Defective Cancer Cells", PLOS GENET., vol. 12, no. 2, 2016, pages 1 - 25, XP055570493, ISSN: 1553-7390 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019189147A1 (fr) * 2018-03-26 2019-10-03 国立大学法人神戸大学 Procédé de modification d'un site cible dans un adn double brin dans une cellule
JPWO2019189147A1 (ja) * 2018-03-26 2020-04-30 国立大学法人神戸大学 細胞の有する二本鎖ｄｎａの標的部位を改変する方法
JP2020191879A (ja) * 2018-03-26 2020-12-03 国立大学法人神戸大学 細胞の有する二本鎖ｄｎａの標的部位を改変する方法
US11041169B2 (en) 2018-03-26 2021-06-22 National University Corporation Kobe University Method for modifying target site in double-stranded DNA in cell
JP7250349B2 (ja) 2018-03-26 2023-04-03 国立大学法人神戸大学 細胞の有する二本鎖ｄｎａの標的部位を改変する方法

Also Published As

Publication number Publication date
JP7212943B2 (ja) 2023-01-26
JPWO2018230731A1 (ja) 2020-04-16

Similar Documents

Publication Publication Date Title
US20230174978A1 (en) Methods and compositions for modulating gene expression
US11339410B2 (en) Methods and products for expressing proteins in cells
JP2019500899A (ja) ＣＲＩＳＰＲ／Ｃａｓ９の核送達を通じた細胞ＲＮＡの追跡と操作
TWI723363B (zh) 用於治療癌症之包含引導rna及內切酶的藥學組成物
US20210322577A1 (en) Methods and systems for modifying dna
EP3908659A1 (fr) Enzyme cas9 non toxique et application associée
US20230159920A1 (en) Methods and compositions comprising brd9 activating therapies for treating cancers and related disorders
WO2022047624A1 (fr) Petites protéines cas et leurs utilisations
WO2018230731A1 (fr) Région de commande de transcription d'oncogène
CA2949345C (fr) Petit arn interferent (arnsi) utilisable en vue du traitement de l'osteoporose autosomique dominante de type 2 (ado2) provoquee par une mutation du gene clcn7 (ado2 dependant de c lcn7)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18818876

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019525586

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18818876

Country of ref document: EP

Kind code of ref document: A1