WO2018230731A1

WO2018230731A1 - Oncogene transcription control region

Info

Publication number: WO2018230731A1
Application number: PCT/JP2018/023028
Authority: WO
Inventors: 公成伊藤
Original assignee: 国立大学法人長崎大学
Priority date: 2017-06-16
Filing date: 2018-06-15
Publication date: 2018-12-20
Also published as: JPWO2018230731A1; JP7212943B2

Abstract

The present invention provides an antitumor agent containing a substance that specifically recognizes a target region of 12 or more consecutive nucleotides including at least part of the Runx binding sequence TGCGGT nearest the transcription initiation site upstream of the transcription initiation site of a c-Myc gene and inhibits the binding of Runx3 to the Runx binding sequence.

Description

Oncogene transcriptional regulatory region

The present invention relates to an antitumor agent containing a substance that specifically recognizes the transcriptional regulatory region of the c-Myc gene and inhibits the binding of Runx3 to the sequence.

The genetic abnormalities accumulated in cancer cells are diverse and their complexity increases with time. A wide variety of molecular targeting drugs (anticancer drugs) have been developed to counter this, but the complexity has not been overcome.

In addition to conventional anticancer agents that target cell division, anticancer agents regulate body immunity, such as molecular targeting agents that target cancer-specific mutations and anti-PD-1 antibodies. And immunotherapeutic agents that cause the immune mechanism to attack cancer. However, conventional anticancer drugs are susceptible to normal cells, and molecular targeting agents may be very effective depending on the target, but may not be very effective, and immunotherapeutic agents are among the patients undergoing treatment. There is a problem that effective people are limited.

Even if mutations accumulate in a cell, in most cases, the mutation is repaired, or the cell is killed by apoptosis or immune attack, but if 3 to 10 mutations accumulate, it is said to cause cancer. Yes. Among these mutations, there are mutations that occur in common factors, and there is a common molecular basis for complex malignant tumors. For example, in human cancer, inactivation of p53 and increased expression of c-Myc are most widely confirmed. p53 is the most famous and considered “cancer suppressor gene”. The main role of p53 is to check for genetic abnormalities in cells and to induce apoptosis if there are abnormalities. It is known that p53 has some kind of mutation (dysfunction, decreased expression level) in about 50% to 80% of all tumors. It is also considered to correlate with malignancy and anticancer resistance.

Although anticancer drugs have been developed for p53 and its surrounding molecules by a great number of methods, it has not been successful to date. It is technically difficult to increase normal p53, and when it exceeds a certain amount, apoptosis is induced. Therefore, when it is excessively expressed, apoptosis is also induced in normal cells (ie, “normal” Difficult to adjust to "amount"). For this reason, many anticancer agents targeting upstream and downstream of p53 are under development, but none has been successful.

C-Myc has a role of regulating proteins for cell proliferation. When c-Myc is knocked down, no growth preparation occurs and the cell cycle stops. Apoptosis is most easily induced at the moment of proliferation, but becomes resistant to apoptosis when the cell cycle stops. Therefore, c-Myc is also difficult to be a direct target for drug discovery.

The Runx family has an evolutionarily conserved Runt domain, and binds to the transcriptional regulatory region of the target gene via the domain. The Runx family also has a region on the C-terminal side that interacts with various transcription factors (cofactors) to form heterodimers and controls transcription of downstream target genes (Non-patent Document 1). The mammalian Runx family consists of Runx1, Runx2, and Runx3, but these abnormalities are closely associated with various diseases. For example, Runx1 is a target for chromosomal translocation in acute myeloid leukemia, and lack of one allele of Runx2 due to chromosomal instability (LOH) has been attributed to clavicular skull dysplasia. On the other hand, it has been pointed out that Runx3 is a tumor suppressor gene for gastric cancer (Non-patent Document 2). Furthermore, it has been suggested that Runx3 binds to p53 in the nucleus and positively regulates the transcription of the target gene group of p53 (Non-patent Document 2). In addition, since a mouse in which Runx3 is knocked down is lethal and a mouse whose expression level is halved also has a short life span, it is considered that Runx3 has an essential function for survival and is not suitable as a target for anticancer agents. It seems.

A large number of Runx binding sequences (ACCCACA, TGCGGT) exist upstream from the transcription start site of the c-Myc gene, and endogenous Runx1 binds to these Runx binding sequences through interaction with cofactors. Have been reported to suppress the expression of the c-Myc gene (Non-patent Document 1).

As described above, inactivation of p53 and increased expression of c-Myc are commonly observed in many cancers. In addition, it has been suggested that the Runx family is a factor that can interact with both p53 and c-Myc. However, it is considered difficult to make these factors direct targets for anticancer drug discovery.

Here, when PI polyamide (Chb-M) targeting TGTGGT, which is a recognition sequence common to Runx1 to 3, was administered to NOG mice injected with A549 cells, a human non-small cell lung cancer cell line, A549 cells It has been reported that the growth rate of the plant was suppressed and the survival rate was improved (Non-patent Document 3). The same document also discloses PI pyramide (Chb-50) that targets TGCGGT, although not used in experiments. However, there are a large number of Runx binding sequences in the transcriptional regulatory region of the c-Myc gene, and it is not known which part of the Runx recognition sequence is important. In addition, since any mouse knocked out of Runx1, Runx2 or Runx3 is embryonic lethal, the PI pyramide targeting a large number of Runx binding sequences is expected to cause very strong side effects.

Therefore, an object of the present invention is to identify a factor that can be a realistic target for cancer suppression from a molecular basis common to cancers, and to target an effective and safe cancer treatment or target. It is to provide a preventive measure.

In order to solve the above problems, the present inventor first paid attention to the relationship between p53 and Runx3 in osteosarcoma, and mice in which p53 was knocked out specifically for osteoblasts almost certainly became osteosarcoma. It has been found that the onset of tumors can be remarkably suppressed by knocking out to the junction. On the other hand, the analysis of NIH database revealed that there was a positive correlation between the expression levels of Runx3 and c-Myc in human osteosarcoma, so we analyzed the molecular mechanism in osteosarcoma cells of p53 conditional knockout mice. However, it was found that Runx3 excessively induces c-Myc expression in the situation where p53 was deleted. Since the tumorigenicity of p53-deficient osteosarcoma cells was significantly suppressed by reducing the expression of c-Myc, the onset of osteosarcoma due to inactivation of p53 is caused by abnormal c-Myc due to RUNX3. It was found that this was due to expression induction. However, a large number of Runx binding sequences exist in the transcriptional regulatory region of the c-Myc gene, and it was completely unknown where to target. In addition, the Runx binding sequence is a consensus sequence of only 6 nucleotides, and since there are many target gene groups other than c-Myc, the off-target effect is sufficiently reduced and c-Myc-specific expression suppression Need to be possible.

As a result of further studies, the present inventor has found that in p53 conditional knockout mice, the Runx binding sequence 5′-TGCGGT-3 ′ located in the vicinity of the transcription start point upstream of the transcription start point of the c-Myc gene. (In the present specification, unless otherwise specified, nucleotide sequences are written in the 5 ′ to 3 ′ direction, from left to right.) By simply introducing mutations to destroy the Runx binding sequence, Runx3 or c -It was found that the tumor suppressor effect is higher than that of suppressing the expression of the Myc protein itself. In addition, it was confirmed that mice having the mutation grew inferior to wild-type mice.
Based on these findings, the present inventor specifically inhibits the binding of Runx3 to the Runx binding sequence located closest to the transcription start site in the transcriptional regulatory region of the c-Myc gene by some means. Thus, it was concluded that a remarkable antitumor effect can be obtained against a wide variety of cancers while avoiding side effects due to the off-target effect, and the present invention was completed.

That is, the present invention is as follows.
[1] Specifically recognizes a continuous target region of 12 nucleotides or more containing at least part of the Runx binding sequence TGCGGT in the upstream of the transcription start point of the c-Myc gene, An antitumor agent comprising a substance that inhibits binding of Runx3 to a Runx binding sequence.
[2] The Runx binding sequence is a nucleotide sequence from −309 to −304 from the transcription start point of the human c-Myc gene, or a sequence (counterpart) corresponding to the nucleotide sequence in other mammalian orthologs. 1].
[3] The agent according to [1] or [2], which is applied to a subject in which p53 is inactivated.
[4] The agent according to any one of [1] to [3], wherein the substance is an antigene for a DNA sequence in the target region.
[5] The agent according to [4], wherein the antigene is pyrrole-imidazole polyamide.
[6] The agent according to any one of [1] to [3], wherein the substance is a nucleic acid sequence recognition module that specifically binds to the target region.
[7] The agent according to [6], wherein the nucleic acid sequence recognition module is CRISPR-Cas, zinc finger motif, TAL effector or PPR motif.
[8] The agent according to [6], wherein the nucleic acid sequence recognition module is CRISPR-dCas.
[9] The agent according to [6] or [7], wherein the substance comprises a nuclease that forms a complex with the nucleic acid sequence recognition module.
[10] The agent according to [9], wherein the substance further comprises donor DNA capable of causing homologous recombination at a site cleaved by the nuclease.
[11] The agent according to any one of [6] to [8], wherein the nucleic acid sequence recognition module forms a complex with a transcription repressing factor.
[12] The agent according to any one of [1] to [3] and [6] to [11], wherein the substance is provided in the form of one or more expression vectors encoding the substance.
[13] The agent according to any one of [1] to [12], which is combined with a reagent for assaying inactivation of p53.
[14] (1) 12 or more consecutive nucleotides containing the Runx binding sequence TGCGGT nearest to the transcription start point upstream of the transcription start point of the c-Myc gene in the presence or absence of the test substance A step of contacting a double-stranded DNA having a partial nucleotide sequence of Runx3 with
(2) measuring the binding between the DNA and Runx3, and (3) selecting a test substance that inhibits the binding between the DNA and Runx3 as a candidate for a substance having antitumor activity. A screening method for a substance having tumor activity.
[15] Specifically recognizing a target region of 12 nucleotides or more consecutively containing at least a part of the Runx binding sequence TGCGGT in the upstream of the transcription start point of the c-Myc gene, An effective amount of a substance that inhibits the binding of Runx3 to a Runx binding sequence is administered to a mammal, and a method for suppressing tumor formation and / or suppressing growth of an already formed tumor in the mammal .
[16] Runx binding sequence TGCGGT nearest to the transcription start point upstream of the transcription start point of the c-Myc gene for use in inhibiting tumor formation and / or inhibiting the growth of already formed tumors A substance that specifically recognizes a target region of 12 nucleotides or more that contains at least a part of and binds Runx3 to the Runx binding sequence.

According to the present invention, the tumorigenic ability of an extremely large number of types of tumor cells can be suppressed only by inhibiting a specific sequence at a specific position on the genome (binding sequence of Runx3 of c-Myc promoter; 6 bp). A substance that specifically introduces a mutation into the specific sequence and a substance that specifically binds to the specific sequence and can inhibit the binding between the sequence and Runx3 brings about a revolutionary anticancer effect.

FIG. 1 is a diagram showing the positions of Runx binding sequences ACCACA and TGCGGT existing in the upstream region of the transcription start sites of mouse c-Myc gene and human c-Myc gene. FIG. 2 shows that as a result of introducing a mutation into the Runx binding sequence TGCGGT (mR1) located closest to the transcription start site of c-Myc, the expression level of c-Myc was reduced and tumorigenicity was suppressed. FIG. FIG. 3 is a graph showing that the introduction of mutations into mR1 had a greater tumorigenic effect suppressing effect than that of Runx3 knockdown or c-Myc knockdown. FIG. 4-1 is a diagram showing an outline of genetic modification by homologous recombination using ES cells in the production of a genetically modified mouse in which a mutation is introduced into mR1. FIG. 4-2 is a diagram showing an outline of genome editing in the production of a genetically modified mouse in which a mutation is introduced into mR1. FIG. 5 shows that as a result of introducing a mutation into mR1, the tumorigenic ability was greatly suppressed. On the other hand, even if there is a deletion in a part other than the 6 bases of mR1, the tumorigenic ability does not change so much. FIG. FIG. 6 is a diagram showing that tumorigenicity is suppressed as a result of introducing mutations (base deletion or insertion) into mR1. FIG. 7 is a diagram showing that lymphoma formation by p53 knockout is rescued by combining systemic p53 knockout and mR1 ^{m / m} .

The present invention includes at least a part of a Runx binding sequence (TGCGGT; also referred to as “the cis element of the present invention”) nearest to the transcription start point upstream of the transcription start point of the c-Myc gene. An antitumor agent comprising a substance that specifically recognizes a continuous target region of 12 nucleotides or more and inhibits Runx3 binding to the Runx binding sequence (hereinafter also referred to as “binding inhibitor of the present invention”) Hereinafter, it is also referred to as “the antitumor agent of the present invention”. As used herein, the term “antitumor agent” means an agent that can suppress tumor formation and / or growth of an already formed tumor, and preferably has an effect of inhibiting tumor formation and / or tumor regression. .

Preferred examples of the c-Myc gene include, for example, human c-Myc (NCBI Gene ID: 4609), mouse c-Myc (NCBI Gene ID: 17869), rat c-Myc (NCBI Gene ID: 24577) or others Orthologs thereof in mammals (eg, rabbits, sheep, pigs, cattle, cats, dogs, monkeys), or their natural allelic variants or gene polymorphisms.

In this specification, the nucleotide sequence of the c-Myc gene is the nucleotide sequence of chromosome 8 (NCBI Reference Reference: NC_000008.11) registered in the NCBI database for humans, and the chromosome sequence of chromosome 15 for mice. It is expressed based on the nucleotide sequence (NCBI Reference Reference Sequence: NC_000081.6). The transcription start point of human c-Myc gene is nucleotide G at position 127736069 in the nucleotide sequence of NC_000008.11, and the transcription start point of mouse c-Myc gene is nucleotide C at position 61985341 in the nucleotide sequence of NC_000081.6. is there. The nucleotide sequence of 3 kb upstream of the transcription start site of human c-Myc gene (positions 127733069 to 127736068 of NC_000008.11) is SEQ ID NO: 1, and 3 kb upstream of the transcription start site of mouse c-Myc gene (from 61982341 of NC_000081.6) The nucleotide sequence at position 61985340 is shown in SEQ ID NO: 2, respectively. The position of the nucleotide in the transcription regulatory region upstream from the transcription start point of the c-Myc gene is represented by the distance from the nucleotide, with the nucleotide immediately before the transcription start point being -1. Therefore, in the present specification, the Runx binding sequence TGCGGT closest to the transcription start point upstream of the transcription start point of the human c-Myc gene is represented by the -309 to -304th positions (represented by SEQ ID NO: 1). In the nucleotide sequence at nucleotide numbers 2692 to 2697). In addition, the Runx binding sequence TGCGGT closest to the transcription start point upstream of the transcription start point of the mouse c-Myc gene is the position −315 to −310 (the nucleotide number in the nucleotide sequence represented by SEQ ID NO: 2). 2686-2691). However, the c-Myc gene of the present invention has a nucleotide sequence other than those registered in the NCBI database, for example, a natural allelic variant (allele when the registered nucleotide sequence is a wild type). Naturally, a frequency of 1% or more) or a gene polymorphism (allele frequency of less than 1%) is also included. In these nucleotide sequences, the positional relationship with the transcription start point may differ from the above definition due to the insertion or deletion of one or more nucleotides, but the position is easily specified by alignment with the reference sequence. be able to. The position of the cis element of the present invention in the c-Myc gene of mammals other than humans and mice can also be specified in the same manner. Accordingly, the cis element of the present invention is the nucleotide sequence from -309 to -304 from the transcription start point of the human c-Myc gene, or other mammalian orthologs or their natural allelic variants or gene polymorphisms. A sequence (counterpart) corresponding to the nucleotide sequence.

In the present specification, the “cis element” is present on the regulatory region of a gene, is involved in the control of the transcription level of the gene, and is an important element that determines the expression level of the gene product encoded by the gene. This is a region of double-stranded DNA. The cis element of the present invention is a Runx binding region that is closest to the transcription start point of the c-Myc gene, that is, a double-stranded DNA region consisting of a normal strand: TGCGGT and a reverse strand: ACCGCA. It is.

“A region of 12 nucleotides or more that includes at least a part of the cis element TGCGGT of the present invention” (hereinafter, also referred to as “target region of the present invention”) means all of the cis elements (TGCGGT), Includes TGCGG, TGCG, TGC, TG or T from which the nucleotide is removed from the 3 ′ side of the element, or GCGGT, CGGT, GGT, GT or T from which the nucleotide is removed from the 5 ′ side of the cis element And a region consisting of a partial nucleotide sequence containing 12 or more consecutive nucleotides in the upstream sequence of the transcription start site of the c-Myc gene. For example, when the length of the region is 20 nucleotides, taking the human c-Myc gene as an example, the region surrounded by the box in Table 1 is included in the target region of the present invention.

As shown in the examples described later, even if only one terminal nucleotide in the cis element of the present invention is deleted, the tumorigenicity in p53 knockout mice can be halved. A region containing only one terminal nucleotide of the cis element is sufficient, but preferably 2 nucleotides, more preferably 3 nucleotides, still more preferably 4 nucleotides, particularly preferably 5 from the end of the cis element of the present invention. A nucleotide, most preferably a region comprising the entire cis element of the present invention. For example, taking Table 1 as an example, the target regions of the present invention are preferably the regions (2) to (24), more preferably the regions (3) to (23), and further the regions (4) to (22). Preferably, regions (5) to (21) are particularly preferable, and regions (6) to (20) are most preferable.

The length of the target region of the present invention is not particularly limited as long as the binding inhibitor of the present invention can specifically recognize and bind to the region, but is preferably 12 nucleotides or more, more preferably 15 nucleotides or more, Preferably it is 17 nucleotides or more. The upper limit of the length is not particularly limited, but is, for example, 30 nucleotides or less, preferably 25 nucleotides or less, more preferably 22 nucleotides or less. Accordingly, the range of the length of the target region includes, for example, 12 to 30 nucleotides, preferably 15 to 25 nucleotides, and more preferably 17 to 22 nucleotides.

The binding inhibitor of the present invention comprises the target of the present invention comprising all or part of the cis element of the present invention, which is the Runx binding sequence nearest to the transcription start site upstream of the transcription start site of the c-Myc gene. By specifically recognizing and binding the region, it is possible to block the binding of Runx3 to the cis element of the present invention and suppress the transcriptional activation of the c-Myc gene caused by the binding. Runx3 cannot bind to the Runx binding sequence on the regulatory region of the c-Myc gene and cannot induce c-Myc expression in the state of binding to p53. Therefore, the binding inhibitor of the present invention is preferably applied to a subject in which p53 is inactivated (at least binds to Runx3 and lacks the activity of suppressing the transcriptional activation of c-Myc gene by Runx3).

The binding inhibitor of the present invention may be any substance as long as it can block the binding of Runx3 to the cis element of the present invention by specifically recognizing and binding to the target region of the present invention, For example, a protein that can specifically bind to the target region of the present invention, a nucleic acid that specifically hybridizes with the target region of the present invention, and can form a triplex (Hoogsteen-type recognition) or an analog thereof, Examples include a broad sense antigene such as a substance (for example, PI polyamide) capable of specifically binding to a minor groove having a double helical structure of the target region of the present invention. Alternatively, a component used for genome editing that can specifically destroy a cis element by introducing a mutation into the cis element of the present invention can also be included in the binding inhibitor of the present invention. However, considering the application to human clinical practice, the use of genome editing technology involving genome sequence modification (particularly double-strand DNA breakage; modification involving DSB) is extremely limited. By using only TALEN, CRISPR / Cas nucleic acid sequence recognition modules, or by combining an inactivated nuclease or a substance that binds to the cis element of the present invention but does not activate transcription of the c-Myc gene. It is desirable to inhibit the binding of Runx3 to the cis elements of the present invention and / or without modification of the genomic sequence.

1. Antigene (a) triplex DNA formation type oligonucleotide (TFO)
A typical antigene is based on the binding of a third nucleic acid to a DNA duplex, and the base of the third nucleic acid is hydrogen bonded to the purine base of the purine-pyrimidine base pair, resulting in in-plane By forming a structure in which three bases are continuously arranged, a triple chain can be formed. As shown in the following structural formula, the position of the 1'-position carbon of the base of the third nucleic acid (TFO) is outward (Hoogsteen binding type) (SEQ ID NO: 13) and the opposite (reverse Hoogsteeen binding type) ) (SEQ ID NO: 14), the former being parallel orientation (the same orientation as the strand on which DNA double-stranded base pairs are formed) and the latter being anti-parallel orientation (DNA double-stranded base pairs The orientation is opposite to that of the side chain to be formed). The sequence of each strand of the DNA duplex is represented by SEQ ID NO: 15 or 16.

The parallel oriented TFO has T (T: AT base pair) and protonated C (C) for the AT base pair and the GC base pair A and G in the DNA duplex, respectively. ⁺ : GC base pair) is bound. On the other hand, the anti-parallel orientation TFO has T (T: AT base pair) and G (G: G: G) for AT base pair and GC base pair A and G in the DNA duplex, respectively. GC base pairs). In order for C to be protonated, it must be under acidic conditions, so its use under physiological conditions is limited, but methylcytidine that is protonated even in neutrality or a derivative that does not require protonation ( This problem can be avoided by using the example 5-methyl-6-oxocytidine).

As mentioned above, a typical triplex is a DNA duplex with one homopurine (G or A) strand and the other homopyrimidine (C or T) strand, while TFO binds to the homopurine strand in the major groove. It is formed by doing. Thus, the use of TFO is limited to those that target purine-rich (pyrimidine-rich in the reverse strand) DNA duplex. For example, taking the human c-Myc gene as an example, a 10-nucleotide AGGA C AAGGA (SEQ ID NO: 4) immediately before the cis element of the present invention may be mentioned as a purine-rich sequence in the target region of the present invention. That is, 9 nucleotides out of 10 nucleotides are purine residues, and only the underlined C is a mismatch. To increase the specificity to a target area of the present invention, if T G 5 'cis-elements TGCGGT of the present invention, or a T G C GG a TFO targeted to DNA duplexes reach out, the number of mismatches Will be 2/12 and 3/15, respectively, increasing the instability of the triplex. In order to suppress destabilization at the mismatched portion, for example, a base is removed from the corresponding nucleotide of TFO, or TA base pair or CG base pair called BIG (B2, B3) as described below. Can be substituted with a non-natural molecule that selectively recognizes only.

Alternatively, for example, an antigene is designed for 10 nucleotides AGGACAAGGA (SEQ ID NO: 4) immediately before the cis element of the present invention, and a PI polyamide capable of specifically recognizing the cis element of the present invention described later is used as an appropriate linker. The specificity for the target region of the present invention can also be increased by linking via (eg, amino acid linkers such as proline, lysine, glycine, peptide linkers, etc.).

The nucleotide molecule constituting TFO may be natural DNA or RNA, and various chemical modifications may be performed to improve stability (chemical and / or enzyme) and specific activity (affinity with DNA). It may be an applied nucleotide molecule or a nucleic acid analogue. As an example of the above chemical modification, the phosphate residue (phosphate) of each nucleotide constituting the oligonucleotide is replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, boranophosphate, etc. Modification to be mentioned.
Another example of the chemical modification is a modification in which the 2′-position hydroxyl group of each nucleotide sugar is substituted with another functional group. Here, as another functional group, a halogen atom (eg, fluorine atom); a C _1-6 alkyl group (eg, methyl group); a C _1-6 alkyl group (eg, methyl group) may be substituted. Good amino group; -OR (R is for example CH ₃ (2'-O-Me), CH ₂ CH ₂ OCH ₃ (2'-O-MOE), CH ₂ CH ₂ NHC (NH) NH ₂ , CH ₂ CONHCH ₃ and CH ₂ CH ₂ CN are shown).
Examples of the nucleic acid analog include UNA (unlocked nucleic acid), HNA, morpholino oligo and the like. In the above HNA, the hydroxyl group of the hexopyranose part may be deoxylated. In the above HNA, the hydroxyl group of the hexopyranose part may be substituted with a fluorine atom.

TFO can be chemically synthesized by, for example, a method known per se described in International Publication No. 2005/021570, International Publication No. 03/068695, International Publication No. 2001/007455, or a method analogous thereto. In addition, the desired modified oligonucleotide is available by consignment synthesis.

(B) Pyrrole-imidazole (PI) polyamide As the second antigene, pyrrole-imidazole (PI) polyamide and a modified product thereof may be mentioned. PI polyamide is a polyamide containing an N-methylpyrrole unit (Py), an N-methylimidazole unit (Im), and a γ-aminobutyric acid moiety, and Py, Im, and γ-aminobutyric acid moiety are mutually bonded with an amide bond (- C (= O) -NH-) (Trauger et al, Nature, 382, 559-61 (1996); White et al, Chem. Biol., 4, 569-78 (1997); and Dervan, Bioorg. Med. Chem., 9, 2215-35 (2001)). In PI polyamide, a pyrrole (Py) / imidazole (Im) pair recognizes a CG base pair, a Py / Py pair recognizes an AT or TA base pair, and an Im / Py pair recognizes a GC base pair. When 3-hydroxypyrrole (Hp) is used, the Hp / Py pair recognizes the TA base pair, and the Py / Hp pair recognizes the AT base pair. The γ-aminobutyric acid moiety becomes a linker and is folded entirely to take a U-shaped conformation (hairpin type). In the U-shaped conformation, two chains containing Py and Im are arranged in parallel across the linker. As a result, PI polyamide enters the minor groove of the DNA duplex and binds to any DNA duplex in a base sequence-specific manner, thereby inhibiting the binding of transcription factors to the DNA duplex.

The PI polyamide of the present invention comprises the target region of the present invention (ie, all of the cis elements of the present invention (TGCGGT), TGCGG, TGCG, TGC, TG or T, wherein one nucleotide is removed from the 3 ′ side of the cis element. Or 12 or more consecutive nucleotides in the upstream sequence of the transcription start point of the c-Myc gene, including GCGGT, CGGT, GGT, GT or T from which 5 nucleotides have been removed from the 5 ′ side of the cis element (for example, , 12 to 30 nucleotides, preferably 15 to 25 nucleotides, more preferably 17 to 22 nucleotides), a region consisting of a partial nucleotide sequence of the c-Myc gene regulatory region). Inhibits Runx3 binding to the element and activates c-Myc gene transcription Control to.

PI polyamides do not have a nucleic acid structure unlike existing antisense nucleic acids and siRNAs, and therefore are not easily degraded by nucleolytic enzymes in vivo, and do not require a drug delivery system such as a vector or chaotic lipid, or an electroporation method.

PI polyamide can be synthesized using, for example, Fmoc peptide solid-phase synthesis technology using Py and Im derivatives having the Fmoc-protected amino group (following formula) as synthesis raw materials, but is not limited thereto.

(In the formula, X represents a carbon or nitrogen atom.)
A suitable linker such as γ-aminobutyric acid is introduced into the molecule between the paired pyrrole-imidazole chains so that the PI polyamide can form the desired hairpin structure. In addition, an appropriate spacer molecule that does not contribute to the binding with a target DNA sequence such as β-alanine can be inserted into a complementary position of both pyrrole-imidazole pairs to be paired.

When the coupling of the entire sequence of PI polyamide is completed, the terminal amino group is capped with an acyl group or the like, and then used as a carboxylic acid using trifluoroacetic acid (TFA) or N, N-dimethylaminopropylamine (Dp) Can be used to cut PI polyamide from the solid phase as an amine.

Furthermore, pyrrole-imidazole polyamide derivatives can be prepared by introducing various functional groups into the molecular ends. For example, seco-CBI, chlorambucil, bleomycin, nitrogen mustard, pyrrolobenzodiazepine, duocarmycin, enediyne compounds, derivatives of these, etc. that have the ability to alkylate DNA (alkylating agents) are introduced as necessary can do. The alkylating agent introduces an alkyl group at the guanine N-7 position or the adenine N-3 position of DNA, and causes an adduct formation or a cross-linking reaction between guanines or adenines. Double-stranded DNA that has undergone a cross-linking reaction or double-stranded DNA that has been formed as an adduct is difficult to repair by the repair mechanism. As a result, DNA cannot be transcribed or replicated, resulting in cell growth arrest or cell death due to apoptosis. Is induced.

The obtained PI polyamide can be isolated and purified by a known purification method. Here, examples of the purification method include solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, and combinations thereof. Purified PI polyamide can be lyophilized by a method known per se and stored at room temperature. When used, it can be dissolved in an organic solvent such as DMSO and then diluted to an appropriate concentration with water or a water / organic solvent mixture. it can. A design method and a production method of PI polyamide are described in, for example, Japanese Patent No. 3045706, Japanese Patent Application Laid-Open No. 2001-136974, and WO 03/000683.

Since synthesizing a long PI polyamide having more than 20 residues is disadvantageous in terms of technology and cost, when using PI polyamide, a shorter region within the target region of the present invention is targeted. The entire target area may be covered by combining with TFO.

(C) Peptide nucleic acid (PNA)
The third antigene includes peptide nucleic acid (PNA). PNA is a molecule having a peptide structure in the main chain and a structure similar to DNA or RNA. PNA has a main chain in which N- (2-aminoethyl) glycine is bonded by an amide bond instead of sugar. A purine ring or pyrimidine ring corresponding to a nucleobase is bonded to the main chain via a methylene group and a carbonyl group.

Since PNA does not have a phosphate site charge that is present in DNA or RNA, the PNA / DNA duplex forms a stronger bond than the DNA / DNA duplex due to a decrease in electrostatic repulsion. Therefore, PNA penetrates into a DNA duplex to form a D-loop and forms a Watson-Crick base pair with a complementary DNA strand, thereby binding a transcription factor to the DNA duplex. Can be inhibited. Accurate molecular recognition is also performed when PNA strands bind to complementary DNA, and PNA / DNA duplexes containing mismatched base pairs are less likely than DNA / DNA duplexes with similar mismatches. It is known to become stable. Therefore, it is expected that the off-target effect can be further reduced by using PNA. PNA is not easily recognized by nucleases and proteases in vivo, has resistance to enzymatic degradation, and can exist stably in a wider pH range.

The PNA of the present invention comprises the target region of the present invention (ie, all of the cis elements of the present invention (TGCGGT), TGCGG, TGCG, TGC, TG or T from which 3 nucleotides have been removed from the 3 ′ side of the cis element, Alternatively, it includes GCGGT, CGGT, GGT, GT or T from which 5 nucleotides are removed from the 5 ′ side of the cis element, and 12 or more consecutive nucleotides in the upstream sequence of the transcription start site of the c-Myc gene (for example, A cis element of the present invention by specifically binding to a region consisting of a partial nucleotide sequence of the c-Myc gene regulatory region comprising 12-30 nucleotides, preferably 15-25 nucleotides, more preferably 17-22 nucleotides) Inhibits binding of Runx3 to c-Myc gene and suppresses transcriptional activation

As in the case of PI polyamide, PNA can be produced using a peptide solid phase synthesis technique known per se.

2. Binding Inhibitor of the Present Invention Utilizing Genome Editing Technology (a) Binding Inhibitor without Encoding Genomic Sequence The present invention also inhibits binding of Runx3 to the cis element of the present invention using genome editing technology. Thus, an antitumor agent characterized by suppressing the transcriptional activation of the c-Myc gene is provided.
As a conventional genome editing method, a method using an artificial nuclease in which a molecule having a sequence-independent DNA cutting ability and a molecule having a sequence recognition ability are combined is well known. For example, zinc finger nuclease (ZFN), a transcriptional activator-like (TAL) effector that is a DNA-binding module of the genus Xanthomonas phytopathogen, in which a zinc finger DNA binding domain and a non-specific DNA cleavage domain are linked, and DNA TALEN linked with endonuclease, or CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) functioning in the acquired immune system possessed by eubacteria and archaea, and nuclease Cas (CRISPR-associated) that plays an important role together with CRISPR A method using a CRISPR-Cas9 system in combination with a protein family has been reported. Furthermore, an artificial nuclease is also reported in which a PPR protein composed of 35 amino acids and recognizing a specific nucleotide sequence by a PPR motif that recognizes one nucleobase and a nuclease are linked. Yes.

In these genome editing technologies, a specific target nucleotide sequence is recognized by a protein (ZF, TAL effector, PPR) or a complex of RNA and protein (CRISPR-Cas9). Therefore, it is possible to inhibit the binding of Runx3 to the cis element of the present invention by binding to the target region of the present invention using these substances (nucleic acid sequence recognition modules) that impart sequence specificity to the artificial nuclease. it can.

In the present invention, the “nucleic acid sequence recognition module” means a molecule or molecular complex having the ability to specifically recognize and bind to a specific nucleotide sequence (ie, target nucleotide sequence) on a DNA strand. Binding of the nucleic acid sequence recognition module to the target nucleotide sequence allows the effector linked to the module to specifically act on the targeted site of DNA.

In one embodiment of the present invention, the nucleic acid sequence recognition module includes a CRISPR-Cas system. The CRISPR-Cas system is a complex of short CRISPR RNA (crRNA) with a target nucleotide sequence and trans-activated crRNA (tracrRNA), or a single synthetic RNA (guide RNA, gRNA that combines crRNA and tracrRNA) ) Recognizes the sequence of the target DNA, so that any sequence can be targeted simply by synthesizing an oligo DNA that can specifically hybridize with the complementary sequence of the target nucleotide sequence.

Nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of Cas protein and RNA molecule (guide RNA) consisting of target nucleotide sequence and tracrRNA necessary for Cas protein recruitment. As another embodiment, a nucleic acid sequence recognition module using CRISPR-Cas is provided as a complex of crRNA containing RNA having the same sequence as the target nucleotide sequence, tracrRNA, and Cas.

The Cas protein used in the present invention is not particularly limited as long as it belongs to the CRISPR system, but is preferably Cas9. Examples of Cas9 include, but are not limited to, Cas9 (SpCas9) derived from Streptococcus pyogenes, Cas9 (StCas9) derived from Streptococcus thermophilus, and the like. SpCas9 is preferable. In consideration of use in human clinical practice, it is not preferable to generate DSB, and therefore, Cas that has inactivated DNA cleavage activity (dCas) is preferable. For example, in the case of SpCas9, the 10th Asp residue is converted to an Ala residue, a D10A mutant lacking the ability to cleave the opposite strand that forms a complementary strand with the guide RNA, and the 840th His residue is the Ala residue. Double mutants of the H840A mutant lacking the ability to cleave the guide RNA and the complementary strand converted with the group can be used, but other mutant Cass can be used as well.

When CRISPR-Cas is used as a nucleic acid sequence recognition module, when a complex of guide RNA and Cas is bound to the target nucleotide sequence, the cis element of the present invention is blocked by the complex, and Runx3 cannot bind For example, in the case of the mouse c-Myc gene, the target nucleotide sequence (that is, CTGCGTATATCAGTCACCGC; SEQ ID NO: 12) used in Examples described later (see FIG. 4-2) can be mentioned. It is done. On the other hand, in the case of the human c-Myc gene, for example, CGG in the cis element of the present invention is PAM, and the reverse strand sequence of 20 nucleotides upstream (ie, ATACTCACAGGACAAGGATG; SEQ ID NO: 6) from immediately before is used as the target nucleotide sequence. crRNA can be designed.

In another aspect of the present invention, the nucleic acid sequence recognition module includes a zinc finger motif, a TAL effector, a PPR motif, etc., as well as DNA of a protein that can specifically bind to DNA such as a restriction enzyme, transcription factor, RNA polymerase, etc. A fragment that contains a binding domain and does not have the ability to cleave DNA double strands can be used.

The zinc finger motif is a linkage of 3 to 6 different zinc finger units of the Cys2His2 type (one finger recognizes about 3 bases), and can recognize a target nucleotide sequence of 9 to 18 bases. Zinc finger motifs are: Modular assembly method (Nat Biotechnol (2002) 20: 135-141), OPEN method (Mol Cell (2008) 31: 294-301), CoDA method (Nat Methods (2011) 8: 67-69) In addition, it can be prepared by a known method such as E. coli one-hybrid method (Nat Biotechnol (2008) 26: 695-701). Japanese Patent No. 4968498 can be referred to for details of the production of the zinc finger motif.

The TAL effector has a repeating structure of modules of about 34 amino acids, and the binding stability and base specificity are determined by the 12th and 13th amino acid residues (called RVD) of one module. The Since each module is highly independent, it is possible to create a TAL effector specific to the target nucleotide sequence simply by connecting the modules. TAL effectors are produced using open resources (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), Golden Gate method (Nucleic Acids Res 2011 (2011) 39: e82) etc. have been established, and a TAL effector for a target nucleotide sequence can be designed relatively easily. The details of the production of the TAL effector can be referred to JP-T-2013-513389.

The PPR motif consists of 35 amino acids, and is constructed to recognize a specific nucleotide sequence by a series of PPR motifs that recognize one nucleobase. The 1st, 4th, and ii (-2) th amino acids of each motif Only recognize the target base. Since there is no dependence on the motif structure and there is no interference from the motifs on both sides, it is possible to produce a PPR protein specific to the target nucleotide sequence by linking the PPR motifs just like the TAL effector. JP, 2013-128413, A can be referred to for details of preparation of a PPR motif.

In addition, when using fragments such as restriction enzymes, transcription factors, RNA polymerase, etc., the DNA-binding domain of these proteins is well known, so it is easy to design a fragment that contains this domain and does not have the ability to cleave DNA double strands. And can be built.

Even when any nucleic acid sequence recognition module is used, the above-mentioned “target region of the present invention”, that is, all of the cis elements of the present invention (TGCGGT), TGCGG in which one nucleotide is removed from the 3 ′ side of the cis elements. TGCG, TGC, TG or T, or GCGGT, CGGT, GGT, GT or T from which the nucleotides are removed from the 5 ′ side of the cis element, and in the upstream sequence of the transcription start site of the c-Myc gene A region consisting of a partial nucleotide sequence containing 12 or more consecutive nucleotides can be targeted.

Alternatively, as in the case of the dCas of the CRISPR-Cas, the nuclease is sterically formed by combining an inactivated nuclease (eg, FokI) with a nucleic acid sequence recognition module such as a zinc finger motif, a TAL effector, and a PPR motif. Alternatively, the cis element of the present invention can be blocked, thereby inhibiting Runx3 binding. In this case, for example, two nucleic acid sequence recognition modules that specifically recognize a normal nucleotide sequence upstream of the cis element of the present invention and a reverse nucleotide sequence downstream of the cis element are designed, and the end of the module is designed. The cis element of the present invention can be blocked by forming a complex with a nuclease inactivated at (eg, C-terminal).

Nucleic acid sequence recognition modules such as zinc finger motif, TAL effector and PPR motif can be provided as fusion proteins with the above nucleases, and protein binding domains such as SH3 domain, PDZ domain, GK domain, GB domain and their The binding partner may be fused to a nucleic acid sequence recognition module and a nuclease, respectively, and provided as a protein complex through the interaction between the protein binding domain and the binding partner. Alternatively, the intein can be fused to the nucleic acid sequence recognition module and the nuclease, and both can be linked by ligation after synthesis of each protein.

The nucleic acid sequence recognition module of the present invention further inhibits the transcription of the c-Myc gene while blocking the binding of Runx3 to the cis element of the present invention by forming a complex with a transcription repressing factor instead of a nuclease. You can also In the present invention, the “transcription repressing factor” means a protein or protein domain having transcription repressing activity of a target gene.

The transcription repressing factor used in the present invention is not particularly limited as long as it can suppress the transcriptional activation of the c-Myc gene. For example, KRAB, MBD2B, v-ErbA, SID (SID concatemer ( SID4X)), MBD2, MBD3, DNMT family (eg, DNMT1, DNMT3A, DNMT3B), Rb, MeCP2, ROM2 and AtHD2A, and preferably KRAB. When KRAB is used as the transcriptional repressor of the present invention, the protein derived therefrom is not particularly limited. For example, KOX-1 (ZNF10), KOX8 (ZNF708), ZNF43, ZNF184, ZNF91, HPF4, HTF10, HTF34, etc. Is mentioned.

The contact between the nucleic acid sequence recognition module and the c-Myc gene in which the target region of the present invention is present is the target mammal (eg, human, mouse, rat, cow, dog, cat, monkey, etc., preferably human Alternatively, it is carried out by introducing a nucleic acid encoding the module (or an effector protein when used in combination with an effector such as a nuclease or a transcription repressing factor) into a mouse, more preferably a human cell.
Therefore, the nucleic acid sequence recognition module, or the nucleic acid sequence recognition module and the effector, can be used as a nucleic acid encoding their fusion protein or in a form that can be complexed in the host cell after being translated into the protein. Preferably, it is prepared as a nucleic acid encoding. Here, the nucleic acid may be DNA or RNA. In the case of DNA, it is preferably double-stranded DNA, and is provided in the form of an expression vector capable of expressing each constituent element under the control of a functional promoter in mammalian cells. In the case of RNA, it is preferably a single-stranded RNA.

When CRISPR-Cas is used as a nucleic acid sequence recognition module, an expression vector encoding guide RNA and Cas protein is introduced into the cell, and the guide RNA and Cas protein are expressed in the cell, so that the guide RNA and Cas protein are expressed in the cell. Form a complex. The guide RNA and Cas protein may be encoded on the same expression vector, or may be encoded on different expression vectors.

The DNA encoding Cas can be cloned from cells that produce Cas by methods well known in the art. The obtained Cas-encoding DNA can be inserted downstream of the promoter of an expression vector for mammalian cells.

On the other hand, the DNA encoding the guide RNA is chemically designed using a DNA / RNA synthesizer by designing an oligo DNA sequence in which a target nucleotide sequence and a known tracrRNA sequence (for example, gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgctttt; Can be synthesized. In this specification, the nucleotide sequence is described as a DNA sequence unless otherwise specified. However, when the polynucleotide is RNA, thymine (T) is appropriately replaced with uracil (U).

DNA that encodes guide RNA can also be inserted into an expression vector for mammalian cells. The guide RNA and Cas may be encoded on the same expression vector, or may be encoded on different expression vectors. Preferably, the DNA encoding Cas and the DNA encoding guide RNA are inserted downstream of separate promoters in the same expression vector.

The RNA encoding Cas can also be prepared by, for example, transcribing it to mRNA using an in vitro transcription system known per se using the above-described DNA encoding Cas as a template.
The guide RNA can also be chemically synthesized using a DNA / RNA synthesizer by designing an oligo RNA sequence in which a target nucleotide sequence and a known tracrRNA sequence are linked. In this case, various modifications for improving stability and membrane permeability can be imparted to the ribonucleotide constituting the guide RNA. Alternatively, crRNA and tracrRNA can be synthesized separately and annealed for use.

DNA encoding nucleic acid sequence recognition modules such as zinc finger motifs, TAL effectors, and PPR motifs can be obtained by any of the methods described above for each module. For example, DNA encoding sequence recognition modules such as restriction enzymes, transcription factors, RNA polymerase, etc. covers the region encoding the desired part of the protein (part containing the DNA binding domain) based on the cDNA sequence information. Thus, oligo DNA primers can be synthesized and cloned by amplifying by RT-PCR using total RNA or mRNA fraction prepared from cells producing the protein as a template.

Similarly, for DNA encoding effectors such as nucleases and transcriptional repressors, oligo DNA primers are synthesized based on the cDNA sequence information of the effector used, and total RNA or mRNA fractions prepared from cells producing the effector. And can be cloned by amplification by RT-PCR. For example, DNA encoding FokI can be cloned from mRNA derived from Flavobacterium okeanokoites (IFO 12536) by RT-PCR by designing appropriate primers upstream and downstream of CDS based on the cDNA sequence.

The DNA encoding the cloned nucleic acid sequence recognition module can be digested as it is or with a restriction enzyme if desired, or an appropriate linker and / or nuclear translocation signal can be added. When used in combination with an effector such as a nuclease or transcription repressor, the DNA encoding the cloned nucleic acid sequence recognition module is ligated with the DNA encoding the cloned nucleic acid sequence recognition module to encode a fusion protein. DNA can be prepared. Alternatively, by fusing the DNA encoding the nucleic acid sequence recognition module and the DNA encoding the effector, respectively, by fusing the DNA encoding the binding domain or its binding partner, or by fusing the DNA encoding the separation intein to both DNAs, A complex may be formed after the nucleic acid sequence recognition module and the effector are translated in the host cell. In these cases, a linker and / or a nuclear translocation signal can be linked to an appropriate position of one or both of DNAs as desired.

For DNA encoding nucleic acid sequence recognition modules and DNA encoding effectors, chemically synthesize DNA strands, or synthesize partially overlapping oligo DNA short strands using the PCR method or Gibson Assembly method. By connecting, it is possible to construct a DNA encoding the full length. The advantage of constructing full-length DNA in combination with chemical synthesis or PCR method or Gibson Assembly method is that the codon used can be designed over the entire CDS according to the host into which the DNA is introduced. In the expression of heterologous DNA, an increase in protein expression level can be expected by converting the DNA sequence into a codon frequently used in the host organism. Data on the frequency of codon usage in the host to be used is, for example, the genetic code usage frequency database (http://www.kazusa.or.jp/codon/index.html) published on the Kazusa DNA Research Institute website. ) May be used, or references describing the frequency of codon usage in each host may be consulted. By referring to the obtained data and the DNA sequence to be introduced and converting the codon used in the DNA sequence that is not frequently used in the host into a codon that encodes the same amino acid and is frequently used Good.

As an expression vector into which DNA encoding a nucleic acid sequence recognition module and / or effector is inserted, an animal virus vector such as a retrovirus, vaccinia virus, adenovirus, or the like is used.
Promoters include SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, etc. A promoter that can function in mammalian cells is used, but is not limited thereto.

In addition to the above, the expression vector may contain an enhancer, a splicing signal, a terminator, a poly A addition signal, a selection marker such as a drug resistance gene, a replication origin, and the like as desired.

By introducing an expression vector encoding a nucleic acid sequence recognition module (and optionally an effector further) into target mammalian target cells (eg, cancer cells, precancerous cells inactivated p53), A nucleic acid sequence recognition module or a complex of the module and an effector is expressed and formed in the cell, and can be brought into contact with a target nucleotide sequence on the c-Myc gene.

(B) Binding Inhibitor with Genomic Sequence Modification In (a) above, by using a wild-type enzyme having DSB activity as a nuclease, DSB is generated in the cis element of the present invention, and the cis element of the present invention The cis element can be disrupted by deletion of one or more nucleotides or substitution of other nucleotides, or insertion of one or more nucleotides into the cis element.

The c-Myc gene is cleaved within the cis element of the present invention and then repaired by non-homologous end joining (NHEJ), but due to a repair error, deletion of one or more nucleotides of the cis element or Substitution for other nucleotides, or insertion of one or more nucleotides within the cis element occurs. As a result, the affinity of Runx3 to the mutant cis element is significantly reduced, the binding of Runx3 to the mutant cis element is inhibited, and the transcriptional activation of the c-Myc gene is suppressed.

As another embodiment for introducing a mutation into the cis element of the present invention, a DNA comprising a sequence homologous to each of the upstream and downstream sequences adjacent to the cis element of the present invention and having the mutation introduced into the cis element part ( The donor DNA is introduced into the target mammalian cell together with the DNA encoding the complex of the nucleic acid sequence recognition module and the nuclease, so that the region containing the target region of the present invention is homologous with the donor DNA. By causing recombination, a desired mutation can be introduced into the cis element of the present invention. The sequence homologous to the upstream and downstream sequences adjacent to the cis element contained in the donor DNA is not particularly limited as long as it is long enough to cause homologous recombination. It may be a short sequence (see FIG. 4-2) or a long homology arm extending over several kb (see FIG. 4-1). In the latter case, the donor DNA can be provided in the form of a targeting vector into which it has been inserted. “Targeting vector into which donor DNA has been inserted” is not limited to a targeting vector into which the same sequence as the above donor DNA is inserted, but has a selection marker and / or a recombinase target sequence between or outside the donor DNA. Including. The vector serving as the basic skeleton of the targeting vector is not particularly limited as long as it is capable of self-replication in a cell to be transformed (for example, E. coli). For example, commercially available pBluescript (manufactured by Stratagene), pZErO1.1 (Invitrogen), pGEM-1 (Promega) and the like can be used.

Donor DNA can be introduced into cells in any form of double-stranded DNA (circular double-stranded DNA, linear double-stranded DNA) or single-stranded DNA.

Since DSB involves unexpected genomic alterations, it has side effects such as strong cytotoxicity and chromosomal translocation, which may impair reliability in gene therapy. Therefore, instead of nuclease, an enzyme capable of genome modification without DSB as an effector can be used in combination with a nucleic acid sequence recognition module. As such an enzyme, for example, an enzyme that substitutes a different base by converting a nucleobase substituent to another substituent (eg, deaminase), catalyzes an abasic reaction, and has an intrinsic repair mechanism. An enzyme that introduces a mutation into an abasic site using an error (eg, DNA glycosylase, etc.) can be mentioned, but is not limited thereto. In this case, if the nucleic acid sequence recognition module is CRISPR-Cas, as Cas, a mutant (nCas) in which at least one DNA cleavage ability is inactivated, preferably a mutant in which both DNA cleavage ability is inactivated (nCas) dCas) is used. Details of using deaminase as the effector are described in, for example, International Publication No. 2015/133554, and details of using DNA glycosylase are described in, for example, International Publication No. 2016/072399.

As described above, in the transcriptional regulatory region of the c-Myc gene, there are many Runx binding sequences in addition to the cis element of the present invention (see Non-Patent Document 1 and FIG. 1). Therefore, transcription of the c-Myc gene can be further suppressed by inhibiting the binding of Runx3 to one or more of these Runx binding sequences in addition to the cis element of the present invention. To specifically block other Runx binding sequences on the transcriptional regulatory region of the c-Myc gene, instead of the target region of the present invention, a sequence containing at least part of the target Runx binding sequence TGCGGT or ACCGCA What is necessary is just to implement the method similar to the above by making the area | region which consists of a partial nucleotide sequence 12 nucleotides or more into a target area | region. In this case, if CRISPR-Cas is used as the nucleic acid sequence recognition module, it is only necessary to design the guide RNA for each target nucleotide sequence, which is simpler than using a ZF motif or a TAL effector.

3. Use of binding inhibitor of the present invention (a) Antitumor agent The binding inhibitor of the present invention specifically recognizes and binds to the target region of the present invention, thereby binding Runx3 to the cis element of the present invention. Can inhibit the transcriptional activation of the c-Myc gene more efficiently than the direct inhibition of Runx3 and c-Myc expression, and the off-target effect on the Runx binding region on other genes is sufficient. Therefore, it can be a safe and effective antitumor agent against cancer, particularly cancer with inactivation of p53.

In the present invention, at least in part, the phenomenon of p53 inactivation and c-Myc increased expression that are commonly observed in many cancers is caused by the fact that Runx3, which has been derepressed by p53, is a specific c-Myc gene. It is based on the discovery that it activates transcription of the gene by binding to the Runx binding sequence.
Therefore, there is no particular limitation on the cancer with which the binding inhibitor of the present invention can exert an antitumor effect, as long as p53 is inactivated. For example, chronic lymphocytic leukemia, cervical cancer, glioma , Hodgkin lymphoma, non-Hodgkin lymphoma, malignant mesothelioma, osteosarcoma, melanoma, multiple myeloma, acute lymphocytic cancer, chronic myelogenous cancer, skin cancer, thyroid cancer, pharyngeal cancer, larynx Cancer, lung cancer, esophageal cancer, stomach cancer, liver cancer, pancreatic cancer, kidney cancer, prostate cancer, small intestine cancer, colon cancer, rectal cancer, colon cancer, testicular cancer, ovarian cancer Cervical cancer, ureteral cancer, bladder cancer. In particular, treatment of pancreatic cancer with high p53 mutation rate and high malignancy, and osteosarcoma, especially pediatric osteosarcoma, which has a treatment period of 1 year and is often difficult to cure. Useful for.

When the binding inhibitor of the present invention is an antigene (eg, TFO, PI polyamide, PNA, etc.), an effective amount of the binding inhibitor alone or with a pharmaceutically acceptable carrier as a pharmaceutical composition, It can be formulated. On the other hand, when the binding inhibitor of the present invention is a nucleic acid sequence recognition module (and an effector that forms a complex with the module) used in genome editing technology, preferably the binding inhibitor is a DNA encoding the same. In the form of an expression vector (hereinafter also referred to as “vector of the present invention”). Examples of the expression vector of the present invention include a detoxified retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, poliovirus, Sindbis virus, Sendai virus, SV40, immunodeficiency virus (HIV). ) And the like can be used. Preferably, an adenovirus or an adeno-associated virus vector is used.

Examples of pharmaceutically acceptable carriers include excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, lubricants such as magnesium stearate and aerosil, citric acid, Fragrances such as menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspensions such as methylcellulose and polyvinylpyrrolide, dispersants such as surfactants, water, Although diluents, such as physiological saline, base wax, etc. are mentioned, it is not limited to them.

In order to promote introduction of an antigene molecule or a vector of the present invention into a target cell, the antitumor agent of the present invention can further contain a reagent for nucleic acid introduction. Examples of the nucleic acid introduction reagent include atelocollagen; liposome; nanoparticle; lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polybrene, or poly (ethyleneimine) (PEI) Cationic lipids such as can be used.

In a preferred embodiment, the antitumor agent of the present invention can be a pharmaceutical composition in which an antigene molecule or the vector of the present invention is encapsulated in liposomes. Liposomes are fine closed vesicles having an inner phase surrounded by one or more lipid bilayers, and can usually retain a water-soluble substance in the inner phase and a fat-soluble substance in the lipid bilayer. In the present specification, when “encapsulated” is used, the antigene molecule and the vector of the present invention may be retained in the liposome internal phase or in the lipid bilayer. The liposome used in the present invention may be a monolayer membrane or a multilayer membrane, and the particle size can be appropriately selected, for example, in the range of 10 to 1000 nm, preferably 50 to 300 nm. In consideration of deliverability to the target tissue, the particle size can be, for example, 200 nm or less, preferably 100 nm or less.

Examples of the encapsulation method of the antigene or the vector of the present invention in the liposome include a lipid film method (vortex method), a reverse phase evaporation method, a surfactant removal method, a freeze-thaw method, a remote loading method, and the like. Without limitation, any known method can be appropriately selected.

The antitumor agent of the present invention can be administered orally or parenterally to mammals (eg, human, rat, mouse, guinea pig, rabbit, sheep, horse, pig, cow, monkey). However, it is desirable to administer parenterally.

It is also possible to prepare a sustained-release preparation (such as a mini-pellet preparation) and embed it in the vicinity of the affected area, or to gradually and continuously administer the affected area using an osmotic pump or the like.

Formulations suitable for parenteral administration (eg, subcutaneous injection, intramuscular injection, local infusion, intraperitoneal administration, etc.) include aqueous and non-aqueous isotonic sterile injection solutions, which include antioxidants Further, a buffer solution, an antibacterial agent, an isotonic agent and the like may be contained. Aqueous and non-aqueous sterile suspensions are also included, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives and the like. The preparation can be enclosed in a container in unit doses or multiple doses like ampoules and vials. Alternatively, the active ingredient and a pharmaceutically acceptable carrier can be lyophilized and stored in a state that may be dissolved or suspended in a suitable sterile vehicle immediately before use.

The content of the antigene molecule and the vector of the present invention in the pharmaceutical composition is, for example, about 0.1 to 100% by weight of the whole pharmaceutical composition.

The dose of the antitumor agent of the present invention varies depending on the administration method, the type of cancer to be treated, the severity, and the situation (sex, age, weight, etc.) of the administration target. For example, when administered systemically to an adult Usually, a single dose of antigene molecule is preferably 2 nmol / kg or more and 50 nmol / kg or less, and when administered locally, 1 pmol / kg or more and 10 nmol / kg or less is desirable. It is desirable to administer such dose 1 to 10 times, more preferably 5 to 10 times. Alternatively, when the vector of the present invention is administered as viral vector particles, it can be administered at a time, for example, in the range of about 1 × 10 ³ pfu to 1 × 10 ¹⁵ pfu as the virus titer.

When the binding inhibitor of the present invention is provided in the form of an expression vector containing the DNA encoding the same, the antitumor agent of the present invention is applied to cells or tissues (eg, cancer cells) collected from the administration subject. It may be an ex 製剤 vivo preparation that is added to introduce the expression vector into the cell and return it to the body of the administration target, preferably the cancer lesion. In this case, examples of the method for introducing a gene into a cell include a lipofection method, a phosphate-calcium coprecipitation method, and a direct injection method using a micro glass tube. In addition, gene transfer methods to tissues include gene transfer methods using encapsulated liposomes, gene transfer methods using electrostatic liposomes, HVJ-liposome method, improved HVJ-liposome method (HVJ-AVE liposome method), receptor-mediated Examples thereof include a gene introduction method, a method of transferring an active ingredient together with a carrier (metal particles) with a particle gun, a direct introduction method of naked-DNA, and a introduction method using a positively charged polymer.

The antitumor agent of the present invention can be used in combination with other drugs, for example, existing anticancer drugs depending on the cancer type. When the antitumor agent of the present invention is used in combination with another drug, the binding inhibitor of the present invention and the other drug can be mixed according to a method known per se to form a mixture, but each is separately It may be formulated and administered to the same subject at the same time or with a time difference.
As the dose of the other drug, for example, the dose usually used when the drug is administered alone can be applied as it is.

As described above, if p53 is functioning normally, p53 binds to Runx3 and inhibits the binding of Runx3 to the c-Myc gene, so that the increase in expression of the c-Myc gene is suppressed. Therefore, the antitumor agent of the present invention is particularly effective because p53 is inactivated. Therefore, it is desirable to test whether the cancer patient to be administered has a p53 mutation in order to predict the therapeutic efficacy of the antitumor agent of the present invention. Therefore, the present invention also provides a medicament comprising a combination of the antitumor agent of the present invention and a reagent for assaying p53 inactivation. As a method for detecting a mutation in the p53 gene, a method in which an exon of the p53 gene is amplified by a PCR method, and sequencing or SSCP analysis is widely used. For example, a set of primers designed to amplify a region containing each exon of the p53 gene is commercially available. When it is determined in the assay for p53 inactivation that p53 is not inactivated (it is a wild type or has a mutation that does not affect the ability to bind Runx3), the antitumor agent of the present invention is ineffective One should consider choosing other therapies, as the effects can be expected to be limited.

(B) Genetically modified animals When the binding inhibitor of the present invention is a component of genome editing that involves modification of the genome sequence (eg, nucleic acid sequence recognition module, nuclease, nucleobase modifying enzyme, donor DNA), these are used. Thus, a non-human animal having a mutation in the cis element of the present invention and lacking the function of the cis element can be produced.

As the non-human animal, non-human warm-blooded animals (non-human mammals and birds) are preferable. Mammals include, for example, laboratory animals such as mice, rats, hamsters, guinea pigs and rabbits, domestic animals such as pigs, cows, goats, horses and sheep, pets such as dogs and cats, primates such as monkeys, orangutans and chimpanzees. Is mentioned. Examples of birds include chickens.

The genetically modified animal of the present invention can be obtained by introducing NHEJ or homologous recombination by introducing the binding inhibitor of the present invention into, for example, a pluripotent stem cell derived from a p53 conditional knockout non-human animal (eg, ES cell, iPS cell). Thus, after producing a pluripotent stem cell in which the cis element of the present invention is deficient in function, a chimeric embryo or a chimeric animal is produced by a method known per se, and a progeny is obtained from the chimeric animal subjected to germline transmission. By using genome editing technology, the functions of both alleles can be deleted at once, and homozygous genetically modified animals can be easily obtained.

The genetically modified animal of the present invention thus obtained is useful for analyzing the molecular mechanism of transcriptional regulation of the c-Myc gene and the molecular mechanism related to the onset and progression of cancer by p53, c-Myc and Runx3. is there.

4). Screening method The present invention also provides a method for screening a substance having antitumor activity, using as an index the ability to specifically bind to a specific region in the regulatory region of the c-Myc gene, which contains the cis element of the present invention. The method includes the following steps (1) to (3).
(1) A step of bringing Runx3 into contact with a double-stranded DNA having a partial nucleotide sequence of 12 nucleotides or more that contains the cis element of the present invention in the presence or absence of a test substance,
(2) a step of measuring the binding between the DNA and Runx3, and (3) a step of selecting a test substance that inhibits the binding between the DNA and Runx3 as a candidate for a substance having antitumor activity. As the double-stranded DNA used in (2), the double-stranded DNA constituting the target region of the present invention described above is preferable.

The test substance used in the screening method of the present invention may be any known compound and novel compound, for example, using nucleic acids, carbohydrates, lipids, proteins, peptides, low molecular weight organic compounds, combinatorial chemistry techniques. Examples thereof include a compound library prepared, a random peptide library prepared by solid phase synthesis or a phage display method, or natural components derived from microorganisms, animals and plants, marine organisms, and the like.

In a preferred embodiment, the screening method of the present invention further comprises the following steps (1 ′) to (3 ′).
(1 ′) a double-stranded DNA having a partial nucleotide sequence of 12 or more consecutive nucleotides containing the Runx binding sequence TGCGGT and not present in the regulatory region of the c-Myc gene in the presence or absence of a test substance And a step of contacting Runx3,
(2 ′) a step of measuring the binding between the DNA and Runx3; and (3 ′) whether the binding between the DNA and Runx3 is not inhibited or the inhibitory activity is determined by the double-stranded DNA and Runx3 in the step (1). A step of selecting a test substance having a lower inhibitory activity on binding as a candidate for a substance having antitumor activity The double-stranded DNA used in the step (1 ′) is preferably a gene other than the c-Myc gene, preferably Includes a partial nucleotide sequence including a Runx binding sequence, which is present in a gene related to survival. By collecting and arraying, for example, an array of double-stranded DNAs having a large number of such sequences, the specificity of the test substance for inhibiting Runx3 binding (degree of off-target action) can be comprehensively detected.

Runx3 protein can be prepared by a method known per se. For example, the Runx3 protein can be isolated and purified from the expression tissue of the Runx3 gene. However, in order to prepare a Runx3 protein rapidly, easily and in large quantities, and to prepare a Runx3 protein such as a human, it is preferable to prepare a recombinant protein by a gene recombination technique. The recombinant protein may be prepared in either a cell system or a cell-free system.

In step (2) (2 '), the degree of inhibition of the test substance against the binding is assayed by measuring the degree of binding between the double-stranded DNA and Runx3 by the test substance. The binding between the double-stranded DNA and Runx3 can be performed by a method known per se, for example, by measuring the results of gel shift assay, affinity chromatography, etc. with an image analyzer, a spectrophotometer or the like.

In step (3), a test substance that inhibits the binding between the cis element of the present invention and Runx3 is selected. Furthermore, by the step (3 ′), a Runx binding sequence other than the cis element of the present invention, for example, a gene containing a Runx binding sequence in the regulatory region other than the c-Myc gene, preferably a gene associated with survival, A test substance that does not inhibit the binding of Runx3 to the Runx binding sequence or has a weak inhibitory activity is selected.

The test substance selected by the above screening method is administered to, for example, a p53 conditional knockout animal (for example, a mammal such as a mouse, rat, hamster, guinea pig, rabbit, dog, monkey). The c-Myc gene expression inhibitory effect and / or antitumor effect of the substance and the degree of side effects can be confirmed.

Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited to these examples.

[Example 1]
FIG. 1 shows 3 kb upstream from the transcription start site as a mouse / human c-Myc promoter region. As clearly shown by enlarging the base sequence below, the runx site (TGCGGT) present closest to the transcription start point of the c-Myc gene was noted as mR1. mR1 is located in a highly conserved region with high homology in mammals, and mouse mR1 is located near -360 bp, and human mR1 is located near -310 bp.

[Example 2]
Mouse osteosarcoma cells in which mutations were introduced into the mouse mR1 sequence using the CRISPR / Cas9 system were prepared. In the mR1 sequence of a cell line (83-1 cell) established from osteosarcoma that developed in osteoblast-specific p53 knockout mice, a TGG (antisense side sequence) PAM sequence located at positions of -365 to -363 was added. The cells (83-1-T7 cells and 83-1-T13 cells) into which two types of homo-deficient mutations (T7 and T13-deficient mutations) were introduced by inducing the indel using the CRISPR / Cas9 system were produced. As shown by EMSA (Electrophoresis-Mobility-Shift-Assay) on the left side of FIG. 2, the DNA binding strength of endogenous Runx3 and Runx2 proteins in the nuclear extract of 83-1 cells is a double-stranded 20 having a normal sequence. Compared with base probe DNA (WT: TTCCACC TGCGGT GACTGAT (SEQ ID NO: 7); biotin label at 5 ′ end), probe DNA having T7 and T13 deletion mutations (T7: GTCCACC GCGGT GACTGAT (SEQ ID NO: 8), T13: CGTTCCCACC GGT GACTGAT (SEQ ID NO: 9); both were clearly reduced (5 ′ terminal biotin label) (detected by 4% polyacrylamide gel electrophoresis after 20 minutes of reaction at room temperature). In particular, the T13 deletion mutation completely inhibited the binding of Runx3 and Runx2 proteins. As shown in the result of Western blotting in FIG. 2, the protein amount of Runx3 is not changed in 83-1-T7 cells and 83-1-T13 cells compared to control 83-1-C cells, but clearly In addition, the amount of c-Myc protein was decreased. The tumorigenicity of 83-1-T7 cells and 83-1-T13 cells was examined in a tumor bearing experiment using nude mice together with 83-1-C cells. 2.5 × 10 ⁶ mice were injected subcutaneously on the dorsal side of nude mice (BALB / c nu / nu ♀ 6 weeks old), and the weight of the tumor formed after 30 days was measured and compared (right diagram in FIG. 2). . In mice injected with 83-1-T7 cells and mice injected with 83-1-T13 cells, the tumorigenicity was clearly suppressed as compared to mice injected with control 83-1-C cells. .

[Example 3]
83-1 cells in which Runx3 and c-Myc were knocked down using specific shRNA were prepared, and the results of cancer-bearing experiments in which their tumorigenicity was examined were obtained in [Example 2]. It compared with the result of the cancer experiment (FIG. 3). The cancer bearing experiment was carried out in the same manner as in [Example 2]. The siRNA-specific sequences of Runx3 and c-Myc (Runx3: TGGTCGGGGAAATAGAAAAA (SEQ ID NO: 10), c-Myc: GAACATCATCATCCAGGAC (SEQ ID NO: 11)) are incorporated into Clontech's pSIREN retrovirus shRNA expression vector, and HEK29 is incorporated into TEK29. Retroviruses were produced by transfection. By infecting the 83-1 cell with the retrovirus, the shRNA expression system was inserted into the genome of the 83-1 cell so that the shRNA was constitutively expressed by the U6 promoter. Infected cells were selected by culturing in a culture medium supplemented with 5 μg / ml of puromycin using the activity of the puromycin resistance gene encoded in the pSIREN vector, and the surviving cells were divided into 2.5 × 10 ⁶ nude mice. Injected. The introduction of mutations into mR1 showed a higher tumorigenic effect suppressing effect than that of Runx3 knockdown or c-Myc knockdown.

[Example 4-1]
The mR1: TGCGGT upstream from the transcription start point of the c-Myc gene is replaced with the BglII sequence (AGATCT) (FIG. 4-1). A targeting vector in which “FRT-Neo cassette-FRT” was inserted upstream of Exon2 of the c-Myc gene was constructed. According to a standard method, targeting vectors were introduced into C57BL / 6-derived ES cells (TT2) by electroporation, and neomycin (G418) was selected using the neomycin-resistant gene activity derived from the Neo cassette. Among the surviving ES cells, chimeric mice were prepared from ES cells that had undergone homologous recombination as expected, and F1 mice were obtained. Thereafter, F1 mice were crossed with CAG-FLP mice (a mouse systemically expressing yeast-derived FLP recombinase), and mice from which the Neo cassette had been removed were selected from their offspring. The activity of FLP recombinase that excises DNA in an FRT sequence-specific manner was used.

[Example 4-2]
Genome editing was applied to fertilized eggs to produce mice that specifically mutated mR1 (FIG. 4-2). (1) A complex of crRNA and tracrRNA targeting CTGCGTATATCAGTCACCGC (SEQ ID NO: 12) constitutes a guide RNA and induces Cas9 nuclease. The induced Cas9 nuclease cleaves the genomic DNA into double strands at a position 5 ′ to several bases from the PAM sequence (AGG). (2) The double-stranded genomic DNA is repaired by HDR (Homology-directed repair) using a single-stranded DNA in which mR1 is replaced with a restriction enzyme BglII site (AGATCT) as a donor. The single-stranded DNA has a homologous sequence of about 70 bases in both the 5 ′ and 3 ′ directions from the cleavage site. (3) In the genomic DNA repaired by HDR, mR1 is specifically substituted with a restriction enzyme BglII site (AGATCT).

[Example 5-1]
Mouse osteosarcoma cells in which mutations were introduced in the vicinity of the mouse mR1 sequence using the CRISPR / Cas9 system were prepared. An AGG (sense-side sequence) PAM sequence present at a position of −341 to −339 in the vicinity of the mR1 sequence of a cell line (83-1 cell) established from osteosarcoma developed in an osteoblast-specific p53 knockout mouse The cells (83-1-NA8 and 83-1-NA11 cells) into which two types of homo-deficient mutations (NA8 and NA11-deficient mutations) were introduced by inducing indels with the CRISPR / Cas9 system were used. A cancer-bearing experiment for examining the tumorigenicity of these cells and cells (83-1-T13 cells and 83-1-T18 cells) produced by the same method as in [Example 2] was carried out in [Example 2]. And was carried out in exactly the same way (FIG. 5). Mice injected with 83-1-NA11 cells, 83-1-T7 cells, or 83-1-T13 cells were significantly more in comparison with mice injected with control 83-1-C cells (WT). Tumor-forming ability was suppressed. On the other hand, in mice injected with 83-1-NA11 cells, tumorigenicity was not significantly suppressed. Therefore, it was shown that the tumor-forming ability is greatly reduced by the introduction of mutations into mR1, but the tumor-forming ability does not change so much even if there is a defect (NA8) in a part other than mR1.

[Example 5-2]
Except for using not only 83-1 cells (mOS4 cl.1) but also osteosarcoma-derived cell lines that developed in OS mice (mOS3 cl.2 and 97-3 cells) as cells to be introduced with mutations [ Example 2] Using the CRISPR / Cas9 system, mouse osteosarcoma cells (parent cells (Parental), T7 cells, T14 cells, in which homozygous mutations having deletions or insertions were introduced into the mouse mR1 sequence) were introduced in the same manner as in Example 2. T13 cells, T18 cells, T16 cells, T3 cells, A5 cells, A3 cells; however, T7 cells and T14 cells have the same homozygous mutation but derived from different clones) were prepared, and a tumor bearing experiment was performed (FIG. 6). . All cells had suppressed tumorigenicity as compared to the control parental cells.

From the above, it was speculated that the ability to form tumors was specifically reduced by introducing at least one base substitution, insertion, or deletion mutation at any position in the mR1 sequence.

[Example 6]
C57B6 strain systemic p53 gene knockout mice (# 002101; Current Biology Vol. 4 p1-7, 1994; p53 ^{− / −} mice) were purchased from The Jackson Laboratory (USA). Since most of p53 ^{− / −} mice develop T cell lymphoma and die in about 3 to 4 months (Current Biology Vol.4 p1-7, 1994), they can be used as a T cell lymphoma onset model.
Systemic Runx3 gene knockout mice of C57B6 strain (mice in which Exon3 of Runx3 gene was replaced with LacZ; Cell Vol.109 p113-124, 2002) were used for mating to generate p53 ^{− / −} Runx3 ^+/− mice. . Since C57B6 strain Runx3 ^{− / −} mice died immediately after birth, p53 ^{− / −} Runx3 ^{− / −} mice could not be examined.
The full-length Runx3 generates two types of full-length proteins due to the difference in promoters. One of them, the full-length Runx3 derived from the P1 promoter, was knocked out systemically by deleting Exon0 (Runx3 (P1) ^{− / −} mouse) ) Was produced. The C57B6 strain Runx3 (P1) ^{− / −} mouse expresses the full-length Runx3 derived from the P2 promoter, and is healthy with a lifespan comparable to that of the wild type, and can be mated. By repeating the mating, p53 ^{− / −} Runx3 (P1) ^{− / −} mice were generated.
The C57B6 strain mR1 homozygous mouse (mR1 ^{m / m} mouse) obtained in Example 4-2 was healthy with a lifespan comparable to that of the wild type, and could be mated. By repeating the mating, p53 ^{− / −} mR1 ^{m / m} mice were generated.

Survival rates were evaluated for these generated mice. The results are shown in FIG. Mice lacking mR1 systemically were healthy and mating without inferiority to the wild type, indicating that there was no concern about side effects even when mR1 was inhibited. Although p53 ^{− / −} mice developed lymphoma in the thymus and died early, p53 ^{− / −} mR1 ^{m / m} mice survived for a long time. Therefore, it was shown that tumorigenicity by p53 ^{− / −} is rescued by mR1 mutation. Moreover, surprisingly, this rescue effect was significantly higher than the effect of Runx3 ^+/− and Runx3 (P1) ^{− / −} .

This application is based on Japanese Patent Application No. 2017-119159 filed in Japan (filing date: June 16, 2017), the contents of which are incorporated in full herein.

According to the present invention, it is possible to suppress the tumorigenicity of an extremely large number of types of tumor cells only by inhibiting the binding of Runx3 to a specific region (target region of the present invention) on the c-Myc gene. In addition, since a substance that can specifically inhibit the binding does not affect the action of Runx3 on gene expression other than the c-Myc gene, it is very useful as a safe antitumor agent with reduced side effects.

Claims

Specific recognition of a continuous target region of 12 nucleotides or more including at least part of the Runx binding sequence TGCGGT closest to the transcription start point upstream of the transcription start point of the c-Myc gene, and the Runx binding sequence An antitumor agent comprising a substance that inhibits the binding of Runx3 to.
The Runx binding sequence is a nucleotide sequence from -309 to -304 from the transcription start point of the human c-Myc gene, or a sequence corresponding to the nucleotide sequence in other mammalian orthologs (counterpart). The agent described.
3. The agent according to claim 1 or 2, which is applied to a subject in which p53 is inactivated.
The agent according to any one of claims 1 to 3, wherein the substance is an antigene against a DNA sequence in the target region.
The agent according to claim 4, wherein the antigene is pyrrole-imidazole polyamide.
The agent according to any one of claims 1 to 3, wherein the substance is a nucleic acid sequence recognition module that specifically binds to the target region.
The agent according to claim 6, wherein the nucleic acid sequence recognition module is CRISPR-Cas, zinc finger motif, TAL effector or PPR motif.
The agent according to claim 6, wherein the nucleic acid sequence recognition module is CRISPR-dCas.
The agent according to claim 6 or 7, wherein the substance comprises a nuclease that forms a complex with the nucleic acid sequence recognition module.
The agent according to claim 9, wherein the substance further comprises donor DNA capable of causing homologous recombination at a site cleaved by the nuclease.
The agent according to any one of claims 6 to 8, wherein the nucleic acid sequence recognition module forms a complex with a transcription repressing factor.
The agent according to any one of claims 1 to 3 and 6 to 11, wherein the substance is provided in the form of one or more expression vectors encoding the substance.
The agent according to any one of claims 1 to 12, which is combined with a reagent for assaying inactivation of p53.
(1) 12 or more consecutive partial nucleotides containing the Runx binding sequence TGCGGT closest to the transcription start point upstream of the transcription start point of the c-Myc gene in the presence or absence of the test substance Contacting double-stranded DNA having a sequence with Runx3;
(2) measuring the binding between the DNA and Runx3, and (3) selecting a test substance that inhibits the binding between the DNA and Runx3 as a candidate for a substance having antitumor activity. A screening method for a substance having tumor activity.