WO2018222503A1 - Virus adéno-associé à capside variante et ses méthodes d'utilisation - Google Patents

Virus adéno-associé à capside variante et ses méthodes d'utilisation Download PDF

Info

Publication number
WO2018222503A1
WO2018222503A1 PCT/US2018/034456 US2018034456W WO2018222503A1 WO 2018222503 A1 WO2018222503 A1 WO 2018222503A1 US 2018034456 W US2018034456 W US 2018034456W WO 2018222503 A1 WO2018222503 A1 WO 2018222503A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
acid sequence
cases
seq
polypeptide
Prior art date
Application number
PCT/US2018/034456
Other languages
English (en)
Inventor
David V. Schaffer
Deepak Srivastava
David Stephen OJALA
Pengzhi YU
Original Assignee
The Regents Of The University Of California
The J. David Gladstone Institutes
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California, The J. David Gladstone Institutes filed Critical The Regents Of The University Of California
Publication of WO2018222503A1 publication Critical patent/WO2018222503A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14133—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145—Special targeting system for viral vectors

Definitions

  • Adeno-associated virus belongs to the Parvoviridae family and Dependovirus genus, whose members require co-infection with a helper virus such as adenovirus to promote replication, and AAV establishes a latent infection in the absence of a helper.
  • Virions are composed of a 25 nm icosahedral capsid encompassing a 4.9 kb single-stranded DNA genome with two open reading frames: rep and cap.
  • the non-structural rep gene encodes four regulatory proteins essential for viral replication, whereas cap encodes three structural proteins (VP 1-3) that assemble into a 60-mer capsid shell.
  • This viral capsid mediates the ability of AAV vectors to overcome many of the biological barriers of viral transduction-in el ding ceil surface receptor binding, endocytosis, intracellular trafficking, and unpackaging in the nucleus.
  • the present disclosure provides recombinant adeno-associated virus (AAV) virions with altered capsid protein, where the recombinant AAV (rAAV) virions exhibit greater infectivity of a cardiac cell compared to wild-type AAV, and where the rAAV virions comprise a heterologous nucleic acid.
  • AAV adeno-associated virus
  • rAAV recombinant AAV
  • the present disclosure provides methods of delivering a gene product to a cardiac cell in an individual.
  • the present disclosure provides methods of generating an induced cardiomyocyte-like cell.
  • the present disclosure provides methods of editing the genome of a cardiac cell.
  • FIG. 1 is a schematic depiction of a directed evolution strategy for engineering AAV
  • FIG. 2 provides an amino acid sequence of an AAV capsid variant (designated "AAV-
  • FIG. 3A-3B depict a structure of AAV2 capsid with N551S and 1698 V mapped onto the crystal structure of AAV2 in PyMOL.
  • FIG. 3A shows full biological assembly; and
  • FIG. 3B shows an individual asymmetric unit with shapes indicating the axes of symmetry.
  • FIG. 4 depicts transduction efficiency of AAV-A2 benchmarked against natural AAV serotypes.
  • AAV-A2 was packaged as rAAV sc-CMV-GFP along with wild type rAAV 1-6, 8, and 9.
  • FIG. 5A-5B are schematic depictions of single-stranded recombinant AAV expression cassettes for cardia reprogramming (FIG. 5A) and single-stranded AAV cassette for dual expression of Mef2c and Tbx5 using a P2A self-cleaving peptide.
  • FIG. 6A-6B depict in vitro reprogramming of primary mouse cardiac fibroblasts into
  • iCMs induced cardiomyocyte-like cells
  • AAV-A2 FPGA-A2 expressing reprogramming factors
  • FIG. 7 depicts in vivo reprogramming of mouse cardiac fibroblasts into iCMs using AAV-
  • Reprogrammed cells are double positive for the cardiomyocyte marker troponin T and the endogenous lineage.
  • FIG. 8A-8C provide amino acid sequences of RNA-guided endonucleases.
  • FIG. 9A-9B provide amino acid sequences of AAV2 capsid proteins.
  • FIG. 10 provides an alignment of amino acid sequences of capsids of various AAV
  • FIG. 11A-11C provide amino acid sequences of an AAV5 capsid (FIG. 11 A), an AAV4 capsid (FIG. 11B), and an ancestral AAV capsid (FIG. 11C).
  • FIG. 12 provides an alignment of amino acid sequences of AAV2 and AAV5 capsids.
  • FIG. 13 provides an AAV6 capsid amino acid sequence.
  • FIG. 14 provides an alignment of amino acid sequences of AAV2 and AAV6 capsids.
  • FIG. 15 provides an AAV8 capsid amino acid sequence.
  • FIG. 16 provides an alignment of amino acid sequences of AAV2 and AAV8 capsids.
  • FIG. 17 provides an AAV1 capsid amino acid sequence.
  • FIG. 18 provides an alignment of amino acid sequences of AAV1 and AAV8 capsids.
  • FIG. 19 provides a Gata4 amino acid sequence.
  • FIG. 20 provides a nucleotide sequence encoding a Gata4 polypeptide.
  • FIG. 21 provides a Mef2c amino acid sequence.
  • FIG. 22 provides a nucleotide sequence encoding a Mef2c polypeptide.
  • FIG. 23 provides a Mef2c amino acid sequence.
  • FIG. 24 provides a nucleotide sequence encoding a Mef2c polypeptide.
  • FIG. 25 provides a Tbx5 amino acid sequence.
  • FIG. 26 provides a nucleotide sequence encoding a Tbx5 polypeptide.
  • FIG. 27 provides a Tbx5 amino acid sequence.
  • FIG. 28 provides a nucleotide sequence encoding a Tbx5 polypeptide.
  • FIG. 29A-29B provide Esrrg amino acid sequences.
  • FIG. 30 provides an Mespl amino acid sequence.
  • FIG. 31A-31B provide Myocd amino acid sequences.
  • AAV is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise.
  • the abbreviation “rAAV” refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or "rAAV vector”).
  • AAV includes AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV- 6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), AAV type 9 (AAV-9), AAV type 10 (AAV- 10), AAV type 11 (AAV-11), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. See, e.g., Mori et al. (2004) Virology 330:375.
  • AAV also includes chimeric AAV.
  • Prime AAV refers to AAV isolated from a primate
  • non-primate AAV refers to AAV isolated from a non-primate mammal
  • bovine AAV refers to AAV isolated from a bovine mammal (e.g., a cow), etc.
  • rAAV vector refers to an AAV vector comprising a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a sequence of interest for the genetic transformation of a cell.
  • the heterologous polynucleotide is flanked by at least one, and generally by two AAV inverted terminal repeat sequences (ITRs).
  • ITRs AAV inverted terminal repeat sequences
  • An "AAV virus” or “AAV viral particle” or “rAAV vector particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is typically referred to as an "rAAV vector particle” or simply an "rAAV vector". Thus, production of rAAV particle necessarily includes production of rAAV vector, as such a vector is contained within an rAAV particle.
  • AAV "rep” and “cap” genes refer to polynucleotide sequences encoding replication and encapsidation proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes. "
  • a "helper virus” for AAV refers to a virus that allows AAV (e.g. wild-type AAV) to be replicated and packaged by a mammalian cell.
  • a variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia.
  • the adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used.
  • Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC.
  • Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are also available from depositories such as ATCC.
  • HSV herpes simplex viruses
  • EBV Epstein-Barr viruses
  • CMV cytomegaloviruses
  • PRV pseudorabies viruses
  • Helper virus function(s) refers to function(s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein). As described herein, "helper virus function” may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function(s) to a producer cell in trans.
  • infectious virus or viral particle is one that comprises a polynucleotide component which it is capable of delivering into a cell for which the viral species is tropic.
  • the term does not necessarily imply any replication capacity of the virus.
  • infectious virus or viral particle is one that can access a target cell, can infect a target cell, and can express a heterologous nucleic acid in a target cell.
  • infectivity refers to the ability of a viral particle to access a target cell, infect a target cell, and express a heterologous nucleic acid in a target cell. Infectivity can refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles can be expressed as the number of viral genome (vg) copies.
  • the ability of a viral particle to express a heterologous nucleic acid in a cell can be referred to as "transduction.”
  • the ability of a viral particle to express a heterologous nucleic acid in a cell can be assayed using a number of techniques, including assessment of a marker gene, such as a green fluorescent protein (GFP) assay (e.g., where the virus comprises a nucleotide sequence encoding GFP), where GFP is produced in a cell infected with the viral particle and is detected and/or measured; or the measurement of a produced protein, for example by an enzyme -linked immunosorbent assay (ELISA).
  • GFP green fluorescent protein
  • ELISA enzyme -linked immunosorbent assay
  • Viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles.
  • a “replication-competent” virus (e.g. a replication-competent AAV) refers to a virus
  • rAAV vectors as described herein are replication-incompetent in mammalian cells (especially in human cells) by virtue of the lack of one or more AAV packaging genes.
  • such rAAV vectors lack any AAV packaging gene sequences in order to minimize the possibility that replication competent AAV are generated by recombination between AAV packaging genes and an incoming rAAV vector.
  • rAAV vector preparations as described herein are those which contain few if any replication competent AAV (rcAAV, also referred to as RCA) (e.g., less than about 1 rcAAV per 10 2 rAAV particles, less than about 1 rcAAV per 10 4 rAAV particles, less than about 1 rcAAV per 10 s rAAV particles, less than about 1 rcAAV per 10 12 rAAV particles, or no rcAAV).
  • rcAAV replication competent AAV
  • polynucleotide refers to a polymeric form of nucleotides of any length
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • the term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
  • a polynucleotide or polypeptide has a certain percent "sequence identity" to another
  • sequence similarity can be determined in a number of different manners.
  • sequences can be aligned using the methods and computer programs, including BLAST, available over the world wide web at ncbi.nlm.nih.gov/BLAST/.
  • FASTA is Another alignment algorithm, available in the Genetics Computing Group (GCG) package, from Madison, Wisconsin, USA, a wholly owned subsidiary of Oxford Molecular Group, Inc.
  • GCG Genetics Computing Group
  • the program has default parameters determined by the sequences inputted to be compared.
  • the sequence identity is determined using the default parameters determined by the program. This program is available also from Genetics Computing Group (GCG) package, from Madison, Wisconsin, USA.
  • GCG Genetics Computing Group
  • Percent sequence identity is calculated by FastDB based upon the following parameters:
  • Gap Penalty 1.00
  • a “gene” refers to a polynucleotide containing at least one open reading frame that is
  • guide RNA refers to an RNA that comprises: i) an "activator" nucleotide sequence that binds to a guide RNA-directed endonuclease (e.g., a class 2 CRISPR/Cas endonuclease such as a type II, type V, or type VI CRISPR/Cas endonuclease) and activates the RNA-directed endonuclease; and ii) a "targeter" nucleotide sequence that comprises a nucleotide sequence that hybridizes with a target nucleic acid.
  • a guide RNA-directed endonuclease e.g., a class 2 CRISPR/Cas endonuclease such as a type II, type V, or type VI CRISPR/Cas endonuclease
  • the "activator" nucleotide sequence and the “targeter” nucleotide sequence can be on separate RNA molecules (e.g., a “dual-guide RNA”); or can be on the same RNA molecule (a "single- guide RNA”).
  • a "small interfering” or “short interfering RNA” or siRNA is a RNA duplex of nucleotides that is targeted to a gene interest (a "target gene”).
  • An “RNA duplex” refers to the structure formed by the complementary pairing between two regions of a RNA molecule.
  • siRNA is "targeted” to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to a nucleotide sequence of the targeted gene.
  • the length of the duplex of siRNAs is less than 30 nucleotides.
  • the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides in length.
  • the length of the duplex is 19-25 nucleotides in length.
  • the RNA duplex portion of the siRNA can be part of a hairpin structure.
  • the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex.
  • the loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length.
  • the hairpin structure can also contain 3' or 5' overhang portions. In some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.
  • microRNA refers to any type of interfering RNAs, including but not limited to, endogenous microRNAs and artificial microRNAs (e.g., synthetic miRNAs). Endogenous microRNAs are small RNAs naturally encoded in the genome which are capable of modulating the productive utilization of mRNA.
  • An artificial microRNA can be any type of RNA sequence, other than endogenous microRNA, which is capable of modulating the activity of an mRNA.
  • a microRNA sequence can be an RNA molecule composed of any one or more of these sequences.
  • MicroRNA or "miRNA" sequences have been described in publications such as Lim, et al., 2003, Genes & Development, 17, 991-1008, Lim et al., 2003, Science, 299, 1540, Lee and Ambrose, 2001, Science, 294, 862, Lau et al., 2001, Science 294, 858-861, Lagos-Quintana et al., 2002, Current Biology, 12, 735-739, Lagos-Quintana et al., 2001, Science, 294, 853-857, and Lagos-Quintana et al., 2003, RNA, 9, 175-179.
  • microRNAs include any RNA that is a fragment of a larger RNA or is a miRNA, siRNA, stRNA, sncRNA, tncRNA, snoRNA, smRNA, shRNA, snRNA, or other small non-coding RNA. See, e.g., US Patent Applications 20050272923, 20050266552, 20050142581, and 20050075492.
  • a "microRNA precursor" refers to a nucleic acid having a stem-loop structure with a microRNA sequence incorporated therein.
  • a “mature microRNA” includes a microRNA that has been cleaved from a microRNA precursor (a "pre-miRNA”), or that has been synthesized (e.g., synthesized in a laboratory by cell-free synthesis), and has a length of from about 19 nucleotides to about 27 nucleotides, e.g., a mature microRNA can have a length of 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, or 27 nt.
  • a mature microRNA can bind to a target mRNA and inhibit translation of the target mRNA.
  • Recombinant as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature.
  • a recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.
  • control element or "control sequence” is a nucleotide sequence involved in an
  • control elements include, for example, transcriptional regulatory sequences such as promoters and enhancers.
  • a promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter.
  • “Operatively linked” or “operably linked” refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.
  • An "expression vector” is a vector comprising a region which encodes a polypeptide of interest, and is used for effecting the expression of the protein in an intended target cell. An expression vector also comprises control elements operatively linked to the encoding region to facilitate expression of the protein in the target. The combination of control elements and a gene or genes to which they are operably linked for expression is sometimes referred to as an "expression cassette," a large number of which are known and available in the art or can be readily constructed from components that are available in the art.
  • Heterologous means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared.
  • a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide.
  • a promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter.
  • an rAAV that includes a heterologous nucleic acid encoding a heterologous gene product is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild-type AAV.
  • a genetic element e.g., a polynucleotide
  • the element may be heterologous to the cell, or it may be an additional copy or improved version of an element already present in the cell.
  • Genetic alteration may be effected, for example, by transfecting a cell with a recombinant plasmid or other polynucleotide through any process known in the art, such as electroporation, calcium phosphate precipitation, or contacting with a polynucleotide -liposome complex.
  • Genetic alteration may also be effected, for example, by transduction or infection with a DNA or RNA virus or viral vector.
  • the genetic element is introduced into a chromosome or mini- chromosome in the cell; but any alteration that changes the phenotype and/or genotype of the cell and its progeny is included in this term.
  • a cell is said to be “stably” altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro.
  • a cell is “heritably” altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell.
  • polypeptide “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component.
  • Polypeptides such as anti- angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a gene product to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein.
  • references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a gene product to a mammalian subject include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.
  • an "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from.
  • an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this disclosure are increasingly more isolated.
  • An isolated nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.
  • treatment refers to obtaining a desired pharmacologic and/or physiologic effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse affect attributable to the disease.
  • Treatment covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease or at risk of acquiring the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.
  • the terms "individual,” “host,” “subject,” and “patient” are used interchangeably herein, and refer to a mammal, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g., horses, camels, etc.);
  • mammalian farm animals e.g., sheep, goats, cows, etc.
  • mammalian pets e.g., dogs, cats, etc.
  • rodents e.g., mice, rats, etc.
  • the individual is a human.
  • the present disclosure provides recombinant adeno-associated virus (AAV) virions with altered capsid protein, where the recombinant AAV (rAAV) virions exhibit greater infectivity of a cardiac cell compared to wild-type AAV, and where the rAAV virions comprise a heterologous nucleic acid.
  • the present disclosure provides methods of delivering a gene product to a cardiac cell in an individual.
  • the present disclosure provides methods of generating an induced cardiomyocyte-like cell.
  • the present disclosure provides a variant AAV capsid protein, and an rAAV virion comprising the variant AAV capsid protein.
  • the variant capsid protein when present in an rAAV virion, provides for greater infectivity of a cardiac cell (e.g., a cardiac fibroblast; a cardiomyocyte) compared to parental AAV (e.g., compared to a wild-type AAV, e.g., compared to wild-type AAV2).
  • a cardiac cell e.g., a cardiac fibroblast; a cardiomyocyte
  • parental AAV e.g., compared to a wild-type AAV, e.g., compared to wild-type AAV2.
  • a variant AAV capsid polypeptide comprises one or more amino acid substitutions relative to a parental AAV capsid polypeptide; and, when present in an rAAV virion, confers increased infectivity of a cardiac cell (e.g., a cardiac fibroblast; a cardiomyocyte) compared to a control rAAV virion comprising a parental AAV capsid polypeptide.
  • the one or more amino acid substitutions is/are in the GH loop, or loop IV, of the AAV capsid protein, e.g., in a solvent-accessible portion of the GH loop, or loop IV, of the AAV capsid protein.
  • a "parental" AAV capsid protein can be a wild-type AAV capsid protein. In some cases, a "parental" AAV capsid protein is a wild-type AAV2 capsid protein. In some cases, a "parental" AAV capsid protein is a wild-type AAV5 capsid protein.
  • a "parental" AAV capsid protein is a chimeric AAV capsid protein.
  • Amino acid sequences of various AAV capsid proteins are known in the art. See, e.g., GenBank Accession No. NP_049542 for AAV1 ; GenBank Accession No. NP_044927 for AAV4; GenBank Accession No. AAD13756 for AAV5; GenBank Accession No.
  • AAB95450 for AAV6 GenBank Accession No. YP_077178 for AAV7; GenBank Accession No. YP_077180 for AAV 8; GenBank Accession No. AAS99264 for AAV9 and GenBank Accession No. AAT46337 for AAV10. See, e.g., Santiago-Ortiz et al. (2015) Gene Ther. 22:934 for ancestral AAV capsid.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises a substitution of one or more of amino acids 67, 207, 551, and 698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acid in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid substitution of amino acid 67 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acid in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid substitution of amino acid 207 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acid in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid substitution of amino acid 551 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acid in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid substitution of amino acid 698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acid in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 67 and 207 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 67 and 551 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 67 and 698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 207 and 551 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 207 and 698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 551 and 698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 67, 207, and 551 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 67, 207, and 698 of the AAV2 capsid amino acid sequence depicted in FIG.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 67, 551, and 698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 207, 551, and 698 of the AAV2 capsid amino acid sequence depicted in FIG.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises amino acid substitutions of amino acids 67, 207, 551, and 698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A, or the corresponding amino acids in an AAV capsid of an AAV serotype other than AAV2.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises a substitution of amino acid 67 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acid of an AAV capsid of an AAV serotype other than AAV2.
  • the substitution is a Glu ⁇ Ala substitution.
  • the substitution is a Glu ⁇ Ser substitution.
  • the substitution is a Glu ⁇ Gly substitution.
  • the substitution is a Glu ⁇ Thr substitution.
  • the substitution is a Glu ⁇ Val substitution.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises a substitution of amino acid 207 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acid of an AAV capsid of an AAV serotype other than AAV2.
  • the substitution is a Ser ⁇ Gly substitution.
  • the substitution is a Ser ⁇ Ala substitution.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises a substitution of amino acid 551 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acid of an AAV capsid of an AAV serotype other than AAV2.
  • the substitution is an Asn ⁇ Ser substitution.
  • the substitution is an Asn ⁇ Thr substitution.
  • the substitution is an Asn ⁇ Ala substitution.
  • the substitution is an Asn ⁇ Gly substitution.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises a substitution of amino acid 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acid of an AAV capsid of an AAV serotype other than AAV2.
  • the substitution is an He ⁇ Val substitution.
  • the substitution is an He ⁇ Leu substitution.
  • the substitution is an He ⁇ Ala substitution.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 67 and 207 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • substitutions are Glu ⁇ Ala (at position 67 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2) and Ser ⁇ Gly (at position 207 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 67 and 551 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • substitutions are Glu ⁇ Ala (at position 67 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2) and Asn ⁇ Ser (at position 551 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 67 and 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • substitutions are Glu ⁇ Ala (at position 67 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2) and He ⁇ Val (at position 698 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 207 and 551 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • substitutions are Ser ⁇ Gly (at position 207 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2) and Asn ⁇ Ser (at position 551 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 207 and 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • substitutions are Ser ⁇ Gly (at position 207 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2) and He ⁇ Val (at position 698 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 551 and 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • substitutions are Asn ⁇ Ser (at position 551 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2) and He ⁇ Val (at position 698 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 67, 207, and 551 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • the substitutions are Glu ⁇ Ala (at position 67 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), Ser ⁇ Gly (at position 207 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), and Asn ⁇ Ser (at position 551 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 67, 207, and 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • the substitutions are Glu ⁇ Ala (at position 67 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), Ser ⁇ Gly (at position 207 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), and He ⁇ Val (at position 698 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 67, 551, and 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • the substitutions are Glu ⁇ Ala (at position 67 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), Asn ⁇ Ser (at position 551 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), and He ⁇ Val (at position 698 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 207, 551, and 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • the substitutions are Ser ⁇ Gly (at position 207 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), Asn ⁇ Ser (at position 551 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), and He ⁇ Val (at position 698 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9A, and comprises substitution of amino acids 67, 207, 551, and 698 of the amino acid sequence depicted in FIG. 9A, or the corresponding amino acids of an AAV capsid of an AAV serotype other than AAV2.
  • the substitutions are Glu ⁇ Ala (at position 67 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), Ser ⁇ Gly (at position 207 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), Asn ⁇ Ser (at position 551 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2), and He ⁇ Val (at position 698 of AAV2; or a corresponding position in an AAV capsid of a serotype other than AAV2).
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) comprises an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%, amino acid sequence identity to the AAV2 capsid amino acid sequence depicted in FIG. 9B, and comprises A67, G207, S551, and V698, based on the amino acid numbering depicted in FIG. 9B.
  • a variant capsid polypeptide of the present disclosure (which may be present in an rAAV virion of the present disclosure) is a chimeric capsid, e.g., the capsid comprises a portion of an AAV capsid of a first AAV serotype and a portion of an AAV capsid of a second serotype; and comprises one or more amino acid substitutions as set forth above.
  • Those skilled in the art can readily identify a "corresponding position in an AAV capsid of a serotype other than AAV2.” For example, by inspection of an amino acid sequence alignment, a person of ordinary skill in the art can identify a "corresponding position in an AAV capsid of a serotype other than AAV2.”
  • E67 of the AAV2 capsid amino acid sequence depicted in FIG. 9A corresponds to R66 of the AAV5 capsid amino acid sequence depicted in FIG. 12.
  • S207 of the AAV2 capsid amino acid sequence depicted in FIG. 9 A corresponds to G 197 of the AAV5 capsid amino acid sequence depicted in FIG. 12.
  • N551 of the AAV2 capsid amino acid sequence depicted in FIG. 9A corresponds to Y542 of the AAV5 capsid amino acid sequence depicted in FIG. 12.
  • 1698 of the AAV2 capsid amino acid sequence depicted in FIG. 9A corresponds to 1687 of the AAV5 capsid amino acid sequence depicted in FIG. 12.
  • the present disclosure provides a recombinant AAV (rAAV) virion that comprises: i) a variant AAV capsid of the present disclosure; and ii) a heterologous nucleic acid.
  • a variant capsid protein of the present disclosure when present in an rAAV virion, provides for greater infectivity of a cardiac cell (e.g., a cardiac fibroblast; a cardiomyocyte) compared to a control or parental AAV (e.g., compared to a wild-type AAV, e.g., compared to wild-type AAV2).
  • An rAAV virion of the present disclosure exhibits at least 2-fold, at least 5 -fold, at least 10- fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or more than 50-fold, increased infectivity of a cardiac cell, compared to the infectivity of the cardiac cell by an AAV virion comprising the corresponding parental AAV capsid protein.
  • an rAAV virion of the present disclosure exhibits at least 2-fold, at least 5-fold, at least 10- fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or more than 50-fold, increased infectivity of a cardiac fibroblast cell, compared to the infectivity of the cardiac fibroblast cell by an AAV virion comprising the corresponding parental AAV capsid protein.
  • an rAAV virion of the present disclosure exhibits at least 2-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50- fold, or more than 50-fold, increased infectivity of a cardiomyocyte, compared to the infectivity of the cardiomyocyte by an AAV virion comprising the corresponding parental AAV capsid protein.
  • An rAAV virion of the present disclosure comprises a variant AAV capsid protein of the present disclosure.
  • An rAAV virion of the present disclosure is infectious, e.g., an rAAV virion of the present disclosure can infect a cardiac cell (e.g., a cardiac fibroblast;
  • Cardiac cells that can be infected with an rAAV virion of the present disclosure include cardiac fibroblasts and cardiomyocytes.
  • the cardiac fibroblasts are primary cardiac fibroblasts.
  • Suitable cardiac fibroblasts include human cardiac fibroblasts; and cardiac fibroblasts from non-human mammals such as non-human primates, rodents (e.g., mice, rats), lagomorphs (e.g., rabbits), canines (e.g., dogs), felines (e.g., cats), ungulates, and the like.
  • Suitable cardiac fibroblasts include post-natal cardiac fibroblasts. Suitable post-natal cardiac fibroblasts can be from any of a variety of sources.
  • Mammalian postnatal cardiac fibroblasts e.g., human post-natal cardiac fibroblasts, murine (e.g., mouse) post-natal cardiac fibroblasts, rat post-natal cardiac fibroblasts, porcine post-natal cardiac fibroblasts, etc.
  • the post-natal cardiac fibroblasts are human post-natal cardiac fibroblasts.
  • the post-natal cardiac fibroblasts are mouse post-natal cardiac fibroblasts.
  • the post-natal cardiac fibroblasts are rat post-natal cardiac fibroblasts.
  • a "post-natal cardiac fibroblast" refers to a post-natal cardiac fibroblast obtained from a post-natal mammal, or the progeny of a post-natal cardiac fibroblast obtained from a post-natal mammal.
  • Suitable cardiomyocytes include atrial cardiomyocytes.
  • Suitable cardiomyocytes include ventricular cardiomyocytes.
  • Suitable cardiomyocytes include human cardiomyocytes and cardiomyocytes from a non-human mammal (e.g., a rodent (e.g., a rat; a mouse); an ungulate (e.g., a pig, a goat, a sheep, a horse, etc.); a non-human primate; etc.).
  • Suitable cardiomyocytes include primary cardiomyocytes.
  • Suitable cardiomyocytes include diseased cardiomyocytes.
  • Suitable cardiac cardiomyocytes include cardiac cardiomyocytes having a genetic mutation associated with a cardiac disease or disorder.
  • Suitable cardiac fibroblasts include diseased cardiac fibroblasts.
  • Suitable cardiac fibroblasts include diseased cardiac fibroblasts.
  • fibroblasts include cardiac fibroblasts having a genetic mutation associated with a cardiac disease or disorder.
  • Suitable cardiac fibroblasts include ventricular cardiac fibroblasts.
  • Suitable cardiac fibroblasts include atrial cardiac fibroblasts.
  • Suitable cardiac fibroblasts include fetal cardiac fibroblasts, e.g., human fetal cardiac fibroblasts and non-human fetal cardiac fibroblasts.
  • the cardiac cell e.g., cardiac fibroblast; cardiomyocyte
  • the cardiac cell is in vitro.
  • the cardiac cell e.g., cardiac fibroblast; cardiomyocyte
  • the cardiac cell is in vivo.
  • Post-natal cardiac fibroblasts can be derived from tissue of a non-embryonic subject, a neonatal infant, a child, or an adult.
  • Post-natal cardiac fibroblasts can be derived from neonatal or post-natal tissue collected from a subject within the period from birth, including cesarean birth, to death.
  • the post-natal cardiac fibroblasts can be from a subject who is greater than about 10 minutes old, greater than about 1 hour old, greater than about 1 day old, greater than about 1 month old, greater than about 2 months old, greater than about 6 months old, greater than about 1 year old, greater than about 2 years old, greater than about 5 years old, greater than about 10 years old, greater than about 15 years old, greater than about 18 years old, greater than about 25 years old, greater than about 35 years old, >45 years old, >55 years old, >65 years old, >80 years old, ⁇ 80 years old, ⁇ 70 years old, ⁇ 60 years old, ⁇ 50 years old, ⁇ 40 years old, ⁇ 30 years old, ⁇ 20 years old or ⁇ 10 years old.
  • An rAAV virion of the present disclosure comprises a heterologous nucleic acid
  • the gene product is a polypeptide.
  • the gene product is an RNA.
  • an rAAV virion of the present disclosure comprises a heterologous nucleotide sequence encoding both a heterologous nucleic acid gene product and a heterologous polypeptide gene product.
  • the gene product is an RNA
  • the RNA gene product encodes a polypeptide.
  • the gene product is an RNA
  • the RNA gene product does not encode a polypeptide.
  • an rAAV virion of the present disclosure comprises a single heterologous nucleic acid comprising a nucleotide sequence encoding a single heterologous gene product. In some cases, an rAAV virion of the present disclosure comprises a single heterologous nucleic acid comprising a nucleotide sequence encoding two heterologous gene products. Where the single heterologous nucleic acid encodes two heterologous gene products, in some cases, nucleotide sequences encoding the two heterologous gene products are operably linked to the same promoter.
  • nucleotide sequences encoding the two heterologous gene products are operably linked to two different promoters.
  • an rAAV virion of the present disclosure comprises a single heterologous nucleic acid comprising a nucleotide sequence encoding three heterologous gene products.
  • nucleotide sequences encoding the three heterologous gene products are operably linked to the same promoter.
  • nucleotide sequences encoding the three heterologous gene products are operably linked to two or three different promoters.
  • an rAAV virion of the present disclosure comprises two heterologous nucleic acids, each comprising a nucleotide sequence encoding a heterologous gene product.
  • the gene product is a polypeptide -encoding RNA. In some cases, the gene product is an interfering RNA. In some cases, the gene product is an aptamer. In some cases, the gene product is a polypeptide. In some cases, the gene product is a therapeutic polypeptide, e.g., a polypeptide that provides clinical benefit. In some embodiments, the gene product is a site-specific nuclease that provide for site-specific knock-down of gene function. In some embodiments, the gene product is an RNA-guided endonuclease that provides for modification of a target nucleic acid.
  • the gene products are: i) an RNA-guided endonuclease that provides for modification of a target nucleic acid; and ii) a guide RNA that comprises a first segment that binds to a target sequence in a target nucleic acid and a second segment that binds to the RNA-guided endonuclease.
  • the gene products are: i) an RNA-guided endonuclease that provides for modification of a target nucleic acid; ii) a first guide RNA that comprises a first segment that binds to a first target sequence in a target nucleic acid and a second segment that binds to the RNA- guided endonuclease; and iii) a first guide RNA that comprises a first segment that binds to a second target sequence in the target nucleic acid and a second segment that binds to the RNA-guided endonuclease.
  • a nucleotide sequence encoding a heterologous gene product in an rAAV virion of the present disclosure can be operably linked to a promoter.
  • a nucleotide sequence encoding a heterologous gene product in an rAAV virion of the present disclosure can be operably linked to a constitutive promoter, a regulatable promoter, or a cardiac cell- specific promoter.
  • Suitable constitutive promoters include a human elongation factor 1 a- subunit (EFla) promoter, a ⁇ -actin promoter, an a-actin promoter, a ⁇ -glucuronidase promoter, and a ubiquitin promoter.
  • a nucleotide sequence encoding a heterologous gene product in an rAAV virion of the present disclosure is operably linked to a cardiac-specific transcriptional regulator element (TRE), where cardiac-specific TREs include promoters and enhancers.
  • cardiac-specific TREs include, but are not limited to, TREs derived from the following genes: myosin light chain-2 (MLC-2), a- myosin heavy chain (a-MHC), desmin, AE3, cardiac troponin C (cTnC), and cardiac actin.
  • MLC-2 myosin light chain-2
  • a-MHC a- myosin heavy chain
  • desmin desmin
  • AE3 cardiac troponin C
  • cardiac actin cardiac actin
  • a nucleotide sequence encoding a heterologous gene product in an rAAV virion of the present disclosure is operably linked to an a-MHC promoter.
  • a nucleotide sequence encoding a heterologous gene product in an rAAV virion of the present disclosure is operably linked to an MLC-2 promoter. In some cases, a nucleotide sequence encoding a heterologous gene product in an rAAV virion of the present disclosure is operably linked to a cTnT promoter.
  • the gene product is a nucleic acid gene product. In some cases, as
  • the gene product is a guide RNA that binds to an RNA-guided endonuclease.
  • the gene product is an inhibitory nucleic acid that reduces the level of an mRNA and/or a polypeptide gene product in a cardiac cell.
  • the nucleic acid gene product is an interfering RNA that selectively inactivates a transcript encoded by an allele that causes a cardiac disease or disorder.
  • the allele is a myosin heavy chain 7, cardiac muscle, beta (MYH7) allele that comprises a hypertrophic cardiomyopathy-causing mutation.
  • RNAs that selectively inactivate a transcript encoded by an allele that causes hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM) or Left Ventricular Non- Compaction (LVNC), where the allele is a MYL3 (myosin light chain 3, alkali, ventricular, skeletal slow), MYH7, TNNI3 (troponin I type 3 (cardiac)), TNNT2 (troponin T type 2 (cardiac)), TPMl (tropomyosin 1 (alpha) ) or ACTCl allele comprising an HCM-causing, a MYL3 (myosin light chain 3, alkali, ventricular, skeletal slow), MYH7, TNNI3 (troponin I type 3 (cardiac)), TNNT2 (troponin T type 2 (cardiac)), TPMl (tropomyosin 1 (alpha) ) or ACTCl allele comprising an HCM-causing, a
  • DCM-causing or a LVNC-causing mutation See, e.g., U.S. Patent Publication No.
  • a suitable nucleic acid gene product is a microRNA.
  • Suitable micrRNAs include, e.g., mir-1, mir-133, mir-208, mir-143, mir-145, and mir-499.
  • human mir-lb has the following nucleotide sequence: stem-loop:
  • human mir-133 has the following nucleotide sequence: stem-loop:
  • human mir-208 has the following nucleotide sequence: stem-loop:
  • human mir-143 has the following nucleotide sequence: stem-loop:
  • AGC (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU (SEQ ID NO: 1147); mature: GGUGCAGUGCUGCAUCUCUGGU
  • human mir-145 has the following nucleotide sequence: stem-loop:
  • GGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU (SEQ ID NO: 1150); mature: GUCCAGUUUUCCCAGGAAUCCCU (SEQ ID NO: 1151) or
  • human mir-499 has the following nucleotide sequence: stem-loop:
  • the gene product is a polypeptide.
  • the polypeptide gene product is a polypeptide that induces reprogramming of a cardiac fibroblast, to generate an induced cardiomyocyte-like cell (iCM).
  • the polypeptide gene product is a polypeptide that enhances the function of a cardiac cell.
  • the polypeptide gene product is a polypeptide that provides a function that is missing or defective in the cardiac cell.
  • the polypeptide gene product is a genome -editing endonuclease.
  • Functional cardiac proteins include, e.g., cardiac troponin T; a cardiac sarcomeric
  • ⁇ -myosin heavy chain myosin ventricular essential light chain 1 ; myosin ventricular regulatory light chain 2; cardiac a-actin; a-tropomyosin; cardiac
  • troponin I cardiac myosin binding protein C; four-and-a-half LIM protein 1; titin; 5'-AMP- activated protein kinase subunit gamma-2; troponin I type 3, myosin light chain 2, actin alpha cardiac muscle 1 ; cardiac LIM protein; caveolin 3 (CAV3); galactosidase alpha (GLA); lysosomal-associated membrane protein 2 (LAMP2); mitochondrial transfer RNA glycine (MTTG); mitochondrial transfer RNA isoleucine (MTTI); mitochondrial transfer RNA lysine (MTTK); mitochondrial transfer RNA glutamine (MTTQ); myosin light chain 3 (MYL3); troponin C (TNNC1); transthyretin (TTR); sarcoendoplasmic reticulum calcium- ATPase 2a (SERCA2a); stromal-derived factor- 1 (SDF-1); adenylate cyclase-6 (AC6); beta-
  • the polypeptide gene product is a reprogramming factor.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a single reprogramming factor selected from Mef2c, Gata4, Tbx5, Myocd, Esrrg, and Mespl.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Mef2c polypeptide.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Gata4 polypeptide. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Tbx5 polypeptide. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Mef2c polypeptide and a Gata4 polypeptide.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Mef2c polypeptide and a Tbx5 polypeptide. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding only a Mef2c polypeptide and a Tbx5 polypeptide, and no other reprogramming factors. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Gata4 polypeptide and a Tbx5 polypeptide.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding only a Gata4 polypeptide and a Tbx5 polypeptide, and no other reprogramming factors.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Myocd polypeptide.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding an Essrg polypeptide.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Mespl polypeptide. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a MEF2C polypeptide and a Myocd polypeptide. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding only a MEF2C polypeptide and a Myocd polypeptide, and no other reprogramming factors.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a TBX5 polypeptide and a Myocd polypeptide. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding only a TBX5 polypeptide and a Myocd polypeptide, and no other reprogramming factors.
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a MEF2C polypeptide, a TBX5 polypeptide, and a Myocd polypeptide. In some cases, an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising a nucleotide sequence encoding only a MEF2C polypeptide, a TBX5 polypeptide, and a Myocd polypeptide, and no other reprogramming factors.
  • a Gata4 polypeptide is a member of the GATA family zinc-finger transcription factor that recognizes and binds a GATA motif (e.g., recognizes and binds the consensus sequence 5'-AGATAG-3') present in the promoter region of many genes. See, e.g., Huang et al. (1995) Gene 155:219. Amino acid sequences for Gata4 polypeptides, and nucleotide sequences encoding Gata4 polypeptides, from a variety of species are known in the art. See, e.g.: 1) GenBank Accession No. NP_002043.2 (Homo sapiens Gata4 amino acid sequence; and GenBank Accession No.
  • NM_002052 Homo sapiens Gata4-encoding nucleotide sequence; 2) GenBank Accession No. NP_0032118 (Mus musculus Gata4 amino acid sequence); and GenBank Accession No. NM_008092 (Mus musculus Gata4-encoding nucleotide sequence); 3) GenBank Accession No. NP_653331 (Rattus norvegicus Gata4 amino acid sequence); and GenBank Accession No. NM_144730 (Rattus norvegicus Gata4- encoding nucleotide sequence); 4) GenBank Accession No.
  • ABI63575 (Danio rerio Gata4 amino acid sequence; and GenBank Accession No. DQ886664 (Danio rerio Gata4- encoding nucleotide sequence; and 5) GenBank Accession No. AAH71101.1 (Xenopus laevis Gata4 amino acid sequence); and GenBank Accession No. BC071107 (Xenopus laevis Gata4-encoding nucleotide sequence).
  • a suitable Gata4 nucleic acid comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a contiguous stretch of from about 900 nucleotides to about 1000 nucleotides (nt), from about 1000 nt to about 1100 nt, from about 1100 nt to about 1200 nt, or from about 1200 nt to 1329 nt, of the nucleotide sequence depicted in FIG. 20 (SEQ ID NO: 1126).
  • a suitable Gata4 nucleic acid comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a contiguous stretch of from about 900 nucleotides to about 1000 nucleotides (nt), from about 1000 nt to about 1100 nt, from about 1100 nt to about 1200 nt, or from about 1200 nt to 1323 nt, of the nucleotide sequence depicted in FIG. 20 (SEQ ID NO: 1126).
  • a suitable Gata4 nucleic acid comprises a nucleotide sequence encoding a Gata4
  • a suitable Gata4 polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, or from about 400 aa to 442 aa, of the amino acid sequence depicted in FIG. 19 (SEQ ID NO: 1125).
  • a suitable Gata4 polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, or from about 400 aa to 441 aa, of the amino acid sequence depicted in FIG. 19 (SEQ ID NO: 1125).
  • the encoded Gata4 polypeptide is biologically active, e.g., recognizes and binds a GATA motif (e.g., recognizes and binds the consensus sequence 5'-AGATAG-3') present in a promoter; and activates transcription of a gene operably linked to the promoter comprising the GATA motif.
  • a GATA motif e.g., recognizes and binds the consensus sequence 5'-AGATAG-3'
  • polypeptide (or a nucleotide sequence encoding such functional equivalent) is used.
  • a Gata5 polypeptide (or a nucleotide sequence encoding a Gata5 polypeptide) is used.
  • a Gata6 polypeptide (or a nucleotide sequence encoding a Gata6 polypeptide) is used.
  • Gata5 polypeptides and nucleotide sequences encoding Gata5 polypeptides, are known in the art. See, e.g., GenBank Accession Nos.: 1) NP_536721 ⁇ Homo sapiens Gata5 amino acid sequence), and NM_080473 (nucleotide sequence encoding the NP_536721 amino acid sequence); 2) NP_032119 (Mus musculus Gata5 amino acid sequence), and NM_008093 (nucleotide sequence encoding the NP_032119 amino acid sequence); and 3) NP_001019487 (Rattus norvegicus Gata5 amino acid sequence), and NM_001024316 (nucleotide sequence encoding the NP_001019487 amino acid sequence).
  • Gata6 polypeptides and nucleotide sequences encoding Gata6 polypeptides, are known in the art. See, e.g., GenBank Accession Nos.: 1) NP_005248 (Homo sapiens Gata6 amino acid sequence), and NM_005257 (nucleotide sequence encoding the NP_005248 amino acid sequence); 2) NP_062058 (Rattus norvegicus Gata6 amino acid sequence) and NM_019185 (nucleotide sequence encoding the NP_062058 amino acid sequence); 3) NP_034388 (Mus musculus Gata6 amino acid sequence), and NM_010258 (nucleotide sequence encoding the NP_034388 amino acid sequence).
  • a suitable functional equivalent of a Gata4 polypeptide is a
  • polypeptide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence of a Gata5 polypeptide or a Gata6 polypeptide.
  • a suitable nucleotide sequence encoding a functional equivalent of a Gata4 polypeptide comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a nucleotide sequence encoding a Gata5 polypeptide or a Gata6 polypeptide.
  • Mef2c myocyte-specific enhancer factor 2c is a transcription activator that binds
  • Mef2c can include one or more post-translational modifications, e.g., phosphorylation on Ser-59 and Ser-396; sumoylation on Lys-391 ; and acetylation on Lys-4.
  • Mef2c polypeptides from a variety of species are known in the art. See, e.g.: 1) GenBank Accession No. XP_001056692 ⁇ Rattus norvegicus Mef2c amino acid sequence); and GenBank Accession No. XM_001056692 ⁇ Rattus norvegicus Mef2c-encoding nucleotide sequence); 2) GenBank Accession No. NP_079558.1 (Mus musculus Mef2c isoform 2 amino acid sequence); and GenBank Accession No. NM_025282 (Mus musculus Mef2c isoform 2-encoding nucleotide sequence); 3) GenBank Accession No. NP_001164008 (Mus musculus Mef2c isoform 1 amino acid sequence); and GenBank Accession No.
  • NM_001170537 (Mus musculus Mef2c isoform 1-encoding nucleotide sequence); 4) GenBank Accession No. NP_001124477 (Homo sapiens Mef2c isoform 2 amino acid sequence); and GenBank Accession No. NM_001131005 (Homo sapiens Mef2c isoform 2- encoding nucleotide sequence); 5) GenBank Accession No. NP_002388 (Homo sapiens Mef2c isoform 1 amino acid sequence); and GenBank Accession No. NM_002397 (Homo sapiens Mef2c isoform 1-encoding nucleotide sequence).
  • a suitable Mef2c nucleic acid comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a contiguous stretch of from about 900 nucleotides to about 1000 nucleotides (nt), from about 1000 nt to about 1100 nt, from about 1100 nt to about 1200 nt, from about 1200 nt to 1300 nt, or from about 1300 nt to 1392 nt, of the nucleotide sequence depicted in FIG. 22 (SEQ ID
  • a suitable Mefzc nucleic acid comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a contiguous stretch of from about 900 nucleotides to about 1000 nucleotides (nt), from about 1000 nt to about 1100 nt, from about 1100 nt to about 1200 nt, from about 1200 nt to 1300 nt, or from about 1300 nt to 1422 nt, of the nucleotide sequence depicted in FIG. 24 (SEQ ID
  • a suitable Mef2c nucleic acid comprises a nucleotide sequence encoding a Mef2c
  • a suitable Mef2c polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, or from about 400 aa to 463 aa, of the amino acid sequence depicted in FIG. 21 (SEQ ID NO: 1127).
  • the encoded Mef2c polypeptide is biologically active, e.g., recognizes and binds a MEF2C element in a promoter; and activates transcription of a gene operably linked to the promoter.
  • a suitable Mef2c nucleic acid comprises a nucleotide sequence encoding a Mef2c
  • Mef2c polypeptide where a suitable Mef2c polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, or from about 400 aa to 473 aa, of the amino acid sequence depicted in FIG. 23 (SEQ ID NO: 1129).
  • the encoded Mef2c polypeptide is biologically active, e.g., recognizes and binds a MEF2C element in a promoter; and activates transcription of a gene operably linked to the promoter.
  • a Mef2a polypeptide (or a nucleotide sequence encoding a Mef2a polypeptide) is used.
  • a Mef2b polypeptide (or a nucleotide sequence encoding a Mef2b polypeptide) is used.
  • a Mef2d polypeptide (or a nucleotide sequence encoding a Mef2d polypeptide) is used.
  • Mef2a, Me2b, and Mef2d polypeptides are known, as are nucleotide sequences encoding Mef2a, Me2b, and Mef2d polypeptides. See, e.g., GenBank Accession Nos.: 1) NP_005578.2 ⁇ Homo sapiens Mef2a isoform 1 amino acid sequence), and NM_005587 (nucleotide sequence encoding the NP_005578.2 amino acid sequence); 2) NP_001124398.1 ⁇ Homo sapiens Mef2a isoform 2 amino acid sequence), and
  • NM_001130926 (nucleotide sequence encoding the NP_001124398.1 amino acid sequence); 3) NP_001124399.1 ⁇ Homo sapiens Mef2a isoform 3 amino acid sequence), and NM_001130927 (nucleotide sequence encoding the NP_001124399.1 amino acid sequence); 4) NP_001124400.1 ⁇ Homo sapiens Mef2a isoform 4 amino acid sequence), and NM_001130928 (nucleotide sequence encoding the NP_001124400.1 amino acid sequence); 5) NP_001139257.1 ⁇ Homo sapiens Mef2b isoform a amino acid sequence), and NM_001145785 (nucleotide sequence encoding the NP_001139257.1 amino acid sequence); 6) NP_005910.1 ⁇ Homo sapiens Mef2b isoform b amino acid sequence), and NM_005919 (nucleotide sequence
  • NP_001038949.1 Mus musculus Mef2b isoform 2 amino acid sequence
  • NM_001045484 (nucleotide sequence encoding the NP_001038949.1 amino acid sequence); 9) NP_005911.1 ⁇ Homo sapiens Mef2d amino acid sequence), and NM_005920 (nucleotide sequence encoding the NP_005911.1 amino acid sequence); and 10)
  • NP_598426.1 ⁇ Mus musculus Mef2d amino acid sequence
  • NM_133665 nucleotide sequence encoding the NP_598426.1 amino acid sequence
  • a suitable functional equivalent of a Mef2c polypeptide is a
  • polypeptide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence of a Mef2a polypeptide, a Mef2b polypeptide, or a Mef2d
  • a suitable nucleotide sequence encoding a functional equivalent of a Mef2c polypeptide comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a nucleotide sequence encoding a Mef2a polypeptide, a Mef2b polypeptide, or a Mef2d polypeptide.
  • Tbx5 (T-box transcription factor 5) is a transcription factor that binds to an recognizes a T-box (e.g., an element having the consensus sequence 5'-(A/G)GGTGT-3') in the promoter region of some genes; and activates transcription of genes operably linked to such promoters.
  • T-box e.g., an element having the consensus sequence 5'-(A/G)GGTGT-3'
  • Tbx5 polypeptides and nucleotide sequences encoding Tbx5 polypeptides, from a variety of species are known in the art. See, e.g.: 1) GenBank Accession No. CAA70592.1 ⁇ Homo sapiens Tbx5 amino acid sequence); and GenBank Accession No. Y09445 ⁇ Homo sapiens Tbx5-encoding nucleotide sequence); 2) GenBank Accession No. NP_000183 ⁇ Homo sapiens Tbx5 amino acid sequence); and GenBank Accession No. NM_000192 ⁇ Homo sapiens Tbx5-encoding nucleotide sequence); 3) GenBank Accession No.
  • NP_001009964.1 ⁇ Rattus norvegicus Tbx5 amino acid sequence
  • GenBank Accession No. NM_001009964 ⁇ Rattus norvegicus Tbx5-encoding nucleotide sequence
  • GenBank Accession No. NP_035667 ⁇ Mus musculus Tbx5 amino acid sequence
  • NM_011537 ⁇ Mus musculus Tbx5-encoding nucleotide sequence
  • GenBank Accession No. NM_001085701 ⁇ Xenopus laevis Tbx5-encoding nucleotide sequence).
  • a suitable Tbx5 nucleic acid comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a contiguous stretch of from about 900 nucleotides to about 1000 nucleotides (nt), from about 1200 nt to 1300 nt, from about 1300 nt to about 1400 nt, or from about 1400 nt to about 1500 nt, or from about 1500 nt to 1542 nt of the nucleotide sequence depicted in FIG. 19 (SEQ ID NO: 1125).
  • a suitable Tbx5 nucleic acid comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to a contiguous stretch of from about 900 nucleotides to about 1000 nucleotides (nt), from about 1200 nt to 1300 nt, from about 1300 nt to about 1400 nt, or from about 1400 nt to about 1500 nt, or from about 1500 nt to 1557, of the nucleotide sequence depicted in FIG. 28 (SEQ ID NO: 1134).
  • a suitable Tbx5 nucleic acid comprises a nucleotide sequence encoding a Tbx5
  • a suitable Tbx5 polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, from about 400 aa to about 500 aa, or from about 500 aa to 513 aa, of the amino acid sequence depicted in FIG. 25 (SEQ ID NO: 1131).
  • a suitable Tbx5 polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, from about 400 aa to about 500 aa, or from about 500 aa to 518 aa, of the amino acid sequence depicted in FIG. 25 (SEQ ID NO: 1131).
  • the encoded Tbx5 polypeptide is biologically active, e.g., recognizes and binds a Tbx5 binding site (e.g., an element having the consensus sequence 5'-(A/G)GGTGT-3') in a promoter; and activates transcription of a gene operably linked to the promoter.
  • a Tbx5 binding site e.g., an element having the consensus sequence 5'-(A/G)GGTGT-3'
  • a suitable Tbx5 nucleic acid comprises a nucleotide sequence encoding a Tbx5
  • a suitable Tbx5 polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, from about 400 aa to about 500 aa, or from about 500 aa to 518 aa, of the amino acid sequence depicted in FIG. 27 (SEQ ID NO: 1133).
  • the encoded Tbx5 polypeptide is biologically active, e.g., recognizes and binds a Tbx5 binding site (e.g., an element having the consensus sequence 5'-(A/G)GGTGT-3') in a promoter; and activates transcription of a gene operably linked to the promoter.
  • a Tbx5 binding site e.g., an element having the consensus sequence 5'-(A/G)GGTGT-3'
  • an rAAV virion of the present disclosure comprises a heterologous nucleic acid comprising nucleotide sequences encoding 2 reprogramming factors
  • the heterologous nucleic acid comprises: i) a first nucleotide sequence encoding a first reprogramming factor; and ii) a second nucleotide sequence encoding a second
  • the first reprogramming factor is a Mef2c polypeptide and the second reprogramming factor is a Tbx5 polypeptide. In some cases, the first reprogramming factor is a Mef2c polypeptide and the second reprogramming factor is a Gata4 polypeptide. In some cases, the first reprogramming factor is a Gata4 polypeptide and the second reprogramming factor is a Tbx5 polypeptide. In some cases, an internal ribosome entry site (IRES) is interposed between the first nucleotide sequence and the second nucleotide sequence.
  • IRS internal ribosome entry site
  • a nucleotide sequence encoding a "self- cleaving" peptide (also referred to as a "ribosome skip” peptide) is interposed between the first nucleotide sequence and the second nucleotide sequence.
  • the self- cleaving peptide comprises the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO: 1135).
  • the self-cleaving peptide comprises the amino acid sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO: 1136).
  • the self-cleaving peptide comprises the amino acid sequence QCTNYALLKLAGDVESNPGP (SEQ ID NO: 1137).
  • Esrrg polypeptide functions as a transcription activator in the absence of bound ligand; and binds specifically to an estrogen response element. See, e.g., Wang et al. (2006) /. Biol. Chem. 281 :37773; Greschik et al. (2002) Mol. Cell 9:303; and Hong et al. (1999) /. Biol. Chem. llA-.llblZ.
  • GenBank Accession No. NP001127757.1 ⁇ Homo sapiens 435 amino acid Esrrg); and GenBank Accession No. NM_001134285.2 (nucleotide sequence encoding the Homo sapiens 435 amino acid Esrrg); 2) GenBank Accession No. NP_001429 ⁇ Homo sapiens 458 amino acid Esrrg); and GenBank Accession No. NM_001438.2 (nucleotide sequence encoding the Homo sapiens 458 amino acid Esrrg); 3) GenBank Accession No. CAH70619 ⁇ Homo sapiens 442 amino acid Esrrg); 4) GenBank Accession No.
  • AAH08218 ⁇ Homo sapiens 343 amino acid Esrrg); and BC008218 (nucleotide sequence encoding the Homo sapiens 343 amino acid Esrrg); 5) GenBank Accession No. NP_036065 ⁇ Mus musculus 458 amino acid Esrrg); and GenBank Accession No. NM_011935 (nucleotide sequence encoding the Mus musculus 458 amino acid Esrrg); 6) GenBank Accession No. EDL13041 ⁇ Mus musculus 435 amino acid Esrrg); 7) GenBank Accession No. NP_976081 ⁇ Rattus norvegicus 435 amino acid Esrrg); and GenBank Accession No. NM_203336 (nucleotide sequence encoding the Rattus norvegicus 435 amino acid Esrrg); 8) GenBank Accession No.
  • AY341017 (nucleotide sequence encoding the Rattus norvegicus 458 amino acid Esrrg); 9) GenBank Accession No. DAA21449 ⁇ Bos taurus 435 amino acid Esrrg); and GenBank Accession No. GJ062474 (nucleotide sequence encoding the Bos taurus 435 amino acid Esrrg); 10) GenBank Accession No. DAA21448 ⁇ Bos taurus 458 amino acid Esrrg).
  • a suitable Esrrg nucleic acid comprises a nucleotide sequence encoding a Esrrg
  • a suitable Esrrg polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, or from about 400 aa to 435 aa, of the amino acid sequence depicted in FIG. 29B (SEQ ID NO: 1157).
  • a suitable Esrrg polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, or from about 400 aa to 435 aa, of the amino acid sequence depicted in FIG. 29B (SEQ ID NO: 1157).
  • the encoded Esrrg polypeptide is biologically active, e.g., specifically to an estrogen response element.
  • a suitable Esrrg nucleic acid comprises a nucleotide sequence encoding a Esrrg
  • a suitable Esrrg polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 400 aa, or from about 400 aa to 460 aa, of the amino acid sequence depicted in FIG. 29A (SEQ ID NO: 1156).
  • a suitable Esrrg polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 350 amino acids (aa) to about 460 aa, from about 400 aa to 450 aa, or 458 aa, of the amino acid sequence depicted in FIG. 29A (SEQ ID NO: 1156).
  • the encoded Esrrg polypeptide is biologically active, e.g., specifically to an estrogen response element.
  • a suitable Mespl nucleic acid comprises a nucleotide sequence encoding a Mespl polypeptide, where in some embodiments, a suitable Mespl polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 200 amino acids (aa) to about 250 aa, or from about 250 aa to 268 aa, of the amino acid sequence depicted in FIG. 30 (SEQ ID NO: 1158).
  • the encoded Mespl polypeptide is biologically active.
  • a suitable Myocd nucleic acid comprises a nucleotide sequence encoding a Myocd polypeptide, where in some embodiments, a suitable Myocd polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 600 amino acids (aa) to about 850 aa, from about 850 aa to 900 aa, from about 900 aa to 930 aa, or 938 aa, of the amino acid sequence depicted in FIG. 31A (SEQ ID NO: 1159).
  • NP_001139785.1 isoform 3; 684 amino acids
  • NP_001139784.1 isoform 1 ; 986 amino acids
  • NP_705832.1 isoform 2; 938 amino acids.
  • a suitable Myocd nucleic acid comprises a nucleotide sequence encoding a Myocd polypeptide, where in some embodiments, a suitable Myocd polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a contiguous stretch of from about 680 amino acids (aa) to about 986 aa, of the amino acid sequence depicted in FIG. 31B (SEQ ID NO: 1160).
  • the encoded Myocd polypeptide is biologically active.
  • a gene product of interest is a site-specific endonuclease that provide for site-specific knock-down of gene function, e.g., where the endonuclease knocks out an allele associated with a cardiac disease or disorder.
  • a site-specific endonuclease can be targeted to the defective allele and knock out the defective allele.
  • a site-specific endonuclease is an RNA-guided endonuclease.
  • a site-specific nuclease can also be used to stimulate homologous recombination with a donor DNA that encodes a functional copy of the protein encoded by the defective allele.
  • a subject rAAV virion can be used to deliver both a site-specific endonuclease that knocks out a defective allele, and can be used to deliver a functional copy of the defective allele, resulting in repair of the defective allele, thereby providing for production of a functional cardiac protein (e.g., functional troponin; etc.).
  • a subject rAAV virion comprises a heterologous nucleotide sequence that encodes a site-specific endonuclease; and a heterologous nucleotide sequence that encodes a functional copy of a defective allele, where the functional copy encodes a functional cardiac protein.
  • Functional cardiac proteins include, e.g., troponin, a chloride ion channel, and the like.
  • Functional cardiac proteins include, e.g., cardiac troponin T; a cardiac sarcomeric protein; ⁇ -myosin heavy chain; myosin ventricular essential light chain 1 ; myosin ventricular regulatory light chain 2; cardiac a-actin; a-tropomyosin; cardiac troponin I; cardiac myosin binding protein C; four-and-a-half LIM protein 1; titin; 5'-AMP- activated protein kinase subunit gamma-2; troponin I type 3, myosin light chain 2, actin alpha cardiac muscle 1 ; cardiac LIM protein; caveolin 3 (CAV3); galactosidase alpha (GLA); lysosomal-associated membrane protein 2 (LAMP2); mitochondrial transfer RNA glycine (MTTG); mitochondrial transfer RNA isoleucine (MTTI); mitochondrial transfer RNA lysine (MTTK); mitochondrial transfer RNA glutamine (MTTQ); myosin light chain 3 (M
  • Site-specific endonucleases that are suitable for use include, e.g., zinc finger nucleases (ZFNs); meganucleases; and transcription activator-like effector nucleases (TALENs), where such site-specific endonucleases are non-naturally occurring and are modified to target a specific gene.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • site-specific endonucleases can be engineered to cut specific locations within a genome, and non-homologous end joining can then repair the break while inserting or deleting several nucleotides.
  • site-specific endonucleases also referred to as "INDELs” then throw the protein out of frame and effectively knock out the gene. See, e.g., U.S. Patent Publication No.
  • Suitable site-specific endonucleases include engineered meganuclease re-engineered homing endonucleases.
  • Suitable endonucleases include an I-Tevl nuclease.
  • Suitable meganucleases include I-Scel (see, e.g., Bellaiche et al. (1999) Genetics 152: 1037); and I-Crel (see, e.g., Heath et al. (1997) Nature Sructural Biology 4:468).
  • Site-specific endonucleases that are suitable for use include CRISPRi systems and the Cas9-based SAM system.
  • the gene product is an RNA-guided endonuclease.
  • the gene product is an RNA comprising a nucleotide sequence encoding an RNA-guided endonuclease.
  • the gene product is a guide RNA, e.g., a single -guide RNA.
  • the gene products are: 1) a guide RNA; and 2) an RNA-guided endonuclease.
  • the guide RNA can comprise: a) a protein-binding region that binds to the RNA-guided endonuclease; and b) a region that binds to a target nucleic acid.
  • An RNA-guided endonuclease is also referred to herein as a "genome editing nuclease.”
  • Suitable genome editing nucleases are CRISPR/Cas endonucleases (e.g., class 2 CRISPR/Cas endonucleases such as a type II, type V, or type VI CRISPR/Cas endonucleases).
  • a suitable genome editing nuclease is a CRISPR/Cas endonuclease (e.g., a class 2 CRISPR/Cas endonuclease such as a type II, type V, or type VI CRISPR/Cas endonuclease).
  • a genome targeting composition includes a class 2
  • a genome targeting composition includes a class 2 type II CRISPR/Cas endonuclease (e.g., a Cas9 protein).
  • a genome targeting composition includes a class 2 type V CRISPR/Cas endonuclease (e.g., a Cpfl protein, a C2cl protein, or a C2c3 protein).
  • a genome targeting composition includes a class 2 type VI CRISPR/Cas endonuclease (e.g., a C2c2 protein; also referred to as a "Casl3a" protein).
  • a CasX protein is also suitable for use.
  • a genome editing nuclease is a fusion protein that is fused to a heterologous polypeptide (also referred to as a "fusion partner").
  • a genome editing nuclease is fused to an amino acid sequence (a fusion partner) that provides for subcellular localization, i.e., the fusion partner is a subcellular localization sequence (e.g., one or more nuclear localization signals (NLSs) for targeting to the nucleus, two or more NLSs, three or more NLSs, etc.).
  • a fusion partner e.g., one or more nuclear localization signals (NLSs) for targeting to the nucleus, two or more NLSs, three or more NLSs, etc.
  • the genome-editing endonuclease is a Type II CRISPR/Case
  • the genome -editing endonuclease is a Cas9 polypeptide.
  • the Cas9 protein is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g., a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.) by virtue of its association with the protein-binding segment of the Cas9 guide RNA.
  • a target nucleic acid sequence e.g., a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.
  • a Cas9 polypeptide comprises an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more than 99%, amino acid sequence identity to the Streptococcus pyogenes Cas9 depicted in FIG. 8A.
  • the Cas9 polypeptide used in a composition or method of the present disclosure is a Staphylococcus aureus Cas9 (saCas9) polypeptide.
  • the saCas9 polypeptide comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, amino acid sequence identity to the saCas9 amino acid sequence depicted in FIG. 8B.
  • a suitable Cas9 polypeptide is a high-fidelity (HF) Cas9 polypeptide.
  • amino acids N497, R661, Q695, and Q926 of the amino acid sequence depicted in FIG. 8A are substituted, e.g., with alanine.
  • an HF Cas9 polypeptide can comprise an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100%, amino acid sequence identity to the amino acid sequence depicted in FIG. 8A, where amino acids N497, R661, Q695, and Q926 are substituted, e.g., with alanine.
  • a suitable Cas9 polypeptide exhibits altered PAM specificity. See, e.g., Kleinstiver et al. (2015) Nature 523:481.
  • the genome-editing endonuclease is a type V CRISPR/Cas endonuclease.
  • a type V CRISPR/Cas endonuclease is a Cpfl protein.
  • a Cpf 1 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence depicted in FIG. 8C.
  • the genome-editing endonuclease is a CasX or a CasY polypeptide.
  • CasX and CasY polypeptides are described in Burstein et al. (2017) Nature 542:237 '.
  • RNA-guided endonuclease with reduced enzymatic activity.
  • RNA-guided endonuclease is referred to as a "dead” RNA-guided endonuclease; for example, a Cas9 polypeptide that comprises certain amino acid substitutions such that it exhibits substantially no endonuclease activity, but such that it still binds to a target nucleic acid when complexed with a guide RNA, is referred to as a “dead” Cas9 or "dCas9.”
  • a "dead” Cas9 protein has a reduced ability to cleave both the complementary and the non-complementary strands of a double stranded target nucleic acid.
  • a "nuclease defective" Cas9 lacks a functioning RuvC domain (i.e., does not cleave the non- complementary strand of a double stranded target DNA) and lacks a functioning HNH domain (i.e., does not cleave the complementary strand of a double stranded target DNA).
  • the nuclease defective Cas9 protein harbors mutations at amino acid positions corresponding to residues D10 and H840 (e.g., DIOA and H840A) of SEQ ID NO: 15 (or the corresponding residues of a homolog of Cas9) such that the polypeptide has a reduced ability to cleave (e.g., does not cleave) both the
  • Such a Cas9 protein has a reduced ability to cleave a target nucleic acid (e.g., a single stranded or double stranded target nucleic acid) but retains the ability to bind a target nucleic acid.
  • a target nucleic acid e.g., a single stranded or double stranded target nucleic acid
  • a Cas9 protein that cannot cleave target nucleic acid is referred to as a "nuclease defective Cas9", “dead Cas9” or simply “dCas9.”
  • Other residues can be mutated to achieve the above effects (i.e. inactivate one or the other nuclease portions).
  • residues D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, and/or A987 of Streptococcus pyogenes Cas9 can be altered (i.e., substituted).
  • two or more of D10, E762, H840, N854, N863, and D986 of Streptococcus pyogenes Cas9 are substituted.
  • D10 and N863 of Streptococcus pyogenes Cas9 are substituted with Ala.
  • mutations other than alanine substitutions are suitable.
  • the genome-editing endonuclease is an RNA-guided endonuclease (and it corresponding guide RNA) known as Cas9-synergistic activation mediator (Cas9-SAM).
  • Cas9-SAM Cas9-synergistic activation mediator
  • RNA-guided endonuclease (e.g., Cas9) of the Cas9-SAM system is a "dead" Cas9 fused to a transcriptional activation domain (wherein suitable transcriptional activation domains include, e.g., VP64, p65, MyoDl, HSF1, RTA, and SET7/9) or a transcriptional repressor domain (where suitable transcriptional repressor domains include, e.g., a KRAB domain, a NuE domain, an NcoR domain, a SID domain, and a SID4X domain).
  • the guide RNA of the Cas9-SAM system comprises a loop that binds an adapter protein fused to a transcriptional activator domain (e.g., VP64, p65, MyoDl, HSF1, RTA, or SET7/9) or a transcriptional repressor domain (e.g., a KRAB domain, a NuE domain, an NcoR domain, a SID domain, or a SID4X domain).
  • a transcriptional activator domain e.g., VP64, p65, MyoDl, HSF1, RTA, or SET7/9
  • a transcriptional repressor domain e.g., a KRAB domain, a NuE domain, an NcoR domain, a SID domain, or a SID4X domain.
  • the guide RNA is a single- guide RNA comprising an MS2 RNA aptamer inserted into one or two loops of the sgRNA;
  • the dCas9 is a fusion polypeptide comprising dCas9 fused to VP64;
  • adaptor/functional protein is a fusion polypeptide comprising: i) MS2; ii) p65; and iii) HSF1. See, e.g., U.S. Patent Publication No. 2016/0355797.
  • a chimeric polypeptide comprising: a) a dead RNA-guided
  • heterologous fusion polypeptide examples include a polypeptide having, e.g., methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, DNA cleavage activity, DNA integration activity, or nucleic acid binding activity.
  • a nucleic acid that binds to a class 2 CRISPR/Cas endonuclease e.g., a Cas9 protein; a type V or type VI CRISPR/Cas protein; a Cpfl protein; etc.
  • a guide RNA or "CRISPR/Cas guide nucleic acid” or "CRISPR/Cas guide RNA.”
  • a guide RNA provides target specificity to the complex (the RNP complex) by including a targeting segment, which includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence that is complementary to a sequence of a target nucleic acid.
  • a guide RNA includes two separate nucleic acid molecules: an "activator” and a “targeter” and is referred to herein as a “dual guide RNA", a “double-molecule guide RNA”, a “two-molecule guide RNA”, or a “dgRNA.”
  • the guide RNA is one molecule (e.g., for some class 2 CRISPR/Cas proteins, the corresponding guide RNA is a single molecule; and in some cases, an activator and targeter are covalently linked to one another, e.g., via intervening nucleotides), and the guide RNA is referred to as a "single guide RNA", a “single-molecule guide RNA,” a “one -molecule guide RNA”, or simply "sgRNA.”
  • the gene product is an RNA-guided endonuclease, or is both an RNA-guided endonuclease and a guide RNA
  • the gene product can modify a target nucleic acid.
  • a target nucleic acid comprises a deleterious mutation in a defective allele (e.g., a deleterious mutation in a retinal cell target nucleic acid)
  • the RNA-guided endonuclease/guide RNA complex together with a donor nucleic acid comprising a nucleotide sequence that corrects the deleterious mutation (e.g., a donor nucleic acid comprising a nucleotide sequence that encodes a functional copy of the protein encoded by the defective allele), can be used to correct the deleterious mutation, e.g., via homology- directed repair (HDR).
  • HDR homology- directed repair
  • the gene products are: i) an RNA-guided endonuclease; and ii) one guide RNA.
  • the guide RNA is a single-molecule (or “single guide”) guide RNA (an “sgRNA”).
  • the guide RNA is a dual-molecule (or “dual-guide”) guide RNA (“dgRNA").
  • the gene products are: i) an RNA-guided endonuclease; and ii) 2 separate sgRNAs, where the 2 separate sgRNAs provide for deletion of a target nucleic acid via nonhomologous end joining (NHEJ).
  • the guide RNAs are sgRNAs.
  • the guide RNAs are dgRNAs.
  • the gene products are: i) a Cpf 1 polypeptide; and ii) a guide RNA
  • the precursor in these cases, can be cleaved by the Cpf 1 polypeptide to generate
  • RNA-mediated adaptive immune systems in bacteria and archaea rely on Clustered
  • a genome editing nuclease of a genome targeting composition of the present disclosure is a class 2 CRISPR/Cas endonuclease.
  • a subject genome targeting composition includes a class 2 CRISPR/Cas endonuclease
  • the functions of the effector complex are carried out by a single endonuclease
  • CRISPR/Cas protein is used herein to encompass the endonuclease (the target nucleic acid cleaving protein) from class 2 CRISPR systems.
  • class 2 CRISPR/Cas endonuclease encompasses type II CRISPR/Cas proteins (e.g., Cas9); type
  • V-A CRISPR/Cas proteins e.g., Cpfl (also referred to a "Casl2a"); type V-B
  • CRISPR/Cas proteins e.g., C2cl (also referred to as “Casl2b")); type V-C CRISPR/Cas proteins (e.g., C2c3 (also referred to as “Casl2c”)); type V-Ul CRISPR Cas proteins (e.g., C2c4); type V-U2 CRISPR/Cas proteins (e.g., C2c8); type V-U5 CRISPR/Cas proteins (e.g., C2c5); type V-U4 CRISPR/Cas proteins (e.g., C2c9); type V-U3 CRISPR/Cas proteins (e.g., C2cl0); type VI-A CRISPR/Cas proteins (e.g., C2c2 (also known as "Casl3a”)); type VI-B CRISPR/Cas proteins (e.g., Casl3b (also known as C2c
  • CRISPR/Cas proteins encompass type II, type V, and type VI CRISPR/Cas proteins, but the term is also meant to encompass any class 2 CRISPR/Cas protein suitable for binding to a corresponding guide RNA and forming an RNP complex.
  • Type II CRISPR/Cas endonucleases e.g., Cas 9
  • Cas9 functions as an RNA-guided
  • RNA endonuclease that uses a dual-guide RNA having a crRNA and iraws-activating crRNA (tracrRNA) for target recognition and cleavage by a mechanism involving two nuclease active sites in Cas9 that together generate double-stranded DNA breaks (DSBs), or can individually generate single-stranded DNA breaks (SSBs).
  • the Type II CRISPR endonuclease Cas9 and engineered dual- (dgRNA) or single guide RNA (sgRNA) form a ribonucleoprotein (RNP) complex that can be targeted to a desired DNA sequence.
  • Cas9 Guided by a dual-RNA complex or a chimeric single-guide RNA, Cas9 generates site-specific DSBs or SSBs within double-stranded DNA (dsDNA) target nucleic acids, which are repaired either by non-homologous end joining (NHEJ) or homology-directed
  • HDR recombination
  • a genome targeting composition of the present disclosure includes a type II CRISPR/Cas endonuclease.
  • a type II CRISPR/Cas endonuclease is a type of class 2 CRISPR/Cas endonuclease.
  • the type II CRISPR/Cas endonuclease is a Cas9 protein.
  • a Cas9 protein forms a complex with a Cas9 guide RNA.
  • the guide RNA provides target specificity to a Cas9-guide RNA complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein).
  • the Cas9 protein of the complex provides the site-specific activity.
  • the Cas9 protein is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g. a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.) by virtue of its association with the protein-binding segment of the Cas9 guide RNA.
  • a target nucleic acid sequence e.g. a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.
  • a Cas9 protein can bind and/or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and/or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail)(e.g., when the Cas9 protein includes a fusion partner with an activity).
  • the Cas9 protein is a naturally-occurring protein (e.g., naturally occurs in bacterial and/or archaeal cells).
  • the Cas9 protein is not a naturally-occurring polypeptide (e.g., the Cas9 protein is a variant Cas9 protein, a chimeric protein, and the like).
  • Cas9 proteins include, but are not limited to, those set forth in SEQ ID NOs: 5-816.
  • Naturally occurring Cas9 proteins bind a Cas9 guide RNA, are thereby directed to a specific sequence within a target nucleic acid (a target site), and cleave the target nucleic acid (e.g., cleave dsDNA to generate a double strand break, cleave ssDNA, cleave ssRNA, etc.).
  • a chimeric Cas9 protein is a fusion protein comprising a Cas9 polypeptide that is fused to a heterologous protein (referred to as a fusion partner), where the heterologous protein provides an activity (e.g., one that is not provided by the Cas9 protein).
  • the fusion partner can provide an activity, e.g., enzymatic activity (e.g., nuclease activity, activity for DNA and/or RNA methylation, activity for DNA and/or RNA cleavage, activity for histone acetylation, activity for histone methylation, activity for RNA modification, activity for RNA -binding, activity for RNA splicing etc.).
  • a portion of the Cas9 protein exhibits reduced nuclease activity relative to the corresponding portion of a wild type Cas9 protein (e.g., in some cases the Cas9 protein is a nickase).
  • the Cas9 protein is enzymatically inactive, or has reduced enzymatic activity relative to a wild-type Cas9 protein (e.g., relative to Streptococcus pyogenes Cas9).
  • Assays to determine whether given protein interacts with a Cas9 guide RNA can be any convenient binding assay that tests for binding between a protein and a nucleic acid. Suitable binding assays (e.g., gel shift assays) will be known to one of ordinary skill in the art (e.g., assays that include adding a Cas9 guide RNA and a protein to a target nucleic acid).
  • Assays to determine whether a protein has an activity can be any convenient assay (e.g., any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage).
  • Suitable assays e.g., cleavage assays will be known to one of ordinary skill in the art and can include adding a Cas9 guide RNA and a protein to a target nucleic acid.
  • a chimeric Cas9 protein includes a heterologous polypeptide that has enzymatic activity that modifies target nucleic acid (e.g., nuclease activity,
  • methyltransferase activity demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity or glycosylase activity).
  • a chimeric Cas9 protein includes a heterologous polypeptide that has enzymatic activity that modifies a polypeptide (e.g., a histone) associated with target nucleic acid (e.g., methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylating activity, deSUMOylating activity, ribosylation activity, deribosylation activity, myristoylation activity or demyristoylation activity).
  • a polypeptide e.g., a histone
  • target nucleic acid e.g., methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity,
  • RuvC/RNaseH domain e.g., RuvCI, RuvCII, and RuvCIII
  • a Cas9 protein can have 3 different regions (sometimes referred to as RuvC-I, RuvC-II, and RucC-III), that are not contiguous with respect to the primary amino acid sequence of the Cas9 protein, but fold together to form a RuvC domain once the protein is produced and folds.
  • Cas9 proteins can be said to share at least 4 key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC like motifs while motif 3 is an HNH- motif.
  • the motifs set forth in Table 1 may not represent the entire RuvC-like and/or HNH domains as accepted in the art, but Table 1 does present motifs that can be used to help determine whether a given protein is a Cas9 protein.
  • Table 1 lists 4 motifs that are present in Cas9 sequences from various species.
  • amino acids listed in Table 1 are from the Cas9 from 5.
  • pyogenes SEQ ID NO: 5).
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 as set forth in SEQ ID NOs: 1-4, respectively (e.g., see Table 1), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 5- 816.
  • a suitable Cas9 polypeptide comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5 (e.g., the sequences set forth in SEQ ID NOs: 1-4, e.g., see Table 1), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6- 816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4
  • motifs each of motifs 1-4 having 60% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 70% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 75% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 80% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 85% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 90% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 95% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 99% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • Any Cas9 protein as defined above can be used as a Cas9 polypeptide, as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), any of which can be used in an RNP of the present disclosure.
  • a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • Any Cas9 protein as defined above can be used as a Cas9 polypeptide, as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), any of which can be used in an RNP of the present disclosure.
  • a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6- 816.
  • a suitable Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • Any Cas9 protein as defined above can be used as a Cas9 polypeptide, as part of a chimeric Cas9 polypeptide (e.g., a Cas9 fusion protein), any of which can be used in an RNP of the present disclosure.
  • a Cas9 protein comprises 4 motifs (as listed in Table 1), at least one with (or each with) amino acid sequences having 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to each of the 4 motifs listed in Table 1 (SEQ ID NOs: 1-4), or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • Examples of various Cas9 proteins (and Cas9 domain structure) and Cas9 guide RNAs (as well as information regarding requirements related to protospacer adjacent motif (PAM) sequences present in targeted nucleic acids) can be found in the art, for example, see Jinek et al., Science. 2012 Aug 17;337(6096):816-21 ; Chylinski et al., RNA Biol. 2013 May;10(5):726-37; Ma et al., Biomed Res Int. 2013;2013:270805; Hou et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39): 15644-9; Jinek et al., Elife. 2013;2:e00471;
  • a Cas9 protein is a variant Cas9 protein.
  • a variant Cas9 protein has an amino acid sequence that is different by at least one amino acid (e.g., has a deletion, insertion, substitution, fusion) when compared to the amino acid sequence of a
  • the variant Cas9 protein has an amino acid change (e.g., deletion, insertion, or substitution) that reduces the nuclease activity of the Cas9 protein.
  • the variant Cas9 protein has 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, or 1% or less of the nuclease activity of the corresponding wild-type Cas9 protein. In some cases, the variant Cas9 protein has no substantial nuclease activity.
  • a Cas9 protein When a Cas9 protein is a variant Cas9 protein that has no substantial nuclease activity, it can be referred to as a nuclease defective Cas9 protein or "dCas9" for "dead” Cas9.
  • a protein e.g., a class 2 CRISPR/Cas protein, e.g., a Cas9 protein
  • nickase e.g., a "nickase Cas9”
  • a variant Cas9 protein can cleave the complementary strand (sometimes referred to in the art as the target strand) of a target nucleic acid but has reduced ability to cleave the non-complementary strand (sometimes referred to in the art as the non-target strand) of a target nucleic acid.
  • the variant Cas9 protein can have a mutation (amino acid substitution) that reduces the function of the RuvC domain.
  • the Cas9 protein can be a nickase that cleaves the complementary strand, but does not cleave the non-complementary strand.
  • a variant Cas9 protein has a mutation at an amino acid position corresponding to residue D10 (e.g., D10A, aspartate to alanine) of SEQ ID NO: 5 (or the corresponding position of any of the proteins set forth in SEQ ID NOs: 6-261 and 264-816) and can therefore cleave the complementary strand of a double stranded target nucleic acid but has reduced ability to cleave the non-complementary strand of a double stranded target nucleic acid (thus resulting in a single strand break (SSB) instead of a double strand break (DSB) when the variant Cas9 protein cleaves a double stranded target nucleic acid) (see, for example, Jinek et al., Science. 2012 Aug 17;337(6096):816-21). See, e.g., SEQ ID NO: 262.
  • a variant Cas9 protein can cleave the non-complementary strand of a target nucleic acid but has reduced ability to cleave the complementary strand of the target nucleic acid.
  • the variant Cas9 protein can have a mutation (amino acid substitution) that reduces the function of the HNH domain.
  • the Cas9 protein can be a nickase that cleaves the non-complementary strand, but does not cleave the complementary strand.
  • the variant Cas9 protein has a mutation at an amino acid position corresponding to residue H840 (e.g., an H840A mutation, histidine to alanine) of SEQ ID NO: 5 (or the corresponding position of any of the proteins set forth as SEQ ID NOs: 6-261 and 264-816) and can therefore cleave the non- complementary strand of the target nucleic acid but has reduced ability to cleave (e.g., does not cleave) the complementary strand of the target nucleic acid.
  • residue H840 e.g., an H840A mutation, histidine to alanine
  • Such a Cas9 protein has a reduced ability to cleave a target nucleic acid (e.g., a single stranded target nucleic acid) but retains the ability to bind a target nucleic acid (e.g., a single stranded target nucleic acid). See, e.g., SEQ ID NO: 263.
  • a variant Cas9 protein has a reduced ability to cleave both the complementary and the non-complementary strands of a double stranded target nucleic acid.
  • the variant Cas9 protein harbors mutations at amino acid positions corresponding to residues D10 and H840 (e.g., D10A and H840A) of SEQ ID NO: 5 (or the corresponding residues of any of the proteins set forth as SEQ ID NOs: 6-261 and 264-816) such that the polypeptide has a reduced ability to cleave (e.g., does not cleave) both the complementary and the non-complementary strands of a target nucleic acid.
  • residues D10 and H840 e.g., D10A and H840A
  • Such a Cas9 protein has a reduced ability to cleave a target nucleic acid (e.g., a single stranded or double stranded target nucleic acid) but retains the ability to bind a target nucleic acid.
  • a Cas9 protein that cannot cleave target nucleic acid e.g., due to one or more mutations, e.g., in the catalytic domains of the RuvC and HNH domains
  • d Cas9 or simply “dCas9 See, e.g., SEQ ID NO: 264.
  • residues D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, and/or A987 of SEQ ID NO: 5 (or the
  • any of the proteins set forth as SEQ ID NOs: 6-816) can be altered (i.e., substituted). Also, mutations other than alanine substitutions are suitable.
  • a variant Cas9 protein that has reduced catalytic activity e.g., when a Cas9 protein has a D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, and/or a A987 mutation of SEQ ID NO: 5 or the corresponding mutations of any of the proteins set forth as SEQ ID NOs: 6-816, e.g., D10A, G12A, G17A, E762A, H840A, N854A, N863A, H982A, H983A, A984A, and/or D986A)
  • the variant Cas9 protein can still bind to target nucleic acid in a site-specific manner (because it is still guided to a target nucleic acid sequence by a Cas9 guide RNA) as long as it retains the ability to interact with the Cas9 guide RNA.
  • a variant Cas9 protein can have the same parameters for
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 70% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 75% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 80% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 85% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6- 816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 90% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 95% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 99% or more amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, below, and are set forth as SEQ ID NOs: 1-4,
  • a suitable variant Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to amino acids 7-166 or 731- 1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to amino acids 7- 166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to amino acids 7- 166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816.
  • a suitable variant Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-816. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6- 816.
  • a genome targeting composition of the present disclosure includes a type V or type VI CRISPR/Cas endonuclease (i.e., the genome editing endonuclease is a type V or type VI CRISPR/Cas endonuclease) (e.g., Cpfl, C2cl, C2c2, C2c3).
  • Type V and type VI CRISPR/Cas endonucleases are a type of class 2 CRISPR/Cas endonuclease. Examples of type V CRISPR/Cas endonucleases include but are not limited to: Cpfl, C2cl, and C2c3.
  • a subject genome targeting composition includes a type V CRISPR/Cas endonuclease (e.g., Cpfl, C2cl, C2c3).
  • a Type V CRISPR/Cas endonuclease is a Cpfl protein.
  • a subject genome targeting composition includes a type VI CRISPR/Cas endonuclease (e.g., Casl3a).
  • type V and VI CRISPR/Cas endonucleases form a complex with a corresponding guide RNA.
  • the guide RNA provides target specificity to an endonuclease-guide RNA RNP complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein).
  • the endonuclease of the complex provides the site- specific activity. In other words, the endonuclease is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g.
  • a chromosomal sequence or an extrachromosomal sequence e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.
  • Type V or type VI CRISPR/Cas endonuclease e.g., Cpfl, C2cl,
  • C2c2, C2c3) is enzymatically active, e.g., the Type V or type VI CRISPR/Cas polypeptide, when bound to a guide RNA, cleaves a target nucleic acid.
  • the Type V or type VI CRISPR/Cas endonuclease e.g., Cpfl, C2cl, C2c2, C2c3
  • exhibits reduced enzymatic activity relative to a corresponding wild-type a Type V or type VI CRISPR/Cas endonuclease e.g., Cpfl, C2cl, C2c2, C2c3
  • a type V CRISPR/Cas endonuclease is a Cpfl protein.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the Cpfl amino acid sequence set forth in any of SEQ ID NOs:818-822.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI domain of the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822.
  • the Cpfl protein exhibits reduced enzymatic activity relative to a wild- type Cpfl protein (e.g., relative to a Cpfl protein comprising the amino acid sequence set forth in any of SEQ ID NOs: 818-822), and retains DNA binding activity.
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822; and comprises an amino acid substitution (e.g., a D ⁇ A substitution) at an amino acid residue corresponding to amino acid 917 of the Cpfl amino acid sequence set forth in SEQ ID NO: 818.
  • amino acid substitution e.g., a D ⁇ A substitution
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822; and comprises an amino acid substitution (e.g., an E ⁇ A substitution) at an amino acid residue corresponding to amino acid 1006 of the Cpfl amino acid sequence set forth in SEQ ID NO: 818.
  • amino acid substitution e.g., an E ⁇ A substitution
  • a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822; and comprises an amino acid substitution (e.g., a D ⁇ A substitution) at an amino acid residue corresponding to amino acid 1255 of the Cpfl amino acid sequence set forth in SEQ ID NO: 818.
  • amino acid substitution e.g., a D ⁇ A substitution
  • a suitable Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 818-822.
  • a type V CRISPR/Cas endonuclease is a C2cl protein (examples include those set forth as SEQ ID NOs: 823-830).
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2cl amino acid sequence set forth in any of SEQ ID NOs: 823-830.
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2cl amino acid sequence set forth in any of SEQ ID NOs: 823-830.
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI domain of the C2cl amino acid sequences set forth in any of SEQ ID NOs: 823-830).
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the C2cl amino acid sequence set forth in any of SEQ ID NOs: 823-830.
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the C2cl amino acid sequence set forth in any of SEQ ID NOs: 823-830.
  • a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2cl amino acid sequence set forth in any of SEQ ID NOs: 823-830.
  • the C2cl protein exhibits reduced enzymatic activity relative to a wild- type C2cl protein (e.g., relative to a C2cl protein comprising the amino acid sequence set forth in any of SEQ ID NOs: 823-830), and retains DNA binding activity.
  • a suitable C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2cl amino acid sequence set forth in any of SEQ ID NOs: 823-830.
  • a type V CRISPR/Cas endonuclease is a C2c3 protein (examples include those set forth as SEQ ID NOs: 831-834).
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 831-834.
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 831-834.
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 831-834.
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 831-834.
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 831-834.
  • a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 831-834.
  • the C2c3 protein exhibits reduced enzymatic activity relative to a wild- type C2c3 protein (e.g., relative to a C2c3 protein comprising the amino acid sequence set forth in any of SEQ ID NOs: 831-834), and retains DNA binding activity.
  • a suitable C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 831-834.
  • a type VI CRISPR/Cas endonuclease is a C2c2 protein (examples include those set forth as SEQ ID NOs: 835-846).
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 835-846.
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 835-846.
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 835-846.
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCII domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 835-846.
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCIII domain of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 835-846.
  • a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the RuvCI, RuvCII, and RuvCIII domains of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 835-846.
  • the C2c2 protein exhibits reduced enzymatic activity relative to a wild- type C2c2 protein (e.g., relative to a C2c2 protein comprising the amino acid sequence set forth in any of SEQ ID NOs: 835-846), and retains DNA binding activity.
  • a suitable C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 835-846.
  • RNA-guided endonucleases include CasX and CasY proteins. See, e.g.,
  • Cas9 guide RNA specific location within a target nucleic acid is referred to herein as a "Cas9 guide RNA.”
  • a Cas9 guide RNA can be said to include two segments, a first segment (referred to herein as a “targeting segment”); and a second segment (referred to herein as a “protein- binding segment”).
  • target segment a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule.
  • a segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule.
  • the first segment (targeting segment) of a Cas9 guide RNA includes a nucleotide
  • the protein-binding segment (or "protein-binding sequence") interacts with (binds to) a Cas9 polypeptide.
  • the protein-binding segment of a subject Cas9 guide RNA includes two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex).
  • Site-specific binding and/or cleavage of a target nucleic acid can occur at locations (e.g., target sequence of a target locus) determined by base-pairing complementarity between the Cas9 guide RNA (the guide sequence of the Cas9 guide RNA) and the target nucleic acid.
  • a Cas9 guide RNA and a Cas9 protein form a complex (e.g., bind via non-covalent interactions).
  • the Cas9 guide RNA provides target specificity to the complex by including a targeting segment, which includes a guide sequence (a nucleotide sequence that is complementary to a sequence of a target nucleic acid).
  • the Cas9 protein of the complex provides the site-specific activity (e.g., cleavage activity or an activity provided by the Cas9 protein when the Cas9 protein is a Cas9 fusion polypeptide, i.e., has a fusion partner).
  • the Cas9 protein is guided to a target nucleic acid sequence (e.g.
  • a target sequence in a chromosomal nucleic acid e.g., a chromosome
  • a target sequence in an extrachromosomal nucleic acid e.g. an episomal nucleic acid, a minicircle, an ssRNA, an ssDNA, etc.
  • a target sequence in a mitochondrial nucleic acid e.g. an episomal nucleic acid, a minicircle, an ssRNA, an ssDNA, etc.
  • a target sequence in a mitochondrial nucleic acid a target sequence in a chloroplast nucleic acid
  • a target sequence in a plasmid a target sequence in a viral nucleic acid; etc.
  • the "guide sequence” also referred to as the "targeting sequence” of a Cas9 guide RNA can be modified so that the Cas9 guide RNA can target a Cas9 protein to any desired sequence of any desired target nucleic acid, with the exception that the protospacer adjacent motif (PAM) sequence can be taken into account.
  • PAM protospacer adjacent motif
  • a Cas9 guide RNA can have a targeting segment with a sequence (a guide sequence) that has complementarity with (e.g., can hybridize to) a sequence in a nucleic acid in a eukaryotic cell, e.g., a viral nucleic acid, a eukaryotic nucleic acid (e.g., a eukaryotic chromosome, chromosomal sequence, a eukaryotic RNA, etc.), and the like.
  • a eukaryotic cell e.g., a viral nucleic acid, a eukaryotic nucleic acid (e.g., a eukaryotic chromosome, chromosomal sequence, a eukaryotic RNA, etc.), and the like.
  • a Cas9 guide RNA includes two separate nucleic acid molecules: an "activator” and a “targeter” and is referred to herein as a “dual Cas9 guide RNA", a “double-molecule Cas9 guide RNA”, or a "two-molecule Cas9 guide RNA” a “dual guide RNA”, or a “dgRNA.”
  • the activator and targeter are covalently linked to one another (e.g., via intervening nucleotides) and the guide RNA is referred to as a "single guide RNA", a “Cas9 single guide RNA", a “single-molecule Cas9 guide RNA,” or a “one-molecule Cas9 guide RNA”, or simply "sgRNA.”
  • a Cas9 guide RNA comprises a crRNA-like ("CRISPR RNA” / "targeter” / "crRNA” / “crRNA repeat”) molecule and a corresponding tracrRNA -like ("trans-acting CRISPR RNA” / "activator” / "tracrRNA”) molecule.
  • a crRNA-like molecule comprises both the targeting segment (single stranded) of the Cas9 guide RNA and a stretch ("duplex- forming segment") of nucleotides that forms one half of the dsRNA duplex of the protein- binding segment of the Cas9 guide RNA.
  • a corresponding tracrRNA-like molecule comprises a stretch of nucleotides (duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the guide nucleic acid.
  • a stretch of nucleotides of a crRNA-like molecule are complementary to and hybridize with a stretch of nucleotides of a tracrRNA-like molecule to form the dsRNA duplex of the protein-binding domain of the Cas9 guide RNA.
  • each targeter molecule can be said to have a corresponding activator molecule (which has a region that hybridizes with the targeter).
  • the targeter molecule additionally provides the targeting segment.
  • a targeter and an activator molecule hybridize to form a Cas9 guide RNA.
  • the exact sequence of a given crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecules are found.
  • a subject dual Cas9 guide RNA can include any corresponding activator and targeter pair.
  • activator or "activator RNA” is used herein to mean a tracrRNA-like
  • tracrRNA trans-acting CRISPR RNA
  • a Cas9 guide RNA comprises an activator sequence (e.g., a tracrRNA sequence).
  • a tracr molecule is a naturally existing molecule that hybridizes with a CRISPR RNA molecule (a crRNA) to form a Cas9 dual guide RNA.
  • activator is used herein to encompass naturally existing tracrRNAs, but also to encompass tracrRNAs with modifications (e.g., truncations, sequence variations, base modifications, backbone modifications, linkage modifications, etc.) where the activator retains at least one function of a tracrRNA (e.g., contributes to the dsRNA duplex to which Cas9 protein binds). In some cases the activator provides one or more stem loops that can interact with Cas9 protein.
  • An activator can be referred to as having a tracr sequence (tracrRNA sequence) and in some cases is a tracrRNA, but the term "activator” is not limited to naturally existing tracrRNAs.
  • targeter or “targeter RNA” is used herein to refer to a crRNA-like molecule (crRNA: “CRISPR RNA”) of a Cas9 dual guide RNA (and therefore of a Cas9 single guide RNA when the "activator” and the “targeter” are linked together, e.g., by intervening nucleotides).
  • CRISPR RNA crRNA-like molecule
  • a Cas9 guide RNA comprises a targeting segment (which includes nucleotides that hybridize with (are complementary to) a target nucleic acid, and a duplex-forming segment (e.g., a duplex forming segment of a crRNA, which can also be referred to as a crRNA repeat).
  • a targeting segment the segment that hybridizes with a target sequence of a target nucleic acid
  • a crRNA repeat the sequence of a targeter will often be a non-naturally occurring sequence.
  • the duplex-forming segment of a targeter (described in more detail below), which hybridizes with the duplex-forming segment of an activator, can include a naturally existing sequence (e.g., can include the sequence of a duplex-forming segment of a naturally existing crRNA, which can also be referred to as a crRNA repeat).
  • targeter is used herein to distinguish from naturally occurring crRNAs, despite the fact that part of a targeter (e.g., the duplex-forming segment) often includes a naturally occurring sequence from a crRNA.
  • the term "targeter" encompasses naturally occurring crRNAs.
  • a Cas9 guide RNA can also be said to include 3 parts: (i) a targeting sequence (a)
  • nucleotide sequence that hybridizes with a sequence of the target nucleic acid (ii) an activator sequence (as described above)(in some cases, referred to as a tracr sequence); and (iii) a sequence that hybridizes to at least a portion of the activator sequence to form a double stranded duplex.
  • a targeter has (i) and (iii); while an activator has (ii).
  • a Cas9 guide RNA (e.g. a dual guide RNA or a single guide RNA) can be comprised of any corresponding activator and targeter pair.
  • the duplex forming segments can be swapped between the activator and the targeter.
  • the targeter includes a sequence of nucleotides from a duplex forming segment of a tracrRNA (which sequence would normally be part of an activator) while the activator includes a sequence of nucleotides from a duplex forming segment of a crRNA (which sequence would normally be part of a targeter).
  • a targeter comprises both the targeting segment (single stranded) of the
  • a corresponding tracrRNA-like molecule comprises a stretch of nucleotides (a duplex-forming segment) that forms the other half of the dsRNA duplex of the protein- binding segment of the Cas9 guide RNA.
  • a stretch of nucleotides of the targeter is complementary to and hybridizes with a stretch of nucleotides of the activator to form the dsRNA duplex of the protein-binding segment of a Cas9 guide RNA.
  • each targeter can be said to have a corresponding activator (which has a region that hybridizes with the targeter).
  • the targeter molecule additionally provides the targeting segment.
  • a targeter and an activator hybridize to form a Cas9 guide RNA.
  • the particular sequence of a given naturally existing crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecules are found. Examples of suitable activator and targeter are well known in the art.
  • a Cas9 guide RNA (e.g. a dual guide RNA or a single guide RNA) can be comprised of any corresponding activator and targeter pair.
  • Non-limiting examples of nucleotide sequences that can be included in a Cas9 guide RNA include sequences set forth in SEQ ID NOs: 847-1095, or complements thereof.
  • sequences from SEQ ID NOs: 847-977 (which are from tracrRNAs) or complements thereof, can pair with sequences from SEQ ID NOs: 867-1095 (which are from crRNAs), or complements thereof, to form a dsRNA duplex of a protein binding segment.
  • the first segment of a subject guide nucleic acid includes a guide sequence (i.e., a
  • targeting sequence (a nucleotide sequence that is complementary to a sequence (a target site) in a target nucleic acid).
  • the targeting segment of a subject guide nucleic acid can interact with a target nucleic acid (e.g., double stranded DNA (dsDNA)) in a sequence-specific manner via hybridization (i.e., base pairing).
  • dsDNA double stranded DNA
  • the nucleotide sequence of the targeting segment may vary (depending on the target) and can determine the location within the target nucleic acid that the Cas9 guide RNA and the target nucleic acid will interact.
  • the targeting segment of a Cas9 guide RNA can be modified (e.g., by genetic engineering)/designed to hybridize to any desired sequence (target site) within a target nucleic acid (e.g., a eukaryotic target nucleic acid such as genomic DNA).
  • a target nucleic acid e.g., a eukaryotic target nucleic acid such as genomic DNA.
  • the targeting segment can have a length of 7 or more nucleotides (nt) (e.g., 8 or more, 9 or more, 10 or more, 12 or more, 15 or more, 20 or more, 25 or more, 30 or more, or 40 or more nucleotides).
  • nt nucleotides
  • the targeting segment can have a length of from 7 to 100 nucleotides (nt) (e.g., from 7 to 80 nt, from 7 to 60 nt, from 7 to 40 nt, from 7 to 30 nt, from 7 to 25 nt, from 7 to 22 nt, from 7 to 20 nt, from 7 to 18 nt, from 8 to 80 nt, from 8 to 60 nt, from 8 to 40 nt, from 8 to 30 nt, from 8 to 25 nt, from 8 to 22 nt, from 8 to 20 nt, from 8 to 18 nt, from 10 to 100 nt, from 10 to 80 nt, from 10 to 60 nt, from 10 to 40 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 10 to 18 nt, from 12 to 100 nt, from 12 to 80 nt, from 12 to 60 nt
  • the complementary to a nucleotide sequence (target site) of the target nucleic acid can have a length of 10 nt or more.
  • the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid can have a length of 12 nt or more, 15 nt or more, 18 nt or more, 19 nt or more, or 20 nt or more.
  • the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 12 nt or more.
  • the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 18 nt or more.
  • the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid can have a length of from 10 to 100 nucleotides (nt) (e.g., from 10 to 90 nt, from 10 to 75 nt, from 10 to 60 nt, from 10 to 50 nt, from 10 to 35 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 12 to 100 nt, from 12 to 90 nt, from 12 to 75 nt, from 12 to 60 nt, from 12 to 50 nt, from 12 to 35 nt, from 12 to 30 nt, from 12 to 25 nt, from 12 to 22 nt, from 12 to 20 nt, from 15 to 100 nt, from 15 to 90 nt, from 15 to 75 nt, from 15 to 60 nt, from 15 to 50 nt, from 15 to 35 nt,
  • nt nucle
  • the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 25 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 25 nt.
  • the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 22 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 20 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 19 nucleotides in length.
  • the percent complementarity between the targeting sequence (guide sequence) of the targeting segment and the target site of the target nucleic acid can be 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5 '-most nucleotides of the target site of the target nucleic acid.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more over about 20 contiguous nucleotides. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the fourteen contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 14 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder.
  • the targeting sequence can be considered to be 20 nucleotides in length.
  • the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA).
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA).
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA).
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA).
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more (e.g., e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%) over about 20 contiguous nucleotides.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 7 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 8 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 9 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 10 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 11 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 11 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 12 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 12 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 13 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 13 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 14 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 14 nucleotides in length.
  • the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 17 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 18 nucleotides in length.
  • Examples of various Cas9 proteins and Cas9 guide RNAs can be found in the art, for example, see Jinek et al., Science. 2012 Aug 17;337(6096):816-21 ; Chylinski et al., RNA Biol. 2013 May;10(5):726-37; Ma et al., Biomed Res Int. 2013;2013:270805; Hou et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39): 15644-9; Jinek et al., Elife.
  • Jinek et al. Science. 2012 Aug 17;337(6096):816-21 ; Chylinski et al., RNA Biol. 2013 May;10(5):726-37; Ma et al., Biomed Res Int. 2013;2013:270805; Hou et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39): 15644-9
  • RNAs corresponding to type V and type VI CRISPR/Cas endonucleases e.g., Cpfl Guide RNA
  • a guide RNA that binds to a type V or type VI CRISPR/Cas protein e.g., Cpfl, C2cl, C2c2, C2c3
  • a type V or type VI CRISPR/Cas guide RNA e.g., Cpfl, C2cl, C2c2, C2c3
  • An example of a more specific term is a "Cpfl guide RNA.”
  • a type V or type VI CRISPR/Cas guide RNA can have a total length of from 30 nucleotides (nt) to 200 nt, e.g., from 30 nt to 180 nt, from 30 nt to 160 nt, from 30 nt to 150 nt, from 30 nt to 125 nt, from 30 nt to 100 nt, from 30 nt to 90 nt, from 30 nt to 80 nt, from 30 nt to 70 nt, from 30 nt to 60 nt, from 30 nt to 50 nt, from 50 nt to 200 nt, from 50 nt to 180 nt, from 50 nt to 160 nt, from 50 nt to 150 nt, from 50 nt to 125 nt, from 50 nt to 100 nt, from 50 nt to 90 nt, from 50
  • a type V or type VI CRISPR/Cas guide RNA (e.g., cpfl guide RNA) has a total length of at least 30 nt (e.g., at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 80 nt, at least 90 nt, at least 100 nt, or at least 120 nt,).
  • a Cpfl guide RNA has a total length of 35 nt, 36 nt, 37 nt, 38 nt, 39 nt, 40 nt, 41 nt, 42 nt, 43 nt, 44 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt, or 50 nt.
  • a type V or type VI CRISPR/Cas guide RNA can include a target nucleic acid-binding segment and a duplex-forming region (e.g., in some cases formed from two duplex-forming segments, i.e., two stretches of nucleotides that hybridize to one another to form a duplex).
  • the target nucleic acid-binding segment of a type V or type VI CRISPR/Cas guide RNA can have a length of from 15 nt to 30 nt, e.g., 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt.
  • the target nucleic acid-binding segment has a length of 23 nt.
  • the target nucleic acid-binding segment has a length of 24 nt.
  • the target nucleic acid-binding segment has a length of 25 nt.
  • RNA can have a length of from 15 nt to 30 nt (e.g., 15 to 25 nt, 15 to 24 nt, 15 to 23 nt, 15 to 22 nt, 15 to 21 nt, 15 to 20 nt, 15 to 19 nt, 15 to 18 nt,17 to 30 nt, 17 to 25 nt, 17 to 24 nt, 17 to 23 nt, 17 to 22 nt, 17 to 21 nt, 17 to 20 nt, 17 to 19 nt, 17 to 18 nt, 18 to 30 nt, 18 to 25 nt, 18 to 24 nt, 18 to 23 nt, 18 to 22 nt, 18 to 21 nt, 18 to 20 nt, 18 to 19 nt, 19 to 30 nt, 19 to 25 nt, 19 to 24 nt, 19 to 22 nt, 19 to 21 nt, 19 to 20 nt, 20 to 30 nt, 19 to 25 nt
  • the guide sequence has a length of 17 nt. In some cases, the guide sequence has a length of 18 nt. In some cases, the guide sequence has a length of 19 nt. In some cases, the guide sequence has a length of 20 nt. In some cases, the guide sequence has a length of 21 nt. In some cases, the guide sequence has a length of 22 nt. In some cases, the guide sequence has a length of 23 nt. In some cases, the guide sequence has a length of 24 nt.
  • the guide sequence of a type V or type VI CRISPR/Cas guide RNA can have 100% complementarity with a corresponding length of target nucleic acid sequence.
  • the guide sequence can have less than 100% complementarity with a corresponding length of target nucleic acid sequence.
  • the guide sequence of a type V or type VI CRISPR/Cas guide RNA e.g., cpfl guide RNA
  • the target nucleic acid-binding segment has 100% complementarity to the target nucleic acid sequence.
  • the target nucleic acid-binding segment has 1 non-complementary nucleotide and 24 complementary nucleotides with the target nucleic acid sequence.
  • the target nucleic acid-binding segment has 2 non-complementary nucleotides and 23 complementary nucleotides with the target nucleic acid sequence.
  • the duplex-forming segment of a type V or type VI CRISPR/Cas guide RNA (e.g., cpfl guide RNA) (e.g., of a targeter RNA or an activator RNA) can have a length of from 15 nt to 25 nt (e.g., 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, or 25 nt).
  • RNA duplex of a type V or type VI CRISPR/Cas guide RNA e.g., cpfl guide
  • RNA can have a length of from 5 base pairs (bp) to 40 bp (e.g., from 5 to 35 bp, 5 to 30 bp, 5 to 25 bp, 5 to 20 bp, 5 to 15 bp, 5-12 bp, 5-10 bp, 5-8 bp, 6 to 40 bp, 6 to 35 bp, 6 to 30 bp, 6 to 25 bp, 6 to 20 bp, 6 to 15 bp, 6 to 12 bp, 6 to 10 bp, 6 to 8 bp, 7 to 40 bp, 7 to 35 bp, 7 to 30 bp, 7 to 25 bp, 7 to 20 bp, 7 to 15 bp, 7 to 12 bp, 7 to 10 bp, 8 to 40 bp, 8 to 35 bp, 8 to 30 bp, 8 to 25 bp, 8 to 20 bp, 8 to 15 bp, 8 to 40 bp, 8 to 35 b
  • a duplex-forming segment of a Cpfl guide RNA can comprise a
  • AAUUUCCACUGUUGUGGAU SEQ ID NO: 1098
  • AAUUCCUACUGUUGUAGGU SEQ ID NO: 1099
  • AAUUUCUACUAUUGUAGAU SEQ ID NO: 1100
  • AAUUUCUACUGCUGUAGAU (SEQ ID NO: 1101), AAUUUCUACUUUGUAGAU (SEQ ID NO: 1102), and AAUUUCUACUUGUAGAU (SEQ ID NO: 1103).
  • the guide sequence can then follow (5' to 3') the duplex forming segment.
  • RNA that includes the nucleotide sequence
  • a C2cl guide RNA is an RNA that includes the nucleotide sequence
  • a C2cl guide RNA is an RNA that includes the nucleotide sequence
  • a C2cl guide RNA is an RNA that includes the nucleotide sequence
  • an activator RNA e.g. tracrRNA
  • a C2cl guide RNA dual guide or single guide
  • a duplex forming segment of a C2cl guide RNA (dual guide or single guide) of an activator RNA includes the nucleotide sequence AGCUUCUCA (SEQ ID NO: 1108) or the nucleotide sequence GCUUCUCA (SEQ ID NO: 1109) (the duplex forming segment from a naturally existing tracrRNA.
  • a non-limiting example of a targeter RNA (e.g. crRNA) of a C2cl guide RNA (dual guide or single guide) is an RNA with the nucleotide sequence
  • CUGAGAAGUGGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN (SEQ ID NO: 1110), where the Ns represent the guide sequence, which will vary depending on the target sequence, and although 20 Ns are depicted a range of different lengths are acceptable.
  • a duplex forming segment of a C2cl guide RNA (dual guide or single guide) of a targeter RNA e.g.
  • crRNA includes the nucleotide sequence CUGAGAAGUGGCAC (SEQ ID NO: 1111) or includes the nucleotide sequence CUGAGAAGU (SEQ ID NO: 1112) or includes the nucleotide sequence UGAGAAGUGGCAC (SEQ ID NO: 1113) or includes the nucleotide sequence UGAGAAGU (SEQ ID NO: 1114).
  • the present disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising: i) an rAAV virion of the present disclosure; and ii) a pharmaceutically acceptable carrier, diluent, excipient, or buffer.
  • the pharmaceutically acceptable carrier, diluent, excipient, or buffer is suitable for use in a human.
  • excipients include any pharmaceutical agent that can be administered without undue toxicity.
  • Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol and ethanol.
  • Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
  • the present disclosure provides a method of delivering a gene product to a cardiac cell, e.g., a cardiac fibroblast.
  • the methods generally involve infecting a cardiac cell (e.g., a cardiac fibroblast) with an rAAV virion of the present disclosure, where the gene product(s) encoded by the heterologous nucleic acid present in the rAAV virion is/are produced in the cardiac cell (e.g., cardiac fibroblast). Delivery of a gene product(s) to a cardiac cell (e.g., cardiac fibroblast) can provide for treatment of a cardiac disease or disorder.
  • Delivery of a gene product(s) to a cardiac cell can provide for generation of an induced cardiomyocyte from the cardiac fibroblast. Delivery of a gene product(s) to a cardiac cell (e.g., cardiac fibroblast) can provide for editing of the genome of the cardiac cell (e.g., cardiac fibroblast).
  • infecting a cardiac cell is carried out in vitro.
  • infecting a cardiac cell is carried out in vitro; and the infected cardiac cell (e.g., cardiac fibroblast) is introduced into (e.g., implanted into) an individual in need thereof, e.g., directly into cardiac tissue of an individual in need thereof.
  • an effective amount of rAAV virions to be delivered to cells will be on the order of from about 10 s to about 10 13 of the rAAV virions.
  • Other effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves.
  • infecting a cardiac cell e.g., cardiac fibroblast
  • a cardiac cell e.g., cardiac fibroblast
  • an effective amount of an rAAV virion of the present disclosure is administered directly into cardiac tissue of an individual in need thereof.
  • An "effective amount" will fall in a relatively broad range that can be determined through
  • a therapeutically effective dose will be on the order of from about 10 6 to about 10 15 of the rAAV virions, e.g., from about 10 s to 10 12 rAAV virions, of the present disclosure.
  • an effective amount of an rAAV virion of the present disclosure is administered via intramyocardial injection through the epicardium.
  • an effective amount of an rAAV virion of the present disclosure is administered via vascular delivery through the coronary artery.
  • an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through the superior vena cava.
  • an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through a peripheral vein.
  • rAAV virions administered to an individual, e.g., are administered directly into cardiac tissue in the individual, or are administered via another route.
  • the number of rAAV virions are administered to an individual, e.g., are administered directly into cardiac tissue in the individual, or are administered via another route.
  • an rAAV virion of the present disclosure is from about 10 2 vg/kg to 10 4 vg/kg, from about 10 4 vg/kg to about 10 6 vg/kg, from about 10 6 vg/kg to about 10 s vg/kg, from about 10 s vg/kg to about 10 10 vg/kg, from about 10 10 vg/kg to about 10 12 vg/kg, from about 10 12 vg/kg to about 10 14 vg/kg, from about 10 14 vg/kg to about 10 14 vg/kg, from about 10 14 vg/kg to about 10 16 vg/kg, or more than 10 16 vg/kg.
  • an effective amount of an rAAV virion of the present disclosure is administered via intramyocardial injection through the epicardium. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via vascular delivery through the coronary artery. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through the superior vena cava. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through a peripheral vein.
  • more than one administration may be employed to achieve the desired level of gene expression.
  • the more than one administration is administered at various intervals, e.g., daily, weekly, twice monthly, monthly, every 3 months, every 6 months, yearly, etc.
  • multiple administrations are administered over a period of time of from 1 month to 2 months, from 2 months to 4 months, from 4 months to 8 months, from 8 months to 12 months, from 1 year to 2 years, from 2 years to 5 years, or more than 5 years.
  • Suitable gene products are described above.
  • the gene product is a
  • the gene product is a therapeutic gene product. In some cases, the gene product is a genome-editing enzyme. In some cases, the gene product is an RNA. In some cases, the gene product is a polypeptide. In some cases, two gene products are encoded in a single rAAV of the present disclosure. In some cases, the two gene products are two different reprogramming factors. In some cases, the two gene products are: i) an RNA-guided endonuclease; and ii) a guide RNA that comprises a segment that binds the RNA-guided endonuclease and a segment that binds to a target nucleotide sequence in a target nucleic acid.
  • the gene product is a therapeutic gene product.
  • the present disclosure provides a method of treating a cardiac disease or disorder, the method generally involving delivering a therapeutic gene product to a cardiac cell (e.g., a cardiac fibroblast) using a method of the present disclosure.
  • a cardiac cell e.g., a cardiac fibroblast
  • Cardiac diseases and disorders that can be treated with a method of the present disclosure include hypertrophic cardiomyopathy; a valvular heart disease; myocardial infarction; congestive heart failure; long QT syndrome; atrial arrhythmia; ventricular arrhythmia; diastolic heart failure; systolic heart failure; cardiac valve disease; cardiac valve calcification; left ventricular non-compaction;
  • the present disclosure provides a method of reprogramming a cardiac fibroblast to generate an induced cardiomyocyte-like cell (iCM).
  • the method generally involves infecting a cardiac fibroblast with an rAAV virion of the present disclosure, where the rAAV virion comprises a heterologous nucleic acid comprising a nucleotide sequence encoding one or more reprogramming factors.
  • Suitable reprogramming factors include Mef2c, Gata4, Tbx5, Esrrg, Mespl, and Myocd.
  • a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a single reprogramming factor selected from Mef2c, Gata4, Tbx5, Esrrg, Mespl, and Myocd.
  • a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Mef2c polypeptide. In some cases, a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Gata4 polypeptide.
  • a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Tbx5 polypeptide. In some cases, a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Mef2c polypeptide and a Gata4 polypeptide.
  • a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Mef2c polypeptide and a Tbx5 polypeptide. In some cases, a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Gata4 polypeptide and a Tbx5 polypeptide.
  • a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Myocd polypeptide. In some cases, a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Myocd polypeptide and a Tbx5 polypeptide.
  • a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding only a Myocd polypeptide and a Tbx5 polypeptide, and no other reprogramming factor. In some cases, a method of the present disclosure comprises infecting a cardiac fibroblast with an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a Myocd polypeptide, a Tbx5 polypeptide, and a Mef2c polypeptide.
  • a method of the present disclosure comprises infecting a cardiac fibroblast with an r AAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding only a Myocd polypeptide, a Tbx5 polypeptide, and a Mef2c polypeptide, and no other reprogramming factor.
  • An rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding one or more reprogramming factors is used to infect a cardiac fibroblast.
  • the one or more reprogramming factors is/are produced in the cardiac fibroblast, and induce the cardiac fibroblast to become a cardiomyocyte or cardiomyocyte-like cell, referred to herein as an "induced cardiomyocyte" or iCM.
  • Induced cardiomyocytes express one or more cardiomyocyte-specific markers, where cardiomyocyte-specific markers include, but are not limited to, cardiac troponin I, cardiac troponin-C, tropomyosin, caveolin-3, myosin heavy chain, myosin light chain-2a, myosin light chain-2v, ryanodine receptor, sarcomeric a-actinin, Nkx2.5, connexin 43, and atrial natriuretic factor. Induced cardiomyocytes can also exhibit sarcomeric structures.
  • Induced cardiomyocytes exhibit increased expression of cardiomyocyte-specific genes ACTC1 (cardiac a-actin), ACTN2 (actinin a2), MYH6 (a-myosin heavy chain), RYR2 (ryanodine receptor 2), MYL2 (myosin regulatory light chain 2, ventricular isoform), MYL7 (myosin regulatory light chain, atrial isoform), TNNT2 (troponin T type 2, cardiac), and NPPA (natriuretic peptide precursor type A), PLN (phospholamban).
  • ACTC1 cardiac a-actin
  • ACTN2 actinin a2
  • MYH6 a-myosin heavy chain
  • RYR2 ryanodine receptor 2
  • MYL2 myosin regulatory light chain 2, ventricular isoform
  • MYL7 myosin regulatory light chain, atrial isoform
  • TNNT2 troponin T type 2, cardiac
  • RNA coding for markers specific to cardiomyocytes are known and are available through public data bases such as GenBank; thus, marker-specific sequences needed for use as primers or probes is easily determined.
  • Induced cardiomyocytes can also exhibit spontaneous contraction. Whether an induced cardiomyocyte exhibits spontaneous contraction can be determined using standard electrophysiological methods (e.g., patch clamp).
  • induced cardiomyocytes can exhibit spontaneous Ca 2+
  • Ca 2+ oscillations can be detected using standard methods, e.g., using any of a variety of calcium-sensitive dyes, intracellular Ca 2+ ion-detecting dyes include, but are not limited to, fura-2, bis-fura 2, indo-1, Quin-2, Quin-2 AM, Benzothiaza-1, Benzothiaza-2, indo-5F, Fura-FF, BTC, Mag-Fura-2, Mag-Fura-5, Mag-Indo-1, fluo-3, rhod-2, rhod-3, fura-4F, fura-5F, fura-6F, fluo-4, fluo-5F, fluo-5N, Oregon Green 488 BAPTA, Calcium Green, Calcein, Fura-C18, Calcium Green-C18, Calcium Orange, Calcium Crimson, Calcium Green-5N, Magnesium Green, Oregon Green 488 BAPTA-1, Oregon Green 488 BAPTA-2, X-rhod-1, Fura Red, Rhod-5F, Rh
  • an iCM is generated in vitro; and the iCM is introduced into an
  • a method of the present disclosure can comprise infecting a population of cardiac fibroblasts in vitro, to generate a population of iCMs; and the population of iCMs is implanted into a cardiac tissue of an individual in need thereof.
  • an iCM is generated in vivo.
  • an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding one or more reprograrnming factors is administered to an individual.
  • the rAAV virion is administered directly into cardiac tissue of an individual in need thereof.
  • from about 10 6 to about 10 s , from about 10 s to about 10 9 , from about 10 9 to about 10 10 , from about 10 10 to about 10 n , from about 10 n to about 10 12 , from about 10 12 to about 10 13 , from about 10 13 to about 10 14 , from about 10 14 to about 10 15 genome copies, or more than 10 15 genome copies, of an rAAV virion of the present disclosure that comprises a heterologous nucleic acid comprising a nucleotide sequence encoding one or more reprogramming factors are administered to an individual, e.g., are administered directly into cardiac tissue in the individual or via another route of administration.
  • the number of rAAV virions administered to an individual can be expressed in viral genomes (vg) per kilogram (kg) body weight of the individual.
  • effective amount of an rAAV virion of the present disclosure is from about 10 2 vg/kg to 10 4 vg/kg, from about 10 4 vg/kg to about 10 6 vg/kg, from about 10 6 vg/kg to about
  • an effective amount of an rAAV virion of the present disclosure is administered via intramyocardial injection through the epicardium. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via vascular delivery through the coronary artery.
  • an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through the superior vena cava. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through a peripheral vein.
  • the present disclosure provides a method of modifying ("editing") the genome of a cardiac cell.
  • the present disclosure provides a method of modifying ("editing") the genome of a cardiac fibroblast.
  • the present disclosure provides a method of modifying ("editing") the genome of a cardiomyocyte.
  • the methods generally involve infecting a cardiac cell (e.g., a cardiac fibroblast or a cardiomyocyte) with an rAAV virion of the present disclosure, where the rAAV virion comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a genome-editing endonuclease.
  • the method comprises infecting a cardiac fibroblast or a cardiomyocyte with an rAAV virion of the present disclosure, where the rAAV virion comprises a heterologous nucleic acid comprising a nucleotide sequence encoding an RNA-guided genome -editing endonuclease.
  • the method comprises infecting a cardiac fibroblast or a cardiomyocyte with an rAAV virion of the present disclosure, where the rAAV virion comprises a heterologous nucleic acid comprising a nucleotide sequence encoding: i) an RNA-guided genome-editing endonuclease; and ii) one or more guide RNAs.
  • the method comprises infecting a cardiac fibroblast or a cardiomyocyte with an rAAV virion of the present disclosure, where the rAAV virion comprises a heterologous nucleic acid comprising a nucleotide sequence encoding: i) an RNA-guided genome-editing endonuclease; ii) a guide RNAs; and iii) a donor template DNA.
  • RNA-guided genome-editing comprises a heterologous nucleic acid comprising a nucleotide sequence encoding: i) an RNA-guided genome-editing endonuclease; ii) a guide RNAs; and iii) a donor template DNA.
  • infecting a cardiac cell is carried out in vitro.
  • infecting a cardiac cell e.g., cardiac fibroblast; a cardiomyocyte
  • infecting a cardiac cell is carried out in vitro; and the infected cardiac cell (e.g., cardiac fibroblast) is introduced into (e.g., implanted into) an individual in need thereof, e.g., directly into cardiac tissue of an individual in need thereof.
  • an effective amount of rAAV virions to be delivered to cells will be on the order of from about 10 s to about 10 13 of the rAAV virions.
  • Other effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves.
  • infecting a cardiac cell is carried out in vivo.
  • a cardiac cell e.g., cardiac fibroblast; a cardiomyocyte
  • an effective amount of an rAAV virion of the present disclosure is administered directly into cardiac tissue of an individual in need thereof.
  • An "effective amount" will fall in a relatively broad range that can be determined through experimentation and/or clinical trials.
  • a therapeutically effective dose will be on the order of from about 10 6 to about 10 15 of the rAAV virions, e.g., from about 10 s to 10 12 rAAV virions, of the present disclosure.
  • an effective amount of an rAAV virion of the present disclosure is administered via intramyocardial injection through the epicardium. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via vascular delivery through the coronary artery. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through the superior vena cava. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through a peripheral vein.
  • an rAAV virion of the present disclosure is from about 10 2 vg/kg to 10 4 vg/kg, from about 10 4 vg/kg to about 10 6 vg/kg, from about 10 6 vg/kg to about 10 s vg/kg, from about 10 s vg/kg to about 10 10 vg/kg, from about 10 10 vg/kg to about 10 12 vg/kg, from about 10 12 vg/kg to about 10 14 vg/kg, from about 10 14 vg/kg to about 10 14 vg/kg, from about 10 vg/kg to about 10 vg/kg, or more than 10 vg/kg.
  • an effective amount of an rAAV virion of the present disclosure is administered via intramyocardial injection through the epicardium. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via vascular delivery through the coronary artery. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through the superior vena cava. In some cases, an effective amount of an rAAV virion of the present disclosure is administered via systemic delivery through a peripheral vein.
  • the genome editing comprises homology-directed repair (HDR).
  • HDR homology-directed repair
  • the HDR corrects a defect in an endogenous target nucleic acid in the cardiac fibroblast or the cardiomyocyte, where the defect is associated with, or leads to, a defect in structure and/or function of the cardiac fibroblast or the cardiomyocyte, or a component of the cardiac fibroblast or the cardiomyocyte.
  • the genome editing comprises non-homologous end joining (NHEJ).
  • NHEJ non-homologous end joining
  • the NHEJ deletes a defect in an endogenous target nucleic acid in the cardiac fibroblast or the cardiomyocyte, where the defect is associated with, or leads to, a defect in structure and/or function of the cardiac fibroblast or the cardiomyocyte, or a component of the cardiac fibroblast or the cardiomyocyte.
  • a method of the present disclosure for editing the genome of a cardiac cell can be used to correct any of a variety of genetic defects that give rise to a cardiac disease or disorder.
  • Mutations of interest include mutations in one or more of the following genes: cardiac troponin T (TNNT2); myosin heavy chain (MYH7); tropomyosin 1
  • TPM1 myosin binding protein C
  • MYBPC3 myosin binding protein C
  • PRKAG2 5'-AMP-activated protein kinase subunit gamma-2
  • TNNI3 troponin I type 3
  • TTN myosin, light chain 2
  • ACTC1 alpha cardiac muscle 1
  • KCNQ1 potassium voltage-gated channel, KQT- like subfamily, member 1
  • PEP2 plakophilin 2
  • MEF2C myocyte enhancer factor 2c
  • CSRP3 cardiac LIM protein
  • mutations of interest include, without limitation, MYH7 R663H mutation; TNNT2 R173W; PKP2 2013delC mutation; PKP2 Q617X mutation; and KCNQ1 G269S missense mutation.
  • Mutations of interest include mutations in one or more of the following genes: MYH6, ACTN2, SERCA2, GATA4, TBX5, MYOCD, NKX2-5, NOTCH1, MEF2C, HAND2, and HAND1.
  • the mutations of interest include mutations in the following genes: MEF2C, TBX5, and MYOCD.
  • Cardiac diseases and disorders that can be treated with a method of the present disclosure include coronary heart disease, cardiomyopathy, endocarditis, congenital cardiovascular defects, and congestive heart failure.
  • Cardiac diseases and disorders that can be treated with a method of the present disclosure include hypertrophic cardiomyopathy; a valvular heart disease; myocardial infarction; congestive heart failure; long QT syndrome; atrial arrhythmia; ventricular arrhythmia; diastolic heart failure; systolic heart failure; cardiac valve disease; cardiac valve calcification; left ventricular non-compaction;
  • the present disclosure provides an isolated nucleic acid comprising a nucleotide
  • AAV adeno-associated virus
  • a subject recombinant AAV vector can be used to generate a subject recombinant AAV virion, as described above.
  • the present disclosure provides a recombinant AAV vector that, when introduced into a suitable cell, can provide for production of a subject recombinant AAV virion.
  • the present disclosure further provides host cells, e.g., isolated (genetically modified) host cells, comprising a subject nucleic acid.
  • a subject host cell can be an isolated cell, e.g., a cell in in vitro culture.
  • a subject host cell is useful for producing a subject rAAV virion, as described below. Where a subject host cell is used to produce a subject rAAV virion, it is referred to as a "packaging cell.”
  • a subject host cell is stably genetically modified with a subject nucleic acid.
  • a subject host cell is transiently genetically modified with a subject nucleic acid.
  • a subject nucleic acid is introduced stably or transiently into a host cell, using
  • a subject nucleic acid will generally further include a selectable marker, e.g., any of several well-known selectable markers such as neomycin resistance, and the like.
  • a selectable marker e.g., any of several well-known selectable markers such as neomycin resistance, and the like.
  • a subject host cell is generated by introducing a subject nucleic acid into any of a
  • Suitable mammalian cells include, but are not limited to, primary cells and cell lines, where suitable cell lines include, but are not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1/2 fibroblasts, CHO cells, and the like.
  • suitable host cells include, e.g., HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos.
  • CRL9618, CCL61, CRL9096 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like.
  • a subject host cell can also be made using a baculovirus to infect insect cells such as Sf9 cells, which produce AAV (see, e.g., U.S. Patent No.
  • a subject genetically modified host cell includes, in addition to a nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein, as described above, a nucleic acid that comprises a nucleotide sequence encoding one or more AAV rep proteins.
  • a subject host cell further comprises an rAAV vector.
  • An rAAV virion can be generated using a subject host cell. Methods of generating an rAAV virion are described in, e.g., U.S. Patent Publication No. 2005/0053922 and U.S. Patent Publication No. 2009/0202490.
  • a recombinant adeno-associated virus (rAAV) virion comprising: a) a variant AAV capsid protein comprising an amino acid substitution at one or more of E67, S207, N551, and 1698 of the AAV2 capsid amino acid sequence set forth in SEQ ID NO: l, or the corresponding position in another parental AAV serotype, wherein the variant AAV capsid protein confers increased infectivity of a cardiac cell, compared to the infectivity of the cardiac cell by an AAV virion comprising a wild-type AAV capsid protein; and b) a heterologous nucleic acid comprising a nucleotide sequence encoding a gene product.
  • Aspect 2 The rAAV virion of aspect 1 , wherein the variant AAV capsid protein
  • Aspect 3 The rAAV virion of aspect 1 or aspect 2, wherein the cardiac cell is a cardiac fibroblast or a cardiomyocyte.
  • Aspect 4 The rAAV virion of any one of aspects 1-3, wherein the rAAV virion exhibits at least 2-fold increased infectivity of a cardiac cell.
  • Aspect 5 The rAAV virion of any one of aspects 1-3, wherein the rAAV virion exhibits at least 5-fold increased infectivity of a cardiac cell.
  • Aspect 6 The rAAV virion of any one of aspects 1-5, wherein the gene product is a nucleic acid; a polypeptide; or comprises both a nucleic acid and a polypeptide.
  • Aspect 7 The rAAV virion of any one of aspects 1-5, wherein the gene product is a polypeptide.
  • Aspect 8 The rAAV virion of aspect 7, wherein the gene product is a reprogramming factor.
  • Aspect 10 The rAAV virion of aspect 7, wherein the gene product is an angiogenic growth factor.
  • Aspect 11 The rAAV virion of aspect 10, wherein the growth factor is fibroblast growth factor, platelet-derived growth factor, hepatocyte growth factor, or hypoxia inducible factor.
  • Aspect 12 The rAAV virion of aspect 7, wherein the polypeptide is sarcoendoplasmic reticulum calcium- ATPase 2a, stromal-derived factor- 1, adenylate cyclase-6, betaARKct, thymosin -beta-4, nitric oxide synthase, superoxide dismutase, or S100A.
  • Aspect 13 The rAAV virion of aspect 7, wherein the polypeptide is a genome-editing enzyme.
  • Aspect 14 The rAAV virion of aspect 13, wherein the genome -editing enzyme is a Cas9 polypeptide, a zinc finger nuclease, a TALEN, an enzymatically inactive type II
  • CRISPR/Cas polypeptide a type II CRISPR/Cas polypeptide, a type V CRISPR/Cas polypeptide, or a type VI CRISPR/Cas polypeptide.
  • Aspect 15 The rAAV virion of aspect 6, wherein the nucleic acid gene product is a guide RNA that binds to genome -editing enzyme.
  • a pharmaceutical composition comprising: a) the rAAV virion of any one of aspects 1-15; and b) a pharmaceutically acceptable excipient, diluent, carrier, or buffer.
  • a method of delivering a gene product to a cardiac cell the method
  • Aspect 18 A method of delivering a gene product to a cardiac cell in an individual, the method comprising administering to the individual the rAAV virion of any one of aspects
  • Aspect 19 The method of aspect 18, wherein said administering is via intramyocardial injection, vascular delivery via the coronary artery, systemic delivery through the superior vena cava, or systemic delivery through a peripheral vein.
  • a method of reprogramming a cardiac fibroblast comprising contacting a cardiac fibroblast with the rAAV virion of aspect 8 or aspect 9, wherein the reprogramming factor(s) is/are produced in the cardiac fibroblast, and wherein the reprogramming factor(s) induce reprogramming of the cardiac fibroblast to generate a cardiomyocyte-like cell.
  • Aspect 21 The method of aspect 20, wherein said contacting occurs in vitro, thereby generating an in vitro cardiomyocyte-like cell.
  • Aspect 22 The method of aspect 21, comprising implanting the cardiomyocyte-like cell into an individual in need thereof.
  • Aspect 23 The method of aspect 20, wherein said contacting occurs in vivo.
  • Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c, subcutaneous(ly); and the like.
  • FIG. 1 provides an amino acid sequence of the AAV-A2 capsid protein, with mutations relative to wild-type AAV2 highlighted in yellow.
  • FIG. 3 A and 3B depict amino acid mutations N551S and 1698 V mapped onto the crystal structure of AAV2 in PyMOL. E67A and S207G are not shown because they are located in a region of the capsid that was not crystallized.
  • FIG. 3 A full biological assembly.
  • FIG. 3B Individual asymmetric unit with shapes indicating the axes of symmetry.
  • FIG. 4 depicts transduction efficiency of AAV-2 benchmarked against natural AAV serotypes.
  • AAV-A2 was packaged as rAAV sc-CMV-GFP along with wild-type rAAV -6, 8, and 9.
  • Human cardiomyocytes and cardiac fibroblasts were infected at a genomic multiplicity of infection (MOI) of 10,000.
  • FIG. 5A and 5B provide: (5 A), a schematic of single-stranded recombinant AAV
  • FIG. 6A and 6B In vitro reprogramming of primary mouse cardiac fibroblasts into induced cardiomyocyte-like cells (iCMs) using AAV-A2. Reprogrammed cells express the induced cardiomyocyte GFP reporter and beat spontaneously.
  • FIG. 6B Dose response with increasing MOI of AAV-A2 expressing reprogramming factors.
  • FIG. 7 depicts in vivo reprogramming of mouse cardiac fibroblasts into iCMs using
  • AAV-A2 Reprogrammed cells are double positive for the cardiomyocyte marker troponin T and the endogenous lineage tracing marker tdTomato activated by Tcf21-Cre.
  • Tcf21 is expressed in many cell types, including cardiac fibroblasts, but is not expressed in cardiomyocytes.
  • FIG. 6A depict in vitro reprogramming of primary mouse cardiac fibroblasts into induced cardiomyocyte-like cells (iCMs) using AAV-A2 (FIG. 6A)
  • iCMs Human cardiac fibroblasts were reprogrammed into iCMs using AAV-A2.
  • the AAV-A2 capsid protein expressed cardiac reprogramming factors MEF2C, TBX5, and MYOCD in human cardiac fibroblasts in vitro, which were reprogrammed into iCMs.
  • iCMs exhibited sarcomeric structures resembling sarcomeric structures of cardiomyocytes (FIG. 32).
  • hFCFs Human fetal cardiac fibroblasts from a commercial source (Cell Applications, INC.) were routinely maintained in IMDM media with 10% fetal bovine serum (FBS). At the beginning of cardiac reprogramming, 2000 hFCFs were plated into the 20mm glass bottom well of each 35mm dish (Cellvis, D35-20-1-N) pre-coated with 0.5mL of 1% gelatin in phosphate-buffered saline (PBS) with 5 ⁇ g of fibronectin.
  • PBS phosphate-buffered saline
  • AAV-A2 viral vectors containing the expression cassettes for human MEF2C, TBX5, or MYOCD were used to transduce the hFCFs at a MOI of 10,000 for each vector.
  • 12 hours after AAV-A2 transduction culture media is changed from IMDM with 10% FBS into 75% DMEM with 15% M199 and 10% FBS media (also called iCM media).
  • 2 ⁇ of SB431542 (Inman et al. (2002) Mol. Pharmacol. 62:65) and 5 ⁇ g/mL of Laminin was added during the media change.
  • 5 ⁇ of XAV939 (Huang et al. (2009) Nature 461 :614) was added on the second day after AAV-A2 transduction.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des virions de virus adéno-associé (AAV) recombinant à protéine de capside modifiée, les virions d'AAV recombinant (rAAV) présentant une plus grande infectiosité des cellules cardiaques comparativement à l'AAV de type sauvage, et les virions rAAV comprenant un acide nucléique hétérologue. La présente invention concerne des méthodes d'administration d'un produit génique à la cellule cardiaque chez un individu. La présente invention concerne des méthodes de production de cellules induites de type cardiomyocytes. La présente invention concerne des méthodes de modification du génome de la cellule cardiaque.
PCT/US2018/034456 2017-05-31 2018-05-24 Virus adéno-associé à capside variante et ses méthodes d'utilisation WO2018222503A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762513117P 2017-05-31 2017-05-31
US62/513,117 2017-05-31

Publications (1)

Publication Number Publication Date
WO2018222503A1 true WO2018222503A1 (fr) 2018-12-06

Family

ID=64456411

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/034456 WO2018222503A1 (fr) 2017-05-31 2018-05-24 Virus adéno-associé à capside variante et ses méthodes d'utilisation

Country Status (1)

Country Link
WO (1) WO2018222503A1 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021007515A1 (fr) 2019-07-11 2021-01-14 Tenaya Therapeutics, Inc. Reprogrammation de cellules cardiaques avec des microarn et d'autres facteurs
WO2021067598A1 (fr) 2019-10-04 2021-04-08 Ultragenyx Pharmaceutical Inc. Procédés pour une utilisation thérapeutique améliorée d'aav recombinant
US11015211B2 (en) 2018-08-30 2021-05-25 Tenaya Therapeutics, Inc. Cardiac cell reprogramming with myocardin and ASCL1
WO2021163322A1 (fr) 2020-02-14 2021-08-19 Ultragenyx Pharmaceutical Inc. Thérapie génique pour le traitement d'un trouble du déficit en cdkl5
WO2021188892A1 (fr) 2020-03-19 2021-09-23 Ultragenyx Pharmaceutical Inc. Compositions et procédés pour réduire l'empaquetage inverse de séquences cap et rep dans un aav recombinant
WO2021202532A1 (fr) 2020-03-31 2021-10-07 Ultragenyx Pharmaceutical Inc. Thérapie génique pour le traitement de l'acidémie propionique
US11149256B2 (en) 2018-09-26 2021-10-19 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
WO2022022624A1 (fr) * 2020-07-29 2022-02-03 南京昕瑞再生医药科技有限公司 Procédé de production de cardiomyocytes par reprogrammation
CN114450411A (zh) * 2019-04-01 2022-05-06 特纳亚治疗股份有限公司 具有工程化衣壳的腺相关病毒
WO2023283649A1 (fr) 2021-07-08 2023-01-12 Tenaya Therapeutics, Inc. Cassettes d'expression optimisées pour thérapie génique
WO2023019168A1 (fr) 2021-08-11 2023-02-16 Ultragenyx Pharmaceutical Inc. Compositions et méthodes destinées au traitement d'une dystrophie musculaire
WO2023172491A1 (fr) 2022-03-07 2023-09-14 Ultragenyx Pharmaceutical Inc. Systèmes et procédés de production d'aav par lots modifiés
US11781156B2 (en) 2020-10-09 2023-10-10 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy methods and compositions
WO2023201207A1 (fr) 2022-04-11 2023-10-19 Tenaya Therapeutics, Inc. Virus adéno-associé comprenant une capside modifiée
US11821009B2 (en) 2018-05-15 2023-11-21 Cornell University Genetic modification of the AAV capsid resulting in altered tropism and enhanced vector delivery

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100166729A9 (en) * 2007-04-13 2010-07-01 Madison Edwin L Modified factor VII polypeptides and uses thereof
US20160017295A1 (en) * 2013-05-31 2016-01-21 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
US20160102324A1 (en) * 2013-05-29 2016-04-14 Cellectis New compact scaffold of cas9 in the type ii crispr system

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100166729A9 (en) * 2007-04-13 2010-07-01 Madison Edwin L Modified factor VII polypeptides and uses thereof
US20160102324A1 (en) * 2013-05-29 2016-04-14 Cellectis New compact scaffold of cas9 in the type ii crispr system
US20160017295A1 (en) * 2013-05-31 2016-01-21 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11821009B2 (en) 2018-05-15 2023-11-21 Cornell University Genetic modification of the AAV capsid resulting in altered tropism and enhanced vector delivery
US11015211B2 (en) 2018-08-30 2021-05-25 Tenaya Therapeutics, Inc. Cardiac cell reprogramming with myocardin and ASCL1
US11913012B2 (en) 2018-08-30 2024-02-27 Tenaya Therapeutics, Inc. Cardiac cell reprogramming with myocardin and ASCL1
US11149256B2 (en) 2018-09-26 2021-10-19 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
CN114450411A (zh) * 2019-04-01 2022-05-06 特纳亚治疗股份有限公司 具有工程化衣壳的腺相关病毒
WO2021007515A1 (fr) 2019-07-11 2021-01-14 Tenaya Therapeutics, Inc. Reprogrammation de cellules cardiaques avec des microarn et d'autres facteurs
WO2021067598A1 (fr) 2019-10-04 2021-04-08 Ultragenyx Pharmaceutical Inc. Procédés pour une utilisation thérapeutique améliorée d'aav recombinant
WO2021163322A1 (fr) 2020-02-14 2021-08-19 Ultragenyx Pharmaceutical Inc. Thérapie génique pour le traitement d'un trouble du déficit en cdkl5
WO2021188892A1 (fr) 2020-03-19 2021-09-23 Ultragenyx Pharmaceutical Inc. Compositions et procédés pour réduire l'empaquetage inverse de séquences cap et rep dans un aav recombinant
WO2021202532A1 (fr) 2020-03-31 2021-10-07 Ultragenyx Pharmaceutical Inc. Thérapie génique pour le traitement de l'acidémie propionique
WO2022022624A1 (fr) * 2020-07-29 2022-02-03 南京昕瑞再生医药科技有限公司 Procédé de production de cardiomyocytes par reprogrammation
US11781156B2 (en) 2020-10-09 2023-10-10 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy methods and compositions
WO2023283649A1 (fr) 2021-07-08 2023-01-12 Tenaya Therapeutics, Inc. Cassettes d'expression optimisées pour thérapie génique
WO2023019168A1 (fr) 2021-08-11 2023-02-16 Ultragenyx Pharmaceutical Inc. Compositions et méthodes destinées au traitement d'une dystrophie musculaire
WO2023172491A1 (fr) 2022-03-07 2023-09-14 Ultragenyx Pharmaceutical Inc. Systèmes et procédés de production d'aav par lots modifiés
WO2023201207A1 (fr) 2022-04-11 2023-10-19 Tenaya Therapeutics, Inc. Virus adéno-associé comprenant une capside modifiée

Similar Documents

Publication Publication Date Title
WO2018222503A1 (fr) Virus adéno-associé à capside variante et ses méthodes d'utilisation
US11565000B2 (en) Adeno-associated virus virions with variant capsid and methods of use thereof
JP6836999B2 (ja) アデノ随伴ウイルス変異体及びその使用方法
Aurnhammer et al. Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences
US20220354967A1 (en) Compositions and methods for transgene expression from an albumin locus
CN111836649A (zh) 腺相关病毒变异衣壳和其使用方法
AU2018324477A1 (en) Adeno-associated virus capsid variants and methods of use thereof
KR20230002401A (ko) C9orf72의 표적화를 위한 조성물 및 방법
JP7432621B2 (ja) 選択的遺伝子調節のための組成物および方法
EP3947700A1 (fr) Virus adéno-associé comprenant une capside modifiée
JP2022522196A (ja) ラミノパシーを処置するための組成物および方法
CN111718420B (zh) 一种用于基因治疗的融合蛋白及其应用
US20230111672A1 (en) Compositions and methods for production of recombinant adeno-associated virus
US20210371879A1 (en) Adeno-associated virus virions with variant capsids and methods of use thereof
WO2014114934A1 (fr) Procédés pour améliorer l'efficacité du ciblage de gène
WO2020187268A1 (fr) Protéine de fusion pour améliorer l'édition de gène et son utilisation
WO2020187272A1 (fr) Protéine de fusion pour thérapie génique et son application
WO2023215947A1 (fr) Capsides de virus adéno-associés
TW202404993A (zh) 具經工程化蛋白殼之腺相關病毒

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18808975

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18808975

Country of ref document: EP

Kind code of ref document: A1