WO2018195415A1 - Compositions comprising propionibacterium acnes bacteriophages for treating acne - Google Patents
Compositions comprising propionibacterium acnes bacteriophages for treating acne Download PDFInfo
- Publication number
- WO2018195415A1 WO2018195415A1 PCT/US2018/028556 US2018028556W WO2018195415A1 WO 2018195415 A1 WO2018195415 A1 WO 2018195415A1 US 2018028556 W US2018028556 W US 2018028556W WO 2018195415 A1 WO2018195415 A1 WO 2018195415A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- composition
- acnes
- seq
- bacteriophage
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/10—Anti-acne agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
- A61K31/05—Phenols
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/327—Peroxy compounds, e.g. hydroperoxides, peroxides, peroxyacids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/60—Salicylic acid; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/04—Sulfur, selenium or tellurium; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/44—Oxidoreductases (1)
- A61K38/446—Superoxide dismutase (1.15)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
- A61K8/04—Dispersions; Emulsions
- A61K8/06—Emulsions
- A61K8/062—Oil-in-water emulsions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
- A61K8/04—Dispersions; Emulsions
- A61K8/06—Emulsions
- A61K8/064—Water-in-oil emulsions, e.g. Water-in-silicone emulsions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/19—Cosmetics or similar toiletry preparations characterised by the composition containing inorganic ingredients
- A61K8/22—Peroxides; Oxygen; Ozone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/19—Cosmetics or similar toiletry preparations characterised by the composition containing inorganic ingredients
- A61K8/23—Sulfur; Selenium; Tellurium; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
- A61K8/34—Alcohols
- A61K8/347—Phenols
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
- A61K8/36—Carboxylic acids; Salts or anhydrides thereof
- A61K8/368—Carboxylic acids; Salts or anhydrides thereof with carboxyl groups directly bound to carbon atoms of aromatic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
- A61K8/66—Enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/67—Vitamins
- A61K8/671—Vitamin A; Derivatives thereof, e.g. ester of vitamin A acid, ester of retinol, retinol, retinal
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0014—Skin, i.e. galenical aspects of topical compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01052—Beta-N-acetylhexosaminidase (3.2.1.52)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/10011—Details dsDNA Bacteriophages
- C12N2795/10311—Siphoviridae
- C12N2795/10321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/10011—Details dsDNA Bacteriophages
- C12N2795/10311—Siphoviridae
- C12N2795/10332—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y105/00—Oxidoreductases acting on the CH-NH group of donors (1.5)
- C12Y105/01—Oxidoreductases acting on the CH-NH group of donors (1.5) with NAD+ or NADP+ as acceptor (1.5.1)
- C12Y105/01001—Pyrroline-2-carboxylate reductase (1.5.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y111/00—Oxidoreductases acting on a peroxide as acceptor (1.11)
- C12Y111/01—Peroxidases (1.11.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21062—Subtilisin (3.4.21.62)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21064—Peptidase K (3.4.21.64)
Definitions
- Propionibacterium acnes whose overgrowth leads to inflammation that causes pimples.
- Current treatments including benzoyl peroxide and antibiotics are quite ineffective, and the most effective treatment - isotretinoin - is limited to a small set of patients due to dangerous side effects (including birth defects, liver damage, and suicide).
- compositions comprising, consisting essentially of, or consisting of at least one Propionibacterium acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier.
- composition that includes at least one
- Propionibacterium acnes bacteriophage no more than one anti-acne compound, and a pharmaceutically acceptable carrier.
- composition that includes active ingredients consisting of at least one Propionibacterium acnes bacteriophage and no more than one anti-acne compound, and a pharmaceutically acceptable carrier.
- composition that includes at least one
- Propionibacterium acnes bacteriophage at least one anti-acne compound, and a
- composition does not comprise a probiotic bacterium.
- composition that includes a Propionibacterium acnes bacteriophage and an enzyme.
- a combination comprising, consisting essentially of, or consisting of at least one Propionibacterium acnes bacteriophage and at least one anti-acne compound, wherein each of the at least one Propionibacterium acnes bacteriophage and the at least one anti-acne compound is in a composition that further includes a pharmaceutically acceptable carrier.
- a combination that includes a Propionibacterium acnes bacteriophage and an enzyme.
- provided herein is a method of preventing or treating acne in a subject in need thereof, the method including administering an effective amount of a composition or combination provided herein.
- FIG. 1 P. acnes (acne-causing, left half plate) or P. granulosum (commensal, right half plate) bacteria was plated on RCM-agar petri dishes. Sterile half-pads soaked in either minocycline or PHIT-101 (10 7 pfu/mL) were placed on each plate. After anaerobic incubation at 37°C for 3 days, zones of killing (arrows) appear, indicating that minocycline kills both pathogenic and commensal bacteria while PHIT-101 kills the acne-causing bacteria without disturbing commensal P. granulosum.
- FIG. 2 A synthetic skin microbiome that includes P. acnes, P. granulosum, and P. avidum was grown to confluence in a test tube. It was then incubated in the presence or absence of PHIT-101 for 48 hours. The relative proportions of the three species were quantified by NGS sequencing of the 16S amplicon of the washed bacterial pellets using the Illumina MiSeq platform. PHIT-101 was able to almost completely wipe out acne-causing P. acnes, without affecting the growth of the other two commensal species.
- FIG. 3 Biofilm production amongst P. acnes strains is highly variable. 96 strains of P. acnes were grown in a 96-well polystyrene microtiter plate to stimulate biofilm production, and the biofilm produced by each strain was quantified. The variability demonstrated within this set of strains demonstrates the need to quantify biofilm formation under growth conditions more similar to those found in the human pore.
- FIG. 4 A screen to select enzymes that can degrade P. acnes biofilms.
- P. acnes was grown in polystyrene microtiter plates to stimulate biofilm production. Enzymes were added at O.Olmg/mL to the wells and incubated at 30°C for 30 mins. The degraded biofilm was washed away with phosphate buffered saline (PBS), and the residual biofilm in each well was quantified by staining with crystal violet and recording absorbance at 590nm. Proteases like proteinase K and subtilisin showed good activity, and dispersin was the best glycoside depolymerase amongst those tested.
- PBS phosphate buffered saline
- FIG. 5 Enhancement of phage with biofilm degrading enzyme (BDE) greatly increases bacterial killing. Sessile P. acnes cells were incubated with PBS (untreated), PHIT-101, or PHIT-101 and Dispersin. Cell survival was measured using the CellTiter-Blue reagent, and fluorescence was recorded at 56(W590Em. PHIT-101 was unable to kill P. acnes as effectively as in liquid culture, but addition of the biofilm degrading enzyme Dispersin greatly increased the bacterial killing to levels similar to liquid culture.
- BDE biofilm degrading enzyme
- FIG. 6 Probi otic strains produce low levels of lipase in adherent culture.
- Probiotic P. acnes strains with known genotypes were grown under biofilm conditions in a microtiter plate. After 72 hrs of growth, the culture supernatant was filter-sterilized and incubated with 4-MU palmitate at 37C for 4 hours to determine extracellular lipase production. The lipase production of the probiotic strains (Pr#X) was very low in comparison to pathogen, indicating a lower inflammatory potential.
- FIG. 7 Probiotic strains adhere significantly less to epithelial cells than pathogenic P. acnes. Select probiotic strains were incubated with confluent A-431 epithelial cells (MOI 10). After washing the wells, cells were lifted using 0.1% Tween 80 solution and plated on BHI plates. After anaerobic incubation for 72 hours, colonies were counted. The data show that probiotic strains showed significantly lower binding to epithelial cells (* p ⁇ 0.05, ** p ⁇ 0.005).
- FIGS. 8A-8D Lower inflammatory potential of probiotic strain in mouse ear inflammation model.
- CBA/J mice (5 mice per cohort) were injected with P. acnes strains, and cytokine analysis was performed at day 5.
- the probiotic strain Pr#C showed significantly lower levels (* p ⁇ 0.05, ** pO.01, *** pO.0001) of inflammatory cytokines IL- ⁇ ⁇ (FIG. 8A), IL-6 (FIG. 8B), IL-17 (FIG. 8C), and TNFa (FIG. 8D ) than the pathogenic strain.
- Pr-C has the ProII 16S sequence.
- FIG. 10. illustrates life-cycles of exemplary bacteriophages. Anticlockwise from bottom left: A phage particle recognizes and adsorbs onto the surface of the host bacterium. The phage genome is injected into the bacteria. In the lysogenic life cycle, this DNA gets integrated into the bacterial genome and replicates with it for several cycles. In the lytic life cycle, the genome does not integrate and proceeds to hijack the host machinery to replicate its genome and phage structural components. The fully assembled phage then lyses the cell, typically by producing endolysins and holins at the late stage of infection. The liberated phages are now free to seek out and infect a new host bacterium, initiating another lytic cycle. [0025] FIG.
- FIG. 11 illustrates the formation of exemplary bacterial biofilms.
- Bacterial cells land and adhere to a surface with favorable conditions for growth. They replicate to form a colony, until a certain threshold of cell density (quorum) triggers biofilm formation.
- the biofilm includes a mixture of polysaccharides, proteins, DNA and lipids in varying proportions.
- the biofilm is a physical barrier that protects the bacterial colony from harsh external conditions and grants resistance to antibiotics, toxins and immune cells.
- FIG. 12 illustrates an embodiment of three components act in concert; their effects are described sequentially for exposition.
- An inflamed comedone is typically clogged with the biofilm produced by overgrown P. acnes (A), along with commensal skin bacteria (B).
- the biofilm-degrading enzyme (bolts) breaks down the P. acnes biofilm to provide better access for the other components.
- the bacteriophage (hexagons) then edits or specifically kills the pathogenic P. acnes and clears the infection.
- the probiotic bacteria (C) colonize the pore and occupy the niche of the pathogen, preventing it from growing back and recalibrating the microbiome to a healthy state.
- FIG. 13 is a cartoon of a non-limiting probiotic bacterium screening process.
- FIG. 14 is a graph showing that the pathogenic strain produces significantly higher ear inflammation than PBS control, while the lead probiotic strain Pr-C induces ear inflammation not significantly different from PBS control.
- FIG. 15 is a graph showing that a phage remains stable in the presence of low (0.5% w/v) and high (2% w/v) concentrations of salicylic acid.
- FIG. 16 is a graph showing that a phage loses its viability in the presence of benzoyl peroxide over 60 days. The rate of loss of phage viability is greater at the higher concentration (10% w/v) compared to the lower concentration (2.5% w/v).
- compositions, combinations, methods, and systems for treating and preventing acne are, inter alia, compositions, combinations, methods, and systems for treating and preventing acne.
- Salicylic acid and benzoyl peroxide are the most commonly used anti-acne agents in over-the-counter (OTC) products.
- OTC over-the-counter
- the stability of phages in combination with these anti-acne agents is unknown, especially since phages diverge widely in their stability and response to external physical and chemical factors.
- the redox properties of benzoyl peroxide and sulfur can potentially cause the degradation of the protein coat of the phage.
- Previous studies have shown that exposure to peroxide increases the rate of protein degradation by destabilizing the protein and increasing its susceptibility to proteolysis (Fligiel et al. Protein degradation following treatment with hydrogen peroxide. Am J Pathol 1984, 115 (3), 418-25; Kocha ei al. Hydrogen peroxide-mediated degradation of protein: different oxidation modes of copper- and iron- dependent hydroxyl radicals on the degradation of albumin. Biochim Biophys Acta 1997, 1337
- Salicylic acid is noted for its protein-binding ability (Lee et al. Protein binding of acetylsalicylic acid and salicylic acid in porcine and human serum. Vet Hum Toxicol 1995, 37
- a Propionibacterium acnes bacteriophage was found to be stable in compositions that include salicylic acid. See, for example, FIG. 15.
- salicylic acid is shown to be well tolerated by the phage and is a suitable anti-acne agent for co-formulation.
- the anti-keratolytic activity of the salicylic acid complements phage activity by enabling deeper penetration of the phage, thereby increasing its killing efficiency.
- phages as described herein may be combined with salicylic acid in compositions for preventing and treating acne.
- benzoyl peroxide is not suitable for co-formulation with the phage tested (see FIG. 16) for fomulations that wll be stored for more than, e.g. , a few days, benzoyl peroxide can be used along with a phage product as part of an anti-acne combination (e.g., a kit).
- a kit an anti-acne combination
- the benzoyl peroxide is an active ingredient in a cleanser, which is applied to the skin and washed off prior to the application of a comprising the phage composition/formulation.
- the anti-keratolytic and transient antibacterial action of the benzoyl peroxide complements the specific deeper and targeted killing of P. acnes by the bacteriophage.
- a Propionibacterium acnes bacteriophage and an anti-acne compound are in a single composition that is topically administered to the skin of a subj ect.
- a Propionibacterium acnes bacteriophage and an anti-acne compound e.g. in separate containers, such as bottles
- an anti-acne compound such as benzoyl peroxide, salicylic acid, and/or sulfur
- each composition is topically administered to the skin of a subject.
- the Propionibacterium acnes bacteriophage is administered to the subject, and then the anti-acne compound is administered to the subject.
- the anti-acne compound is administered to the subject, and then the Propionibacterium acnes bacteriophage is administered to the subject.
- the subject's face is washed between when the anti-acne compound and the Propionibacterium acnes bacteriophage (in either order) are topically administered to the face of the subject.
- the effective dose of the anti-acne compound when used in combination with the Propionibacterium acnes bacteriophage is less than would be required if the anti-acne compound was used alone.
- the effective dose of the anti-acne compound when used in combination with the Propionibacterium acnes bacteriophage is less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% less than the dose that would be required if the anti-acne compound was used alone.
- a "Propionibacterium acnes bacteriophage” is a bacteriophage that infects, replicates within, and kills P. acnes cells.
- a P. acnes bacteriophage is a lytic P. acnes bacteriophage.
- a P. acnes bacteriophage is capable of lysing a P. acnes bacterium and incapable of lysing any bacterium which is not P. acnes.
- a P. acnes bacteriophage is incapable of sustaining lysogeny in a bacterium.
- a P. acnes bacteriophage lacks the ability to express at least one gene necessary for sustaining lysogeny.
- the term "lacks the ability to express at least one gene necessary for sustaining lysogeny" is intended to indicate that the P. acnes bacteriophage lacks the ability to produce a fully functional protein product necessary to sustain lysogeny, for example, as the result of one or more point mutations or full or partial deletions of the genome.
- the P. acnes bacteriophage lacks the ability to produce a fully functional protein product necessary to sustain lysogeny, for example, as the result of one or more point mutations or full or partial deletions of the genome.
- acnes bacteriophage has a genome that lacks all or part of at least one gene necessary for sustaining lysogeny (e.g., artificially or naturally, e.g., the strain is or is derived from a strain that lacks all or part of at least one gene necessary for sustaining lysogeny).
- the P. acnes bacteriophage may comprise defects (e.g. mutations, insertions or deletions) in the genome in non-coding regions that may, nonetheless, affect the ability of the phage to sustain lysogeny, for example defects in the genome integration site(s) (e.g. a /art/ site) or in a repressor binding site.
- a P. acnes bacteriophage is naturally occurring and isolated, with the added advantage that artificial mutations need not be introduced into the bacteriophage.
- a P. acnes bacteriophage is capable of lysing a plurality of strains of the P. acnes bacterium.
- a P. acnes bacteriophage is capable of lysing at least about 5, 10, 15, 20, 25, 30 or more strains of the P. acnes bacterium.
- Non-limiting examples of P. acnes bacteriophages are disclosed herein.
- acnes bacteriophage has a genome having sequence identity of at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 95%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% with SEQ ID NO: 1.
- aP. acnes bacteriophage has a genome having the sequence of SEQ ID NO: 1, or includes the sequence of SEQ ID NO: 1.
- the genome of the P. acnes bacteriophage has no insertions or deletions compared to SEQ ID NO: 1.
- the P. acnes bacteriophage has no insertions or deletions, and only conservative substitutions compared to SEQ ID NO: 1.
- the P. acnes bacteriophage is one of the following exemplary isolates of P. acnes bacteriophages that have been deposited under the terms of the Budapest Treaty at The National Collection of Industrial, Marine and Food Bacteria (NCIMB), Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, United Kingdom, under the following accession numbers: Accession no. NCIMB 41332 (isolate PA6); Accession no. NCIMB 41334 (isolate 1874); Accession no. NCIMB 41333 (isolate 1878); Accession no.
- NCIMB 41335 (isolate 1905); Accession no. NCIMB 41349 (isolate 1894); Accession no. NCIMB 41350 (isolate 103609); Accession no. NCIMB 41351 (isolate 103672).
- a non-limiting example of a host bacterium, P. acnes, ATI has been deposited as NCIMB 41336.
- a P. acnes bacteriophage has a genome having sequence identity of at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 95%, or 99% with the genome of the bacteriophage deposited under Accession No. NCIMB 41349.
- a P. acnes bacteriophage has a genome having sequence identity of at least 87% with the genome of the bacteriophage deposited under Accession No. NCIMB 41350. In embodiments, a P. acnes bacteriophage has a genome having sequence identity of at least 88% with the genome of the bacteriophage deposited under Accession No. NCIMB 41351. Additional non-limiting descriptions relating to P. acnes bacteriophages are provided in U.S. Patent No. 9,068, 159 B2, issued June 30, 2015, the entire content of which is incorporated herein by reference. The terms “phage” and “bacteriophage” are used interchangeably herein.
- a biofilm means cleaving a covalent bond of at least one compound that forms part of a biofilm (e.g. , by enzymatic activity).
- compounds that may form a part of a biofilm include polymers, glycosides, proteins, polysaccharides, and nucleic acids.
- a "P. acnes biofilm degrading enzyme” is an enzyme that degrades at least one compound that forms part of a P. acnes biofilm.
- the enzymes as provided herein include any naturally occurring forms, homologs, isoforms or variants that maintain the enzymatic activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- isolated when applied to a bacterium or bacteriophage, refers to a bacterium or bacteriophage that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature or in an experimental setting), and/or (2) produced, prepared, purified, and/or manufactured by the hand of man, e.g. using artificial culture conditions such as (but not limited to) growing on a plate and/or in a fermenter.
- Isolated bacteria include those bacteria that are cultured, even if such cultures are not monocultures.
- the isolated bacteria are bacteria that are cultured as a monoculture (e.g., on a plate or in liquid culture such as in a fermenter).
- Isolated bacteria and bacteriophages may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 99% or more of the other components with which they were initially associated (e.g., by weight).
- isolated bacteria are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure (e.g., by weight).
- isolated bacteriophages are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure (e.g., by weight).
- a composition provided herein includes one or more isolated bacteriophages.
- a composition provided herein includes an isolated bacteriophage.
- a bacteriophage that is administered is an isolated bacteriophage.
- a composition provided herein includes one or more isolated bacteria.
- a composition provided herein includes an isolated bacterium.
- a bacterium that is administered is an isolated bacterium.
- a "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample.
- a test sample can be taken from a test condition, e.g. , in the presence of a test compound (e.g., enzyme) or phage, and compared to samples from known conditions, e.g. , in the absence of the test compound, phage, or bacterium (negative control), or in the presence of a known compound, phage, or bacterium (positive control).
- a control can also represent an average value gathered from a number of tests or results.
- controls can be designed for assessment of any number of parameters.
- a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life, the degradation of a biofilm or a component thereof, or bacterial cell lysis) or therapeutic measures (e.g., comparison of side effects).
- pharmacological data e.g., half-life, the degradation of a biofilm or a component thereof, or bacterial cell lysis
- therapeutic measures e.g., comparison of side effects
- Nucleic acid refers to nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and polymers thereof in either single-, double- or multiple-stranded form, or complements thereof.
- polynucleotide refers, in the usual and customary sense, to a linear sequence of nucleotides. Oligonucleotides are typically from about
- Polynucleotides are polymers of any length, including longer lengths, e.g. , 200, 300,
- Polynucleotides and oligonucleotides will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, that include, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press); and peptide nucleic acid backbones and linkages.
- nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U. S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in Antisense Research, Sanghui & Cook, eds. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g. , to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
- Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- the percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
- nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity over a specified region, e.g., of an entire nucleic acid or polypeptide sequence or individual portions or domains of a nucleic acid or polypeptide), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
- a specified region e.g., of an entire nucleic acid or polypeptide sequence or individual portions or domains of a nucleic acid or polypeptide
- the identify exists over a region that is about or at least about 20, 50, 100, 1000, 2500, 5000, 7500, 10000, 15000, 20000, 25000, or 30000 amino acids or nucleotides in length to about, less than about, or at least about 31000, 32000, 33000, 34000 or 35000 amino acids or nucleotides in length.
- the identity exists over a region that is at least about 10 to about 100, about 20 to about 75, about 30 to about 50 amino acids or nucleotides in length.
- the identity exists over a region that is at least about 50 amino acids in length, or more preferably over a region that is 100 to 500 or 1000 or more amino acids in length.
- phages comprising nucleic acids (e.g. , a genome or a portion thereof) having sequences that are substantially identical to any of SEQ ID NOs: 1, 11, 13, 15, 17, 19, 21, 23, 25, or 27.
- Non-limiting examples of phages provided herein comprise genomes having sequences that are substantially identical to SEQ ID NO: 1.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence algorithm program parameters Preferably, default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- a comparison window includes about or at least about 20, 50, 100,
- a comparison window includes about or at least about 20 to about, less than about, or at least about
- a comparison window includes about or at least about 25000 to about, less than about, or at least about 31000 contiguous positions. In embodiments, a comparison window includes about or at least about 26000 to about, less than about, or at least about 31000 contiguous positions. In embodiments, a comparison window includes about or at least about 27000 to about, less than about, or at least about 31000 contiguous positions. In embodiments, a comparison window includes about or at least about 28000 to about, less than about, or at least about 31000 contiguous positions. In embodiments, a comparison window includes about or at least about 29000 to about, less than about, or at least about 31000 contiguous positions.
- a comparison window includes about or at least about 30000 to about, less than about, or at least about 31000 contiguous positions. In embodiments, a comparison includes about 20 to about 600, about 50 to about 200, or about 100 to about 150 contiguous positions. In embodiments, the comparison window is the entire length of a reference sequence, such as the sequence of a bacteriophage genome. Methods of alignment of sequences for comparison are well-known in the art. In embodiments, optimal alignment of sequences for comparison can be conducted, e.g. , by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
- BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins.
- a BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence.
- HSPs high scoring sequence pairs
- T is referred to as the neighborhood word score threshold (Altschul et al, supra).
- these initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
- cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0).
- a scoring matrix is used to calculate the cumulative score.
- extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the NCBI BLASTN or BLASTP program is used to align sequences.
- the BLASTN or BLASTP program uses the defaults used by the NCBI.
- the BLASTN program (for nucleotide sequences) uses as defaults: a word size (W) of 28; an expectation threshold (E) of 10; max matches in a query range set to 0; match/mismatch scores of 1, -2; linear gap costs; the filter for low complexity regions used; and mask for lookup table only used.
- the BLASTP program (for amino acid sequences) uses as defaults: a word size (W) of 3; an expectation threshold (E) of 10; max matches in a query range set to 0; the BLOSUM62 matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1992)); gap costs of existence: 11 and extension: 1; and conditional compositional score matrix adjustment.
- polypeptide peptide
- protein protein
- amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g. , hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
- Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e. , an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g.
- amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
- Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical
- Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
- TGG which is ordinarily the only codon for tryptophan
- amino acid sequences one of skill will recognize that individual substitutions to a peptide, polypeptide, or protein sequence which alters a single amino acid is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles.
- the following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
- the term "disease” refers to any deviation from the normal health of a mammal and includes a state when disease symptoms are present, as well as conditions in which a deviation (e.g., dysbiosis, infection, gene mutation, genetic defect, etc.) has occurred, but symptoms are not yet manifested.
- the disease is acne.
- the disease includes dermal dysbiosis.
- methods, compositions, systems, phages, and probiotic bacteria provided herein are suitable for use in a subject that is a member of the Vertebrate class, Mammalia, including, without limitation, primates (such as humans), livestock, work animals, and domestic pets (e.g., a companion animal).
- a subject is a human subject.
- a "symptom" of a disease includes and clinical or laboratory manifestation associated with the disease, and is not limited to what a subject can feel or observe.
- the term "dermal dysbiosis” means a difference in the skin microbiota compared to a healthy or general population.
- the dysbiosis is on the surface of the skin, within skin (e.g., within a skin region or layer of skin cells), within a gland, and/or within a pore of the skin.
- the dysbiosis is within sweat and/or sebum.
- the skin is on the face (e.g., the forehead, one or more cheeks, the nose, or the chin of a subject).
- the skin is on the shoulders, chest, or back.
- dermal dysbiosis includes a change in microbiota commensal species diversity as compared to a healthy or general population and may include decrease of beneficial microorganisms and/or increase of pathobionts (pathogenic or potentially pathogenic microorganisms) and/or decrease of overall microbiota species diversity. Many factors can lead to dysbiosis, including hormonal changes (e.g., during adolescence), infrequent washing, cosmetic use, antibiotic use, psychological and physical stress, radiation, and dietary changes.
- compositions are administered to a subject suffering from acne in a "therapeutically effective dose.” Amounts effective for this use may depend upon the severity of the disease and the general state of the patient's health. Single or multiple administrations of the compositions may be administered depending on the dosage and frequency as required and tolerated by the patient.
- a "patient” or “subject” includes both humans and other animals, particularly mammals. Thus the methods are applicable to both human therapy and veterinary applications.
- “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the present invention without causing a significant adverse toxicological effect on the patient.
- Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethy cellulose, polyvinyl pyrrolidine, and colors, and the like.
- Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the bacteriophages, probiotic bacteria, and/or compounds of the invention.
- auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the bacteriophages, probiotic bacteria, and/or compounds of the invention.
- auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the bacteri
- the term "contacting" may include allowing two species to react, interact, or physically touch, wherein the two species may be, for example, an enzyme as described herein and a biofilm that includes a substrate of the enzyme.
- the two species may be a bacteriophage and a cell of a species that the bacteriophage infects.
- contacting includes, for example, allowing a bacteriophage as described herein to interact with a P. acnes cell.
- contacting includes, for example, allowing an enzyme as described herein to interact with a P. acnes biofilm.
- "Patient” or “subj ect in need thereof refers to a living member of the animal kingdom suffering from or who may suffer from the indicated disorder.
- the subject is a member of a species that includes individuals who naturally suffer from the disease.
- the subject is a mammal.
- mammals include rodents (e.g., mice and rats), primates (e.g., lemurs, bushbabies, monkeys, apes, and humans), rabbits, dogs (e.g., companion dogs, service dogs, or work dogs such as police dogs, military dogs, race dogs, or show dogs), horses (such as race horses and work horses), cats (e.g. , domesticated cats), livestock (such as pigs, bovines, donkeys, mules, bison, goats, camels, and sheep), and deer.
- the subject is a human.
- the abbreviation "sp.” for species means at least one species (e.g., 1, 2, 3, 4, 5, or more species) of the indicated genus.
- the abbreviation "spp.” for species means 2 or more species (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) of the indicated genus.
- methods and compositions provided herein comprise a single species within an indicated genus or indicated genera, or 2 or more (e.g., a plurality that includes more than 2) species within an indicated genus or indicated genera.
- 1, 2, 3, 4, 5, or more or all or the indicated species is or are isolated.
- the indicated species are administered together.
- each of the indicated species is present in a single composition that includes each of the species.
- each of the species is administered concurrently, e.g. , within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 30, or 60, 1-5, 1-10, 1-30, 1-60, or 5-15 seconds or minutes of each other.
- phrases such as "at least one of or "one or more of may occur followed by a conjunctive list of elements or features.
- the term “and/or” may also occur in a list of two or more elements or features. Unless otherwise implicitly or explicitly contradicted by the context in which it is used, such a phrase is intended to mean any of the listed elements or features individually or any of the recited elements or features in combination with any of the other recited elements or features.
- the phrases “at least one of A and ⁇ ;” “one or more of A and ⁇ ;” and “A and/or B” are each intended to mean "A alone, B alone, or A and B together.”
- a similar interpretation is also intended for lists including three or more items.
- phrases “at least one of A, B, and C;” “one or more of A, B, and C;” and “A, B, and/or C” are each intended to mean “A alone, B alone, C alone, A and B together, A and C together, B and C together, or A and B and C together.”
- use of the term “based on,” herein and in the claims is intended to mean, “based at least in part on,” such that an unrecited feature or element is also permissible.
- treating or “treatment” of a condition, disease or disorder or symptoms associated with a condition, disease or disorder refers to an approach for obtaining beneficial or desired results, including clinical results.
- beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of condition, disorder or disease, stabilization of the state of condition, disorder or disease, prevention of development of condition, disorder or disease, prevention of spread of condition, disorder or disease, delay or slowing of condition, disorder or disease progression, delay or slowing of condition, disorder or disease onset, amelioration or palliation of the condition, disorder or disease state, and remission, whether partial or total.
- Treating can also mean inhibiting the progression of the condition, disorder or disease, slowing the progression of the condition, disorder or disease temporarily, although in some instances, it involves halting the progression of the condition, disorder or disease permanently.
- the terms can refer to reducing, e.g. , dermal dysbiosis and/or the number or size of cystic lesions, whiteheads (closed plugged pores), blackheads (open plugged pores— in which oil exposed to the air has a dark color, e.g. , brown or black), mall red, tender bumps (papules), pimples (pustules; papules with pus at their tips), large, solid, painful lumps beneath the surface of the skin (nodules).
- treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of an established disease, condition, or symptom of the disease or condition.
- a method for treating a disease is considered to be a treatment if there is a 10% reduction in one or more symptoms of the disease in a subject as compared to a control.
- the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels.
- treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition.
- references to decreasing, reducing, or inhibiting include a change of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater as compared to a control level and such terms can include but do not necessarily include complete elimination.
- Treatment can refer to any delay in onset, amelioration of symptoms, improvement in patient skin appearance, etc. The effect of treatment can be compared to an individual or pool of individuals not receiving the treatment, or to the same patient prior to treatment or at a different time during treatment.
- the severity of disease is reduced by at least 10%, as compared, e.g.
- treatment is effective to reduce at least one symptom of acne.
- treatment is effective to reduce the level of pimples (pustules) on the face, forehead, chest, back, and/or shoulders of the subject.
- treatment is effective to reduce the level of whiteheads (closed plugged pores) on the face, forehead, chest, back, and/or shoulders of the subject.
- treatment is effective to reduce the level of blackheads (open plugged pores) on the face, forehead, chest, back, and/or shoulders of the subject.
- treatment is effective to reduce the level of papules on the face, forehead, chest, back, and/or shoulders of the subject. In embodiments, treatment is effective to reduce the level of solid, painful lumps beneath the surface of the skin (nodules) on the face, forehead, chest, back, and/or shoulders of the subject. In embodiments, treatment is effective to reduce the level of cystic lesions on the face, forehead, chest, back, and/or shoulders of the subject.
- the level e.g., number
- the level is reduced compared to before treatment has begun.
- the level (e.g., number) is reduced compared to a corresponding subject who is afflicted with acnes but who has not received treatment.
- the level (e.g., number) is reduced compared to a corresponding subject who is afflicted with acnes but who has not received treatment comprising a bacteriophage.
- a therapeutically effective amount refers to the amount of an agent that is sufficient to ameliorate a disorder, as described herein.
- a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%.
- Therapeutic efficacy can also be expressed as "-fold” increase or decrease.
- a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.
- diagnosis refers to a relative probability a subject has a given metabolic disorder. Symptoms and diagnostic criteria are summarized herein. Similarly, the term “diagnosis” refers to a relative probability a subject has a given metabolic disorder. Symptoms and diagnostic criteria are summarized herein. Similarly, the term “diagnosis” refers to a relative probability a subject has a given metabolic disorder. Symptoms and diagnostic criteria are summarized herein. Similarly, the term “diagnosis” refers to a relative probability a subject has a given metabolic disorder. Symptoms and diagnostic criteria are summarized herein. Similarly, the term “diagnosis” refers to a relative probability a subject has a given metabolic disorder. Symptoms and diagnostic criteria are summarized herein. Similarly, the term “diagnosis” refers to a relative probability a subject has a given metabolic disorder. Symptoms and diagnostic criteria are summarized herein. Similarly, the term
- prognosis refers to a relative probability that a certain future outcome may occur in the subject.
- prognosis can refer to the likelihood that an individual will develop acne.
- Prognosis can also refer to the likely severity of the disease (e.g., severity of symptoms, rate of functional decline, etc.). The terms are not intended to be absolute, as will be appreciated by any one of skill in the field of medical diagnostics. COMPOSITIONS AND COMBINATIONS COMPRISING BACTERIOPHAGES
- composition comprising, consisting essentially of, or consisting of at least one P. acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier.
- composition that includes at least one
- Propionibacterium acnes bacteriophage no more than one anti-acne compound, and a pharmaceutically acceptable carrier.
- composition that includes active ingredients consisting of at least one Propionibacterium acnes bacteriophage and no more than one anti-acne compound, and a pharmaceutically acceptable carrier.
- composition that includes at least one P. acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier, wherein the composition does not comprise a probiotic bacterium.
- the at least one anti-acne compound is benzoyl peroxide.
- the benzoyl peroxide is present at a concentration of 2.5% to 10%
- the benzoyl peroxide is present at a concentration of less than 2.5% but greater than about 0.1%, 0.5%, 1%, 1.5%, or 2% (weight/volume). In embodiments, the benzoyl peroxide is present at a concentration of 2.5% to 10%, e.g. , about 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% (weight/volume). In embodiments, the benzoyl peroxide is present at a concentration of less than 2.5% but greater than about 0.1%, 0.5%, 1%, 1.5%, or 2% (weight/volume).
- the at least one anti-acne compound is salicylic acid.
- the salicylic acid is present at a concentration of 0.5% to 2% (weight/volume). In embodiments, the salicylic acid is present at a concentration of less than 0.5% but greater than about 0.1% (weight/volume). In embodiments, the salicylic acid is present at a concentration of 0.5% to 2%, e.g. , about 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, or 2% (weight/volume).
- the salicylic acid is present at a concentration of less than 0.5% but greater than about 0.1% (weight/volume).
- the at least one anti-acne compound is sulfur.
- the sulfur is present at a concentration of 3% to 10% (weight/volume).
- the sulfur is present at a concentration of less than 3% but greater than about 0.1%, 0.5%, 1%, 1.5%, 2%, or 2.5% (weight/volume).
- the sulfur is present at a concentration of 3% to 10%, e.g.
- the sulfur is present at a concentration of less than 3% but greater than about 0.1%, 0.5%, 1%, 1.5%, 2%, or 2.5% (weight/volume).
- resorcinol is present at a concentration of 2% and sulfur is present at a concentration of 3% to 8% (e.g. , about 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, or 8%)
- the at least one anti-acne compound is resorcinol and sulfur.
- the resorcinol is present at a concentration of 2% and sulfur is present at a concentration of 3% to 8% (weight/volume).
- resorcinol is present at a concentration of 2% and sulfur is present at a concentration of 3% to 8% (e.g. , about 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, or 8%) (weight/volume).
- the at least one anti-acne compound includes resorcinol monoacetate and sulfur.
- the resorcinol monoacetate is present at a concentration of 3% and sulfur is present at a concentration of 3% to 8% (weight/volume).
- resorcinol monoacetate is present at a concentration of 3% and sulfur is present at a concentration of 3% to 8% (e.g. , about 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, or 8%)
- the P. acnes bacteriophage is present in an amount of about lxlO 6 , 2xl0 6 , 3xl0 6 , 4xl0 6 , 5xl0 6 , 6xl0 6 , 7xl0 6 , 8xl0 6 , 9xl0 6 , lxlO 7 , 2xl0 7 , 3xl0 7 , 4xl0 7 , 5xl0 7 , 6xl0 7 , 7xl0 7 , 8xl0 7 , 9xl0 7 , lxlO 8 , 2xl0 8 , 3xl0 8 , 4xl0 8 , 5xl0 8 , 6xl0 8 , 7xl0 8 , 8xl0 8 , 9xl0 8 , lxlO 9 , 2xl0 9 , 3xl0 9 , 4xl0 9 , 5xl0 9 , 6xl0 8 , 7x
- the P. acnes bacteriophage is present in an amount of about lxl 0 6 to lxl 0 8 , about lxlO 8 to lxlO 9 , about lxlO 9 to lxlO 10 , about lxlO 9 to lxlO 11 or about lxlO 10 to lxlO 11 pfu.
- a probiotic bacterium is present in an amount of about lxlO 6 , 2xl0 6 , 3xl0 6 , 4xl0 6 , 5xl0 6 , 6xl0 6 , 7xl0 6 , 8xl0 6 , 9xl0 6 , lxlO 7 , 2xl0 7 , 3xl0 7 , 4xl0 7 , 5xl0 7 , 6xl0 7 , 7xl0 7 , 8xl0 7 , 9xl0 7 , lxlO 8 , 2xl0 8 , 3xl0 8 , 4xl0 8 , 5xl0 8 , 6xl0 8 , 7xl0 8 , 8xl0 8 , 9xl0 8 , lxlO 9 , 2xl0 9 , 3xl0 9 , 4xl0 9 , 5xl0 9 , 6xl0 8 , 7xl0 8
- the probiotic bacterium is present in an amount of about lxlO 6 to lxlO 11 cfu. In embodiments, the probiotic bacterium is present in an amount of about lxlO 6 to lxlO 8 , about lxlO 8 to lxlO 9 , about lxlO 9 to lxlO 10 , about lxlO 9 to lxlO 11 or about lxlO 10 to lxlO 11 cfu.
- the anti-acne compound is an antibiotic, a retinoid, or an alpha- hydroxy acid.
- composition that includes a P. acnes bacteriophage and an enzyme.
- a combination comprising, consisting essentially of, or consisting of at least one P. acnes bacteriophage, at least one anti-acne compound, wherein each of the at least one P. acnes bacteriophage and the at least one anti-acne compound is in a composition that further includes a pharmaceutically acceptable carrier.
- a combination that includes a P. acnes bacteriophage and an enzyme.
- the P. acnes bacteriophage has a linear double stranded DNA genome.
- the P. acnes bacteriophage is within the bacteriophage family
- the bacteriophage is a wild-type bacteriophage.
- the bacteriophage has a genome with a nucleotide sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the genomic sequence of a wild-type P. acnes bacteriophage.
- a non-limiting example of an genomic sequence for a wild-type P. acnes bacteriophage is as follows:
- the bacteriophage is a bacteriophage as deposited under Accession No. NCIMB 41349, 41350, or 41351.
- the bacteriophage has a genome with a nucleotide sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the genome of the bacteriophage deposited under Accession No.
- the bacteriophage has a genome with a nucleotide sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the genome of the bacteriophage deposited under Accession No. NCIMB 41350.
- the bacteriophage has a genome with a nucleotide sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the genome of the bacteriophage deposited under Accession No. NCIMB 41351.
- the bacteriophage has a genome with a nucleotide sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the nucleotide sequence of SEQ ID NO: 1.
- the bacteriophage has a genome with a nucleotide sequence that is identical to the nucleotide sequence of SEQ ID NO: 1.
- the genome of the bacteriophage encodes, from the 5 ' to the 3' end, a small terminase, a large terminase, a portal protein, gp4, a scaffold protein, a maj or head protein, gp7, gp8, gp9, gpl O, a maj or tail protein, gpl2, gpl3, a tape measure protein, a minor tail subunit, optionally a protease, gpl 7, gpl 8, a tail protein, an amidase, a holin, gp22, gp23, a sigma factor, gp25, gp26, gp27, gp28, gp29, gp30, a DNA primase, a DNA primase 2, gp33, a DNA helicase, gp35, gp36, an exonuclease, gp38, g
- the composition further includes a P. acnes biofilm degrading enzyme.
- the enzyme is an anti-aging enzyme.
- the anti-aging enzyme is a superoxide dismutase or a peroxidase.
- the enzyme is a P. acnes biofilm degrading enzyme.
- the enzyme is a glycosidase, a protease, a DNAse, or a restriction endonuclease.
- the enzyme is a glycosidase.
- the glycosidase is a glycoside hydrolase.
- the enzyme catalyzes the hydrolysis of linear polymers of N-acetyl- D-glucosamines.
- the enzyme is a ⁇ -hexosaminidase.
- the enzyme hydrolyzes -l,6-glycosidic linkages of acetylglucosamine polymers.
- the enzyme is a DNAse I, a restriction endonuclease, papain, bromelain, Trypsin, Proteinase K, Subtilisin, serratiopeptidase, dispersin, alginate lyase, amylase, or cellulase.
- the enzyme is Dispersin B.
- the enzyme is a protease, and the protease is proteinase K or subtilisin.
- the enzyme is a dispersin.
- the enzyme is Dispersin B.
- the enzyme is a naturally occurring form, homolog, isoform or variant of a dispersin (such as Dispersin B) that maintains the enzymatic activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes Dispersin B is as follows:
- Dispersin B amino acid sequence is as follows:
- the enzyme is an alginate lyase.
- the enzyme is a naturally occurring form, a homolog, an isoform or a variant of an alginate lyase that maintains the enzymatic activity of the alginate lyase (e.g. , within at least 50%, 80%, 90%, 95%, 96%,
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes an alginate lyase is as follows:
- alginate lyase amino acid sequence is as follows:
- the enzyme is an amylase.
- enzyme is a naturally occurring form, a homolog, an isoform or a variant of an amylase that maintains the enzymatic activity of the amylase (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes an amylase is as follows:
- amylase amino acid sequence is as follows:
- the enzyme is a cellulase.
- enzyme is a naturally occurring form, a homolog, an isoform or a variant of a cellulase that maintains the enzymatic activity of the cellulase (e.g. , within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes a cellulase is as follows: ATGAAGTTTCAGAGCACTTTGCTTCTTGCCGCCGCGGCTGGTTCCGCGTTGGCTGTGTGTGTG
- a non-limiting example of a cellulase amino acid sequence is as follows:
- the enzyme is proteinase K.
- the enzyme is a naturally occurring form, a homolog, an isoform or a variant of proteinase K that maintains the enzymatic activity of proteinase K (e.g. , within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes proteinase K is as follows:
- a non-limiting example of a proteinase K amino acid sequence is as follows:
- the enzyme is subtilisin.
- the enzyme is a naturally occurring form, a homolog, an isoform or a variant of subtilisin that maintains the enzymatic activity of subtilisin (e.g. , within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes subtilisin is as follows:
- a non-limiting example of a subtilisin amino acid sequence is as follows:
- the enzyme is trypsin.
- the enzyme is a naturally occurring form, a homolog, an isoform or a variant of trypsin that maintains the enzymatic activity of trypsin (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes trypsin is as follows:
- a non-limiting example of a trypsin amino acid sequence is as follows:
- the enzyme is serratiopeptidase.
- the enzyme is a naturally occurring form, a homolog, an isoform or a variant of serratiopeptidase that maintains the enzymatic activity of serratiopeptidase (e.g. , within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- a non-limiting example of a DNA sequence that encodes serratiopeptidase is as follows:
- a non-limiting example of a serratiopeptidase amino acid sequence is as follows:
- the enzyme is a DNAse.
- the enzyme is a naturally occurring form, a homolog, an isoform or a variant of a DNAse that maintains the enzymatic activity of the DNAse (e.g. , within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
- variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
- the enzyme is a DNAse I.
- the DNAse I is bovine pancreatic DNAse I.
- a non-limiting example of a DNA sequence that encodes a bovine pancreatic DNAse I is as follows:
- a non-limiting example of a bovine pancreatic DNAse I amino acid sequence is as follows:
- the composition or combination includes a probiotic bacterium.
- the probiotic bacterium is a probiotic a P. sp., Staphylococcus sp., and/or Corynebacterium sp. bacterium.
- the probiotic bacterium is a bacterium within the class
- the probiotic bacterium is a probiotic P. acnes bacterium.
- the P. acnes bacterium (a) has a 16S ribosomal DNA (rDNA) sequence with a T992C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (b) has a 16S rDNA sequence with a T838C mutation compared to the
- the P. acnes bacterium (a) produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture; (b) produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level of lipase that is produced by a pathogenic P.
- the combination or composition includes at least one additional probiotic bacterium.
- the at least one additional probiotic bacterium includes
- Propionibacterium granulosum and/or Propionibacterium avidum are Propionibacterium granulosum and/or Propionibacterium avidum.
- a pathogenic P. acnes strain (a) has a 16S rDNA sequence with a G1058C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (b) has a 16S rDNA sequence with a G1058C and an A1201C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (c) has a 16S rDNA sequence with a G529A mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (d) has a 16S rDNA sequence with a G1004A and a T1007C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (e) has a 16S rDNA sequence with a G1268A mutation compared to the KPA171202 type strain 16S rDNA sequence
- the combination or composition further includes at least one additional P. acnes bacteriophage.
- the composition or combination includes a pharmaceutically acceptable carrier.
- the pharmaceutically acceptable carrier includes an emulsion.
- the emulsion is an oil-in-water emulsion or a water-in-oil emulsion.
- a combination or combination includes or is in the form of a cream, lotion, suspension, or aqueous solution.
- a composition that includes a bacteriophage is provided.
- the composition is formulated for topical application to the skin (i.e. , the composition is a topical composition).
- the composition is a pharmaceutical composition.
- a pharmaceutical composition including a wild-type P. acnes bacteriophage and an isolated probiotic P. acnes bacterium.
- the composition further includes a pharmaceutically acceptable carrier.
- a pharmaceutical composition including a bacteriophage and/or an isolated probiotic P. acnes bacterium and a pharmaceutically acceptable carrier.
- the pharmaceutical composition is formulated for topical
- the pharmaceutically acceptable carrier includes an emulsion.
- the emulsion is an oil-in-water emulsion or a water-in-oil emulsion.
- the pharmaceutical composition is in the form of a cream, lotion, suspension, or aqueous solution.
- a composition or combination includes at least about 2, 3, 4, 5, 6, 7, 8, 9, or 10 P. acnes bacteriophages.
- the P. acnes bacteriophages include more than one type of P. acnes bacteriophage.
- a combination or composition including an isolated probiotic P. acnes bacterium may further comprise at least one additional bacterium.
- a P. acnes bacterium has a 16S rDNA sequence that includes a
- the P. acnes bacterium includes a
- the P. acnes bacterium is the Prol strain. In embodiments, the P. acnes bacterium includes a 16S rDNA sequence with a
- the P. acnes bacterium is the ProII strain.
- the P. acnes bacterium includes a 16S rDNA sequence with a T992C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (b) includes a 16S rDNA sequence with a T838C mutation compared to the KPA171202 type strain
- ID NO: 2 includes a 16S rDNA sequence with a C986T mutation compared to the
- the P. acnes bacterium has a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 3 or 4.
- the P. acnes bacterium (a) produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture; (b) produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level of lipase that is produced by a pathogenic P.
- acnes strain when grown in an adherent culture; (c) adheres to epithelial cells at least 50% less than a pathogenic P. acnes strain; and/or (d) is less inflammatory than a pathogenic P. acnes strain.
- acnes strain (a) has a 16S rDNA sequence with a G1058C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (b) has a 16S rDNA sequence with a G1058C and an A1201C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (c) has a 16S rDNA sequence with a G529A mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (d) has a 16S rDNA sequence with a G1004A and a T1007C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (e) has a 16S rDNA sequence with a G1268A mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (f)
- SEQ ID NO: 2 is the 16S rDNA sequence for the KPA171202 type strain, and is as follows: 1 TTTTTCATTG GAGAGTTTGA TCCTGGCTCA GGACGAACGC TGGCGGCGTG CTTAACACAT 61 GCAAGTCGAA CGGAAAGGCC CTGCTTTTGT GGGGTGCTCG AGTGGCGAAC GGGTGAGTAA 121 CACGTGAGTA ACCTGCCCTT GACTTTGGGA TAACTTCAGG AAACTGGGGC TAATACCGGA 181 TAGGAGCTCC TGCTGCATGG TGGGGGTTGG AAAGTTTCGG CGGTTGGGGA TGGACTCGCG 241 GCTTATCAGC TTGTTGGTGG GGTAGTGGCT TACCAAGGCT TTGACGGGTA GCCGGCCTGA 301 GAGGGTGACC GGCCACATTG GGACTGAAAT ACGGCCCAGA CTCCTACGGG AGGCAGCAGT 361 GGGGAATATT GCACAATGGG
- SEQ ID NO: 3 is the 16S rDNA sequence for the Prol probiotic strain, and is as follows:
- SEQ ID NO: 4 is the 16S rDNA sequence for the ProII probiotic strain, and is as follows:
- the P. acnes bacterium produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture.
- the P. acnes bacterium produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture.
- the P. acnes bacterium produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level
- acnes bacterium produces about 1-5%, 1-10%, 1-20%, 1-30%, 5-50%, 5-40%, 5-30%, 5-20%, 5-10%, 10-50%, 10-40%, 10-30%, 10-20%, 20-50%, 20-40%, or 20-30% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture.
- the P. acnes bacterium produces less than about 5% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture.
- the P. acnes bacterium produces less than about 10% of the level of lipase that is produced by a pathogenic P.
- the P. acnes bacterium produces less than about 20% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture. In embodiments, the P. acnes bacterium produces less than about 30% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture. In embodiments, the P. acnes bacterium produces less than about 40% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture. In embodiments, the P.
- acnes bacterium produces less than about 50% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in a planktonic culture. In embodiments, the P. acnes bacterium produces less than about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture. In embodiments, the P. acnes bacterium produces less than about 5% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture. In embodiments, the P.
- acnes bacterium produces less than about 10% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture. In embodiments, the P. acnes bacterium produces less than about 20% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture. In embodiments, the P. acnes bacterium produces less than about 30% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture. In embodiments, the P. acnes bacterium produces less than about 40% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture. In embodiments, the P.
- acnes bacterium produces less than about 50% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture.
- the P. acnes bacterium produces about 1-5%, 1-10%, 1-20%, 1-30%, 5-50%, 5-40%, 5-30%, 5- 20%, 5-10%, 10-50%, 10-40%, 10-30%, 10-20%, 20-50%, 20-40%, or 20-30% of the level of lipase that is produced by a pathogenic P. acnes strain when grown in an adherent culture.
- the lipase is extracellular lipase.
- the level of lipase produced by a P. acnes bacterium is the level of lipase in culture supernatant.
- the culture supernatant is filtered.
- the culture supernatant is from a liquid (planktonic) culture.
- the culture supernatant is from an adherent culture.
- Non-limiting examples of methods for detecting a level of lipase include absorbance, Bradford protein assays, Biuret test derived assays, fluorescamine, amino black, colloidal gold, nitrogen detection, High-performance liquid chromatography (HPLC), Liquid chromatography-mass spectrometry (LC/MS), enzyme-linked immunosorbent assay (ELISA), protein immunoprecipitation, Immunoelectrophoresis, and Western blot.
- the P. acnes bacterium adheres to epithelial cells at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% less than a pathogenic P. acnes strain. In embodiments, the P. acnes bacterium adheres to epithelial cells at least about 50% less than a pathogenic P. acnes strain. In embodiments, the P. acnes bacterium adheres to epithelial cells at least about 60% less than a pathogenic P. acnes strain. In embodiments, the P. acnes bacterium adheres to epithelial cells at least about 70% less than a pathogenic P.
- the P. acnes bacterium adheres to epithelial cells at least about 80% less than a pathogenic P. acnes strain. In embodiments, the P. acnes bacterium adheres to epithelial cells at least about 90% less than a pathogenic P. acnes strain. In embodiments, the P. acnes bacterium adheres to epithelial cells 1- 5%, 1-10%, 1-20%, 1-30%, 5-50%, 5-40%, 5-30%, 5-20%, 5-10%, 10-50%, 10-40%, 10-30%, 10-20%, 20-50%, 20-40%, 20-30%, 50-60, 50-70, 50-80, 50-90, 60-80, 70-90 less than a pathogenic P. acnes strain.
- adherence of a P. acnes bacterium e.g., a probiotic or a pathogenic P. acnes bacterium, such as for comparison
- epithelial cells are determined using A-432 epithelial cells.
- the epithelial cells are confluent on a tissue culture plate or flask.
- adherence is detected by determining a number of colonies that are formed by P. acnes bacteria that have adhered to cultured epithelial cells.
- the P. acnes bacterium is less inflammatory than a pathogenic P. acnes strain.
- a P. acnes bacterium is less inflammatory than a pathogenic P. acnes strain if a lower level of an inflammatory cytokine (e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% less) is released by an immune cell that contacts the P. acnes bacterium or a compound produced by the P. acnes bacterium compared to a bacterium of the pathogenic P. acnes strain or a compound produced by the bacterium of the pathogenic P. acnes strain.
- a P. acnes bacterium is less inflammatory than a pathogenic P.
- tissue such as skin tissue
- the tissue is skin tissue.
- the tissue is ear tissue, e.g. , of a mouse.
- the inflammatory cytokine is IL- ⁇ , IL-6, IL-17, or TNFa, or any combination thereof.
- the pathogenic P. acnes strain (a) has a 16S rDNA sequence with a G1058C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (b) has a 16S rDNA sequence with a G1058C and an A1201C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (c) has a 16S rDNA sequence with a G529A mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (d) has a 16S rDNA sequence with a G1004A and a T1007C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (e) has a 16S rDNA sequence with a G1268A mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO:
- SEQ ID NO: 5 is as follows (mutations compared to the 16S sequence of the type strain KPA171202 are underlined):
- SEQ ID NO: 6 is as follows (a mutation compared to the 16S sequence of the type strain KPA171202 is underlined):
- SEQ ID NO: 7 is as follows (a mutation compared to the 16S sequence of the type strain KPA171202 is underlined):
- SEQ ID NO: 8 is as follows (mutations compared to the 16S sequence of the type strain KPA171202 are underlined):
- SEQ ID NO: 9 is as follows (a mutation compared to the 16S sequence of the type strain KPA171202 is underlined):
- SEQ ID NO: 10 is as follows (mutations compared to the 16S sequence of the type strain KPA171202 are underlined):
- the at least one additional bacterium comprises, consists essentially of, or consists of a probiotic bacterium.
- the at least one bacterium includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bacterial strains and/or species, less than about 10, 9, 8, 7, 6, 5, 4, 3, or 2 bacterial strains and/or species, or 1-10, 2-10, 3-10, 4-10, 5-10, 1-5, 2-5, 3-5, or 4-5 bacterial strains and/or species.
- the at least one bacterium includes a plurality of bacterial strains and/or species, e.g. , at least about 2, 3, 4, 5, 6, 7, 8, 9, 10 bacterial strains and/or species.
- the least one bacterium includes an isolated Propionibacterium granulosum bacterium, an isolated Propionibacterium avidum bacterium, an isolated
- the least one bacterium includes 1, 2 (of any combination of), 3 (of any combination of), 4 (of any combination of), or 5 of an isolated Propionibacterium granulosum bacterium, an isolated Propionibacterium avidum bacterium, an isolated Staphylococcus epidermidis bacterium, an isolated Staphylococcus aureus bacterium, and/or an isolated Corynebacterium jeikeium bacterium.
- a composition or combination provided herein includes an enhancing peptide or enzyme.
- the enhancing peptide or enzyme has one or more or any combination of the following properties: biofilm degradation, improving skin penetration, antibacterial, reducing inflammation (e.g. , of the skin), reducing irritation (e.g. , of the skin), reducing redness (e.g. , of the skin), firming skin, removing lines, removing wrinkles, or otherwise improving appearance (e.g. , of the skin).
- a composition that includes a P. acnes bacteriophage and an anti-acne compound is provided.
- the composition includes a pharmaceutically acceptable carrier.
- the dose of the P. acnes bacteriophage is adjusted (e.g., increased or decreased) for stability.
- the dose of the P. acnes bacteriophage is adjusted up or down depending on the anti-acne compound to adjust for its stability in combination with the anti-acne compound.
- a combination or system that includes a P. acnes bacteriophage and one or more anti-acne compounds.
- the bacteriophage is within one composition (e.g. , within one vessel such as a bottle, tube, or other container), and the one or more anti-acne compounds are in a separate composition (within another vessel such as a bottle, tube, or other container).
- the composition that includes the bacteriophage includes a pharmaceutically acceptable carrier.
- the composition that includes the anti-acne compound includes a pharmaceutically acceptable carrier.
- an additional one or more compounds e.g.
- an enzyme, a hydrating compound, an ultraviolet radiation absorbing or blocking compound, etc. are present in the composition that includes the bacteriophage, the composition that includes the one or more anti-acne compounds, or a third separate composition (within a third vessel such as a bottle, tube, or other container).
- one or more probiotic bacteria are present in the composition that includes the bacteriophage, the composition that includes the one or more anti-acne compounds, or a third separate composition (within a third vessel such as a bottle, tube, or other container).
- the combination or system further includes instructions for administration.
- the combination or system includes at least about 2, 3, 4, 5, 6, 7, 8, 9, or 10 P. acnes bacteriophages.
- a combination or system that includes a P. acnes bacteriophage and one or more probiotic bacteria and/or one or more compounds (such as one or more enzymes or antiacne compounds) is provided.
- the bacteriophage is within one composition (e.g., within one vessel such as a bottle, tube, or other container), and the one or more probiotic bacteria are in a separate composition (within another vessel such as a bottle, tube, or other container), and optionally, an additional one or more compounds are present in the composition that includes the bacteriophage, the composition that includes the one or more probiotic bacteria, or a third separate composition (within a third vessel such as a bottle, tube, or other container).
- the combination or system further includes instructions for administration.
- the combination or system includes at least about 2, 3, 4, 5, 6, 7, 8, 9, or 10 P. acnes bacteriophages.
- a system, combination, or composition includes an enzyme such as a biofilm degradation enzyme or an anti-aging enzyme.
- biofilm degradation enzymes include DNAses (e.g., DNAse I), proteases (e.g., papain, bromelain, Trypsin, Proteinase K, Subtilisin, or serratiopeptidase), glycosidases (e.g., dispersin, alginate lyase, amylase, or cellulase).
- Non-limiting examples of anti-aging enzymes include superoxide dismutase, and peroxidase.
- a system, combination, or composition includes a topical retinoid, an antibiotic, and/or an alpha-hydroxy acid.
- a system or composition further includes a topical retinoid.
- a system or composition further includes an antibiotic.
- a system or composition further includes an alpha-hydroxy acid.
- the system or composition further includes benzoyl peroxide, salicylic acid, sulfur, resorcinol, resorcinol monoacetate, or any combination thereof.
- the benzoyl peroxide is present at a concentration of 2.5% to 10%, e.g. , about 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% (weight/volume).
- the benzoyl peroxide is present at a concentration of less than 2.5% but greater than about 0.1%, 0.5%, 1%, 1.5%, or 2% (weight/volume).
- the salicylic acid is present at a concentration of 0.5% to 2%, e.g., about 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, or 2% (weight/volume).
- the salicylic acid is present at a concentration of less than 0.5% but greater than about 0.1%
- the sulfur is present at a concentration of 3% to 10%, e.g. , about 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% (weight/volume).
- the sulfur is present at a concentration of less than 3% but greater than about 0.1%, 0.5%, 1%, 1.5%, 2%, or 2.5% (weight/volume).
- resorcinol is present at a concentration of 2% and sulfur is present at a concentration of 3% to 8% (e.g. , about 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, or 8%)
- resorcinol monoacetate is present at a concentration of 3% and sulfur is present at a concentration of 3% to 8% (e.g., about 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, or 8%) (weight/volume).
- the resorcinol is present at a concentration of less than 2% but greater than about 0.1%, 0.5%, 1%, 1.5% (weight/volume).
- the resorcinol monoacetate is present at a concentration of less than 3% but greater than about 0.1%, 0.5%, 1%, 1.5%, 2%, or 2.5% (weight/volume).
- a composition provide herein includes a moisturizer.
- a method of preventing or treating acne in a subject in need thereof including administering an effective amount of a composition or combination provided herein.
- an effective amount of a composition including administering an effective amount of a composition or combination provided herein.
- compositions comprising, consisting essentially of, or consisting of at least one P. acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier is administered to the subject.
- an effective amount of a composition that includes at least one P. acnes bacteriophage, at least one anti-acne compound and a pharmaceutically acceptable carrier, wherein the composition does not comprise a probiotic bacterium is administered to the subject.
- an effective amount of a composition that includes a P. acnes bacteriophage and an enzyme is administered to the subject.
- an effective amount of a composition that includes a bacteriophage as described herein, including embodiments thereof, is administered to the subject.
- the bacteriophage is a wild-type bacteriophage. [0162] In embodiments, the bacteriophage is administered topically. In embodiments, the bacteriophage is in a composition (e.g. , a pharmaceutical or cosmetic composition) that further includes a pharmaceutically or cosmetically acceptable carrier.
- a composition e.g. , a pharmaceutical or cosmetic composition
- the method further includes administering a probiotic bacterium to the subject.
- a method of treating acne in a subject in need thereof includes administering an effective amount of a probiotic P. acnes bacterium to the subject. In embodiments, the method further includes administering a bacteriophage to the subject.
- the P. acnes bacterium has a 16S rDNA sequence that includes a T992C, T838C, C1322T, and/or a C986T mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2.
- the P. acnes bacterium includes a 16S rDNA sequence with a T838C and a C1322T mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2.
- the P. acnes bacterium is the Prol strain.
- acnes bacterium includes a 16S rDNA sequence with a C986T and a T992C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2.
- the P. acnes bacterium is the ProII strain.
- the P. acnes bacterium includes a 16S rDNA sequence with a T992C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2; (b) includes a 16S rDNA sequence with a T838C mutation compared to the
- the at least one additional bacterium comprises, consists essentially of, or consists of a probiotic bacterium.
- the at least one bacterium includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bacterial strains and/or species, less than about 10, 9, 8, 7, 6, 5, 4, 3, or 2 bacterial strains and/or species, or 1-10, 2-10, 3-10, 4-10, 5-10, 1-5, 2-5, 3-5, or 4-5 bacterial strains and/or species.
- the at least one bacterium includes a plurality of bacterial strains and/or species, e.g. , at least about 2, 3, 4, 5, 6, 7, 8, 9, 10 bacterial strains and/or species.
- the least one bacterium includes a Propionibacterium sp.,
- the least one bacterium includes bacterium within the class Betaproteobacteria. In embodiments, the least one bacterium includes an isolated Propionibacterium granulosum bacterium, an isolated Propionibacterium avidum bacterium, an isolated Staphylococcus epidermidis bacterium, an isolated Staphylococcus aureus bacterium, and/or an isolated Corynebacterium jeikeium bacterium.
- the least one bacterium includes 1, 2, 3, 4, or 5 of an isolated Propionibacterium granulosum bacterium, an isolated Propionibacterium avidum bacterium, an isolated Staphylococcus epidermidis bacterium, an isolated Staphylococcus aureus bacterium, and/or an isolated Corynebacterium jeikeium bacterium.
- the subject has been administered a bacteriophage as described herein, including embodiments thereof.
- the subject has been administered an antibiotic that kills P. acnes.
- the antibiotic is clindamycin, doxycycline, erythromycin, or tetracycline, or a derivative of clindamycin, doxycycline, erythromycin, or tetracycline.
- the antibiotic is clindamycin, doxycycline, erythromycin, or tetracycline, or a derivative of clindamycin, doxycycline, erythromycin, or tetracycline.
- the method further includes administering an enzyme to the subject such as a biofilm degradation enzyme or an anti-aging enzyme.
- biofilm degradation enzymes include DNAses (e.g., DNAse I), restriction endonucleases, proteases (e.g., papain, bromelain, Trypsin, Proteinase K, Subtilisin, or serratiopeptidase), glycosidases (e.g., dispersin, alginate lyase, amylase, or cellulase).
- Non-limiting examples of anti-aging enzymes include superoxide dismutase, and peroxidase.
- the method further includes administering a topical retinoid, an antibiotic, and/or an alpha-hydroxy acid. In embodiments, the method further includes administering a topical retinoid. In embodiments, the method further includes administering an antibiotic. In embodiments, the method further includes administering an alpha-hydroxy acid. In embodiments, the method further includes administering benzoyl peroxide, salicylic acid, sulfur, resorcinol, and/or resorcinol monoacetate to the subject. In embodiments, the method further includes administering benzoyl peroxide. In embodiments, the method further includes administering salicylic acid. In embodiments, the method further includes administering sulfur. In embodiments, the method further includes administering resorcinol and/or sulfur. In embodiments, the method further includes administering resorcinol and/or resorcinol monoacetate.
- the method further includes administering an enhancing peptide or enzyme.
- the enhancing peptide or enzyme has one or more or any combination of the following properties: biofilm degradation, improving skin penetration, antibacterial, reducing inflammation (e.g. , of the skin), reducing irritation (e.g. , of the skin), reducing redness (e.g. , of the skin), firming skin, removing lines, removing wrinkles, or otherwise improving appearance (e.g. , of the skin).
- P. acnes bacteriophages are administered to the subject.
- the P. acnes bacteriophages include more than one types of P. acnes bacteriophage.
- composition that includes a bacteriophage.
- the bacteriophage is present in a composition, such as a therapeutic or cosmetic composition.
- the composition further includes a strain of probiotic bacteria.
- the composition further includes an enzyme that degrades a bacterial biofilms
- the enzyme enhances penetration of the bacteriophage and/or the probiotic bacteria.
- a bacteriophage e.g. , a component thereof
- phage destroys an acne-causing (i.e., pathogenic) strain of P. acnes with a high degree of specificity and efficacy, without killing beneficial skin bacteria.
- the biofilm- degrading enzyme dissolves the biofilm to increase the susceptibility of the pathogen (e.g., by reducing pathogen adherence to host cells and/or by increasing access of the bacteriophage to pathogenic cells).
- the probiotic bacteria are immune to the bacteriophage (e.g., the bacteria lack a cellular receptor to which the bacteriophage specifically binds).
- the probiotic bacteria occupy the niche left by a killed P. acnes pathogenic strain.
- the probiotic bacteria reduce or prevent the recolonization or growth of a subj ect's skin (such as a pore) by surviving pathogenic bacteria.
- compositions for the therapeutic treatment of the skin disease acne includes a lytic P. acnes bacteriophage, and optionally a probiotic bacterium sourced from healthy skin, and/or optionally a biofilm- degrading enzyme in the composition as an adjuvant to increase penetration of the active components.
- a lytic P. acnes bacteriophage infects virulent P. acnes in a skin comedone.
- the bacteriophage replicates and lyses within the P. acnes.
- the P. acnes lyses it releases new virions.
- enzymes unclog the blocked comedones, dissolve the P. acnes biofilms and increase access of virions to P. acnes.
- the exponential proliferation of lytic P. acnes phages rapidly kills the P. acnes with high specificity, without disturbing the growth beneficial skin commensal bacteria.
- the niche vacated by the P. acnes is then be filled by the probiotic bacteria.
- the bacteria are sourced from healthy skin and expand to occupy the niche, thereby preventing any surviving P. acnes bacteria from growing back.
- this strategy helps to balance the skin microbiome in subjects and recalibrates their microbiome toward a healthy skin bacterial community.
- the biofilm-degrading enzyme is in a formulation as an adjuvant that helps unclog blocked comedones and increase access of the phage and probiotic bacteria to the pores.
- a combination that includes a bacteriophage, a probiotic bacterium, and (optionally) an enzyme that enhances the penetration of the bacteriophage is provided.
- the pathogens are killed and the probiotic bacterium replaces the pathogen.
- a "kill and replace" approach to is used to treat acne.
- a biologic that selectively kills pathogenic bacteria that cause acne is administered to a subject.
- probiotic bacteria sourced from healthy skin are applied to occupy the niche of the killed pathogen. In embodiments, this approach avoids the problems of rampant drug resistance associated with antibiotics.
- the presence of actively dividing probiotic bacteria prevents relapses by not allowing any pathogens to grow back.
- dysbiosis on the skin of the subject is treated.
- a microbiome associated with acne is recalibrated into a healthy one.
- the bacteriophage is a naturally occurring P. acnes bacteriophage.
- Non-limiting examples of enzymes that may be co-administered with a bacteriophage include BL00275 from Bacillus licheniformis; DNase I; restriction endonucleases;
- deoxyribonucleases e.g. from Staphylococcus aureus thermonuclease, B. licheniformis NucB, DNase 1L2
- glycoside hydrolases e.g. Dispersin B, alginate lyase, amylase, cellulase, glycanase
- proteases e.g. subtlisin, proteinase K, trypsin, serratiopeptidase.
- Non-limiting examples of probiotic bacteria that may be administered or present in a system or composition include one or more or any combination of the following bacterial species: Propionibacterium acnes, Propionibacterium granulosum, Propionibacterium avidum, Staphylococcus epidermidis, Staphylococcus aureus, and Corynebacterium jeikeium.
- a probiotic bacterial strain is be selected based on its ability to (a) colonize the skin without eliciting an adverse immune response, characterized by low lipase activity and reduced adhesion to human keratinocytes; and (b) occupy a niche similar to Propionibacterium acnes.
- a biofilm degrading enzyme is present in the formulation and acts as an adjuvant, to increase the efficacy of the active ingredients (such as a bacteriophage).
- the enzyme has the capacity to degrade P. acnes biofilms in vitro.
- Embodiments include Embodiments PI to P56 following:
- Embodiment PI A composition consisting essentially of at least one
- Propionibacterium acnes bacteriophage at least one anti-acne compound, and a
- Embodiment P2 A composition comprising at least one Propionibacterium acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier, wherein the composition does not comprise a probiotic bacterium.
- Embodiment P3 The composition of Embodiment P2, wherein the composition further comprises a P. acnes biofilm degrading enzyme.
- Embodiment P4 The composition of any one of Embodiments P1-P3, wherein the at least one anti-acne compound is benzoyl peroxide.
- Embodiment P5 The composition of Embodiment P4, wherein the benzoyl peroxide is present at a concentration of 2.5% to 10% (weight/volume).
- Embodiment P6 The composition of Embodiment P4, wherein the benzoyl peroxide is present at a concentration of less than 2.5% but greater than about 0.1%, 0.5%, 1%, 1.5%, or 2% (weight/volume).
- Embodiment P7 The composition of any one of Embodiments P1-P3, wherein the at least one anti-acne compound is salicylic acid.
- Embodiment P8 The composition of Embodiment P7, wherein the salicylic acid is present at a concentration of 0.5% to 2% (weight/volume).
- Embodiment P9 The composition of Embodiment P7, wherein the salicylic acid is present at a concentration of less than 0.5% but greater than about 0.1% (weight/volume).
- Embodiment P10 The composition of any one of Embodiments P1-P3, wherein the at least one anti-acne compound is sulfur.
- Embodiment PI 1 The composition of Embodiment P10, wherein the sulfur is present at a concentration of 3% to 10% (weight/volume).
- Embodiment P12 The composition of Embodiment P10, wherein the sulfur is present at a concentration of less than 3% but greater than about 0.1%, 0.5%, 1%, 1.5%, 2%, or 2.5% (weight/volume).
- Embodiment PI 3 The composition of any one of Embodiments P1-P3, wherein the at least one anti-acne compound is resorcinol and sulfur.
- Embodiment P14 The composition of Embodiment P13, wherein the resorcinol is present at a concentration of 2% and sulfur is present at a concentration of 3% to 8%
- Embodiment PI 5 The composition of any one of Embodiments P1-P3, wherein the at least one anti-acne compound comprises resorcinol monoacetate and sulfur.
- Embodiment P16 The composition of Embodiment P15, wherein the resorcinol monoacetate is present at a concentration of 3% and sulfur is present at a concentration of 3% to 8% (weight/volume).
- Embodiment PI 7 The composition of any one of Embodiments P1-P3, wherein the anti-acne compound is an antibiotic, a retinoid, or an alpha-hydroxy acid.
- Embodiment PI 8 A composition comprising a Propionibacterium acnes
- Embodiment PI 9 The composition of any one of Embodiments PI -PI 8, wherein the P. acnes bacteriophage is a lytic P. acnes bacteriophage.
- Embodiment P20 The composition of any one of Embodiments PI -PI 9, wherein the P. acnes bacteriophage comprises a linear double stranded DNA genome.
- Embodiment P21 The composition of any one of Embodiments P1-P20, wherein the P. acnes bacteriophage is within the bacteriophage family Siphoviridae.
- Embodiment P22 The composition of any one of Embodiments P1-P21, wherein the genome of the P. acnes bacteriophage comprises a nucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 1.
- Embodiment P23 The composition of any one of Embodiments P18-P21, wherein the enzyme is a P. acnes biofilm degrading enzyme.
- Embodiment P24 The composition of any one of Embodiments P3 or P18-P23, wherein the enzyme is a glycosidase, a protease, a DNAse, or a restriction endonuclease.
- Embodiment P25 The composition of any one of Embodiments P3 or P18-P24, wherein the enzyme is a glycosidase.
- Embodiment P26 The composition of Embodiment P25, wherein the glycosidase is a glycoside hydrolase.
- Embodiment P27 The composition of Embodiment P26, wherein the enzyme catalyzes the hydrolysis of linear polymers of N-acetyl-D-glucosamines.
- Embodiment P28 The composition of Embodiment P27, wherein the enzyme is a ⁇ - hexosaminidase.
- Embodiment P29 The composition of Embodiment P28, wherein the enzyme is hydrolyzes -l,6-glycosidic linkages of acetylglucosamine polymers.
- Embodiment P30 The composition of any one of Embodiments P3 or P18-P24, wherein the enzyme is a DNAse I, a restriction endonuclease, papain, bromelain, Trypsin, Proteinase K, Subtilisin, serratiopeptidase, dispersin, alginate lyase, amylase, or cellulase.
- the enzyme is a DNAse I, a restriction endonuclease, papain, bromelain, Trypsin, Proteinase K, Subtilisin, serratiopeptidase, dispersin, alginate lyase, amylase, or cellulase.
- Embodiment P31 The composition of any one of Embodiments P3 or P18-P24, wherein the enzyme is Dispersin B.
- Embodiment P32 The composition of any one of Embodiments P3 or P18-P24, wherein the enzyme is a protease, and the protease is proteinase K or subtilisin.
- Embodiment P33 composition of any one of Embodiments P18-P22, wherein the enzyme is an anti-aging enzyme.
- Embodiment P34 The composition of Embodiment P33, wherein the anti-aging enzyme is a superoxide dismutase or a peroxidase.
- Embodiment P35 The composition of any one of Embodiments P18-P34, further comprising a probiotic bacterium.
- Embodiment P36 The composition of Embodiment P35, wherein the probiotic bacterium is a probiotic a P. sp., Staphylococcus sp., and/or Corynebacterium sp. bacterium.
- Embodiment P37 The composition of Embodiment P35, wherein the probiotic bacterium is a bacterium within the class Betaproteobacteria.
- Embodiment P38 The composition of Embodiment P36, wherein the probiotic bacterium is a probiotic P. acnes bacterium.
- Embodiment P39 The composition of Embodiment P38, wherein the P. acnes bacterium
- (a) comprises a 16S DNA sequence with a T992C mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (b) comprises a 16S DNA sequence with a T838C mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (c) comprises a 16S DNA sequence with a C1322T mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (d) comprises a 16S DNA sequence with a C986T mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (e) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 3;
- (f) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 4;
- (h) does not comprise a plasmid that comprises a virulence factor
- (i) does not comprises a plasmid that encodes an extrachromosomal lipase and/or a tight adhesion virulence factor.
- Embodiment P40 The composition of Embodiment P38, wherein the P. acnes bacterium:
- (d) is less inflammatory than a pathogenic P. acnes strain.
- Embodiment P41 The composition of any one of Embodiments P35-P40, further comprising at least one additional probiotic bacterium.
- Embodiment P42 The composition of Embodiment P41, wherein said at least one additional probiotic bacterium comprises Propionibacterium granulosum and/or
- Embodiment P43 The composition of Embodiment P40, wherein said pathogenic P. acnes strain
- (a) comprises a 16S DNA sequence with a G1058C mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (b) comprises a 16S DNA sequence with a G1058C and an A1201C mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (c) comprises a 16S DNA sequence with a G529A mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (d) comprises a 16S DNA sequence with a G1004A and a T1007C mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (e) comprises a 16S DNA sequence with a G1268A mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (f) comprises a 16S DNA sequence with a T554C and a G1058C mutation compared to the KPA171202 type strain 16S DNA sequence set forth as SEQ ID NO: 2;
- (g) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 5;
- (h) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 6;
- (i) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 7;
- (j) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 8;
- (k) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 9;
- (1) comprises a 16S DNA sequence that is identical to the sequence of SEQ ID NO: 10.
- Embodiment P44 The composition of any one of Embodiments P18-P43, further comprising at least one additional P. acnes bacteriophage.
- Embodiment P45 The composition of any one of Embodiments P1-P44, comprising a pharmaceutically acceptable carrier.
- Embodiment P46 The composition of Embodiment P45, wherein the
- pharmaceutically acceptable carrier comprises an emulsion.
- Embodiment P47 The composition of Embodiment P46, wherein the emulsion is an oil-in-water emulsion or a water-in-oil emulsion.
- Embodiment P48 The composition of any one of Embodiments P1-P47, which is in the form of a cream, lotion, suspension, or aqueous solution.
- Embodiment P49 A combination consisting essentially of at least one
- Propionibacterium acnes bacteriophage and at least one anti-acne compound, wherein each of the at least one Propionibacterium acnes bacteriophage and the at least one anti-acne compound is in a composition that further comprises a pharmaceutically acceptable carrier.
- Embodiment P50 The combination of Embodiment P49, wherein the at least one P. acnes bacteriophage and the at least one anti-acne compound are within separate compositions.
- Embodiment P51 The combination of Embodiment P50, wherein the at least one P. acnes bacteriophage and the at least one anti-acne compound are within separate containers.
- Embodiment P52 A combination comprising a Propionibacterium acnes bacteriophage and an enzyme.
- Embodiment P53 The combination of Embodiment P52, wherein the P. acnes bacteriophage and the enzyme are within separate compositions.
- Embodiment P54 The combination of Embodiment P53, wherein the P. acnes bacteriophage and the enzyme are within separate containers.
- Embodiment P55 A method of treating acne in a subject in need thereof, the method comprising administering an effective amount of the composition of any one of Embodiments P1-P46 or the combination of any one of Embodiments P49-P54 to the subject.
- Embodiment P56 The method of Embodiment P55, wherein the composition is administered topically.
- Additional embodiments include Embodiments 1 to 55 following:
- Embodiment 1 A composition comprising at least one Propionibacterium acnes bacteriophage, at least one anti-acne compound, and a pharmaceutically acceptable carrier.
- Embodiment 2 The composition of Embodiment 1, which does not comprise a probiotic bacterium.
- Embodiment 3 The composition of Embodiment 1 or 2, wherein the composition further comprises a P. acnes biofilm degrading enzyme.
- Embodiment 4 The composition of any one of Embodiments 1-3, wherein the at least one anti-acne compound is salicylic acid.
- Embodiment 5 The composition of Embodiment 4, wherein the salicylic acid is present at a concentration of 0.5% to 2% (weight/volume).
- Embodiment 6 The composition of Embodiment 5, wherein the salicylic acid is present at a concentration of less than 0.5% but greater than about 0.1% (weight/volume).
- Embodiment 7 The composition of any one of Embodiments 1-3, wherein the at least one anti-acne compound is sulfur.
- Embodiment 8 The composition of Embodiment 7, wherein the sulfur is present at a concentration of 3% to 10% (weight/volume).
- Embodiment 9 The composition of Embodiment 7, wherein the sulfur is present at a concentration of less than 3% but greater than about 0.1%, 0.5%, 1%, 1.5%, 2%, or 2.5% (weight/volume).
- Embodiment 10 The composition of any one of Embodiments 1-3, wherein the at least one anti-acne compound is resorcinol and sulfur.
- Embodiment 11 The composition of Embodiment 10, wherein the resorcinol is present at a concentration of 2% and sulfur is present at a concentration of 3% to 8%
- Embodiment 12 The composition of any one of Embodiments 1-3, wherein the at least one anti-acne compound comprises resorcinol monoacetate and sulfur.
- Embodiment 13 The composition of Embodiment 12, wherein the resorcinol monoacetate is present at a concentration of 3% and sulfur is present at a concentration of 3% to 8% (weight/volume).
- Embodiment 14 The composition of any one of Embodiments 1-3, wherein the antiacne compound is an antibiotic, a retinoid, or an alpha-hydroxy acid.
- Embodiment 15 The composition of any one of Embodiments 1-14, wherein the Propionibacterium acnes bacteriophage is a naturally occurring Propionibacterium acnes bacteriophage.
- Embodiment 16 The composition of any one of Embodiments 1-15, wherein the P. acnes bacteriophage is a lytic P. acnes bacteriophage.
- Embodiment 17 The composition of any one of Embodiments 1-16, wherein the P. acnes bacteriophage comprises a linear double stranded DNA genome.
- Embodiment 18 The composition of any one of Embodiments 1-17, wherein the P. acnes bacteriophage is within the bacteriophage family Siphoviridae.
- Embodiment 19 The composition of any one of Embodiments 1-19, wherein the genome of the P. acnes bacteriophage comprises a nucleotide sequence that is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 1.
- Embodiment 20 The composition of any one of Embodiments 3-19, wherein the enzyme is a P. acnes biofilm degrading enzyme.
- Embodiment 21 The composition of any one of Embodiments 3-20, wherein the enzyme is a glycosidase, a protease, a DNAse, or a restriction endonuclease.
- the enzyme is a glycosidase, a protease, a DNAse, or a restriction endonuclease.
- Embodiment 22 The composition of any one of Embodiments 3-21, wherein the enzyme is a glycosidase.
- Embodiment 23 The composition of Embodiment 22, wherein the glycosidase is a glycoside hydrolase.
- Embodiment 24 The composition of Embodiment 23, wherein the enzyme catalyzes the hydrolysis of linear polymers of N-acetyl-D-glucosamines.
- Embodiment 25 The composition of Embodiment 24, wherein the enzyme is a ⁇ - hexosaminidase.
- Embodiment 26 The composition of Embodiment 25, wherein the enzyme is hydrolyzes -l,6-glycosidic linkages of acetylglucosamine polymers.
- Embodiment 27 The composition of any one of Embodiments 3-20, wherein the enzyme is a DNAse I, a restriction endonuclease, papain, bromelain, Trypsin, Proteinase K, Subtilisin, serratiopeptidase, dispersin, alginate lyase, amylase, or cellulase.
- the enzyme is a DNAse I, a restriction endonuclease, papain, bromelain, Trypsin, Proteinase K, Subtilisin, serratiopeptidase, dispersin, alginate lyase, amylase, or cellulase.
- Embodiment 28 The composition of any one of Embodiments 3-20, wherein the enzyme is Dispersin B.
- Embodiment 29 The composition of any one of Embodiments 3-20, wherein the enzyme is a protease, and the protease is proteinase K or subtilisin.
- Embodiment 30 The composition of any one of Embodiments 1-29, further comprising an anti-aging enzyme.
- Embodiment 31 The composition of Embodiment 30, wherein the anti-aging enzyme is a superoxide dismutase or a peroxidase.
- Embodiment 32 The composition of any one of Embodiments 1-31, further comprising a probiotic bacterium.
- Embodiment 33 The composition of Embodiment 32, wherein the probiotic bacterium is a probiotic a P. sp., Staphylococcus sp., and/or Corynebacterium sp. bacterium.
- Embodiment 34 The composition of Embodiment 32, wherein the probiotic bacterium is a bacterium within the class Betaproteobacteria.
- Embodiment 35 The composition of Embodiment 33, wherein the probiotic bacterium is a probiotic P. acnes bacterium.
- Embodiment 36 The composition of Embodiment 35, wherein the P. acnes bacterium (a) comprises a 16S rDNA sequence with a T992C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (b) comprises a 16S rDNA sequence with a T838C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (c) comprises a 16S rDNA sequence with a C1322T mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (d) comprises a 16S rDNA sequence with a C986T mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (e) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 3;
- (f) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 4;
- (h) does not comprise a plasmid that comprises a virulence factor
- (i) does not comprises a plasmid that encodes an extrachromosomal lipase and/or a tight adhesion virulence factor.
- Embodiment 37 The composition of Embodiment 35 or 36, wherein the P. acnes bacterium:
- (d) is less inflammatory than a pathogenic P. acnes strain.
- Embodiment 39 The composition of Embodiment 38, wherein said at least one additional probiotic bacterium comprises Propionibacterium granulosum and/or
- Embodiment 40 The composition of Embodiment 37, wherein said pathogenic P. acnes strain (a) comprises a 16S rDNA sequence with a G1058C mutation compared to the
- KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (b) comprises a 16S rDNA sequence with a G1058C and an A1201C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (c) comprises a 16S rDNA sequence with a G529A mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (d) comprises a 16S rDNA sequence with a G1004A and a T1007C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (e) comprises a 16S rDNA sequence with a G1268A mutation compared to the
- KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (f) comprises a 16S rDNA sequence with a T554C and a G1058C mutation compared to the KPA171202 type strain 16S rDNA sequence set forth as SEQ ID NO: 2;
- (g) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 5;
- (h) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 6;
- (i) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 7; (j) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 8; (k) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 9; and/or
- (1) comprises a 16S rDNA sequence that is identical to the sequence of SEQ ID NO: 10.
- Embodiment 41 The composition of any one of Embodiments 1-40, further comprising at least one additional P. acnes bacteriophage.
- Embodiment 42 The composition of any one of Embodiments 1-41, wherein the pharmaceutically acceptable carrier comprises an emulsion.
- Embodiment 43 The composition of Embodiment 42, wherein the emulsion is an oil-in-water emulsion or a water-in-oil emulsion.
- Embodiment 44 The composition of any one of Embodiments 1-44, which is in the form of a cream, lotion, suspension, or aqueous solution.
- Embodiment 45 A combination comprising at least one Propionibacterium acnes bacteriophage and at least one anti-acne compound, wherein each of the at least one Propionibacterium acnes bacteriophage and the at least one anti-acne compound is in a composition that further comprises a pharmaceutically acceptable carrier.
- Embodiment 46 The combination of Embodiment 45, wherein the at least one P. acnes bacteriophage and the at least one anti-acne compound are within separate compositions.
- Embodiment 47 The combination of Embodiment 46, wherein the at least one antiacne compound is benzoyl peroxide.
- Embodiment 48 The combination of Embodiment 47, wherein the benzoyl peroxide is present at a concentration of 2.5% to 10% (weight/volume).
- Embodiment 49 The combination of Embodiment 47, wherein the benzoyl peroxide is present at a concentration of less than 2.5% but greater than about 0.1%, 0.5%, 1%, 1.5%, or 2% (weight/volume).
- Embodiment 50 A method of treating acne in a subject in need thereof, the method comprising administering an effective amount of the composition of any one of Embodiments 1- 44 to the subject.
- Embodiment 51 The method of Embodiment 50, wherein the composition is administered topically.
- Embodiment 52 A method of treating acne in a subject in need thereof, the method comprising administering an effective amount of the combination of any one of Embodiments 45-49 to the subject.
- Embodiment 53 A composition comprising a Propionibacterium acnes
- Embodiment 54 A combination comprising a Propionibacterium acnes bacteriophage and an enzyme.
- Embodiment 55 A composition consisting essentially of at least one
- Propionibacterium acnes bacteriophage at least one anti-acne compound, and a
- P. acnes bacteriophages have been shown to be genetically highly similar and exhibit a broad range against multiple strains of P. acnes.
- a lead bacteriophage (PHIT-101) was used for experimentation.
- PHIT-101 is a single lytic phage that killed all the strain types of P. acnes tested (data not shown).
- PHIT-101 has the sequence of SEQ ID NO: 1. In order to showcase the efficacy and specificity of this phage, a plate assay was performed as follows. P. acnes
- KPA171202 and P. granulosum (a closely related but benign skin bacterium) were plated on separate BHI-agar plates. Sterile cotton pads were placed on each plate. The sterile cotton pads were soaked in either minocycline, an antibiotic commonly used to treat acne, or a phage solution with a titer of 2 x 10 7 pfu/mL. After incubating the plates anaerobically for 72 hours at 37°C, the minocycline pads killed bacteria indiscriminately, showing a zone of killing on both the acne-causing P. acnes and the commensal P. granulosum (FIG. 1). In contrast, the PHIT-101 pads killed only the P. acnes, without disturbing the growth of beneficial P. granulosum.
- a synthetic skin microbiome was formulated comprising P. acnes, P. granulosum, and P. avidum, three skin bacteria that comprise 60-80% of microbiota in the skin pore [Science (2009) 324: 1190-1192].
- This synthetic skin microbiome was grown anaerobically in the presence or absence of PHIT-101 (final concentration 5 x 10 5 pfu/mL). After 48 hours of incubation at 37°C, the cells were pelleted and washed, and the relative proportions of the three species was determined using 16S amplicon next-generation sequencing (NGS) on Illumina MiSeq.
- NGS next-generation sequencing
- BDEs Screening biofilm degrading enzymes (BDEs) to disrupt P. acnes biofilms.
- FIG. 3 shows that adherent cultures of multiple strains isolated from the microbiota of a single subject produce markedly different levels of biofilm under similar conditions.
- ProII strains have C986T and T992C mutations relative to the KPA171202 sequence. Further, using specific primer pairs, the presence or absence of a linear plasmid within each strain was determined. Probiotic strains were identified as lacking this plasmid, which carries an extrachromosomal lipase as well as the Tad (tight adhesion) virulence factor.
- the probiotic strains are characterized primarily by their 16S sequences, e.g., SEQ ID NO: 3 and SEQ ID NO: 4. In embodiments, they can be genotypically identified by the lack of the plasmid bearing virulence factors, such as an extrachromosomal lipase and a Tad locus.
- the cohort of probiotic strains was further characterized for their immunogenic potential.
- a lead probiotic candidate based on two factors: low lipase production, and less tight adherence to epithelial cells. The phenotypic validation of these features was important in selecting the probiotic lead candidate.
- Lipases play an important role in pathogenesis of acne by hydrolyzing sebum triglycerides and releasing irritating free fatty acids in the pilosebaceous follicles. Lipase is a strong chemotactic and proinflammatory antigen. Therefore, lipase is of high interest as a pharmacological target for anti-acne drugs.
- the overall strategy is to replace the pathogenic P. acnes that secretes high levels of lipase with a low-secreting probiotic P. acnes.
- lipase production of the probiotic P. acnes strains was compared against pathogenic P.
- FIG. 8 shows that the top probiotic candidates had a low lipase profile compared to the pathogenic strain.
- FIG. 10 shows that the pathogenic strain had significantly higher levels of IL-1 ⁇ , IL-6, IL-17, and TNFa compared to the probiotic strain.
- a miniswine model was used to test the probiotic strain for skin irritation.
- Swine are one of the major animals used in translational research, and pig skin is physiologically, anatomically, biochemically and immunologically similar to human skin.
- Miniswine are particularly commonly used to model human dermal diseases and conditions like acne [Vet Pathol (2012) 49:344-356].
- the probiotic strain was applied to the skin of three separate miniswine in two doses - 10 8 cfu and 10 9 cfu - in delimited skin areas.
- the animals were observed daily for clinical signs and the dosing site skin was scored using the Draize Scoring System at pre-dose, 0.5, 1, 4, 8, and 24 hours post dose administration.
- Table 1 Acute dermal safety/tox in miniswine skin model shows good safety profile of probiotic strain.
- Probiotic bacteria was applied at normal (10 8 cfu) and acute (10 9 cfu) doses on delimited skin areas in 3 male miniswine and monitored for 24 hours post-application. Erythema and edema were quantified using the Draize Scoring System. The Draize score provides the relative severity of erythema and edema. A Draize score of 0, indicating complete absence of erythema and edema, was observed on all the skin areas throughout the monitoring period.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Birds (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Dermatology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Inorganic Chemistry (AREA)
- Virology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Emergency Medicine (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Dispersion Chemistry (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020197034011A KR102799152B1 (ko) | 2017-04-21 | 2018-04-20 | 프로피오니박테리움 아크네스 박테리오파지를 포함하는 여드름 치료용 조성물 |
| AU2018255972A AU2018255972B2 (en) | 2017-04-21 | 2018-04-20 | Compositions comprising propionibacterium acnes bacteriophages for treating acne |
| EP18787737.8A EP3612200A4 (en) | 2017-04-21 | 2018-04-20 | COMPOSITIONS CONTAINING BACTERIOPHAGES OF PROPIONIBACTERIUM ACNES INTENDED FOR THE TREATMENT OF ACNE |
| CA3060415A CA3060415A1 (en) | 2017-04-21 | 2018-04-20 | Compositions comprising propionibacterium acnes bacteriophages for treating acne |
| JP2020507498A JP7595459B2 (ja) | 2017-04-21 | 2018-04-20 | ざ瘡を治療するためのプロピオニバクテリウムアクネス(Propionibacterium acnes)バクテリオファージを含む組成物 |
| CN201880041505.9A CN110799203A (zh) | 2017-04-21 | 2018-04-20 | 用于治疗痤疮的包含痤疮丙酸杆菌噬菌体的组合物 |
| KR1020257012416A KR20250054134A (ko) | 2017-04-21 | 2018-04-20 | 프로피오니박테리움 아크네스 박테리오파지를 포함하는 여드름 치료용 조성물 |
| US16/606,158 US20210338569A1 (en) | 2017-04-21 | 2018-04-20 | Compositions comprising propionibacterium acnes bacteriophages for treating acne |
| US17/819,050 US11903984B1 (en) | 2017-04-21 | 2022-08-11 | Compositions comprising Propionibacterium acnes bacteriophages for treating acne |
| US18/413,988 US12576024B2 (en) | 2017-04-21 | 2024-01-16 | Compositions comprising Propionibacterium acnes bacteriophages for treating acne |
| JP2024063779A JP7801389B2 (ja) | 2017-04-21 | 2024-04-11 | ざ瘡を治療するためのプロピオニバクテリウムアクネス(Propionibacterium acnes)バクテリオファージを含む組成物 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762488326P | 2017-04-21 | 2017-04-21 | |
| US62/488,326 | 2017-04-21 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/606,158 A-371-Of-International US20210338569A1 (en) | 2017-04-21 | 2018-04-20 | Compositions comprising propionibacterium acnes bacteriophages for treating acne |
| US17/819,050 Continuation US11903984B1 (en) | 2017-04-21 | 2022-08-11 | Compositions comprising Propionibacterium acnes bacteriophages for treating acne |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018195415A1 true WO2018195415A1 (en) | 2018-10-25 |
Family
ID=63857016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/028556 Ceased WO2018195415A1 (en) | 2017-04-21 | 2018-04-20 | Compositions comprising propionibacterium acnes bacteriophages for treating acne |
Country Status (8)
| Country | Link |
|---|---|
| US (3) | US20210338569A1 (https=) |
| EP (1) | EP3612200A4 (https=) |
| JP (2) | JP7595459B2 (https=) |
| KR (2) | KR102799152B1 (https=) |
| CN (1) | CN110799203A (https=) |
| AU (1) | AU2018255972B2 (https=) |
| CA (1) | CA3060415A1 (https=) |
| WO (1) | WO2018195415A1 (https=) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020104216A1 (en) * | 2018-11-19 | 2020-05-28 | Unilever N.V. | An antimicrobial composition for selectively inhibiting growth of p. acnes bacteria |
| CN112516116A (zh) * | 2019-09-19 | 2021-03-19 | 成均馆大学校产学协力团 | 含有间苯二酚或苯乙基间苯二酚用于预防、治疗或改善由空气污染物诱发的皮肤病的组合物 |
| US11207357B2 (en) | 2016-04-21 | 2021-12-28 | Symbiome, Inc. | Compositions and methods for treatment of skin disorders |
| US11903984B1 (en) | 2017-04-21 | 2024-02-20 | Phi Therapeutics, Inc. | Compositions comprising Propionibacterium acnes bacteriophages for treating acne |
| US20240100105A1 (en) * | 2017-12-05 | 2024-03-28 | Biomx Ltd. | Bacteriophage treatment for acne and biofilms |
| US20240277791A1 (en) * | 2021-06-11 | 2024-08-22 | Integrated Pharma Services, Llc | Device and methods for acne therapeutics: antibacterial bacteriophages and engineered lysins |
| WO2025024918A1 (en) * | 2023-07-28 | 2025-02-06 | Kane Biotech Inc. | Composition, methods, and uses thereof for acne prevention, reduction, and treatment |
| WO2025099684A1 (en) * | 2023-11-10 | 2025-05-15 | Universidad De Los Andes | Functionalized phage for acne treatment |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115813869A (zh) * | 2022-12-15 | 2023-03-21 | 深圳市奥极因科技有限公司 | 一种感知进食状态智能给药的重组菌含片 |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| EP0817613B1 (en) * | 1996-01-31 | 2005-03-30 | Cosmoferm B.V. | Use of compositions comprising stabilized enzymes |
| WO2007007055A1 (en) * | 2005-07-12 | 2007-01-18 | The University Of Leeds | Bacteriophage and their uses |
| WO2013142378A1 (en) | 2012-03-17 | 2013-09-26 | The Regents Of The University Of California | Fast diagnosis and personalized treatments for acne |
| WO2015118150A2 (en) | 2014-02-07 | 2015-08-13 | Fixed Phage Limited | Treatment of topical and systemic bacterial infections |
| US9125919B2 (en) * | 2008-12-17 | 2015-09-08 | Ei Llc | Acne treatment powder foundation |
| US20160338979A1 (en) * | 2014-01-10 | 2016-11-24 | The Regents Of The University Of California | Skin probiotic |
| US9526738B2 (en) | 2009-08-21 | 2016-12-27 | Novan, Inc. | Topical gels and methods of using the same |
| WO2017200873A1 (en) | 2016-05-15 | 2017-11-23 | The Regents Of The University Of California | Compositions and methods for treating acne |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6034506A (en) | 1998-01-16 | 2000-03-07 | Space Systems/Loral, Inc. | Lithium ion satellite battery charge control circuit |
| US6235033B1 (en) | 2000-04-19 | 2001-05-22 | Synthes (Usa) | Bone fixation assembly |
| JP2008297241A (ja) | 2007-05-31 | 2008-12-11 | Fujifilm Corp | ニキビ用皮膚外用剤 |
| KR20120115920A (ko) * | 2011-04-11 | 2012-10-19 | 신라대학교 산학협력단 | 여드름 치료, 개선 또는 예방용 조성물 |
| KR101689033B1 (ko) * | 2014-06-10 | 2016-12-22 | 경북대학교 산학협력단 | 여드름균을 사멸시키는 여드름균 특이적 박테리오파지 |
| WO2016130024A1 (en) * | 2015-02-13 | 2016-08-18 | Supreme Biotechnologies Limited | Endolysin expression platform |
| CN110799203A (zh) | 2017-04-21 | 2020-02-14 | Phi治疗股份有限公司 | 用于治疗痤疮的包含痤疮丙酸杆菌噬菌体的组合物 |
| US20210177920A1 (en) * | 2017-12-05 | 2021-06-17 | Biomx Ltd. | Bacteriophage treatment for acne and biofilms |
-
2018
- 2018-04-20 CN CN201880041505.9A patent/CN110799203A/zh active Pending
- 2018-04-20 CA CA3060415A patent/CA3060415A1/en active Pending
- 2018-04-20 AU AU2018255972A patent/AU2018255972B2/en active Active
- 2018-04-20 WO PCT/US2018/028556 patent/WO2018195415A1/en not_active Ceased
- 2018-04-20 US US16/606,158 patent/US20210338569A1/en not_active Abandoned
- 2018-04-20 JP JP2020507498A patent/JP7595459B2/ja active Active
- 2018-04-20 KR KR1020197034011A patent/KR102799152B1/ko active Active
- 2018-04-20 EP EP18787737.8A patent/EP3612200A4/en active Pending
- 2018-04-20 KR KR1020257012416A patent/KR20250054134A/ko active Pending
-
2022
- 2022-08-11 US US17/819,050 patent/US11903984B1/en active Active
-
2024
- 2024-01-16 US US18/413,988 patent/US12576024B2/en active Active
- 2024-04-11 JP JP2024063779A patent/JP7801389B2/ja active Active
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| EP0817613B1 (en) * | 1996-01-31 | 2005-03-30 | Cosmoferm B.V. | Use of compositions comprising stabilized enzymes |
| WO2007007055A1 (en) * | 2005-07-12 | 2007-01-18 | The University Of Leeds | Bacteriophage and their uses |
| US7405066B2 (en) | 2005-07-12 | 2008-07-29 | The University Of Leeds | Bacteriophage and their uses |
| US9068159B2 (en) | 2005-07-12 | 2015-06-30 | Micreos B.V. | Bacteriophage and their uses |
| US9125919B2 (en) * | 2008-12-17 | 2015-09-08 | Ei Llc | Acne treatment powder foundation |
| US9526738B2 (en) | 2009-08-21 | 2016-12-27 | Novan, Inc. | Topical gels and methods of using the same |
| WO2013142378A1 (en) | 2012-03-17 | 2013-09-26 | The Regents Of The University Of California | Fast diagnosis and personalized treatments for acne |
| US20160338979A1 (en) * | 2014-01-10 | 2016-11-24 | The Regents Of The University Of California | Skin probiotic |
| WO2015118150A2 (en) | 2014-02-07 | 2015-08-13 | Fixed Phage Limited | Treatment of topical and systemic bacterial infections |
| WO2017200873A1 (en) | 2016-05-15 | 2017-11-23 | The Regents Of The University Of California | Compositions and methods for treating acne |
Non-Patent Citations (24)
| Title |
|---|
| "Current Protocols in Molecular Biology", 1995 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., NUC. ACIDS RES., vol. 25, 1977, pages 3389 - 3402 |
| ANAEROBE, vol. 40, 2016, pages 63 - 67 |
| BR J DERMATOL, vol. 172, 2015, pages 13 |
| EWA JONCZYK-MATYSIAK ET AL., FRONTIERS IN MICROBIOLOGY, vol. 8, 8 February 2017 (2017-02-08) |
| EXP DERMATOL, vol. 23, 2014, pages 687 |
| FLIGIEL ET AL.: "Protein degradation following treatment with hydrogen peroxide.", AM J PATHOL, vol. 115, no. 3, 1984, pages 418 - 25 |
| HENIKOFFHENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 |
| J BACTERIOL, vol. 182, 2000, pages 6169 - 6176 |
| KOCHA ET AL.: "Hydrogen peroxide-mediated degradation of protein: different oxidation modes of copper- and iron-dependent hydroxyl radicals on the degradation of albumin", BIOCHIM BIOPHYS ACTA, vol. 1337, no. 2, 1997, pages 319 - 26 |
| LEE ET AL.: "Protein binding of acetylsalicylic acid and salicylic acid in porcine and human serum.", VET HUM TOXICOL, vol. 37, no. 3, 1995, pages 224 - 5 |
| NAT REV MICROBIOL, vol. 5, 2007, pages 363 - 375 |
| NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| PEARSONLIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PNAS, vol. 100, 2003, pages 7295 - 7300 |
| RES MICROBIOL, vol. 158, 2007, pages 386 - 392 |
| SAMBROOK ET AL.: "MOLECULAR CLONING, A LABORATORY MANUAL", 1989, COLD SPRINGS HARBOR PRESS |
| SCIENCE, vol. 324, 2009, pages 1190 - 1192 |
| See also references of EP3612200A4 |
| SINGLETON ET AL.: "DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY", 1994, J. WILEY & SONS |
| SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| VERBEECKCARDINAL: "Plasma protein binding of salicylic acid, phenytoin, chlorpromazine, propranolol and pethidine using equilibrium dialysis and ultracentrifugation", ARZNEIMITTELFORSCHUNG, vol. 35, no. 6, 1985, pages 903 - 6 |
| VET PATHOL, vol. 49, 2012, pages 344 - 356 |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11207357B2 (en) | 2016-04-21 | 2021-12-28 | Symbiome, Inc. | Compositions and methods for treatment of skin disorders |
| US11903984B1 (en) | 2017-04-21 | 2024-02-20 | Phi Therapeutics, Inc. | Compositions comprising Propionibacterium acnes bacteriophages for treating acne |
| US20240100105A1 (en) * | 2017-12-05 | 2024-03-28 | Biomx Ltd. | Bacteriophage treatment for acne and biofilms |
| WO2020104216A1 (en) * | 2018-11-19 | 2020-05-28 | Unilever N.V. | An antimicrobial composition for selectively inhibiting growth of p. acnes bacteria |
| CN112996532A (zh) * | 2018-11-19 | 2021-06-18 | 联合利华知识产权控股有限公司 | 一种选择性抑制痤疮丙酸杆菌细菌生长的抗微生物组合物 |
| CN112516116A (zh) * | 2019-09-19 | 2021-03-19 | 成均馆大学校产学协力团 | 含有间苯二酚或苯乙基间苯二酚用于预防、治疗或改善由空气污染物诱发的皮肤病的组合物 |
| US20240277791A1 (en) * | 2021-06-11 | 2024-08-22 | Integrated Pharma Services, Llc | Device and methods for acne therapeutics: antibacterial bacteriophages and engineered lysins |
| WO2025024918A1 (en) * | 2023-07-28 | 2025-02-06 | Kane Biotech Inc. | Composition, methods, and uses thereof for acne prevention, reduction, and treatment |
| WO2025099684A1 (en) * | 2023-11-10 | 2025-05-15 | Universidad De Los Andes | Functionalized phage for acne treatment |
Also Published As
| Publication number | Publication date |
|---|---|
| US12576024B2 (en) | 2026-03-17 |
| JP2020517735A (ja) | 2020-06-18 |
| AU2018255972B2 (en) | 2024-11-21 |
| JP7801389B2 (ja) | 2026-01-16 |
| CN110799203A (zh) | 2020-02-14 |
| KR20190135054A (ko) | 2019-12-05 |
| AU2018255972A1 (en) | 2019-10-31 |
| JP7595459B2 (ja) | 2024-12-06 |
| KR102799152B1 (ko) | 2025-04-23 |
| US11903984B1 (en) | 2024-02-20 |
| US20210338569A1 (en) | 2021-11-04 |
| KR20250054134A (ko) | 2025-04-22 |
| US20240066079A1 (en) | 2024-02-29 |
| EP3612200A1 (en) | 2020-02-26 |
| JP2024099592A (ja) | 2024-07-25 |
| US20240189220A1 (en) | 2024-06-13 |
| CA3060415A1 (en) | 2018-10-25 |
| EP3612200A4 (en) | 2020-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11903984B1 (en) | Compositions comprising Propionibacterium acnes bacteriophages for treating acne | |
| Liu et al. | Identification of two depolymerases from phage IME205 and their antivirulent functions on K47 capsule of Klebsiella pneumoniae | |
| Okuda et al. | The composition and structure of biofilms developed by Propionibacterium acnes isolated from cardiac pacemaker devices | |
| Daboor et al. | Disruption of the extracellular polymeric network of Pseudomonas aeruginosa biofilms by alginate lyase enhances pathogen eradication by antibiotics | |
| Donnarumma et al. | Lactobacillus crispatus L1: high cell density cultivation and exopolysaccharide structure characterization to highlight potentially beneficial effects against vaginal pathogens | |
| Pinto et al. | The role of bacteriophages in periodontal health and disease | |
| JP7624219B2 (ja) | ニキビの治療のためのプロピオニバクテリウム・アクネスに対する細菌療法 | |
| CA2831345A1 (en) | Lactic acid bacterial strains that coaggregate with staphylococcus aureus, and compositions and uses of the strains | |
| EP4392550B1 (en) | Targeting e coli cells | |
| Ansiliero et al. | Pathogenic microbial profile and antibiotic resistance associated with periodontitis | |
| Lebeer et al. | Topical cream with live lactobacilli modulates the skin microbiome and reduce acne symptoms | |
| US20240287468A1 (en) | Bacteriophages against vancomycin-resistant enterococci | |
| Li et al. | Improvement of intestinal microflora balance by polysaccharide from Physalis alkekengi var. francheti | |
| Myoung et al. | Nano-sized lysate of Lactiplantibacillus plantarum isolated from green tea leaves as a potential skin care ingredient | |
| Podrini et al. | Topical administration of lactiplantibacillus plantarum (SkinDuoTM) serum improves anti-acne properties. Microorganisms. 2023; 11 (2): 417 | |
| Li et al. | vB_Ent31 bacteriophage may combat Enterobacter cloacae infections with macrophage modulating activity | |
| KR20100079078A (ko) | 락토바실러스 퍼멘툼 No.1969 균주를 유효성분으로 포함하는 세균성질염치료용 질내 투여용 약학조성물 | |
| KR20250167084A (ko) | 습진을 포함한 피부 질환 및 병태의 치료를 위한 조성물 및 방법 | |
| Chen et al. | Synovial Fluid‐derived Micrococcus Luteus G18 Exacerbates Osteoarthritis Progression by Promoting Chondrocyte Degradation via TLR2/JNK/AP‐1 Signaling Pathway | |
| Kaewkod et al. | Protective effects of metabolites from lactic acid bacteria against infections of mastitis pathogen in bovine cells | |
| Ishitsuka et al. | Isolation of Rhodococcus equi bacteriophage ReT1 and investigation of its bactericidal effect | |
| Merdan et al. | Kiperin Postbiotic Supplement-Enhanced Bacterial Supernatants Promote Fibroblast Function: Implications for Regenerative Medicine | |
| Najwa et al. | African Journal of Biological Sciences | |
| Górski | Prospects of Phage Application in the Treatment of Acne Caused by | |
| Parajuli | Charaterization, whole genome analysis and application bacteriophages to control biofilm produced by charbapenem resistant bacteria prioritized by world health organization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18787737 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3060415 Country of ref document: CA Ref document number: 2020507498 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018255972 Country of ref document: AU Date of ref document: 20180420 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20197034011 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018787737 Country of ref document: EP Effective date: 20191121 |
|
| WWD | Wipo information: divisional of initial pct application |
Ref document number: 1020257012416 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020257012416 Country of ref document: KR |