WO2018193847A1 - Algae growth inhibitor and method for inhibiting algae growth - Google Patents

Abstract

Provided are: an algae growth inhibitor that inhibits the growth of algae and contains nanoparticles of an organic compound that exhibits affinity for an algal cell wall and has hydrocarbon as a major component; and a method for inhibiting algae growth using nanoparticles of an organic compound that exhibits affinity for an algal cell wall and has hydrocarbon as a major component.

Description

Algae growth inhibitor and method for inhibiting algae growth

The present invention relates to an algal growth inhibitor that suppresses the growth of algae and a method for suppressing the growth of algae.

The red tide in the waters such as the Seto Inland Sea and the bay causes fishery damage and landscape deterioration. Freshwater red tide generated in lakes and dam lakes is also a major social problem. According to Non-Patent Document 1, red tide is a term that refers to the occurrence of a specific type of plankton that occurs in the sea and its surface layer accumulation phenomenon. The word freshwater red tide is officially used for those that are yellow and accumulate in surface water. The red tide in the sea area has great social impact, not only worsening the landscape but also causing serious damage such as the massive death of cultured fish. In addition, according to Non-Patent Document 1, the influence of freshwater red tide on surrounding residents is pointed out as follows. (1) At the time of the occurrence of red tide, create an unpleasant odor in the water and sewerage water that uses the water, (2) cause filtration problems at the water purification plant, (3) aquaculture at the fish farm that incorporates the water Ayu and other fish may be killed, (4) In the peak red tide, there may be direct odors to neighboring residents, and (5) in severe cases, the water landscape is damaged. I have raised things. In addition to actual harm, (6) it points out the social impact of image degradation due to occurrence.

Patent Document 1 describes a red tide algae using silver thiosulfate ion as a component.

Patent Document 2 describes an antibacterial agent containing cyanoacrylate polymer particles conjugated with an antibiotic as an active ingredient as an antibacterial agent for vancomycin-resistant gram-positive bacteria. The cyanoacrylate polymer particles are obtained by anionic polymerization of a cyanoacrylate monomer that is used, for example, as an adhesive for wound closure in the surgical field. Cyanoacrylate-based polymer particles are porous, and a desired substance can be conjugated inside. In the antibacterial agent of Patent Document 1, vancomycin-resistant enterococci (VRE) that has acquired resistance to various antibiotics by conjugating antibiotics to cyanoacrylate polymer particles and has become impossible to antibacterial by administration of the antibiotics. ), The antibacterial action of antibiotics is exerted, and the growth of VRE can be suppressed.

On the other hand, it is known that cyanoacrylate polymer particles are used in addition to antibacterial agents. For example, Patent Document 3 describes that a cyanoacrylate polymer particle conjugated with an amino acid is synthesized by anionic polymerization of a cyanoacrylate monomer in the presence of an amino acid to synthesize cyanoacrylate polymer particles having an average particle diameter of less than 1000 nm. The amino acid-conjugated particles of Patent Document 3 are said to be useful for cancer treatment and prevention because they can induce apoptosis-like cell death in cancer cells and damage the cancer cells.

Thus, cyanoacrylate polymer particles are useful for antibacterial action and cancer treatment and prevention.

JP 2007-332039 A International Publication No. 2008/126646 International Publication No. 2010/101178

Like the red tide and freshwater red tide mentioned above, the damage caused by the abnormal phenomenon of plankton including algae (microalgae) is serious, and effective countermeasures are an important issue. In this specification, “abnormal generation of microalgae and its surface accumulation phenomenon” in sea areas and freshwater areas, and “microalgae generation phenomenon in artificial closed water areas” such as farms, cooling circulation water, fountains, etc. This is referred to as “red tide etc.” regardless of the sea area, fresh water area and artificial closed water area.

In order to suppress the abnormal occurrence of microalgae and the surface layer accumulation phenomenon, the use of metal ions as described in Patent Document 1 may cause concern about accumulation of metals in the environment. In view of the accumulation of metal in the environment as described above, it is desirable to suppress the growth of microalgae using a metal-free component.

In addition, it is not known to prevent or suppress red tide or the like by using nano-sized cyanoacrylate polymer particles described in Patent Documents 2 and 3.

Therefore, an object of the present invention is to provide an algal growth inhibitor that suppresses the growth of algae and a method for suppressing the growth of algae using metal-free nanoparticles.

The present invention relates to an algae growth inhibitor having an action of inhibiting the growth of algae (microalgae) constituting, for example, red tides and the like and a method for inhibiting the growth of algae. The object is to prevent or reduce the above-mentioned damage by suppressing the occurrence of abnormal algae and its surface accumulation phenomenon.

That is, in order to achieve the above object, the following inventions [1] to [16] are provided.
[1] An algae growth inhibitor that suppresses the growth of algae containing organic compound nanoparticles having a hydrocarbon as a main component and affinity for the cell walls of algae.
[2] The algal growth inhibitor according to [1], wherein the nanoparticles are cyanoacrylate nanoparticles.
[3] The algal growth inhibitor according to [2], wherein the cyanoacrylate nanoparticles are polymerized in the presence of a cyanoacrylate monomer and a surfactant.
[4] The algal growth inhibitor according to [3], wherein the cyanoacrylate monomer is isobutyl cyanoacrylate.
[5] The algae growth inhibitor according to any one of [1] to [4], wherein the algae are microalgae.
[6] The algae growth inhibitor according to [5], wherein the microalgae are algae belonging to the green algal plant gate.
[7] The algae growth inhibitor according to [6], wherein the green alga plant gate is an algae belonging to the class of green algae or trevoxia algae.
[8] The algae growth inhibitor according to any one of [5] to [7], wherein the microalgae are algae belonging to the genus Chlamydomonas or Chlorella.
[9] The microalgae are at least selected from the group of dinoflagellates belonging to the dinoflagellate, diatoms belonging to the diatomaceous plant, raffido algae belonging to the irregular planta, golden algae, or true eyed algae. The algal growth inhibitor according to [5], which is a kind.
[10] The algae growth inhibitor according to any one of [5] to [9], which prevents or inhibits water pollution caused by the growth of the microalgae.
[11] The algae growth inhibitor according to [10], wherein the water pollution is red tide or pollution in a closed water area.
[12] The algae growth inhibitor according to any one of [5] to [9], wherein the growth of the microalgae on the solid surface is prevented or suppressed.
[13] The algae growth inhibitor according to [12], wherein the solid is a member used in a plant factory or an outer wall for building materials.

According to the configurations of [1] to [13] above, the algal growth inhibitor uses nanoparticles of organic compounds mainly composed of hydrocarbons, for example, nanoparticles composed of organic compounds such as acrylic resins. be able to. Therefore, the algal growth inhibitor does not use metal oxide nanoparticles, is metal-free, has no accumulation in the environment, and is highly safe. In addition, metal oxide nanoparticles often form large agglomerates in aqueous solutions, but organic compound nanoparticles mainly composed of hydrocarbons have little cohesiveness between the nanoparticles, and in aqueous solutions. A dispersed state can be stably maintained. Specifically, cyanoacrylate nanoparticles may be used as the organic compound nanoparticles, and the cyanoacrylate nanoparticles may be polymerized in the presence of a cyanoacrylate monomer and a surfactant. In particular, the cyanoacrylate monomer is preferably isobutyl cyanoacrylate.

The cell wall is composed of glycoprotein, chitin, cellulose, proteoglycan and the like in algae (microalgae). The above-mentioned organic compound nanoparticles mainly composed of hydrocarbons have an affinity for the cell wall composed of the above components. Therefore, the organic compound nanoparticles can adhere to and cover the cell surface due to the affinity with the cell wall.

Microalgae includes, for example, green algae belonging to the green algal plant gate, dinoflagellate belonging to the dinoflagellate gate, diatoms belonging to the diatom plant gate, rafido algae belonging to the irregular plant gate, golden algae or true-eye algae It is. Examples of the green algae belonging to the green alga plant gate include algae belonging to the green algae class or the Trevoxia algae class. Examples of the green algae belonging to the green alga class include Chlamydomonas, and examples of the green algae belonging to the Trevoxia algae class include Chlorella.

As shown in the Examples below, the inventors unexpectedly found that the organic compound nanoparticles are acute cell death against the eukaryotic unicellular green alga Chlamydomonas (eg Chlamydomonas reinhardtii). It was found that can be induced. Furthermore, it has been found that protoplast-like cells are generated at a high frequency by inducing the secretion of cell wall lytic enzymes in the genus Chlorella (for example, Chlorella vulgaris).

As described above, a large number of organic compound nanoparticles adhere to and cover the cell surface due to affinity with the cell wall. This makes it difficult for cells to introduce components essential for growth, such as oxygen, carbon dioxide, and nutrients, with the external environment (choking action). The choking action causes physiological abnormal reactions such as accumulation of ROS (reactive oxygen species), chlorophyll degradation, and cell wall lytic enzyme secretion. As a result, an event occurs in which the cell becomes a protoplast or the nanoparticle enters the cytoplasm through the damaged cell wall. As a result, the homeostasis of the cells is not maintained, and it is considered that cell death is caused. According to this concept, it can be interpreted that the suffocation effect by covering the whole cell wall with nanoparticles promoted the growth inhibition of microalgae and the secretion of cell wall lytic enzyme. If the nanoparticles are sufficiently small and can pass through damaged cell walls, it is highly likely that the nanoparticles can enter the cytoplasm and induce cell death by phagocytosis.

In addition, nanoparticles of organic compounds can induce cell death against a wide range of algae or induce abnormal secretion of cell wall lytic enzymes that do not directly induce cell death but are partially degraded even if the cell wall is small. Thus, the cells can be easily changed to a state in which the cells are lysed by mechanical stimulation. In addition, as shown by accelerated chlorophyll degradation and ROS generation, it causes damage to the photosynthetic system and various metabolic abnormalities.

The algal growth inhibitor of the present invention prevents or suppresses water pollution caused by the growth of the above-mentioned microalgae. The algae growth inhibitor can suppress the growth of microalgae, or can kill and remove microalgae that have already occurred, thereby preventing water pollution caused by the growth of microalgae or Can be suppressed. By preventing or suppressing water pollution, damage to fish and shellfish that live in, for example, farms and aquariums can be reduced. In addition, by preventing or suppressing water pollution, it is possible to suppress odors and improve the landscape.

The water pollution is red tide or pollution in a closed water area. The red tide is a phenomenon in which a large amount of microalgae is generated in open waters and semi-open waters such as oceans, lakes and dam lakes, and causes various problems as described above. Examples of the closed water area include artificial closed water areas such as ponds, fountains, reservoirs, moats, drains, septic tanks, water-cooled cooling towers, bathtubs, and farms in parks. The algal growth inhibitor of the present invention can suppress the occurrence of abnormalities of the above-mentioned specific types of microalgae and the surface layer accumulation phenomenon, thereby preventing or suppressing contamination in the red tide or closed water area.

Moreover, the algal growth inhibitor of the present invention prevents or suppresses the growth of microalgae on the solid surface. The solid may be, for example, a member used in a plant factory or an outer wall for building materials. That is, as a member to be used in a plant factory, a microalgae that inhibits the growth of plant seedlings by applying an algae growth inhibitor to the hole for inserting the seedlings formed in the member supporting the plant seedlings. Proliferation can be prevented or suppressed. In addition, by applying an algal growth inhibitor to the outer wall for building materials, the growth of microalgae that grow on the outer wall for building materials can be prevented or suppressed.

[14] A method for suppressing the growth of algae using nanoparticles of an organic compound mainly composed of hydrocarbons and having affinity for the cell walls of algae.
[15] The method for suppressing the growth of algae according to [14], wherein the algae are microalgae.
[16] The method for inhibiting the growth of algae according to [15], wherein microalgae insensitive to the nanoparticles can be grown.

According to the configurations of [14] to [16] above, the organic compound nanoparticles adhere to the cell surface due to the affinity with the cell wall and cover the cell surface, so that the cell is in contact with the external environment. It becomes difficult to introduce components essential for growth, such as oxygen, carbon dioxide, and nutrients (suffocation effect), and the suffocation effect causes physiological abnormal reactions such as ROS accumulation, chlorophyll degradation, and cell wall lytic enzyme secretion. Wake up. As a result, an event occurs in which the cell becomes a protoplast or the nanoparticle enters the cytoplasm through the damaged cell wall. As a result, the homeostasis of the cells is not maintained, and it is considered that cell death is caused. According to this concept, it can be interpreted that the suffocation effect by covering the whole cell wall with nanoparticles promoted the growth inhibition of microalgae and the secretion of cell wall lytic enzyme. If the nanoparticles are sufficiently small and can pass through damaged cell walls, it is highly likely that the nanoparticles can enter the cytoplasm and induce cell death by phagocytosis.

In addition, nanoparticles of organic compounds can induce cell death against a wide range of algae or induce abnormal secretion of cell wall lytic enzymes that do not directly induce cell death but are partially degraded even if the cell wall is small. Thus, the cells can be easily changed to a state in which the cells are lysed by mechanical stimulation. In addition, as shown by accelerated chlorophyll degradation and ROS generation, it causes damage to the photosynthetic system and various metabolic abnormalities.

Through the above mechanism, the growth of algae can be suppressed using nanoparticles of organic compounds that have an affinity for the cell wall of algae (microalgae).

On the other hand, it is useful for the oil production industry utilizing microalgae, for example, to suppress the growth of microalgae that are insensitive to nanoparticles of organic compounds described above and to suppress the growth of microalgae that are insensitive to the nanoparticles. However, until now, there has been no technical means for eliminating unnecessary microalgae growth and selectively growing useful microalgae. In the method of the present invention, unnecessary microalgae (microalgae sensitive to nanoparticles) are eliminated, and useful desired microalgae (microalgae insensitive to nanoparticles) can be selectively grown. . For example, when trying to cultivate microalgae that are not sensitive to nanoparticles such as Euglena gracilis, for example, in an open culture tank in the field, the nanoparticles can be added to the medium for the purpose. Harmful or unnecessary growth of microalgae can be prevented.

It is a photograph figure which shows a mode that many cyanoacrylate nanoparticles adhered to the cell surface of Chlamydomonas rain hardy. It is a photograph figure which shows a mode that many cyanoacrylate nanoparticles adhered to the cell surface of Chlorella vulgaris. It is the graph which showed the result of the trypan blue dyeing | staining assay of Chlamydomonas (wild type CC-124) co-incubated with 250 mg / L cyanoacrylate nanoparticle. It is the graph which showed the result of the trypan blue dyeing | staining assay of Chlamydomonas (wild type CC-124) co-incubated with 500 mg / L cyanoacrylate nanoparticle. It is the graph which showed the result of the trypan blue dyeing | staining assay of Chlamydomonas (wild type CC-124) co-incubated with 1 g / L cyanoacrylate nanoparticle. It is the graph which showed the result of co-incubating with Chlamydomonas with the same molar concentration in cyanoacrylate nanoparticles having different sizes. It is the graph which showed the result of co-incubation with Chlamydomonas with the same surface area in the cyanoacrylate nanoparticle from which size differs. It is the graph which showed the result of having investigated the dead cell rate in wild type CC-124, the very thin cell wall mutant CC-503, and the cell wall deletion mutant CC-400 in Chlamydomonas co-incubated with the cyanoacrylate nanoparticle. . It is the photograph figure which showed the result of having observed the cell ultrastructure of Chlamydomonas after co-incubating with the cyanoacrylate nanoparticle of a size of 25 nm by TEM. It is the graph which showed the result of the ratio which the chlorella cell changed into the protoplast or the spheroplast after the cyanoacrylate nanoparticle exposure with respect to a chlorella. It is the graph which showed the result of having investigated whether protoplast or spheroplast was obtained with the filtrate obtained after the cyanoacrylate nanoparticle exposure with respect to chlorella. It is the photograph figure which showed the result of having observed the cell ultrastructure of the chlorella after co-incubating with the cyanoacrylate nanoparticle of a size of 25 nm by TEM. It is the graph which showed the result (fluorescence positive cell rate) investigated about the time-dependent change of reactive oxygen species (ROS) production | generation. It is the graph which showed the result (dead cell rate) which investigated about the time-dependent change of reactive oxygen species (ROS) production | generation. It is the photograph figure (optical microscope and fluorescence microscope) which showed the result investigated about the time-dependent change of reactive oxygen species (ROS) production | generation. It is the photograph figure which showed the result of having culture | cultivated Euglena gracilis insensitive to a cyanoacrylate nanoparticle on a HUT culture medium. FIG. 3 is a photographic diagram showing the results of culturing Chlamydomonas (wild type CC-124) sensitive to cyanoacrylate nanoparticles on a TAP medium. It is the photograph figure which showed the result of having performed the microscope observation, after adding a cyanoacrylate nanoparticle to Euglena gracilis of a logarithmic growth phase, and culturing for 12 hours. A photograph showing the results of applying a Chlamydomonas (CC-124 strain) on a sample in which a dispersion of cyanoacrylate nanoparticles is uniformly attached on the surface of an agar medium and conducting a culture test (day 0 of culture). is there. A photographic diagram showing the results of applying a Chlamydomonas (CC-124 strain) on a sample in which a dispersion of cyanoacrylate nanoparticles was uniformly attached on the surface of an agar medium and conducting a culture test (7 days of culture). is there. FIG. 5 is a photographic diagram showing the results of applying a Chlamydomonas (CC-124 strain) on a sample in which a dispersion of cyanoacrylate nanoparticles is uniformly attached on the surface of an agar medium and conducting a culture test (day 11 of culture). is there.

Hereinafter, embodiments of the present invention will be described with reference to the drawings.
The algae growth inhibitor that suppresses the growth of algae according to the present invention contains nanoparticles of organic compounds mainly composed of hydrocarbons and having affinity for the cell walls of algae.
Moreover, the method for suppressing the growth of algae according to the present invention suppresses the growth of algae by using nanoparticles of an organic compound mainly composed of hydrocarbons and having an affinity for the cell walls of algae.

The algal growth inhibitor is an organic compound nanoparticle mainly composed of hydrocarbons. That is, the algal growth inhibitor may be nanoparticles composed of an organic compound such as an acrylic resin. Therefore, the algal growth inhibitor does not use metal oxide nanoparticles, is metal-free, has no accumulation in the environment, and is highly safe. In addition, metal oxide nanoparticles often form large agglomerates in aqueous solutions, but organic compound nanoparticles mainly composed of hydrocarbons have little cohesiveness between the nanoparticles, and in aqueous solutions. A dispersed state can be stably maintained.

The cell wall is composed of glycoprotein, chitin, cellulose, proteoglycan and the like in algae (microalgae). The above-mentioned organic compound nanoparticles mainly composed of hydrocarbons have an affinity for the cell wall composed of the above components. The degree of affinity is not particularly limited. For example, the affinity is such that nanoparticles of an organic compound can adhere to and cover the cell surface due to affinity with the cell wall. If there is.

The algae in the present specification include, for example, seaweeds (red algae, brown algae, green algae) that are multicellular organisms, and microalgae that cause red tides. This embodiment demonstrates the case where algae is used as a micro algae.

The microalgae includes, for example, green algae belonging to the green algal plant gate, dinoflagellate belonging to the dinoflagellate gate, diatom belonging to the diatom plant gate, rafido algae belonging to the irregular plant gate, golden algae and true-eye algae It is.

Examples of the green algae belonging to the green algae plant gate include algae belonging to the green algae class or the Trevoxia algae class. Examples of the green algae belonging to the green alga class include Chlamydomonas, and examples of the green algae belonging to the Trevoxia algae class include Chlorella. The genus Chlamydomonas has a shape of 10 to 30 μm in a spherical shape or a smooth ellipse shape, and has two flagellums of almost the same length as the insect antennae in front of the cell body. The genus Chlorella is a nearly spherical shape with a diameter of about 2 to 10 μm and has no flagella.

The genus Chlamydomonas applanata, Chlamydomonas assymetrica, Chlamydomonas debaryana, Chlamydomonas lam lambomona monadina), Chlamydomonas noctigama, Chlamydomonas parkeae, Chlamydomonas perpusilla, Chlamydomonas reinhardtii, but not limited to them, such as Chlamydomonas reinhardtii.

Examples of the genus Chlorella include, but are not limited to, Chlorella ellipsoidea, Chlorella saccharophila, Chlorella sorokiniana, Chlorella 等 vulgaris, and the like. is not.

In addition, Chlamydomonas and other microalgae (Chlorophyceae) other than Chlorella genus (Astrephomene gubernaculifera), Carteria radiosa, Dismorphococcus globosus, Eudoraina elegans (Eudo, elegans) Gonium multicocum, Labochlamys culleus, Pandorina morum, Phacotuslenticularis, Tetrabaena socialis, Volbox Carteri (Volvox carti, Volvox carti) (Volvulina steiniii) and the like, but are not limited thereto.

Further, other microalgae other than the above-mentioned green algae include Chattonella marina (Rafido algae), Heterocapsa triketra (Heterocapsatriquetra), Thalassioneama nitzschioides (Diatomae), Karenia mikimotoi (Dinoflagellate), Keetoceros debilis (Chadiato), Calyptophaphaphaera sphaeroidea (Golden algae), Gambierdiscus sp (Dinoflagellate) , Heterosigma akashiwo (Rafido algae), Odontella longicruris (Odontella longicruris) and the like, but are not limited thereto.

In this embodiment, the case where the nanoparticles are cyanoacrylate nanoparticles will be described. The cyanoacrylate nanoparticles are preferably polymerized in the presence of a cyanoacrylate monomer and a surfactant.

As long as the algal growth inhibitor in the present invention contains cyanoacrylate nanoparticles having an average particle diameter of 10 to 500 nm, preferably 25 to 350 nm, a particle dispersion, a particulate form, a granular form, etc. Any aspect may be sufficient. The dispersion may take a form such as a suspension or a colloidal liquid, but is not limited thereto. In addition, the algal growth inhibitor may have a cyanoacrylate nanoparticle concentration of 30 mg / L to 1 g / L, preferably 250 to 1 g / L.

The cyanoacrylate polymer portion is obtained by anionic polymerization of a cyanoacrylate monomer. The cyanoacrylate monomer used is preferably an alkyl cyanoacrylate monomer (the alkyl group preferably has 1 to 8 carbon atoms), and is particularly used as an adhesive for sutures in the surgical field. It is preferable to use butyl cyanoacrylate represented by the formula.

As the cyanoacrylate monomer, butyl cyanoacrylate such as isobutyl cyanoacrylate, n-butyl-2-cyanoacrylate, sec-butyl cyanoacrylate, tert-butyl cyanoacrylate, etc. can be used, and methyl cyanoacrylate, ethyl cyanoacrylate ( Other alkyl cyanoacrylates such as adhesive for false eyelashes) and propyl cyanoacrylate may be selected. In particular, isobutyl cyanoacrylate, n-butyl-2-cyanoacrylate, and ethyl cyanoacrylate are excellent in safety.

In anionic polymerization, a surfactant is used to stabilize the polymerization. As the surfactant, a nonionic surfactant or an ionic surfactant can be used, but the surfactant is not limited thereto. The ionic surfactant is preferably an anionic surfactant, but is not limited thereto.

As nonionic surfactants, for example, polysorbates ( Tween 20, 40, 60, 80, etc.) can be used, and as anionic surfactants, for example, alkylbenzenesulfonic acid or a salt thereof, sodium lauryl sulfate, sodium laureth sulfate, sodium dodecylbenzenesulfonate. , Sodium 1-pentanesulfonate, sodium 1-decanesulfonate and the like can be used, but are not limited thereto.

The nonionic surfactant and the anionic surfactant may be used at the same time. By using a nonionic surfactant and an anionic surfactant in combination, the cyanoacrylate polymer particles hardly aggregate over time.

Also, the above-mentioned surfactant can be used in combination with those having a function of stabilizing the polymerization of anionic polymerization such as polyethylene glycol and saccharide.

The saccharide is not particularly limited and may be any of a monosaccharide having a hydroxyl group, a disaccharide having a hydroxyl group, and a polysaccharide having a hydroxyl group, and is particularly preferably a polysaccharide. Examples of monosaccharides include glucose, mannose, ribose and fructose. Examples of the disaccharide include maltose, trehalose, lactose and sucrose. As the polysaccharide, dextran, mannan, or the like used for the polymerization of conventionally known cyanoacrylate polymer particles can be used.

The cyanoacrylate polymer particles are porous, and a desired substance can be conjugated inside. After forming the cyanoacrylate polymer particles, the desired substance may be conjugated to the inside of the cyanoacrylate polymer particles by immersing the cyanoacrylate polymer particles in an aqueous solution of the desired substance or adding the desired substance. The desired substance may be conjugated to the produced particles by performing the above-described anionic polymerization in the presence of the desired substance. For example, amino acids such as glycine and aspartic acid can be conjugated to cyanoacrylate polymer particles. Conjugation refers to a state in which a foreign substance is held in, for example, a hydrophilic molecule.
Moreover, it is not limited to the aspect which conjugated an amino acid to a cyanoacrylate polymer particle in this way, You may set it as the aspect which the cyanoacrylate polymer particle and the amino acid are mixing. The said mixture should just be an aspect with which the cyanoacrylate polymer particle and the amino acid coexist and are mixed.

Water can be used as a solvent for the polymerization reaction. Purified water, ion-exchanged water, distilled water, pure water, tap water, ground water, etc. may be appropriately selected as the water depending on the product application having different required purity.

The algal growth inhibitor of the present invention can be produced by performing anion polymerization of a cyanoacrylate monomer in the presence of a cyanoacrylate monomer and a surfactant. Specifically, the polymerization reaction can be performed, for example, by dissolving a surfactant as a polymerization stabilizer in water as a solvent, adding a cyanoacrylate monomer with stirring, and continuing stirring. Although reaction temperature is not specifically limited, It is good to carry out at room temperature. The reaction time is not particularly limited because the reaction rate varies depending on the pH of the reaction solution, the type of solvent and the concentration of the polymerization stabilizer, and may be appropriately selected depending on these factors, but is usually about 1 to 6 hours. It is.

The concentration of the cyanoacrylate monomer in the polymerization reaction solution at the start of the reaction is not particularly limited, but is usually about 0.01 to 5%, preferably about 0.1 to 3%. The concentration of the surfactant in the polymerization reaction solution at the start of the reaction is not particularly limited, but is usually about 0.01 to 5%, preferably about 0.1 to 3%. The concentration of the saccharide in the polymerization reaction solution at the start of the reaction is not particularly limited, but is usually about 0.01 to 5%, preferably about 0.1 to 3%.

By the polymerization reaction described above, the cyanoacrylate monomer is anionically polymerized to synthesize cyanoacrylate nanoparticles, whereby the algal growth inhibitor of the present invention can be produced.

As a result of the polymerization reaction, the synthesized cyanoacrylate nanoparticles can be used as an algal growth inhibitor in the state of a particle dispersion dispersed in a solvent. The obtained particle dispersion hardly changes over time in the particle size distribution during storage, and the particles do not aggregate or settle even when stored at rest, and is excellent in dispersion stability.

Further, the synthesized cyanoacrylate nanoparticles can be collected by conventional filtration such as centrifugal ultrafiltration and used as an algal growth inhibitor in a particulate or granular state. Furthermore, the cyanoacrylate nanoparticles recovered by filtration can be used as an algal growth inhibitor in the state of a particle dispersion in which the particles are dispersed in a solvent such as water.

The particle size of the synthesized cyanoacrylate nanoparticles can be adjusted by adjusting the concentration of cyanoacrylate monomer in the reaction solution and the reaction time. When a surfactant is used as the polymerization stabilizer, the particle size can be adjusted by changing the concentration and type of the polymerization stabilizer.

Since anionic polymerization is initiated by hydroxide ions, the pH of the reaction solution affects the polymerization rate. When the pH of the reaction solution is high, the hydroxyl ion concentration is high, so that the polymerization is fast, and when the pH is low, the polymerization is slow. Therefore, the pH is preferably about 1 to 4.

The algal growth inhibitor of the present invention prevents or suppresses water pollution caused by the growth of the above-mentioned microalgae. That is, by spreading an appropriate amount of the algal growth inhibitor containing the above-mentioned cyanoacrylate nanoparticles to the ocean, lakes, or water tanks, it is possible to suppress the growth of microalgae, or to kill already generated microalgae. Therefore, it is possible to prevent or suppress water pollution caused by the growth of microalgae. By preventing or suppressing water pollution, damage to fish and shellfish that live in, for example, farms and aquariums can be reduced. In addition, by preventing or suppressing water pollution, it is possible to suppress odors and improve the landscape.

The algae growth inhibitor is not only sprayed directly on the ocean, lakes, or aquariums, but also solids containing the algae growth inhibitors may be introduced into the oceans, lakes, or aquariums. For example, if the solid is solidified (filmed) by mixing cyanoacrylate nanoparticles with polyethylene glycol or gelled by mixing with polyethylene oxide, the mode is particularly limited. It is not a thing.

The water pollution is red tide or pollution in a closed water area.
The red tide is water pollution caused by the generation of a large amount of microalgae in open and semi-open water systems such as the ocean and lake water. In addition, examples of the closed water area include artificial closed water areas such as ponds, fountains, reservoirs, moats, drains, septic tanks, water-cooled cooling towers, bathtubs, and farms in parks, but are not limited thereto. Absent. In these closed water areas, the production of a large amount of microalgae causes water pollution.

In the case of red tide, the above-mentioned algal growth inhibitor containing cyanoacrylate nanoparticles may be added to or sprayed on the surface of a ship where the red tide is generated or expected from the air, or a solid substance containing an algal growth inhibitor may be added. You may throw into the said area | region.

In a closed water area, the above-described algal growth inhibitor containing cyanoacrylate nanoparticles may be added to or sprayed on the water surface, and solid matter containing the algal growth inhibitor may be added to a pond, fountain, reservoir, moat in a park. , It may be put into artificial closed water areas such as drains, septic tanks, water-cooled cooling towers, bathtubs, and farms.

The algal growth inhibitor of the present invention prevents or inhibits the growth of microalgae on a solid surface. The solid may be, for example, a member used in a plant factory or an outer wall for building materials. That is, as a member to be used in a plant factory, a microalgae that inhibits the growth of plant seedlings by applying an algal growth inhibitor to a hole for inserting the seedlings formed in a member that supports plant seedlings in advance. Can be prevented or suppressed. In addition, by applying an algae growth inhibitor to building material outer walls (for example, shaded areas with less sunlight), it is possible to prevent or suppress the growth of microalgae that grow on the outer wall of building materials in a wet state. Can do.

In addition, as algae, for example, it is possible to prevent or inhibit the growth of seaweeds, which are multicellular organisms, on solids such as ship bottoms by the algal growth inhibitor of the present invention. In this case, by applying an algal growth inhibitor to the ship bottom or the like in advance, it is possible to prevent or suppress the growth of seaweed on the ship bottom or the like.

Many cyanoacrylate nanoparticles adhere to and cover the cell surface due to affinity with the cell wall (Fig. 1: Chlamydomonas reinhardtii wild type, Fig. 2: Chlorella vulgaris) )). This makes it difficult for cells to introduce components essential for growth, such as oxygen, carbon dioxide, and nutrients, with the external environment (choking action). The choking action causes physiological abnormal reactions such as accumulation of ROS (reactive oxygen species), chlorophyll degradation, and cell wall lytic enzyme secretion. As a result, an event occurs in which the cells become protoplasts or the nanoparticles pass through the damaged cell wall and enter the cytoplasm (FIG. 9). As a result, the homeostasis of the cells is not maintained, and it is considered that cell death is caused. According to this concept, it can be interpreted that the suffocation effect by covering the whole cell wall with nanoparticles promoted the growth inhibition of microalgae and the secretion of cell wall lytic enzyme. In order to achieve asphyxiation, the nanoparticles need only have an affinity to stably adhere to the outermost layer of cells (so-called cell walls), and high specificity such as binding to specific receptor proteins is necessary. There is no. Therefore, if it is a nanoparticle which has affinity with the outermost layer of a target cell, possibility that a metabolic disorder will be caused not only with a cyanoacrylate nanoparticle but with various species by the choking effect is high. If the nanoparticles are sufficiently small and can pass through damaged cell walls, it is highly likely that the nanoparticles can enter the cytoplasm and induce cell death by phagocytosis.

Cyanoacrylate nanoparticles have the ability to induce cell death against a wide range of algae, or induce abnormal secretion of cell wall lytic enzymes that do not directly induce cell death but are partially degraded even if the cell wall is at least small. The cells can be easily changed to a state in which the cells are lysed by mechanical stimulation. In addition, as shown by accelerated chlorophyll degradation and ROS generation, it causes damage to the photosynthetic system and various metabolic abnormalities.

Moreover, in the method for inhibiting the growth of algae according to the present invention, microalgae that are insensitive to nanoparticles can be grown. According to this method, for example, in the case of culturing in an open culture tank in the field, by adding nanoparticles to the medium, the growth of unnecessary microalgae (microalgae sensitive to nanoparticles) is eliminated. The useful desired microalgae (microalgae insensitive to nanoparticles) can be selectively grown.

Examples of useful microalgae that are insensitive to nanoparticles include Euglena gracilis (Euglena algae), Haematococcus lacustris (Hematococcus algae), etc., but are not limited thereto. Absent.

[Example 1]
Cyanoacrylate nanoparticles (isobutyl cyanoacrylate nanoparticles), which are nanoparticles of an organic compound contained in the algal growth inhibitor of the present invention, were prepared by the following method.

To 200 mL of 0.01 N hydrochloric acid solution, 2.5 mL of Rheodor TW-L 120 2.5 mL (manufactured by Kao Corporation) as a nonionic surfactant as a dispersant / stabilizer and 2.0 mL of Neoperex G-15 as an anionic surfactant (Kao) In addition, 2.0 mL of isobutyl cyanoacrylate (manufactured by Toagosei Co., Ltd .: # 501) was added dropwise, and a magnetic stirrer (RS-1DN manufactured by AS ONE Co., Ltd.) was used. The polymerization reaction was carried out under conditions of 2 hours. Two hours later, 4.0 N of 0.5 N hydrochloric acid (manufactured by Wako Pure Chemical Industries, Ltd.) was added dropwise to carry out a neutralization reaction for 1 hour. The reaction solution was filtered through a 5.0 μm size membrane filter (manufactured by Sartorius Co., Ltd .: Minisalt) to obtain 1.0 wt% cyanoacrylate nanoparticles. The particle size (average particle size) of the cyanoacrylate nanoparticles obtained at this time was 25 nm as measured by a conventional method using a Zetasizer (Malvern Nano-ZS90).

In addition, by adding 2.0 g of dextran (molecular weight 60,000: manufactured by Wako Pure Chemical Industries, Ltd.) as a dispersant / stabilizer to the hydrochloric acid solution described above and performing a polymerization reaction, cyanoacrylate having a particle size of 180 nm Nanoparticles were made. Furthermore, by adding 6.0 g of polyethylene glycol (molecular weight 20,000: manufactured by Wako Pure Chemical Industries, Ltd.) as a dispersant / stabilizer to the hydrochloric acid solution described above, and performing a polymerization reaction, cyano having a particle size of 350 nm. Acrylate nanoparticles were prepared. The cyanoacrylate nanoparticles having these three particle sizes were used in the following examples.

[Example 2]
The effect of cyanoacrylate nanoparticle exposure on Chlamydomonas reinhardtii (wild type CC-124) was investigated. Wild-type CC-124 Chlamydomonas used in this example was provided by the Chlamydomonas Resource Center at the University of Minnesota (USA). Chloramonas of wild-type CC-124 is mixed nutritionally under constant fluorescence (84 mmol photon m ⁻² s ⁻¹ ) while gently shaking in Tris-Acetate-Phosphate (TAP) medium (pH 7.0). Cells that had been cultured and reached the middle logarithmic growth phase (OD750 ca. 0.8) were used for the assay.

The cyanoacrylate nanoparticles used various sizes (25 nm, 180 nm, 350 nm), and assayed at concentrations of 250 mg / L, 500 mg / L, and 1 g / L at each size. The co-incubation of the Chlamydomonas and cyanoacrylate nanoparticles was performed with very gentle rotation (10 rpm). As a negative control, a culture solution containing only cells and a dispersing agent and subjected to simultaneous incubation was used.

By co-incubating with cyanoacrylate nanoparticles of various sizes, Chlamydomonas immediately showed an abnormal migration pattern with rapid and frequent orbital changes and eventually stopped migration. In addition, due to this co-incubation, the cyanoacrylate nanoparticles adhere to and cover the cell surface due to the affinity with the cell wall (FIG. 1), and the original elliptical shape of Chlamydomonas gradually changes to a spherical shape. Observed. Most of the cells that stopped migration swelled spherically, and some of them disintegrated, releasing the cytoplasmic contents. This was thought to mean that such swollen globular cells are protoplasts or have very thin cell walls (spheroplasts). Such an acute response was elicited regardless of the size difference of the cyanoacrylate nanoparticles, but in a negative control containing only the dispersant used to prepare the cyanoacrylate nanoparticles, such changes were not at all. I was not able to admit.

Here, in order to examine the survival rate of Chlamydomonas exposed to cyanoacrylate nanoparticles in the simultaneous incubation, a trypan blue staining assay for staining dead cells in blue was performed. A 0.3 mL culture sample was taken out and a trypan blue (0.4% w / v, manufactured by Wako Pure Chemical Industries, Ltd.) solution was directly added (final concentration 0.2% (w / v)). The cytoplasm color was observed with a microscope (IX71: Olympus Corporation) after 5 minutes without a washing step. In this assay, the destroyed and stained cells were dark blue and were considered dead cells. The results are shown in FIG. 3 (250 mg / L), FIG. 4 (500 mg / L), and FIG. 5 (1 g / L). In the figure, “NP” represents cyanoacrylate nanoparticles.

From FIG. 3, when the concentration of cyanoacrylate nanoparticles was 250 mg / L, all (100%) cells were stained by co-incubation with cyanoacrylate nanoparticles having a size of 25 nm for 2 hours (100% dead cell rate). ). Also, about 75% of cells were stained by co-incubation with 180 nm size cyanoacrylate nanoparticles for 2 hours, and less than 20% by co-incubation with 350 nm size cyanoacrylate nanoparticles for 2 hours. Cells were stained. All (100%) cells were stained by co-incubation with 180 nm size cyanoacrylate nanoparticles for 3 hours, but even when co-incubated with 350 nm size cyanoacrylate nanoparticles for 4 hours, 60% Less than% cells were stained.
From this, it was recognized that the dead cell rate depends on the particle size of the cyanoacrylate nanoparticles, and that the smaller the particle size, the more dead cells can be induced (in the order of 25 nm, 180 nm, and 350 nm). Moreover, it was recognized that dead cells can be induced in any of the cyanoacrylate nanoparticles having different particle sizes.

The dead cell rate when co-incubated with cyanoacrylate nanoparticles of 25 nm size (250 mg / L) for 2 hours was about 30% (FIG. 3), but cyanoacrylate nanoparticles of 25 nm size (500 mg / L) The dead cell rate when co-incubated with 2 hours was about 65% (FIG. 4), and the dead cell rate when co-incubated with 25 nm size cyanoacrylate nanoparticles (1 g / L) for 2 hours was 100%. (FIG. 5).
From this, it was recognized that many dead cells could be induced by increasing the concentration of cyanoacrylate nanoparticles even in the same incubation period.

From FIG. 4, when the concentration of cyanoacrylate nanoparticles was 500 mg / L, all (100%) cells were stained by co-incubation with cyanoacrylate nanoparticles having a size of 25 nm for 2 hours (dead cell rate of 100%). ). Also, approximately 100% of cells were stained by co-incubation with 180 nm size cyanoacrylate nanoparticles for 3 hours, and approximately 100% cells were co-incubated with 350 nm size cyanoacrylate nanoparticles for 4 hours. Was stained.
FIG. 5 shows that when the concentration of cyanoacrylate nanoparticles was 1 g / L, all (100%) cells were stained by co-incubation with cyanoacrylate nanoparticles having a size of 25 nm for 1 hour (dead cell rate of 100%). ). In addition, approximately 100% of cells were stained by co-incubation with cyanoacrylate nanoparticles of 180 nm size for 2 hours, and approximately 100% of cells were co-incubated with cyanoacrylate nanoparticles of 350 nm size for 3 hours. Was stained.
From this, it was recognized that dead cells could be induced in a short time by increasing the concentration of cyanoacrylate nanoparticles.

From the above, in the three kinds of cyanoacrylate nanoparticles with different particle sizes, the order in which cell death can be rapidly induced at a low concentration was confirmed to be 25 nm, 180 nm, and 350 nm in descending order of their action. It was also suggested that the cells stained with trypan blue were dead cells with severe damage to the plasma membrane.

It should be noted that cyanoacrylate nanoparticles having a particle size of 25 nm and 180 nm were not observed to aggregate even after 8 hours co-incubation with Chlamydomonas. Cyanoacrylate nanoparticles with a particle size of 350 nm produced aggregates consisting of 20-30 nanoparticles with co-incubation for more than 4 hours. From this, it was recognized that the organic compound nanoparticles (cyanoacrylate nanoparticles) contained in the algal growth inhibitor of the present invention have almost no cohesiveness between the nanoparticles, and can stably maintain a dispersed state in an aqueous solution. .

In the case of cyanoacrylate nanoparticles having a size of 25 nm, the concentration at which dead cells could be induced against Chlamydomonas wild-type CC-124 was 30 mg / L (results not shown).

Moreover, in the case of cyanoacrylate nanoparticles of different sizes, if the same molar concentration (number of particles) is used and co-incubation with Chlamydomonas, cyanoacrylate nanoparticles with a larger particle size (180 nm, 350 nm) can be obtained (death) The ratio at which cells can be induced tended to be large (FIG. 6).

Furthermore, in the case of cyanoacrylate nanoparticles of different sizes, the effect obtained (the ratio at which dead cells can be induced) showed the same tendency when co-incubated with Chlamydomonas with the same surface area introduced into the culture solution ( FIG. 7).

Example 3
In Chlamydomonas reinhardtii, the dead cell rate in wild type CC-124, very thin cell wall mutant CC-503 and cell wall deletion mutant CC-400 was examined. The two variants were also provided by the Chlamydomonas Resource Center at the University of Minnesota (USA). As described in Example 2, the dead cell rate was determined by co-incubating with cyanoacrylate nanoparticles (250 mg / L) having a size of 25 nm and performing a trypan blue staining assay. The results are shown in FIG.

As a result, co-incubation with cyanoacrylate nanoparticles for 1 hour induced about 95% dead cells in cell wall defective mutant CC-400 and about 40% dead cells in thin cell wall mutant CC-503. Cells were induced and about 28% dead cells were induced in wild type CC-124.

From this, it was shown that cell wall deletion mutant CC-400, thin cell wall mutant CC-503, and wild type CC-124 are in descending order of sensitivity to cyanoacrylate nanoparticles. This order of sensitivity suggested that the cell wall acts as a kind of mechanical barrier that inhibits dead cell induction by cyanoacrylate nanoparticles.

Example 4
Cellular ultrastructure of Chlamydomonas (wild-type CC-124) after co-incubation with cyanoacrylate nanoparticles (65 mg / L) of 25 nm size for 20 minutes was observed by TEM. The results are shown in FIG.

As a result, a large number of cyanoacrylate nanoparticles were observed inside the cell wall of wild type CC-124 and between the cell wall and the plasma membrane (periplasmic space). That is, in the cell ultrastructure observed by TEM, the cell wall has strong damage, and cyanoacrylate nanoparticles accumulate inside the cell wall and between the cell wall and the plasma membrane (periplasmic space) and enter the cytoplasm. Proved that

Example 5
The effect of cyanoacrylate nanoparticle exposure on Chlorella vulgaris was investigated. Chlorella vulgaris used in this example was provided by the National Institute for Environmental Studies (NIES).

The cyanoacrylate nanoparticles used various sizes (25 nm, 180 nm, 350 nm), and assayed at a concentration of 1 g / L at each size. Due to this co-incubation, the cyanoacrylate nanoparticles adhere to and cover the surface of the cell due to the affinity with the cell wall (FIG. 2). As a result, chlorella cells are not induced into dead cells, and protoplasts or spherospheres are not induced. Changed to plast (protoplast / spheroplast).

The appearance of protoplasts / spheroplasts was confirmed by a cell wall staining test using Fluorescent Brightener 28 (F3543, manufactured by Sigma-Aldrich), which is a fluorescent dye that specifically binds to chitin and cellulose.

A stock solution of Fluorescent Brightener 28 (1 mg / mL in H ₂ O) was added to the cell culture (final concentration 0.04 mg / mL). Samples were kept in the dark for 10 minutes prior to optical microscopy. Stained cells were observed without a washing step using a microscope (IX71: manufactured by Olympus Corporation) having a U-MWU2 filter unit or BZ-X700 (manufactured by Keyence Corporation).

In this test, cells with pure red fluorescence were determined as protoplasts / spheroplasts, and cells with pink-red were evaluated as non-protoplasts / spheroplasts. To establish this criterion, Chlorella vulgaris protoplasts were prepared using a commercially available lytic enzyme mixture. Commercially available lytic enzyme mixtures are 0.5% cellulidine (produced by Calbio Chem), 2% maceroteam R-10 (produced by Yakult Pharmaceutical Co., Ltd.) and 1% chitosanase derived from Bacillus R-4 (Kei Kasei Co., Ltd.). (Manufactured by the company) dissolved in a 25 mM phosphate buffer (pH 7.0) containing 0.5 M mannitol was used. Harvest cells at mid-log phase (OD750 = 0.8-1.0) by centrifugation (1000 × g, 10 min), then suspend cell pellet in enzyme mixture (2 × 10 ⁸ cells / mL) Incubated for 4-8 hours at 25 ° C. with very gentle shaking in a dim place.
In the cells treated with the enzyme, pure red fluorescent cells from which the cell walls in the vicinity were removed were used as a reference standard for protoplasts. On the other hand, the color of the non-enzyme-treated cells was pinkish red as a result of the fusion of the pure red autofluorescence of chlorophyll and the blue fluorescence of fluorescent brightener 28 and was used as a reference standard for non-protoplasts.

Samples were periodically removed by simultaneous incubation with cyanoacrylate nanoparticles and the number of protoplasts / spheroplasts in 100 cells observed was counted (FIG. 10). The peak frequency of protoplast / spheroplast reached about 60% after 4 hours of co-incubation with 25 nm cyanoacrylate nanoparticles. The 25 nm cyanoacrylate nanoparticles induced protoplasts / spheroplasts more efficiently than the 180 nm and 350 nm cyanoacrylate nanoparticles.

Even when the concentration of cyanoacrylate nanoparticles was changed to 250 mg / L and 500 mg / L, protoplasts / spheroplasts were induced (results not shown). Protoplast / spheroplast was also not stained with trypan blue.

The same experiment was carried out for three genus Chlorella other than Chlorella vulgaris, namely Chlorella ellipsoidea, Chlorella saccharophila, and Chlorella sorokiniana. . These were provided by the National Institute for Environmental Studies (NIES). As a result, protoplasts / spheroplasts were also induced for these three genus Chlorella by simultaneous incubation with 25 nm cyanoacrylate nanoparticles. In particular, for chlorella ellipsoides, protoplasts / spheroplasts were induced at the same level as Chlorella vulgaris (results not shown).

Example 6
It was investigated whether cell wall lytic enzyme was secreted by exposure to cyanoacrylate nanoparticles against Chlorella vulgaris.

Cells were recovered after co-incubation of chlorella and 350 nm cyanoacrylate nanoparticles (1 g / L) for 8 hours, and the supernatant was filtered using a membrane filter unit having 100 nm size pores to remove cyanoacrylate nanoparticles. did. The filtrate was added to a cell pellet prepared from exponentially growing Chlorella vulgaris and incubated for 8 hours, which turned about 15% of the cells into protoplasts / spheroplasts (FIG. 11). The determination of protoplast / spheroplast was performed according to Example 5.

This clearly showed that the filtrate contained chlorella cell wall lytic enzyme secreted in the abnormally proliferating cell cycle. Note that “control” in FIG. 11 is obtained by co-incubation with a culture solution containing only cells and a dispersing agent, and “NP (350 nm)” is produced by protoplast / spheroplast by co-incubation with cyanoacrylate nanoparticles. Indicates what was induced.

Example 7
The cellular ultrastructure of chlorella after co-incubation with 25 nm sized cyanoacrylate nanoparticles (1 g / L) for 3 hours was observed by TEM. The results are shown in FIG.

As a result, cyanoacrylate nanoparticles were not detected inside the cell wall and between the cell wall and the plasma membrane (periplasmic space).

Example 8
In the above-mentioned Examples, the effect of cyanoacrylate nanoparticle exposure was examined in Chlamydomonas reinhardtii belonging to the genus Chlamydomonas. In this example, the effects of exposure to cyanoacrylate nanoparticles (25 nm) were examined for other Chlamydomonas species and Green algae. The experimental conditions were the same as in the above-described example. For reference, the results are also shown for the four Chlamydomonas reinhardtii species used in the above-described Examples (Table 1-1, Table 1-2).

As a result, Chlamydomonas globosa (Chlamydomonas applanata), Chlamydomonas assymetrica, Chlamydomonas debaryana, Chlamydomonas clamosa, Dead cell induction was observed in Chlamydomonas monadina, Chlamydomonas noctigama, Chlamydomonas parkeae, and Chlamydomonas perpusilla.

In addition to the genus Chlamydomonas, Asprephomene gubernaculifera, Carteria radiosa, Dysmorphococcus globosus, Eudorina elegans, Gonium multicocum, Gonium multicocum Creochs (Labochlamys culleus), Pandorina morum, Phacotus
Induction of dead cells was observed in lenticularis, Tetrabaena socialis, Volvox carteri, and Volvulina steiniii.

Therefore, it was recognized that by using the algal growth inhibitor of the present invention, water pollution (red tide or pollution in a closed water area) caused by the growth of the above-mentioned microalgae can be prevented or suppressed.

Example 9
The time course of reactive oxygen species (ROS) production by exposure to cyanoacrylate nanoparticles was examined in Chlamydomonas reinhardtii wild-type CC-124.

In order to detect reactive oxygen species, 2 ', 7'-dichlorodihydrofluorescein diacetate (H2DCFDA) (D668, manufactured by Sigma-Aldrich) was used. Non-fluorescent H2DCFDA is converted to highly fluorescent 2 ', 7'-dichlorofluorescein (DCF) by reactive oxygen species in the cytoplasm.

Co-incubation of Chlamydomonas and 25 nm cyanoacrylate nanoparticles (100 mg / L) attempted to detect time-dependent increased fluorescence-positive cells released from DCF as oxidized forms of H2DCFDA by ROS accumulated in the cytoplasm . Fifteen minutes prior to fluorescence microscopy, H2DCFDA dissolved in DMSO was added to the cell culture (final concentration 10 μM). The fluorescence of DCF was observed with a microscope (IX71: manufactured by Olympus Corporation).

As a control, a culture medium containing only cells and a dispersing agent was used, and as a comparative control, two types of metal oxide nanoparticles, that is, ZnO containing less than 100 nm (544906, Sigma-Aldrich). And TiO ₂ (anatase form) (205-01715, manufactured by Wako Pure Chemical Industries, Ltd.) were used.

As a result, the fluorescence positive cell rate reached a peak at 60 to 90 minutes after the start of the simultaneous incubation (FIGS. 13 and 14). In addition, as a result of observation with a fluorescence microscope, only the sample obtained by simultaneous incubation of Chlamydomonas and 25 nm cyanoacrylate nanoparticles detected the fluorescence of DCF (FIG. 15), but the sample using two types of metal oxide nanoparticles. No fluorescence was detected. This clearly showed that cyanoacrylate nanoparticles were more capable of inducing physiological disturbances than the same concentration of these metal oxide nanoparticles.

Example 10
In this example, the effects of exposure to cyanoacrylate nanoparticles (25 nm) were examined for other microalgae other than the green alga class described above. The experimental conditions were the same as in the above-described example.

The microalgae used are dinoflagellates belonging to the dinoflagellate, diatoms belonging to the diatomaceous plant, rafidoalgae or golden algae belonging to the irregular planta, and specifically, Shutnera marina ( Chattonella marina (NIES-1), Heterocapsatriquetra (NIES-7), Thalassioneama nitzschioides (NIES-534), Karenia mikimotoi (NIES-2411), rosdece NIES-3710), Calyptrosphaera sphaeroidea (NIES-1308), Gambierdiscus sp (NIES-2766), Heterosigma akashiwo (NIES-5), Odontera Longicurlis (Odontella longicruris: NIES-590).

As a result, dead cell induction was observed for all these microalgae. Therefore, it was recognized that the use of the algal growth inhibitor of the present invention can prevent or suppress water pollution (red tide or pollution in a closed water area) caused by the growth of the above-mentioned microalgae.

Example 11
Regarding microalgae insensitive to cyanoacrylate nanoparticles and microalgae sensitive to cyanoacrylate nanoparticles, whether or not each microalgae grew when the concentration of cyanoacrylate nanoparticles was changed in various ways was investigated.

Cyanoacrylate nanoparticles having a particle size of 180 nm are used, and microalgae insensitive to cyanoacrylate nanoparticles is Euglena gracilis (NIES-49), which is sensitive to cyanoacrylate nanoparticles. As the algae, Chlamydomonas reinhardy (wild type CC-124) was used.

1% (10 g / L (w / v)), 0.3%, 0.1%, 0.03%, 0 at different locations on HUT medium (pH 6.4) containing 1.5% agar 20 μL each of 0.01% and 0.003% cyanoacrylate nanoparticles were dropped and adsorbed on the HUT medium. Next, the Euglena gracilis culture solution that reached the logarithmic growth phase was adsorbed onto a cotton swab, spread on a HUT medium, and cultured for 10 days. As a result, it was recognized that Euglena gracilis cells were proliferating at all cyanoacrylate nanoparticle dropping positions (FIG. 16). From this, it was found that Euglena gracilis is resistant to extremely high concentrations (˜1%) of cyanoacrylate nanoparticles (insensitive to cyanoacrylate nanoparticles).

On the other hand, 0.03%, 0.01%, 0.003%, and 0.001% cyanoacrylate nanoparticles were respectively placed at different positions on a TAP medium (pH 7.0) containing 1.5% agar. 20 μL was dropped and adsorbed on the TAP medium. Next, the culture solution of Chlamydomonas (CC-124 strain) that reached the logarithmic growth phase was adsorbed onto a cotton swab, spread on a TAP medium, and cultured for 10 days. As a result, it was confirmed that cells of Chlamydomonas were proliferating at the dropping positions of 0.003% and 0.001% of cyanoacrylate nanoparticles, but 0.03% and 0.01% of cyanoacrylate nanoparticles were dropped. It was recognized that Chlamydomonas cells did not proliferate in the position (FIG. 17: in the broken line part).

Although cyanoacrylate nanoparticles were added to Euglena gracilis in the logarithmic growth phase to a final concentration of 0.01% (100 mg / L) and cultured in a liquid medium for 12 hours, observation was performed with an optical microscope. No cells that stopped swimming were observed (FIG. 18). From this, it was estimated that the cell death rate of Euglena gracilis under this condition was zero. Similar results were obtained when the final concentration of cyanoacrylate nanoparticles was 0.03% (results not shown).

On the other hand, cyanoacrylate nanoparticles were added to Chlamydomonas (CC-124 strain) in the logarithmic growth phase to a final concentration of 0.01% (100 mg / L) and cultured in a liquid medium for 12 hours. However, few cells were observed to swim (results not shown). Similar results were obtained when the final concentration of cyanoacrylate nanoparticles was 0.03% (results not shown).

In addition, an experiment similar to the above was performed using Haematococcus lacustris (NIES-144) as a microalgae insensitive to cyanoacrylate nanoparticles, and the same results as in Euglena gracilis were obtained. It was.

According to this example, for example, when culturing in an open culture tank in the field, cyanoacrylate nanoparticles are added to the culture medium (for example, final concentration is 0.01 to 0.03%), so that Eliminate the growth of microalgae sensitive to particles (eg Chlamydomonas reinhardi) and selectively select microalgae insensitive to cyanoacrylate nanoparticles (eg useful microalgae such as Euglena gracilis, Haematococcus laxtris) It was recognized that it could be grown.

Also, in this experiment, it is shown that the growth of Chlamydomonas reinhardi on the agar is inhibited if the cyanoacrylate nanoparticles are attached to the solid agar surface. Therefore, by attaching cyanoacrylate nanoparticles to the surface of a solid material (member used in a plant factory or an outer wall for building materials), it is expected to inhibit the growth of microalgae on the surface.

Example 12
An experiment was conducted to determine the minimum number of cyanoacrylate nanoparticles necessary for an effect as an algae growth inhibitor on a solid surface and the area density (mass per square meter).

20 μL of a dispersion of cyanoacrylate nanoparticles (particle size 30 nm) diluted to a predetermined concentration (10, 30, 100, 300 ppm) at different positions on TAP medium (pH 7.0) containing 1.5% agar It was dripped and made to adsorb | suck to a TAP culture medium. When 20 μL of the dispersion was dropped, the area spread on the TAP medium was about 0.785 cm ² .
Table 2 shows the results of determining the mass and number of cyanoacrylate nanoparticles, mass g / m ² per square meter, and the like at each concentration.

The culture solution of Chlamydomonas (CC-124 strain) that reached the logarithmic growth phase was adsorbed onto a cotton swab, spread on a TAP medium, and cultured for 10 days. As a result, Chlamydomonas cells were observed to be growing at the dropping position of 10, 30, 100 ppm (level 1 to 3) of cyanoacrylate nanoparticles, but at the dropping position of 300 ppm (level 4) cyanoacrylate nanoparticles. Was found not to grow Chlamydomonas cells (results not shown).

Level 4 cyanoacrylate nanoparticles had a mass per square meter of 0.076 g / m ² .

Example 13
Chlamydomonas (CC-124 strain) was applied to a sample in which a dispersion of cyanoacrylate nanoparticles (particle size 30 nm) was uniformly attached on the surface of an agar medium, and a culture test was performed. Table 3 shows the results of determining the addition amount of the cyanoacrylate nanoparticle liquid added to each sample A to D, the mass of the cyanoacrylate nanoparticles, and the number of cyanoacrylate nanoparticles. Sample E was a control to which no cyanoacrylate nanoparticles were added.

The cyanoacrylate nanoparticle liquid (concentration 1%) of each sample A to D was separately added to a TAP medium (surface area 64 cm ² ) containing 1.5% agar, and the petri dish was placed in a thermostat set at 50 ° C. The cyanoacrylate nanoparticle liquid was dried. A culture solution of Chlamydomonas (CC-124 strain) that reached the logarithmic growth phase was adsorbed onto a cotton swab, spread on a TAP medium, and cultured at room temperature (25 ± 2 ° C.) for 2 weeks. The results are shown in FIG. 19 (culture day 0), FIG. 20 (culture day 7), and FIG. 21 (culture day 11).

As a result, regarding sample A, the growth of Chlamydomonas was clearly confirmed visually on the 11th day of culture. On the other hand, for Samples B to D, the growth of Chlamydomonas was not visually confirmed even on the 11th day of culture. That is, the cyanoacrylate nanoparticles of Samples B to D had a mass per square meter of 0.108 to 1.078 g / m ² .

Together with the results of Example 12, cyanoacrylate nanoparticles square meter per mass is equal 0.076 g / ^{m 2,} or 0.108 g / ^{m 2} or more, preventing or inhibiting the growth of Chlamydomonas with solid surface It was recognized that it was possible. Similar results were obtained for microalgae other than Chlamydomonas (results not shown).

Thus, for example, the outer wall of the building materials, square meter per mass be previously coated with cyanoacrylate nanoparticles solution so that 0.076 g / ^{m 2,} or 0.108 g / ^{m 2} or more, the outer wall of the building materials It can be expected to prevent or suppress the growth of microalgae on the surface.

In order to actually apply the cyanoacrylate nanoparticle liquid to the surface of the outer wall for building materials, it is preferable to carry out as follows. That is, the volume of 0.1 g of the cyanoacrylate nanoparticle dispersion is 10 cm ³ when the dispersion concentration is 1%. In the case of 10 cm ^3, a method in which the dispersion is sprayed and dried can be used. In the case of application, it is easy to work uniformly if it is diluted 10 times and made into a liquid of 100 cm ³ . Considering the drying time, it is advantageous that the amount of liquid to be diluted is small.

Example 14
In outdoor ponds, cyanoacrylate nanoparticles were added to investigate the effect on the growth of microalgae.

The isobutyl cyanoacrylate nanoparticles having a diameter of 25 nm were introduced into one of the 42-ton water ponds arranged in parallel on the Kochi University of Technology campus in a final concentration of 100 ppm. Isobutyl cyanoacrylate nanoparticles were not added to the other pond, which was the target experimental group. After the lapse of 24 days, 500 mL of water was collected from each of the pond to which the cyanoacrylate nanoparticles were added and the pond of the target experimental group, and filtered through a mesh having a mesh size of 1 μm to collect organisms such as microalgae.

The cells were disrupted by repeating freezing and thawing three times for the organism on the filter. Total DNA extraction from the disrupted cells was performed using QIAamp DNA Mini Kit (Qiagen). Using the extracted DNA, an amplicon amplified by the PCR method using the following primer set was analyzed for end-pair sequences under the conditions of 2 × 300 bp using a next-generation sequencer MiSeq (manufactured by Illumina).

1st-1422f
5'ACACTCTTTCCCTACACGACGCTCTTCCGATCTATAACAGGTCTGTGATGCC3 '

1st-1642r
5'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGGGCGGTGTGTACAAAGG3 '

A quality check was performed on the sequence data obtained using the DNA of the organism obtained from the pond into which the cyanoacrylate nanoparticles were introduced, and 49,376 reads (bp) were finally obtained. Moreover, the quality of the sequence data obtained using the DNA of the organism obtained from the pond of the target experimental section was checked, and finally 67,268 reads (bp) were obtained. By comparing these sequence data with GenBank base sequence data managed and managed by the US Biotechnology Information Center, the species closest to the analyzed 18S rDNA sequence was estimated.

Among the analyzed DNA sequences, 7 types were found to have the highest homology to dinoflagellates (Table 4). None of these DNA sequences were detected for a limited number of times or at all from the pond into which the cyanoacrylate nanoparticle solution was introduced. On the other hand, all were detected 60 times or more from the pond of the target experimental section. From these results, it was recognized that these dinoflagellates were species that were killed by most of the growing individuals upon exposure to the cyanoacrylate nanoparticle solution.

Of the analyzed DNA sequences, three types were found to have the highest homology to golden algae (Table 5). None of these DNA sequences were detected for a limited number of times or at all from the pond into which the cyanoacrylate nanoparticle solution was introduced. On the other hand, all were detected 88 times or more from the pond of the target experimental section. From this, it can be said that these golden algae are the species that most of the growing individuals die upon exposure to the cyanoacrylate nanoparticle solution.

Of the analyzed DNA sequences, three types were found to have the highest homology to true-eyed point algae (Table 6). All of these DNA sequences were detected only a limited number of times from the pond into which the cyanoacrylate nanoparticle solution was introduced. On the other hand, all were detected 243 times or more from the pond of the target experimental section. From this, it can be said that these true eyed point algae are species in which most of the grown individuals die upon exposure to the cyanoacrylate nanoparticle liquid.

Among the analyzed DNA sequences, 5 types were found to have the highest homology to green algae (Table 7). In these DNA sequences, the number of reads detected from the pond into which the cyanoacrylate nanoparticle solution was introduced was only about one-third or less of the number of reads detected from the pond of the target experimental group. From these facts, it can be said that these green algae are species that can easily be killed by individuals exposed to the cyanoacrylate nanoparticle solution.

The present invention can be used for an algal growth inhibitor that suppresses the growth of algae and a method for suppressing the growth of algae.

Claims (16)

1. An algae growth inhibitor that suppresses the growth of algae containing organic compound nanoparticles that are mainly composed of hydrocarbons and have affinity for the cell walls of algae.
2. The algal growth inhibitor according to claim 1, wherein the nanoparticles are cyanoacrylate nanoparticles.
3. The algal growth inhibitor according to claim 2, wherein the cyanoacrylate nanoparticles are polymerized in the presence of a cyanoacrylate monomer and a surfactant.
4. The algal growth inhibitor according to claim 3, wherein the cyanoacrylate monomer is isobutyl cyanoacrylate.
5. The algae growth inhibitor according to any one of claims 1 to 4, wherein the algae are microalgae.
6. The algae growth inhibitor according to claim 5, wherein the microalgae are algae belonging to the green algal plant gate.
7. The algal growth inhibitor according to claim 6, wherein the green algae plant gate is an algae belonging to the green algae or the Trevoxia algae.
8. The algal growth inhibitor according to any one of claims 5 to 7, wherein the microalga is an algae belonging to the genus Chlamydomonas or Chlorella.
9. The microalgae is at least one selected from the group of dinoflagellates belonging to the dinoflagellate, diatoms belonging to the diatom plant, rafido algae belonging to the unequal phytophyte, golden algae, or true-eyed algae The algae growth inhibitor according to claim 5.
10. The algae growth inhibitor according to any one of claims 5 to 9, wherein water pollution caused by the growth of the microalgae is prevented or suppressed.
11. The algal growth inhibitor according to claim 10, wherein the water pollution is red tide or pollution in a closed water area.
12. The algae growth inhibitor according to any one of claims 5 to 9, wherein the growth of the microalgae on the solid surface is prevented or suppressed.
13. The algae growth inhibitor according to claim 12, wherein the solid is a member used in a plant factory or an outer wall for building materials.
14. A method of suppressing the growth of algae using nanoparticles of organic compounds mainly composed of hydrocarbons and having affinity for the cell walls of algae.
15. The method of suppressing the growth of algae according to claim 14, wherein the algae are microalgae.
16. The method for inhibiting the growth of algae according to claim 15, wherein microalgae insensitive to the nanoparticles can be grown.
    

Images