JP7134442B2 - Algae growth inhibitor and method for inhibiting algae growth - Google Patents

Description

The present invention relates to an algae growth inhibitor for inhibiting algae growth and a method for inhibiting algae growth.

Red tides in sea areas such as the Seto Inland Sea and bays cause damage to fisheries and deterioration of scenery. In addition, freshwater red tide that occurs in lakes, marshes and dam lakes has become a major social problem. According to Non-Patent Document 1, red tide is a term that refers to the abnormal occurrence of a specific species of plankton that occurs in the sea and its surface accumulation phenomenon. The term freshwater red tide is officially used for those that are yellowish and accumulate in surface waters. Red tides not only degrade the landscape, but also have serious social impacts such as mass mortality of farmed fish. In addition, according to Non-Patent Document 1, the impact of freshwater red tide on surrounding residents is pointed out as follows. (1) At the time of red tide, it gives an unpleasant odor to the tap water and sewage water that uses the water, (2) Causes filtration failure at the water purification plant, and (3) Aquaculture at the fish farm that takes in the water. (4) At the height of the red tide, the surrounding residents may directly smell a foul odor. I am giving you things. In addition to the actual damage, (6) it points out the social impact of the deterioration of the image caused by the outbreak.

Patent Document 1 describes a red tide algicide using silver thiosulfate ions as a component.

Patent Document 2 describes an antibacterial agent containing, as an active ingredient, cyanoacrylate polymer particles conjugated with an antibiotic as an antibacterial agent for vancomycin-resistant Gram-positive bacteria. Cyanoacrylate polymer particles are anionically polymerized cyanoacrylate monomers that are used, for example, as adhesives for suturing wounds in the surgical field. Cyanoacrylate-based polymer particles are porous and can be conjugated with a desired substance inside. In the antibacterial agent of Patent Document 1, by conjugating antibiotics to cyanoacrylate polymer particles, resistance to various antibiotics is acquired, and vancomycin-resistant enterococci (VRE ), the antibacterial effect of antibiotics is exerted, and the proliferation of VRE can be suppressed.

On the other hand, it is known that cyanoacrylate polymer particles are used for purposes other than antibacterial agents. For example, Patent Document 3 describes that nano-sized (average particle size less than 1000 nm) cyanoacrylate polymer particles conjugated with an amino acid were synthesized by anionically polymerizing a cyanoacrylate monomer in the presence of an amino acid. The amino acid-conjugated particles of Patent Document 3 can induce apoptosis-like cell death in cancer cells to damage cancer cells, and are therefore considered useful for cancer treatment and prevention.

Thus, cyanoacrylate polymer particles are useful for antibacterial action and cancer treatment and prevention.

Japanese Patent Application Laid-Open No. 2007-332039 WO2008/126846 WO2010/101178

Edited by Hajime Kadota, "Tamsui Red Tide", "Introduction", Kouseisha Kouseikaku, 1987

Like the above-mentioned red tide and freshwater red tide, the damage caused by the abnormal occurrence of plankton including algae (microalgae) is serious, and effective countermeasures are an important issue. In the present specification, "abnormal occurrence of microalgae and its surface accumulation phenomenon" in sea areas and freshwater areas, and "microalgae occurrence phenomenon in artificial closed water areas" such as farms, cooling circulating water, and fountains. This is referred to as "red tide, etc." regardless of whether it is a sea area, a freshwater area, or an artificially closed water area.

The use of metal ions as described in Patent Literature 1 to suppress the abnormal growth of microalgae and their accumulation on the surface layer may lead to concerns about the accumulation of metals in the environment. Considering the accumulation of metals in the environment, it is desirable to use metal-free ingredients to suppress the growth of microalgae.

Moreover, it is not known to prevent or suppress red tide or the like using the nano-sized cyanoacrylate polymer particles described in Patent Documents 2 and 3.

Accordingly, an object of the present invention is to provide an algae growth inhibitor for inhibiting algae growth and a method for inhibiting algae growth using metal-free nanoparticles.

TECHNICAL FIELD The present invention relates to an algae growth inhibitor having an effect of inhibiting the growth of algae (microalgae) that constitute red tide and the like, and a method for inhibiting the growth of algae. The purpose is to prevent or reduce the above-mentioned damage by suppressing the abnormal growth of algae and its surface layer accumulation phenomenon.

That is, in order to achieve the above objects, the following inventions [1] to [15] are provided.
[1] An algae growth inhibitor containing cyanoacrylate nanoparticles that inhibits the growth of algae.
[2] The algal growth inhibitor according to [1] , wherein the cyanoacrylate nanoparticles are polymerized in the presence of a cyanoacrylate monomer and a surfactant.
[3] The algal growth inhibitor according to [2] , wherein the cyanoacrylate monomer is isobutyl cyanoacrylate.
[4] The algae growth inhibitor according to any one of [1] to [3] , wherein the algae are microalgae.
[5] The algae growth inhibitor according to [4] , wherein the microalgae belong to the phylum Chlorophyta.
[6] The algal growth inhibitor according to [5] , wherein the Chlorophyta belongs to the Chlorophyceae or the Trebouxiaphyceae.
[7] The algae growth inhibitor according to any one of [4] to [6] , wherein the microalgae belong to the genus Chlamydomonas or Chlorella.
[8] The microalgae are at least selected from the group of dinoflagellates belonging to the phylum Dinoflagellate, diatoms belonging to the phylum Diatomaceae, raphidophytes belonging to the phylum Heterochondrome, gold algae, or eunotal algae The algal growth inhibitor according to [4] , which is one type.
[9] The algae growth inhibitor according to any one of [4] to [8] , which prevents or suppresses water pollution caused by the growth of microalgae.
[10] The algae growth inhibitor according to [9] , wherein the water pollution is red tide or pollution in closed water areas.
[11] The algae growth inhibitor according to any one of [4] to [8] , which prevents or inhibits growth of the microalgae on a solid surface.
[12] The algae growth inhibitor according to [11] , wherein the solid is a member used in a plant factory or an outer wall for building materials.

According to the configurations [1] to [12] above, the algae growth inhibitor uses nanoparticles of an organic compound mainly composed of hydrocarbons, for example, nanoparticles composed of an organic compound such as an acrylic resin. be able to. Therefore, since the algae growth inhibitor does not use metal oxide nanoparticles, it is metal-free and is highly safe without accumulating in the environment. In addition, nanoparticles of metal oxides often form large agglomerates in aqueous solutions, but nanoparticles of organic compounds mainly composed of hydrocarbons have almost no cohesiveness among the nanoparticles, and in aqueous solutions A stable dispersed state can be maintained. Specifically, cyanoacrylate nanoparticles are used as the organic compound nanoparticles, and the cyanoacrylate nanoparticles are preferably polymerized in the coexistence of a cyanoacrylate monomer and a surfactant. In particular, the cyanoacrylate monomer is preferably isobutyl cyanoacrylate.

Cell walls in algae (microalgae) are composed of glycoproteins, chitin, cellulose, proteoglycans, and the like. Nanoparticles of the above-mentioned organic compound containing hydrocarbon as a main component show affinity for the cell wall composed of the aforementioned components. Therefore, the organic compound nanoparticles can adhere to and cover the surface of the cell due to their affinity with the cell wall.

Microalgae include, for example, green algae belonging to the phylum Chlorophyta, dinoflagellates belonging to the phylum Dinoflagellate, diatoms belonging to the phylum Diatomaceae, raphid algae belonging to the phylum Heterochondrome, gold algae, and eunotal algae. be Green algae belonging to the phylum Chlorophyta include, for example, algae belonging to the Chlorophyceae or the Trebouxiaphyceae. Examples of green algae belonging to the Chlorophyceae include the genus Chlamydomonas, and examples of the green algae belonging to the class Trebouxia include Chlorella.

As shown in the examples below, the inventors unexpectedly found that nanoparticles of organic compounds caused acute cell death against the eukaryotic unicellular green alga Chlamydomonas spp. can be induced. Furthermore, it was found that it induces the secretion of cell wall lytic enzymes in Chlorella (for example, Chlorella vulgaris) and frequently produces protoplast-like cells.

As described above, a large number of organic compound nanoparticles adhere to the cell surface due to their affinity for the cell wall, covering the surface. This makes it difficult for cells to introduce components essential for growth, such as oxygen, carbon dioxide, and nutrients, into the external environment (suffocation). Such suffocation causes abnormal physiological reactions such as accumulation of ROS (reactive oxygen species), decomposition of chlorophyll, and secretion of cell wall-dissolving enzymes. As a result, events such as protoplasting of cells and nanoparticles penetrating into the cytoplasm through passage of damaged cell walls occur. This is thought to further disrupt cell homeostasis and cause cell death. According to this idea, it can be interpreted that the suffocation effect caused by covering the entire cell wall with nanoparticles promotes the growth inhibition of microalgae and the secretion of cell wall-dissolving enzymes. In addition, if the nanoparticles are sufficiently small to pass through the damaged cell wall, it is highly possible that the nanoparticles can enter the cytoplasm and induce cell death by phagocytosis or the like.

In addition, nanoparticles of organic compounds have the ability to induce cell death in a wide range of algae, or induce the abnormal secretion of cell wall lytic enzymes that do not directly induce cell death, leading to at least partial degradation of the cell wall. Thus, the cells can be changed into a state in which the cells can be easily lysed by mechanical stimulation. In addition, as shown by accelerated decomposition of chlorophyll and generation of ROS, it also causes damage to the photosynthetic system and various metabolic abnormalities.

The algae growth inhibitor of the present invention prevents or suppresses water pollution caused by the growth of microalgae described above. The algae growth inhibitor can suppress the growth of microalgae, or can kill and remove already generated microalgae, so that water pollution caused by the growth of microalgae can be prevented or can be suppressed. By preventing or suppressing water pollution, it is possible to reduce damage to fish and shellfish living in, for example, fish farms and tanks. In addition, by preventing or suppressing water pollution, it is possible to suppress odors and improve the landscape.

The water pollution is red tide or pollution in closed water areas. Red tide is a phenomenon in which a large amount of microalgae occurs in open or semi-open water areas such as oceans, lakes, dam lakes, etc., and causes various problems as described above. Closed water areas include, for example, artificial closed water areas such as ponds, fountains, reservoirs, moats, drainage ditches, septic tanks, water-cooled cooling towers, bathtubs, and fish farms in parks. The algae growth inhibitor of the present invention can suppress the above-mentioned abnormal growth of the specific species of microalgae and its surface accumulation phenomenon, thereby preventing or suppressing red tides or contamination in closed water areas.

In addition, the algae growth inhibitor of the present invention prevents or inhibits the growth of microalgae on solid surfaces. The solid can be, for example, a member used in a plant factory or an outer wall for building materials. That is, as a member used in a plant factory, by applying an algae growth inhibitor to a hole for inserting the seedling formed in a member that supports the seedling of a plant, microalgae that inhibit the growth of the seedling of the plant are inhibited. Proliferation can be prevented or suppressed. Further, by applying an algae growth inhibitor to the outer wall for building materials, it is possible to prevent or suppress the growth of microalgae growing on the outer wall for building materials.

[13] A method of inhibiting algae growth using cyanoacrylate nanoparticles.
[14] The method for inhibiting algae growth according to [13] , wherein the algae are microalgae.
[15] The method for suppressing the growth of algae according to [14] , which allows the growth of microalgae insensitive to the nanoparticles.

According to the above configurations [13] to [15] , a large number of organic compound nanoparticles (cyanoacrylate nanoparticles) adhere to the cell surface due to their affinity with the cell wall and cover the surface, so that the cell is It becomes difficult to introduce components essential for growth such as oxygen, carbon dioxide, and nutrients between the external environment (asphyxiation), and the asphyxiation causes accumulation of ROS, decomposition of chlorophyll, secretion of cell wall lytic enzymes, etc. cause abnormal physiological reactions. As a result, events such as protoplasting of cells and nanoparticles penetrating into the cytoplasm through passage of damaged cell walls occur. This is thought to further disrupt cell homeostasis and cause cell death. According to this idea, it can be interpreted that the suffocation effect caused by covering the entire cell wall with nanoparticles promotes the growth inhibition of microalgae and the secretion of cell wall-dissolving enzymes. In addition, if the nanoparticles are sufficiently small to pass through the damaged cell wall, it is highly possible that the nanoparticles can enter the cytoplasm and induce cell death by phagocytosis or the like.

In addition, nanoparticles of organic compounds have the ability to induce cell death in a wide range of algae, or induce the abnormal secretion of cell wall lytic enzymes that do not directly induce cell death, leading to at least partial degradation of the cell wall. Thus, the cells can be changed into a state in which the cells can be easily lysed by mechanical stimulation. In addition, as shown by accelerated decomposition of chlorophyll and generation of ROS, it also causes damage to the photosynthetic system and various metabolic abnormalities.

According to the mechanism described above, the growth of algae can be suppressed by using nanoparticles of an organic compound that has an affinity for the cell walls of algae (microalgae).

On the other hand, suppressing the growth of microalgae that are sensitive to the nanoparticles of the organic compound described above while growing microalgae that are insensitive to the nanoparticles is useful, for example, in the oil-producing industry that uses microalgae. However, until now, there has been no technical means for eliminating the growth of unwanted microalgae and selectively growing useful microalgae. The method of the present invention can eliminate the growth of unwanted microalgae (nanoparticle-sensitive microalgae) and selectively grow useful desired microalgae (nanoparticle-insensitive microalgae). . For example, when trying to culture nanoparticle-insensitive microalgae such as Euglena gracilis in an open-air culture tank, for example, by adding nanoparticles to the medium, the purpose Harmful or unwanted microalgae growth can be prevented.

FIG. 2 is a photograph showing a state in which a large number of cyanoacrylate nanoparticles are attached to the cell surface of Chlamydomonas reinhardtii. FIG. 2 is a photograph showing a state in which a large number of cyanoacrylate nanoparticles are attached to the cell surface of Chlorella vulgaris. FIG. 10 is a graph showing the results of a trypan blue staining assay of Chlamydomonas (wild-type CC-124) co-incubated with 250 mg/L cyanoacrylate nanoparticles. FIG. 10 is a graph showing the results of a trypan blue staining assay of Chlamydomonas (wild-type CC-124) co-incubated with 500 mg/L cyanoacrylate nanoparticles. FIG. 10 is a graph showing the results of a trypan blue staining assay of Chlamydomonas (wild-type CC-124) co-incubated with 1 g/L cyanoacrylate nanoparticles. FIG. 4 is a graph showing the results of co-incubation of cyanoacrylate nanoparticles of different sizes with Chlamydomonas at the same molarity. FIG. 4 is a graph showing the results of co-incubation of cyanoacrylate nanoparticles of different sizes with the same surface area and Chlamydomonas. FIG. 10 is a graph showing cell death rates in wild type CC-124, very thin cell wall mutant CC-503 and cell wall deficient mutant CC-400 in Chlamydomonas co-incubated with cyanoacrylate nanoparticles. . FIG. 3 is a photographic diagram showing the results of TEM observation of the cellular ultrastructure of Chlamydomonas after co-incubation with 25 nm sized cyanoacrylate nanoparticles. FIG. 10 is a graph showing the results of percent conversion of Chlorella cells to protoplasts or spheroplasts after exposure of cyanoacrylate nanoparticles to Chlorella. FIG. 10 is a graph showing the results of investigating whether the filtrate obtained after exposure of cyanoacrylate nanoparticles to Chlorella yields protoplasts or spheroplasts. FIG. FIG. 3 is a photograph showing the results of TEM observation of the cellular ultrastructure of chlorella after co-incubation with cyanoacrylate nanoparticles with a size of 25 nm. Fig. 10 is a graph showing the results (percentage of fluorescence-positive cells) of the time-dependent change in reactive oxygen species (ROS) generation. It is a graph showing the result (dead cell rate) of investigating the time course of reactive oxygen species (ROS) generation. FIG. 2 is a photographic diagram (optical microscope and fluorescence microscope) showing the results of an investigation of changes over time in reactive oxygen species (ROS) generation. FIG. 2 is a photographic diagram showing the results of culturing Euglena gracilis insensitive to cyanoacrylate nanoparticles on HUT medium. FIG. 3 is a photographic diagram showing the results of culturing Chlamydomonas (wild-type CC-124) sensitive to cyanoacrylate nanoparticles on TAP medium. Fig. 2 is a photographic diagram showing the results of microscopic observation after adding cyanoacrylate nanoparticles to Euglena gracilis in logarithmic growth phase and culturing for 12 hours. A photographic diagram showing the results of a culture test (day 0 of culture) in which Chlamydomonas (strain CC-124) was applied to a sample in which a dispersion of cyanoacrylate nanoparticles was uniformly adhered to the surface of an agar medium. be. A photographic diagram showing the results of a culture test (day 7 of culture) of applying Chlamydomonas (strain CC-124) to a sample in which a dispersion of cyanoacrylate nanoparticles was uniformly adhered to the surface of an agar medium. be. A photographic diagram showing the results of a culture test (11th day of culture) by applying Chlamydomonas (strain CC-124) to a sample in which a dispersion of cyanoacrylate nanoparticles was uniformly adhered to the surface of an agar medium. be.

BEST MODE FOR CARRYING OUT THE INVENTION An embodiment of the present invention will be described below with reference to the drawings.
The algae growth inhibitor for inhibiting the growth of algae of the present invention contains nanoparticles of an organic compound that is mainly composed of hydrocarbons and that exhibits affinity for algae cell walls.
In addition, the method for inhibiting algae growth of the present invention uses nanoparticles of an organic compound containing hydrocarbons as a main component and having an affinity for the cell walls of algae to inhibit algae growth.

Algae growth inhibitors are nanoparticles of hydrocarbon-based organic compounds. That is, the algae growth inhibitor may be nanoparticles composed of an organic compound such as an acrylic resin. Therefore, since the algae growth inhibitor does not use metal oxide nanoparticles, it is metal-free and is highly safe without accumulating in the environment. In addition, nanoparticles of metal oxides often form large agglomerates in aqueous solutions, but nanoparticles of organic compounds mainly composed of hydrocarbons have almost no cohesiveness among the nanoparticles, and in aqueous solutions A stable dispersed state can be maintained.

Cell walls in algae (microalgae) are composed of glycoproteins, chitin, cellulose, proteoglycans, and the like. Nanoparticles of the above-mentioned organic compound containing hydrocarbon as a main component show affinity for the cell wall composed of the aforementioned components. The degree of affinity strength is not particularly limited. For example, due to the affinity of the nanoparticles of the organic compound with the cell wall, the affinity strength is such that it can adhere to the cell surface and cover the surface. It would be nice if there was

Algae in the present specification include, for example, sea algae (red algae, brown algae, green algae), which are multicellular organisms, and microalgae that cause red tide and the like. In this embodiment, a case where algae are microalgae will be described.

Microalgae include, for example, green algae belonging to the phylum Chlorophyta, dinoflagellates belonging to the phylum Dinoflagellate, diatoms belonging to the phylum Diatomaceae, raphid algae belonging to the phylum Heterochondrome, gold algae, and eunotal algae. be

Green algae belonging to the phylum Chlorophyta include, for example, algae belonging to the Chlorophyceae or the Trebouxiaphyceae. Examples of green algae belonging to the Chlorophyceae include the genus Chlamydomonas, and examples of the green algae belonging to the class Trebouxia include Chlorella. The genus Chlamydomonas has a spherical or smooth oval shape of 10 to 30 μm, and has two flagella of approximately the same length in front of the cell body like antennae of an insect. Chlorella has a nearly spherical shape with a diameter of about 2 to 10 μm and does not have flagella.

The genus Chlamydomonas includes, for example, Chlamydomonas applanata, Chlamydomonas assymetrica, Chlamydomonas debaryana, Chlamydomonas globosa, Chlamydomonas moewusii, Chlamydomonas monadina, Chlamydomonas noctigama, Chlamydomonas parkeae, Chlamydomonas perpusilla, Chlamydomonas reinhardtii, etc., but not limited thereto.

The Chlorella genus includes, for example, Chlorella ellipsoidea, Chlorella saccharophila, Chlorella sorokiniana, Chlorella vulgaris, etc., but is limited to these. is not.

In addition, as microalgae (Green algae) other than the genus Chlamydomonas and the genus Chlorella, Astrephomene gubernaculifera, Carteria radiosa, Dysmorphococcus globosus, Eudorina elegans, Gonium multicocum, Labochlamys culleus, Pandorina morum, Phacotuslenticularis, Tetrabaena socialis, Volvox carteri, Volbrina steiny (Volvulina steiniii) and the like, but are not limited to these.

Furthermore, other microalgae other than the above-mentioned Chlorophyceae include Chattonella marina (Raphido algae), Heterocapsa triquetra (Heterocapsatriquetra: dinoflagellates), Thalassioneama nitzschioides (Thalassioneama nitzschioides: diatoms), Karenia mikimotoi (dinoflagellate), Chaetoceros debilis (diatom), Calyptrosphaera sphaeroidea (golden alga), Gambierdiscus sp (dinoflagellate) , Heterosigma akashiwo (raphido algae), Odontella longicruris (diatoms) and the like, but are not limited thereto.

In this embodiment, a case where the nanoparticles are cyanoacrylate nanoparticles will be described. The cyanoacrylate nanoparticles are preferably polymerized in the coexistence of a cyanoacrylate monomer and a surfactant.

The algal growth inhibitor in the present invention contains cyanoacrylate nanoparticles having an average particle size of 10 to 500 nm, preferably 25 to 350 nm. Any mode may be used. The dispersion may take the form of suspension, colloidal liquid, etc., but is not limited to these. In addition, the algal growth inhibitor may have a concentration of cyanoacrylate nanoparticles of 30 mg/L to 1 g/L, preferably 250 to 1 g/L.

The cyanoacrylate polymer portion is obtained by anionically polymerizing cyanoacrylate monomers. The cyanoacrylate monomer used is preferably an alkyl cyanoacrylate monomer (the number of carbon atoms in the alkyl group is preferably 1 to 8), and is particularly used as an adhesive for suturing wounds in the surgical field. Butyl cyanoacrylate represented by the formula is preferred.

As the cyanoacrylate monomer, butyl cyanoacrylate such as isobutyl cyanoacrylate, n-butyl-2-cyanoacrylate, sec-butyl cyanoacrylate, tert-butyl cyanoacrylate can be used, and methyl cyanoacrylate, ethyl cyanoacrylate ( Other alkyl cyanoacrylates such as false eyelash adhesives), propyl cyanoacrylate, etc. may be selected. In particular, isobutyl cyanoacrylate, n-butyl-2-cyanoacrylate, and ethyl cyanoacrylate are excellent in safety.

Anionic polymerization uses a surfactant to stabilize the polymerization. Nonionic surfactants and ionic surfactants can be used as surfactants, but are not limited to these. An anionic surfactant is preferably used as the ionic surfactant, but is not limited thereto.

Examples of nonionic surfactants include polysorbates (Tween 20, 40, 60, 80, etc.), and examples of anionic surfactants include alkylbenzenesulfonic acid or salts thereof, sodium lauryl sulfate, sodium laureth sulfate, and sodium dodecylbenzenesulfonate. , sodium 1-pentanesulfonate, sodium 1-decanesulfonate and the like can be used, but are not limited thereto.

Nonionic surfactants and anionic surfactants may be used simultaneously. Combined use of a nonionic surfactant and an anionic surfactant makes it difficult for the cyanoacrylate polymer particles to aggregate over time.

Moreover, it is also possible to use a combination of the surfactants described above with those having a function of stabilizing polymerization in anionic polymerization, such as polyethylene glycol and sugars.

The saccharides are not particularly limited, and may be monosaccharides having hydroxyl groups, disaccharides having hydroxyl groups, or polysaccharides having hydroxyl groups, but polysaccharides are particularly preferred. Monosaccharides include, for example, glucose, mannose, ribose and fructose. Examples of disaccharides include maltose, trehalose, lactose and sucrose. As polysaccharides, dextran, mannan, and the like, which are conventionally used for polymerization of cyanoacrylate polymer particles, can be used.

The cyanoacrylate polymer particles are porous and can be conjugated with desired substances inside. After forming the cyanoacrylate polymer particles, the desired substance may be conjugated inside the cyanoacrylate polymer particles by immersing the cyanoacrylate polymer particles in an aqueous solution of the desired substance or adding the desired substance, The desired substance may be conjugated to the particles produced by performing the above-described anionic polymerization in the coexistence of the desired substance. For example, cyanoacrylate polymer particles can be conjugated with amino acids such as glycine and aspartic acid. Conjugation refers to, for example, a state in which a foreign substance is held by a hydrophilic molecule.
Moreover, the present invention is not limited to the embodiment in which the cyanoacrylate polymer particles are conjugated with the amino acid, and the cyanoacrylate polymer particles and the amino acid may be mixed. The mixing may be a mode in which the cyanoacrylate polymer particles and the amino acid coexist and are mixed together.

Water can be used as a solvent for the polymerization reaction. Purified water, ion-exchanged water, distilled water, pure water, tap water, underground water, etc. may be appropriately selected as water depending on the product application with different purity requirements.

The algae growth inhibitor of the present invention can be produced by anionically polymerizing a cyanoacrylate monomer in the coexistence of a cyanoacrylate monomer and a surfactant. Specifically, the polymerization reaction can be carried out, for example, by dissolving a surfactant, which is a polymerization stabilizer, in water, which is a solvent, and then adding a cyanoacrylate monomer under stirring and continuing stirring. The reaction temperature is not particularly limited, but room temperature is preferred. The reaction time is not particularly limited because the reaction rate varies depending on the pH of the reaction solution, the type of solvent and the concentration of the polymerization stabilizer. is.

Although the concentration of the cyanoacrylate monomer in the polymerization reaction solution at the start of the reaction is not particularly limited, it is usually about 0.01 to 5%, preferably about 0.1 to 3%. The concentration of the surfactant in the polymerization reaction solution at the start of the reaction is not particularly limited, but is usually about 0.01 to 5%, preferably about 0.1 to 3%. The concentration of saccharides in the polymerization reaction solution at the start of the reaction is not particularly limited, but is usually about 0.01 to 5%, preferably about 0.1 to 3%.

By the polymerization reaction described above, the cyanoacrylate monomer undergoes anionic polymerization, cyanoacrylate nanoparticles are synthesized, and the algal growth inhibitor of the present invention can be produced.

As a result of the polymerization reaction, the synthesized cyanoacrylate nanoparticles can serve as an algal growth inhibitor in the form of a particle dispersion dispersed in a solvent. The obtained particle dispersion has excellent dispersion stability, with little change in particle size distribution over time during storage, and no aggregation or sedimentation of particles even after standing storage.

In addition, the synthesized cyanoacrylate nanoparticles can be recovered by conventional filtration such as centrifugal ultrafiltration, and can be used as an algae growth inhibitor in the form of particles or in the form of granules. Furthermore, the cyanoacrylate nanoparticles recovered by filtration can be used as an algae growth inhibitor in the form of a particle dispersion in a solvent such as water.

The particle size of the synthesized cyanoacrylate nanoparticles can be adjusted by adjusting the concentration of the cyanoacrylate monomer in the reaction solution and the reaction time. Moreover, when a surfactant is used as a polymerization stabilizer, the particle size can be adjusted also by changing the concentration and type of the polymerization stabilizer.

Since anionic polymerization is initiated by hydroxide ions, the pH of the reaction solution affects the rate of polymerization. When the pH of the reaction solution is high, the concentration of hydroxyl ions is high, so that the polymerization is accelerated, and when the pH is low, the polymerization is slow. Therefore, it is preferable to set the pH to about 1 to 4.

The algae growth inhibitor of the present invention prevents or suppresses water pollution caused by the growth of microalgae described above. That is, by spraying an appropriate amount of the algae growth inhibitor containing the cyanoacrylate nanoparticles in the ocean, lakes, marshes, aquariums, etc., it is possible to suppress the growth of microalgae, or kill the already generated microalgae. Therefore, it is possible to prevent or suppress water pollution caused by the growth of microalgae. By preventing or suppressing water pollution, it is possible to reduce damage to fish and shellfish living in, for example, fish farms and tanks. In addition, by preventing or suppressing water pollution, it is possible to suppress odors and improve the landscape.

The algae growth inhibitor may not only be directly sprayed in the ocean, lakes, or water tanks, but also solids containing the algae growth inhibitor may be put into the ocean, lakes, or water tanks. If the solid is, for example, solidified (film-formed) by mixing cyanoacrylate nanoparticles with polyethylene glycol, or gelled by mixing with polyethylene oxide, the embodiment is particularly limited. not a thing

The water pollution is red tide or pollution in closed water areas.
Red tide is pollution of water quality caused by the generation of large amounts of microalgae in open water systems and semi-open water systems such as oceans and lakes. In addition, closed water areas include artificial closed water areas such as ponds, fountains, ponds, moats, drainage ditches, septic tanks, water-cooled cooling towers, bathtubs, and fish farms in parks, but are not limited to these. do not have. In these closed water areas, the occurrence of microalgae in large quantities causes water pollution.

In the case of red tide, the algae growth inhibitor containing the cyanoacrylate nanoparticles described above may be added or sprayed on the surface of the water in the area where red tide occurs or is expected to occur from the ship or the air, or solids containing the algae growth inhibitor may be added. You may inject into the said area|region.

In closed water areas, the algae growth inhibitor containing the cyanoacrylate nanoparticles described above may be added or sprayed on the water surface, or solids containing the algae growth inhibitor may be added to ponds, fountains, ponds, and moats in the park. , drainage ditches, septic tanks, water-cooled cooling towers, bathtubs, and artificial closed water areas such as fish farms.

The algae growth inhibitor of the present invention prevents or inhibits the growth of microalgae on solid surfaces. The solid can be, for example, a member used in a plant factory or an outer wall for building materials. That is, as a member used in a plant factory, a microalgae that inhibits the growth of plant seedlings is applied in advance to a hole formed in a member that supports plant seedlings and into which the seedlings are inserted. can prevent or suppress the growth of In addition, by applying an algae growth inhibitor to the outer wall for building materials (for example, a shaded area with little sunlight) in advance, it is possible to prevent or suppress the growth of microalgae growing on the outer wall for building materials in a wet state. can be done.

As algae, for example, seaweeds, which are multicellular organisms, can be prevented or suppressed from growing on solids such as ship bottoms by the algae growth inhibitor of the present invention. In this case, it is possible to prevent or suppress the growth of seaweeds on the bottom of the ship or the like by previously applying the algae growth inhibitor to the bottom of the ship or the like.

Many cyanoacrylate nanoparticles adhere to the cell surface due to their affinity with the cell wall and cover the surface (Fig. 1: Wild type of Chlamydomonas reinhardtii, Fig. 2: Chlorella vulgaris )). This makes it difficult for cells to introduce components essential for growth, such as oxygen, carbon dioxide, and nutrients, into the external environment (suffocation). Such suffocation causes abnormal physiological reactions such as accumulation of ROS (reactive oxygen species), decomposition of chlorophyll, and secretion of cell wall-dissolving enzymes. As a result, events such as protoplasting of cells and nanoparticles passing through damaged cell walls and penetrating into the cytoplasm occur (Fig. 9). This is thought to further disrupt cell homeostasis and cause cell death. According to this idea, it can be interpreted that the suffocation effect caused by covering the entire cell wall with nanoparticles promotes the growth inhibition of microalgae and the secretion of cell wall-dissolving enzymes. In order to achieve asphyxiation, nanoparticles need only have affinity to stably adhere to the outermost layer of cells (the so-called cell wall), and high specificity such as binding to a specific receptor protein is necessary. There is no Therefore, nanoparticles that have affinity for the outermost layer of target cells are not limited to cyanoacrylate nanoparticles, and are highly likely to induce metabolic abnormalities due to their suffocating effect on a variety of biological species. In addition, if the nanoparticles are sufficiently small to pass through the damaged cell wall, it is highly possible that the nanoparticles can enter the cytoplasm and induce cell death by phagocytosis or the like.

Cyanoacrylate nanoparticles have the ability to induce cell death in a wide range of algae, or induce aberrant secretion of cell wall lytic enzymes that do not directly induce cell death, resulting in at least partial degradation of the cell wall. , can change cells into a state in which they are easily lysed by mechanical stimulation. In addition, as shown by accelerated decomposition of chlorophyll and generation of ROS, it also causes damage to the photosynthetic system and various metabolic abnormalities.

In addition, in the method of suppressing the growth of algae of the present invention, nanoparticle-insensitive microalgae can be grown. According to this method, for example, when culturing in an open-air culture tank outdoors, the growth of unnecessary microalgae (nanoparticle-sensitive microalgae) can be eliminated by adding nanoparticles to the medium. can selectively grow useful and desired microalgae (nanoparticle-insensitive microalgae).

Useful nanoparticle-insensitive microalgae include, but are not limited to, Euglena gracilis, Haematococcus lacustris, and the like. do not have.

[Example 1]
Cyanoacrylate nanoparticles (isobutyl cyanoacrylate nanoparticles), which are nanoparticles of an organic compound contained in the algae growth inhibitor of the present invention, were prepared by the following method.

In 200 mL of 0.01N hydrochloric acid solution, 2.5 mL of rheodol TW-L120 (manufactured by Kao Corporation), which is a nonionic surfactant as a dispersant/stabilizer, and 2.0 mL of Neoperex G-15 (Kao Corporation), which is an anionic surfactant, are added. Co., Ltd.) was dissolved, and 2.0 mL of isobutyl cyanoacrylate (Toagosei Co., Ltd.: #501) was added dropwise and a magnetic stirrer (AS ONE RS-1DN) was used at room temperature at 600 rpm, A polymerization reaction was carried out under the conditions for 2 hours. After 2 hours, 4.0 mL of 0.5N hydrochloric acid (manufactured by Wako Pure Chemical Industries, Ltd.) was added dropwise to conduct a neutralization reaction for 1 hour. The reaction solution was filtered through a 5.0 μm-sized membrane filter (manufactured by Sartorius: Minizart) to obtain 1.0 wt % cyanoacrylate nanoparticles. The particle size (average particle size) of the cyanoacrylate nanoparticles obtained at this time was 25 nm when measured by a conventional method using a Zetasizer (Nano-ZS90 manufactured by Malvern).

In addition, by adding 2.0 g of dextran (molecular weight: 60,000: Wako Pure Chemical Industries, Ltd.) as a dispersant/stabilizer to the hydrochloric acid solution described above and performing a polymerization reaction, a cyanoacrylate having a particle size of 180 nm was obtained. Nanoparticles were produced. Furthermore, 6.0 g of polyethylene glycol (molecular weight: 20,000: manufactured by Wako Pure Chemical Industries, Ltd.) is added to the hydrochloric acid solution described above as a dispersant/stabilizer, and a polymerization reaction is performed to obtain cyano having a particle size of 350 nm. Acrylate nanoparticles were made. Cyanoacrylate nanoparticles having these three particle sizes were provided in the following examples.

[Example 2]
The effect of cyanoacrylate nanoparticle exposure on Chlamydomonas reinhardtii (wild-type CC-124) was investigated. The wild-type CC-124 Chlamydomonas used in this example was provided by the Chlamydomonas Resource Center at the University of Minnesota (USA). Wild-type CC-124 Chlamydomonas was mixed trophically under constant fluorescence (84 mmol photons m ⁻² s ⁻¹ ) with gentle shaking in Tris-Acetate-Phosphate (TAP) medium (pH 7.0). Cells that were cultured and reached mid-logarithmic growth phase (OD750-0.8) were used for the assay.

Cyanoacrylate nanoparticles were used in various sizes (25 nm, 180 nm, 350 nm) and assayed at concentrations of 250 mg/L, 500 mg/L, and 1 g/L for each size. The co-incubation of the Chlamydomonas and cyanoacrylate nanoparticles was performed with very gentle rotation (10 rpm). As a negative control, co-incubation with medium containing only cells and dispersant was used.

By co-incubating with cyanoacrylate nanoparticles of different sizes, Chlamydomonas immediately exhibited an abnormal migration pattern with rapid and frequent trajectory changes and eventually stopped migration. In addition, due to this co-incubation, many cyanoacrylate nanoparticles adhered to the cell surface due to their affinity with the cell wall, covering the surface (Fig. 1), and the original oval shape of Chlamydomonas gradually changed to a spherical shape. observed. Most of the cells that stopped migrating swelled into spheres, and some of them disintegrated releasing their cytoplasmic contents. This was thought to mean that such swollen spherical cells are protoplasts or have very thin cell walls (spheroplasts). Such acute responses were induced regardless of the size difference of the cyanoacrylate nanoparticles, but no such changes were observed in the negative control containing only the dispersant used to prepare the cyanoacrylate nanoparticles. I was not able to admit.

Here, to examine the viability of Chlamydomonas exposed to cyanoacrylate nanoparticles in co-incubation, a trypan blue staining assay was performed, staining dead cells blue. A 0.3 mL culture sample was taken and a trypan blue (0.4% w/v, manufactured by Wako Pure Chemical Industries, Ltd.) solution was directly added (final concentration 0.2% (w/v)). The color of the cytoplasm was observed with a microscope (IX71: manufactured by Olympus Corporation) after 5 minutes without a washing step. In this assay, disrupted and stained cells had a deep blue color and were considered dead cells. The results are shown in FIG. 3 (250 mg/L), FIG. 4 (500 mg/L) and FIG. 5 (1 g/L). The notation "NP" in the figure means cyanoacrylate nanoparticles.

From FIG. 3, when the concentration of cyanoacrylate nanoparticles was 250 mg/L, all (100%) cells were stained by co-incubation with 25 nm size cyanoacrylate nanoparticles for 2 hours (dead cell rate 100% ). Also, co-incubation with 180 nm sized cyanoacrylate nanoparticles for 2 hours stained about 75% of the cells, and co-incubation with 350 nm sized cyanoacrylate nanoparticles for 2 hours stained less than 20%. Cells were stained. By co-incubating with 180 nm sized cyanoacrylate nanoparticles for 3 h, all (100%) cells were stained, but even when co-incubated with 350 nm sized cyanoacrylate nanoparticles for 4 h, 60 Less than % cells were stained.
From this, it was confirmed that the dead cell rate depends on the particle size of the cyanoacrylate nanoparticles, and that the smaller the particle size, the more dead cells can be induced (in the order of 25 nm, 180 nm, and 350 nm). In addition, it was found that both cyanoacrylate nanoparticles with different particle sizes can induce dead cells.

The dead cell rate was about 30% when co-incubated with 25 nm sized cyanoacrylate nanoparticles (250 mg/L) for 2 hours (Fig. 3), whereas 25 nm sized cyanoacrylate nanoparticles (500 mg/L) The dead cell rate was about 65% when co-incubated with for 2 hours (Fig. 4), and the dead cell rate was 100% when co-incubated with 25 nm sized cyanoacrylate nanoparticles (1 g/L) for 2 hours. There was (Fig. 5).
From this, it was recognized that increasing the concentration of cyanoacrylate nanoparticles could induce a large number of dead cells even with the same time of co-incubation.

From FIG. 4, when the concentration of cyanoacrylate nanoparticles was 500 mg/L, all (100%) cells were stained by co-incubation with 25 nm size cyanoacrylate nanoparticles for 2 hours (dead cell rate 100% ). Also, co-incubation with 180 nm sized cyanoacrylate nanoparticles for 3 hours stained approximately 100% of the cells, and co-incubation with 350 nm sized cyanoacrylate nanoparticles for 4 hours stained approximately 100% of the cells. was dyed.
From FIG. 5, when the concentration of cyanoacrylate nanoparticles was 1 g/L, all (100%) cells were stained by co-incubation with cyanoacrylate nanoparticles with a size of 25 nm for 1 hour (dead cell rate 100% ). Also, co-incubation with 180 nm sized cyanoacrylate nanoparticles for 2 hours stained approximately 100% of the cells, and co-incubation with 350 nm sized cyanoacrylate nanoparticles for 3 hours stained approximately 100% of the cells. was dyed.
From this, it was recognized that dead cells could be induced in a short period of time by increasing the concentration of cyanoacrylate nanoparticles.

From the above, it was confirmed that the three types of cyanoacrylate nanoparticles with different particle sizes were able to induce cell death rapidly at low concentrations in order of 25 nm, 180 nm, and 350 nm, in descending order of action. It was also suggested that cells stained with trypan blue were dead cells with severe damage to the plasma membrane.

It should be noted that no aggregates were observed for cyanoacrylate nanoparticles with particle sizes of 25 nm and 180 nm even after co-incubation with Chlamydomonas for 8 hours. Cyanoacrylate nanoparticles with a particle size of 350 nm produced aggregates consisting of 20-30 nanoparticles over 4 hours of co-incubation. From this, it was confirmed that the organic compound nanoparticles (cyanoacrylate nanoparticles) contained in the algae growth inhibitor of the present invention have almost no cohesion between the nanoparticles and can maintain a stable dispersion state in an aqueous solution. .

In the case of cyanoacrylate nanoparticles with a size of 25 nm, the concentration capable of inducing cell death against wild-type CC-124 Chlamydomonas was 30 mg/L (results not shown).

In addition, when cyanoacrylate nanoparticles with different sizes are co-incubated with Chlamydomonas at the same molar concentration (number of particles), cyanoacrylate nanoparticles with larger particle sizes (180 nm, 350 nm) are more effective (death The rate at which cells can be induced) tended to be large (Fig. 6).

Furthermore, when cyanoacrylate nanoparticles of different sizes were co-incubated with Chlamydomonas with the same surface area introduced into the culture medium, the resulting effect (the ratio at which dead cells can be induced) showed a similar tendency ( Figure 7).

[Example 3]
In Chlamydomonas reinhardtii, cell death rates were examined in wild-type CC-124, very thin cell wall mutant CC-503 and cell wall deficient mutant CC-400. The above two mutants were also provided by the Chlamydomonas Resource Center at the University of Minnesota (USA). The dead cell rate was determined by co-incubating with 25 nm sized cyanoacrylate nanoparticles (250 mg/L) and performing a trypan blue staining assay as described in Example 2. The results are shown in FIG.

As a result, co-incubation with cyanoacrylate nanoparticles for 1 hour induced approximately 95% dead cells in the cell wall-deficient mutant CC-400 and approximately 40% dead cells in the thin cell wall mutant CC-503. Cells were induced, wild-type CC-124 induced approximately 28% dead cells.

This indicated that the cell wall-deficient mutant CC-400, thin cell wall mutant CC-503, and wild-type CC-124 were in descending order of sensitivity to cyanoacrylate nanoparticles. Such an order of sensitivity suggested that the cell wall acted as a kind of mechanical barrier to inhibit dead cell induction by cyanoacrylate nanoparticles.

[Example 4]
Cellular ultrastructure of Chlamydomonas (wild-type CC-124) after co-incubation with cyanoacrylate nanoparticles of 25 nm size (65 mg/L) for 20 minutes was observed by TEM. The results are shown in FIG.

As a result, numerous cyanoacrylate nanoparticles were observed inside the cell wall of wild-type CC-124 and between the cell wall and the plasma membrane (periplasmic space). That is, the cell ultrastructure observed by TEM shows that the cell wall has strong damage, and cyanoacrylate nanoparticles accumulate inside the cell wall and between the cell wall and the plasma membrane (periplasmic space) and enter the cytoplasm. proved that there is

[Example 5]
The effect of cyanoacrylate nanoparticle exposure on Chlorella vulgaris was investigated. Chlorella vulgaris used in this example was provided by the National Institute for Environmental Studies (NIES).

Cyanoacrylate nanoparticles were used in various sizes (25 nm, 180 nm, 350 nm) and assayed at a concentration of 1 g/L in each size. Due to this co-incubation, many cyanoacrylate nanoparticles adhere to the cell surface due to their affinity with the cell wall and cover the surface (Fig. 2). transformed into plasts (protoplasts/spheroplasts).

The appearance of protoplasts/spheroplasts was confirmed by a cell wall staining test using Fluorescent Brightener 28 (F3543, Sigma-Aldrich), a fluorescent dye that specifically binds to chitin and cellulose.

A stock solution of Fluorescent Brightener 28 (1 mg/mL in H ₂ O) was added to the cell cultures (0.04 mg/mL final concentration). Samples were kept in the dark for 10 minutes before light microscopy. Stained cells were observed without a washing step using a microscope (IX71: Olympus Corp.) with a U-MWU2 filter unit or BZ-X700 (Keyence Corp.).

In this test, cells with pure red fluorescence were assessed as protoplasts/spheroplasts and cells with pink-red as non-protoplasts/spheroplasts. To establish this criterion, protoplasts of Chlorella vulgaris were prepared using a commercial lytic enzyme mixture. A commercially available lytic enzyme mixture contains 0.5% cerulidin (manufactured by Calbio-Chem), 2% macerozyme R-10 (manufactured by Yakult Pharmaceutical Co., Ltd.) and 1% chitosanase derived from Bacillus R-4 (K.I. Kasei Co., Ltd.). company) dissolved in 25 mM phosphate buffer (pH 7.0) containing 0.5 M mannitol. Cells were harvested at mid-log phase (OD750=0.8-1.0) by centrifugation (1000×g, 10 min), then the cell pellet was suspended in enzyme mixture (2×10 ⁸ cells/mL), Incubate for 4-8 hours at 25° C. with very gentle shaking in the dark.
For enzyme-treated cells, pure red fluorescent cells with adjacent cell walls removed were used as a reference standard for protoplasts. On the other hand, the color of non-enzyme-treated cells was pinkish-red as a result of the fusion of the pure red autofluorescence of chlorophyll and the blue fluorescence of Fluorescent Brightener 28, and was used as a reference standard for non-protoplasts.

By co-incubation with cyanoacrylate nanoparticles, samples were taken periodically to count the number of protoplasts/spheroplasts in 100 cells observed (Fig. 10). The peak frequency of protoplasts/spheroplasts reached about 60% after co-incubation with 25 nm cyanoacrylate nanoparticles for 4 hours. 25 nm cyanoacrylate nanoparticles induced protoplasts/spheroplasts more efficiently than 180 nm and 350 nm cyanoacrylate nanoparticles.

Protoplasts/spheroplasts were induced even when the concentration of cyanoacrylate nanoparticles was changed to 250 mg/L, 500 mg/L (results not shown). Protoplasts/spheroplasts were also not stained by trypan blue.

Similar experiments were conducted on three chlorella genera other than Chlorella vulgaris, namely, Chlorella ellipsoidea, Chlorella saccharophila, and Chlorella sorokiniana. . These were provided by the National Institute for Environmental Studies (NIES). As a result, protoplasts/spheroplasts were induced by co-incubation with 25 nm cyanoacrylate nanoparticles for these three Chlorella species as well. In particular, Chlorella ellipsoidea induced protoplasts/spheroplasts at the same level as Chlorella vulgaris (results not shown).

[Example 6]
We investigated whether cell wall lytic enzymes were secreted by cyanoacrylate nanoparticle exposure to Chlorella vulgaris.

After co-incubation of chlorella and 350 nm cyanoacrylate nanoparticles (1 g/L) for 8 hours, cells were harvested and the supernatant was filtered using a membrane filter unit with 100 nm size pores to remove cyanoacrylate nanoparticles. did. Addition of the filtrate to a cell pellet prepared from exponentially growing Chlorella vulgaris and incubation for 8 hours transformed about 15% of the cells into protoplasts/spheroplasts (Fig. 11). Protoplast/spheroplast determination was performed according to Example 5.

This clearly indicated that the filtrate contained chlorella cell wall lytic enzymes secreted during the abnormal cell cycle of growth. In addition, "control" in FIG. 11 is a culture medium containing only cells and a dispersing agent, and "NP (350 nm)" is a protoplast/spheroplast by co-incubation with cyanoacrylate nanoparticles. Denotes what is induced.

[Example 7]
Cellular ultrastructure of Chlorella after co-incubation with 25 nm size cyanoacrylate nanoparticles (1 g/L) for 3 hours was observed by TEM. The results are shown in FIG.

As a result, no cyanoacrylate nanoparticles were detected inside the cell wall or between the cell wall and the plasma membrane (periplasmic space).

[Example 8]
In the above example, the effects of cyanoacrylate nanoparticle exposure on Chlamydomonas reinhardtii were investigated. In this example, the effects of exposure to cyanoacrylate nanoparticles (25 nm) on other Chlamydomonas and Chlorophyceae were investigated. The experimental conditions were the same as those of the above-described examples. For reference, the results of Chlamydomonas reinhardtii and four species of Chlorella used in the above Examples are also shown (Tables 1-1 and 1-2).

As a result, the genus Chlamydomonas, for example Chlamydomonas applanata, Chlamydomonas assymetrica, Chlamydomonas debaryana, Chlamydomonas globosa, Chlamydomonas moewusii, Chlamydomonas moewusii, Dead cell induction was observed in Chlamydomonas monadina, Chlamydomonas noctigama, Chlamydomonas parkeae and Chlamydomonas perpusilla.

In addition to the genus Chlamydomonas, Astrephomene gubernaculifera, Carteria radiosa, Dysmorphococcus globosus, Eudorina elegans, Gonium multicocum, Labochlamis Creus (Labochlamys culleus), Pandolina morum (Pandorina morum), Phacotus lenticularis (Phacotus
lenticularis, Tetrabaena socialis, Volvox carteri, and Volvulina steiniii.

Therefore, it was confirmed that water pollution (red tide or contamination in closed water areas) caused by the growth of the microalgae can be prevented or suppressed by using the algae growth inhibitor of the present invention.

[Example 9]
Chlamydomonas reinhardtii wild-type CC-124 was examined for time course of reactive oxygen species (ROS) generation by exposure to cyanoacrylate nanoparticles.

2',7'-Dichlorodihydrofluorescein diacetate (H2DCFDA) (D668, Sigma-Aldrich) was used to detect reactive oxygen species. Non-fluorescent H2DCFDA is converted to highly fluorescent 2',7'-dichlorofluorescein (DCF) by reactive oxygen species in the cytoplasm.

Co-incubation of Chlamydomonas and 25 nm cyanoacrylate nanoparticles (100 mg/L) attempted to detect a time-dependent increase in fluorescence-positive cells released from DCF as the oxidized form of H2DCFDA by ROS accumulated in the cytoplasm. . Fifteen minutes before fluorescence microscopy, H2DCFDA dissolved in DMSO was added to the cell cultures (10 μM final concentration). DCF fluorescence was observed with a microscope (IX71: manufactured by Olympus Corporation).

As a control, co-incubation with media containing only cells and dispersant was used, and as a comparison, ZnO containing two metal oxide nanoparticles, i.e., particles less than 100 nm (544906, Sigma-Aldrich (manufactured by Wako Pure Chemical Industries, Ltd.) and TiO ₂ (anatase form) (205-01715, manufactured by Wako Pure Chemical Industries, Ltd.).

As a result, the fluorescence-positive cell rate reached a peak 60 to 90 minutes after co-incubation started (FIGS. 13 and 14). In addition, fluorescence microscopy results showed that DCF fluorescence was detected only in the sample co-incubated with Chlamydomonas and 25 nm cyanoacrylate nanoparticles (Fig. 15), whereas in the sample using two types of metal oxide nanoparticles, no fluorescence was detected. This clearly showed that cyanoacrylate nanoparticles are more capable of inducing physiological disorders than these metal oxide nanoparticles at the same concentration.

[Example 10]
In this example, the effects of exposure to cyanoacrylate nanoparticles (25 nm) on microalgae other than the Chlorophycea described above were investigated. The experimental conditions were the same as those of the above-described examples.

The microalgae used are dinoflagellates belonging to the phylum Dinoflagellate, diatoms belonging to the phylum Diatomphyta, and raphidophyta or gold algae belonging to the phylum Heterochondrome. Chattonella marina (NIES-1), Heterocapsatriquetra (NIES-7), Thalassioneama nitzschioides (NIES-534), Karenia mikimotoi (NIES-2411), Chaetoceros debilis: NIES-3710), Calyptrosphaera sphaeroidea (NIES-1308), Gambierdiscus sp: NIES-2764), Heterosigma akashiwo (NIES-5), Odonthera longiculus ( Odontella longicruris: NIES-590).

As a result, dead cell induction was observed for all these microalgae. Therefore, it was confirmed that water pollution (red tide or contamination in closed water areas) caused by the growth of the microalgae can be prevented or suppressed by using the algae growth inhibitor of the present invention.

[Example 11]
For microalgae that are insensitive to cyanoacrylate nanoparticles and microalgae that are sensitive to cyanoacrylate nanoparticles, we investigated whether each microalgae grew when the concentration of cyanoacrylate nanoparticles was varied.

Cyanoacrylate nanoparticles with a particle size of 180 nm are used, microalgae that are insensitive to cyanoacrylate nanoparticles are Euglena gracilis (NIES-49), and microalgae that are sensitive to cyanoacrylate nanoparticles are used. Chlamydomonas reinhardtii (wild type CC-124) was used as algae.

1% (10 g/L (w/v)), 0.3%, 0.1%, 0.03%, 0 at different positions on HUT medium (pH 6.4) containing 1.5% agar. 20 μL each of 0.01% and 0.003% cyanoacrylate nanoparticles were dropped and adsorbed to the HUT medium. Next, a culture solution of Euglena gracilis that had reached the logarithmic growth phase was adsorbed on a cotton swab, spread over a HUT medium, and cultured for 10 days. As a result, Euglena gracilis cells were found to proliferate at all cyanoacrylate nanoparticle dropping positions (Fig. 16). From this, it was found that Euglena gracilis is resistant (insensitive to cyanoacrylate nanoparticles) even at very high concentrations (~1%) of cyanoacrylate nanoparticles.

On the other hand, 0.03%, 0.01%, 0.003%, 0.001% cyanoacrylate nanoparticles were applied to different positions on TAP medium (pH 7.0) containing 1.5% agar, respectively. 20 μL was dropped and adsorbed to the TAP medium. Next, a culture solution of Chlamydomonas (strain CC-124) that had reached the logarithmic growth phase was adsorbed on a cotton swab, spread over the TAP medium, and cultured for 10 days. As a result, Chlamydomonas cells were found to proliferate at the positions where 0.003% and 0.001% cyanoacrylate nanoparticles were dropped, but 0.03% and 0.01% cyanoacrylate nanoparticles were dropped. It was found that Chlamydomonas cells did not proliferate at this position (FIG. 17: inside the dashed line).

Cyanoacrylate nanoparticles were added to Euglena gracilis in the logarithmic growth phase to a final concentration of 0.01% (100 mg / L), cultured in a liquid medium for 12 hours, and then observed with an optical microscope. , no cells that stopped swimming were observed (Fig. 18). From this, it was estimated that the cell death rate of Euglena gracilis under these conditions was zero. Similar results were obtained with a final concentration of 0.03% cyanoacrylate nanoparticles (results not shown).

On the other hand, cyanoacrylate nanoparticles were added to logarithmically growing chlamydomonas (strain CC-124) to a final concentration of 0.01% (100 mg/L), cultured in a liquid medium for 12 hours, and then observed with an optical microscope. However, almost no swimming cells were observed (results not shown). Similar results were obtained with a final concentration of 0.03% cyanoacrylate nanoparticles (results not shown).

In addition, Haematococcus lacustris (NIES-144) was used as microalgae insensitive to cyanoacrylate nanoparticles, and the same experiment as above was performed, and the same results as in the case of Euglena gracilis were obtained. was taken.

According to this embodiment, for example, when culturing in an outdoor open culture tank or the like, cyanoacrylate nanoparticles can be added to the medium (for example, the final concentration is 0.01 to 0.03%). Eliminates the growth of particle-sensitive microalgae (e.g., Chlamydomonas reinhardtii) and selectively cyanoacrylate nanoparticle-insensitive microalgae (e.g., useful microalgae such as Euglena gracilis, Haematococcus lacustris, etc.) found to be proliferative.

This experiment also shows that the growth of Chlamydomonas reinhardtii on agar is inhibited if the cyanoacrylate nanoparticles adhere to the solid agar surface. Therefore, by attaching cyanoacrylate nanoparticles to the surface of solids (members used in plant factories, or outer walls for building materials), it is expected to inhibit the growth of microalgae on the surface.

[Example 12]
An experiment was conducted to determine the area density (mass per square meter) of the minimum number of cyanoacrylate nanoparticles required to exhibit an effect as an algal growth inhibitor on a solid surface.

20 μL dispersion of cyanoacrylate nanoparticles (particle size 30 nm) diluted to predetermined concentrations (10, 30, 100, 300 ppm) at different positions on TAP medium (pH 7.0) containing 1.5% agar It was added dropwise and adsorbed to the TAP medium. The area spread on the TAP medium when 20 μL of the dispersion was dropped was about 0.785 cm ² .
Table 2 shows the results of determining the mass, number, mass per square meter (g/m ² ), etc. of cyanoacrylate nanoparticles at each concentration.

A culture solution of Chlamydomonas (strain CC-124) that had reached the logarithmic growth phase was adsorbed on a cotton swab, spread over the TAP medium, and cultured for 10 days. As a result, it was found that Chlamydomonas cells proliferated at the positions where 10, 30, and 100 ppm (levels 1 to 3) of cyanoacrylate nanoparticles were dropped, but at the positions where 300 ppm (level 4) of cyanoacrylate nanoparticles were dropped. was found not to proliferate Chlamydomonas cells (results not shown).

Level 4 cyanoacrylate nanoparticles had a weight per square meter of 0.076 g/m ² .

[Example 13]
Chlamydomonas (strain CC-124) was spread on a sample in which a dispersion of cyanoacrylate nanoparticles (particle size: 30 nm) was uniformly deposited on the surface of an agar medium, and a culture test was performed. Table 3 shows the results of determining the amount of cyanoacrylate nanoparticle liquid added to each sample A to D, the mass of cyanoacrylate nanoparticles, and the number of cyanoacrylate nanoparticles. Sample E served as a control without the addition of cyanoacrylate nanoparticles.

The cyanoacrylate nanoparticle liquid (concentration 1%) of each sample A to D was separately added to a TAP medium (surface area 64 cm ² ) containing 1.5% agar, and placed in a petri dish in a thermostat set at 50 ° C. was added to dry the cyanoacrylate nanoparticle liquid. A culture solution of Chlamydomonas (strain CC-124) that had reached the logarithmic growth phase was adsorbed on a cotton swab, spread over TAP medium, and cultured at room temperature (25±2° C.) for 2 weeks. The results are shown in FIG. 19 (day 0 of culture), FIG. 20 (day 7 of culture), and FIG. 21 (day 11 of culture).

As a result, the growth of Chlamydomonas was clearly visually confirmed in sample A on the 11th day of culture. On the other hand, in samples B to D, growth of Chlamydomonas was not visually confirmed even after 11 days of culture. That is, the cyanoacrylate nanoparticles of samples BD had a mass per square meter of 0.108 to 1.078 g/m ² .

Combined with the results of Example 12, cyanoacrylate nanoparticles prevent or inhibit growth of Chlamydomonas on solid surfaces when the mass per square meter is 0.076 g/m ² or 0.108 g/m ² or more. recognized as possible. Similar results were obtained for microalgae other than Chlamydomonas (results not shown).

Therefore, for example, if the cyanoacrylate nanoparticle liquid is applied in advance to the outer wall for building materials so that the mass per square meter is 0.076 g/m ² or 0.108 g/m ² or more, the outer wall for building materials can be applied. It can be expected to prevent or suppress the growth of microalgae on the surface.

Incidentally, in order to actually apply the cyanoacrylate nanoparticle liquid to the surface of the outer wall for building materials, it is preferable to carry out as follows. That is, the volume of 0.1 g of cyanoacrylate nanoparticle dispersion is 10 cm ³ at a dispersion concentration of 1%. In the case of 10 cm ³ , it is possible to spray the dispersion and dry it. When applying, it is easy to work uniformly by diluting this 10 times to make a liquid of 100 cm ³ . Considering the drying time, it is advantageous to use a small amount of the liquid to be diluted.

[Example 14]
In an outdoor pond, cyanoacrylate nanoparticles were added to investigate the effect on the growth of microalgae.

Isobutyl cyanoacrylate nanoparticles with a diameter of 25 nm were added to one of the ponds with a water capacity of 42 tons arranged side by side on the campus of Kochi University of Technology to a final concentration of 100 ppm. No isobutyl cyanoacrylate nanoparticles were added to the other pond, which was the target experimental plot. After 24 days, 500 mL of water was collected from each of the pond to which cyanoacrylate nanoparticles were added and the pond of the target experimental area, filtered through a mesh with a mesh size of 1 μm, and organisms such as microalgae were collected.

Cells were disrupted by 3 cycles of freezing and thawing the organisms on the filters. Total DNA extraction from disrupted cells was performed using QIAamp DNA Mini Kit (manufactured by Qiagen). Using the extracted DNA, the amplicon amplified by the PCR method using the following primer set was analyzed for end pair sequences under the conditions of 2 × 300 bp using the next-generation sequencer MiSeq (manufactured by Illumina).

1st-1422f
5'ACACTCTTTCCCTACACGACGCTCTTCCGATCTATAACAGGTCTGTGATGCC3'

1st-1642r
5 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGGGCGGTGTGTACAAAGG3'

A quality check was performed on the sequence data obtained using organism DNA obtained from the cyanoacrylate nanoparticle-injected ponds, resulting in a final 49,376 reads (bp). In addition, a quality check was performed on the sequence data obtained using the DNA of the organisms obtained from the ponds of the subject experimental plot, and finally 67,268 reads (bp) were obtained. By comparing these sequence data with the nucleotide sequence data of GenBank managed and operated by the US Center for Biotechnology Information, the species closest to the analyzed 18S rDNA sequence was estimated.

Of the analyzed DNA sequences, seven were found to have the highest homology to dinoflagellates (Table 4). None of these DNA sequences were detected from the cyanoacrylate nanoparticle liquid input ponds only a limited number of times or not at all. On the other hand, it was detected more than 60 times in all of the ponds in the target experimental area. From this, it was recognized that these dinoflagellates are species in which most of the growing individuals die when exposed to the cyanoacrylate nanoparticle liquid.

Of the analyzed DNA sequences, three were found to have the highest homology to golden algae (Table 5). None of these DNA sequences were detected from the cyanoacrylate nanoparticle liquid input ponds only a limited number of times or not at all. On the other hand, it was detected 88 times or more in all of the ponds in the target experimental area. From this, it can be said that these golden algae are species in which most of the growing individuals die when exposed to the cyanoacrylate nanoparticle liquid.

Of the analyzed DNA sequences, three were found to have the highest homology to E. eyedrop algae (Table 6). All of these DNA sequences were detected only a limited number of times from ponds infused with cyanoacrylate nanoparticles. On the other hand, it was detected 243 times or more in all of the ponds in the target experimental area. From this, it can be said that most of the growing individuals of these true eye drop algae die when exposed to the cyanoacrylate nanoparticle liquid.

Of the analyzed DNA sequences, five were found to have the highest homology to green algae (Table 7). In these DNA sequences, the number of reads detected from the pond into which the cyanoacrylate nanoparticle liquid was added was less than about one third of the number of reads detected from the pond of the subject experimental plot. From this, it can be said that these green algae are species whose growing individuals are likely to perish due to exposure to the cyanoacrylate nanoparticle liquid.

INDUSTRIAL APPLICABILITY The present invention can be used for an algae growth inhibitor for inhibiting algae growth and a method for inhibiting algae growth.

Claims (15)

Cyanoacrylate An algal growth inhibitor that inhibits the growth of algae containing nanoparticles. The algal growth inhibitor according to claim 1 , wherein the cyanoacrylate nanoparticles are polymerized in the coexistence of a cyanoacrylate monomer and a surfactant. 3. The algal growth inhibitor of claim 2 , wherein said cyanoacrylate monomer is isobutyl cyanoacrylate. The algae growth inhibitor according to any one of claims 1 to 3 , wherein the algae are microalgae. The algae growth inhibitor according to claim 4 , wherein the microalgae belong to the phylum Chlorophyta. 6. The algal growth inhibitor according to claim 5 , wherein the Chlorophyta belongs to the Chlorophyceae or the Trebouxiaphyceae. The algal growth inhibitor according to any one of claims 4 to 6 , wherein the microalgae belong to the genus Chlamydomonas or Chlorella. The microalgae is at least one selected from the group of dinoflagellates belonging to the phylum Dinoflagellate, diatoms belonging to the phylum Diatomaceae, raphidophytes belonging to the phylum Heterokontophyta, gold algae, and euphytic algae. The algae growth inhibitor according to claim 4 . The algae growth inhibitor according to any one of claims 4 to 8 , which prevents or suppresses water pollution caused by the growth of the microalgae. 10. The algae growth inhibitor according to claim 9 , wherein the water pollution is red tide or pollution in closed water areas. The algae growth inhibitor according to any one of claims 4 to 8 , which prevents or inhibits the growth of said microalgae on a solid surface. The algae growth inhibitor according to claim 11 , wherein the solid is a member used in a plant factory or an outer wall for building materials. Cyanoacrylate A method for inhibiting algae growth using nanoparticles. 14. The method for suppressing the growth of algae according to claim 13 , wherein the algae are microalgae. 15. The method of inhibiting algal growth according to claim 14 , wherein the cyanoacrylate nanoparticles are capable of growing microalgae that are insensitive.

Images