WO2018179514A1

WO2018179514A1 - Steroid-skeleton-containing-compound detecting device and steroid-skeleton-containing-compound detecting method using same

Info

Publication number: WO2018179514A1
Application number: PCT/JP2017/034996
Authority: WO
Inventors: 金子　直人; 克紀堀井; 大橋　啓之; 逢坂　哲彌
Original assignee: Ｎｅｃソリューションイノベータ株式会社; 学校法人早稲田大学
Priority date: 2017-03-27
Filing date: 2017-09-27
Publication date: 2018-10-04
Also published as: JP6823244B2; JPWO2018179514A1

Abstract

Provided are a novel steroid-skeleton-containing-compound detecting device and a steroid-skeleton-containing-compound detecting method using the same. A steroid-skeleton-containing-compound detecting device according to the present invention is characterized by including a transistor at which a nucleic-acid sensor for detecting a steroid-skeleton-containing compound is disposed, and is characterized in that the nucleic-acid sensor includes: a three-dimensional-body forming region (D) that forms a predetermined three-dimensional structure; and a bonding region (A) that bonds with the steroid-skeleton-containing compound, the three-dimensional-body forming region (D) inhibits the formation of the three-dimensional structure in the absence of the steroid-skeleton-containing compound, the three-dimensional-body forming region (D) forms the three-dimensional structure as a result of the steroid-skeleton-containing compound coming into contact with the bonding region (A) in the presence of the steroid-skeleton-containing compound, and at the time of formation of the three-dimensional structure, the steroid-skeleton-containing compound is present in an electrolyte-containing solution, and the number of nucleotide residues constituting the nucleic-acid sensor in the solution within the range of the Debye length thereof increases or decreases compared with when the formation of the three-dimensional structure is inhibited.

Description

Steroid skeleton-containing compound detection device and method for detecting steroid skeleton-containing compound using the same

The present invention relates to a steroid skeleton-containing compound detection device and a steroid skeleton-containing compound detection method using the device.

Detecting targets is required in various fields such as clinical medicine, food, and environment. For the detection of the target, a method using an interaction with the target is generally used.

As a method of using the interaction, a transistor in which a binding substance that binds to the target is disposed is used, and a change in charge caused by the charge of the target generated when the binding substance and the target are bound is detected. Therefore, a method for detecting the target is known (Non-Patent Document 1).

However, although the method using the transistor can analyze a target having a charge, there is a problem that a target having little or no charge cannot be analyzed like a steroid skeleton-containing compound containing cortisol. It was.

Therefore, an object of the present invention is to provide a novel steroid skeleton-containing compound detection device and a method for detecting a steroid skeleton-containing compound using the same.

The steroid skeleton-containing compound detection device of the present invention includes a transistor in which a nucleic acid sensor for detecting a steroid skeleton-containing compound is disposed,
The nucleic acid sensor is
A stereogenic region (D) that forms a predetermined stereostructure and a binding region (A) that binds to the steroid skeleton-containing compound;
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure,
In the presence of the steroid skeleton-containing compound, by the contact of the steroid skeleton-containing compound with the binding region (A), the three-dimensional formation region (D) forms the three-dimensional structure,
During the formation of the three-dimensional structure,
The steroid skeleton-containing compound is present in a solution containing an electrolyte,
The number of nucleotide residues constituting the nucleic acid sensor in the Debye length range of the solution is increased or decreased as compared with the inhibition of formation of the three-dimensional structure.

The method for detecting a steroid skeleton-containing compound of the present invention comprises a contact step of bringing a sample into contact with the detection device of the present invention, and an increase or decrease in the number of nucleotide residues constituting a nucleic acid sensor in the Debye length range of the detection device. By detecting a steroid skeleton-containing compound in the sample.

The steroid skeleton-containing compound detection device of the present invention and the steroid skeleton-containing compound detection method using the device can detect a steroid skeleton-containing compound containing cortisol.

FIG. 1 is a schematic view showing a structural change of a nucleic acid sensor in the device of the present invention. FIG. 2 is a schematic diagram showing the structural change of the nucleic acid sensor in the device of the present invention. FIG. 3 is a graph showing ΔVg when the single-stranded sensor in Example 1 of the present application is used. FIG. 4 is a graph showing ΔVg when the double-stranded sensor in Example 1 of the present application is used.

<Steroid skeleton-containing compound detection device>
As described above, the steroid skeleton-containing compound detection device (hereinafter also referred to as “device”) of the present invention includes a steroid skeleton-containing compound detection nucleic acid sensor (hereinafter also referred to as “nucleic acid sensor” or “sensor”). The nucleic acid sensor includes a three-dimensional formation region (D) forming a predetermined three-dimensional structure (hereinafter also referred to as “predetermined structure”) and the steroid skeleton-containing compound (hereinafter also referred to as “steroid compound”). In the absence of the steroid skeleton-containing compound, the steric formation region (D) is inhibited from forming the steric structure, and in the presence of the steroid skeleton-containing compound, the binding By the contact of the steroid skeleton-containing compound with the region (A), the three-dimensional formation region (D) forms the three-dimensional structure, and the three-dimensional structure is formed. The steroid skeleton-containing compound is present in a solution containing an electrolyte, and the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range of the solution is greater than that at the time of inhibiting the formation of the three-dimensional structure. It is characterized by increasing or decreasing.

The sensor disposed in the transistor, as will be described later, in the presence of the steroid compound, that is, at the time of forming the predetermined structure, the number of nucleotide residues constituting the sensor in the Debye length range (hereinafter, (Also called “Debye length nucleotide number”). Moreover, the nucleotide residue constituting the sensor has, for example, a negative charge. For this reason, in the presence of the steroid compound, the charge in the Debye length range decreases or increases compared to the absence of the steroid compound, for example, to correspond to an increase or decrease in the number of nucleotides of the Debye length. Therefore, in the detection device of the present invention, for example, the charge in the range of the Debye length increases or decreases due to the presence of the steroid compound regardless of the charge of the steroid compound. It is possible to analyze the steroid compounds that do not. Since the nucleotide residues constituting the sensor have a base, a sugar skeleton, and a phosphate group, the number of nucleotide residues is, for example, “number of bases”, “number of sugar skeletons”, “ It can also be referred to as “the number of phosphate groups”.

Hereinafter, each region is also referred to as a nucleic acid region. In the present invention, the single-stranded nucleic acid sensor described below can also be referred to as a single-stranded sensor, for example, and the double-stranded nucleic acid sensor can also be referred to as a double-stranded sensor, for example. In addition, regarding the three-dimensional formation region (D), the formation of a predetermined structure is inhibited, the switch-OFF (or turn-OFF), the formation of the predetermined structure is indicated by a switch-ON (or turn- ON).

The three-dimensional formation region (D) is a nucleic acid region that forms a predetermined structure. The predetermined structure is not particularly limited, and examples thereof include higher order structures formed by nucleic acid molecules, and specific examples include secondary structures, tertiary structures, and quaternary structures. Specific examples of the predetermined structure include a stem structure, a hairpin loop structure, a bulge loop structure, a G-quartet structure, an i-motif structure, and a pseudoknot structure. As a specific example, the three-dimensional formation region (D) is, for example, a G formation region (G) that forms a G-quartet structure, and the predetermined structure is a G-quartet structure. The number of the predetermined structures formed in the three-dimensional formation region (D) is not particularly limited, and is, for example, 1 to 10. The array of the three-dimensional formation region (D) may be an array that forms the predetermined structure. The three-dimensional formation region (D) may form, for example, a three-dimensional structure other than the predetermined structure (hereinafter also referred to as “other three-dimensional structure”) in the absence of the steroid compound. In this case, the nucleic acid sensor, for example, in the absence of the steroid compound, the three-dimensional formation region (D) forms another three-dimensional structure, and in the presence of the steroid compound, the steroid to the binding region (A) is formed. The three-dimensional formation region (D) may form the predetermined three-dimensional structure by contact with a compound. The other three-dimensional structure is, for example, a three-dimensional structure different from the predetermined structure. As specific examples of the other three-dimensional structure, for example, specific examples of the predetermined structure can be used.

The G-quartet (also referred to as “G-tetrad”) is generally known as a surface structure in which G (guanine) is a tetramer. The G formation region (G) is, for example, a region having a plurality of bases G and forming a G-quartet structure with the plurality of bases G in the region. The G-quartet structure may be, for example, a parallel type or an anti-parallel type, and is preferably a parallel type. In the sensor of the present invention, the number of G-quartet structures formed in the G formation region (G) is not particularly limited, and may be one surface or a plurality of two or more surfaces. G) preferably forms a guanine quadruplex (or G-quadruplex) structure in which multiple G-quartets are stacked. The sequence of the G-forming region (G) may be any sequence that forms the G-quartet structure, and more preferably a sequence that forms a guanine quadruplex structure.

As the sequence of the G-forming region (G), for example, a sequence of a known nucleic acid molecule that forms the G-quartet structure can be used. Examples of the known nucleic acid molecule include nucleic acid molecules such as the following articles (1) to (4).
(1) Travascio et al., Chem. Biol., 1998, vol.5, p.505-517
(2) Cheng et al., Biochemistry, 2009, vol.48, p.7817-7823
(3) Teller et al., Anal. Chem., 2009, vol.81, p.9114-9119
(4) Tao et al., Anal. Chem., 2009, vol.81, p.2144-2149

When the predetermined three-dimensional structure is an i-motif structure, the sequence of the three-dimensional formation region (D) can be, for example, the sequence of a known nucleic acid molecule that forms the i-motif structure. Examples of the known nucleic acid molecule include nucleic acid molecules such as the following paper (5).
(5) Patrycja Bielecka et al., “Fluorescent Sensor for PH Monitoring Based on an i-Motif--Switching Aptamer Containing a Tricyclic Cytosine Analogue (tC)”, 2015, Molecules, vol.20, pp.18511-18525

When the predetermined three-dimensional structure is a pseudoknot structure, the sequence of the three-dimensional formation region (D) can be, for example, the sequence of a known nucleic acid molecule that forms the pseudoknot structure. Examples of the known nucleic acid molecule include nucleic acid molecules such as the following paper (6).
(6) Calliste Reiling et al., “Loop Contributions to the Folding Thermodynamics of DNA Straight Hairpin Loops and Pseudoknots”, 2015, J. Phys. Chem. B, vol.119, pp.1939-1946

The solid formation region (D) may be, for example, a single-stranded type or a double-stranded type. The single-stranded type can form a predetermined structure in, for example, a single-stranded three-dimensional formation region (D), and the double-stranded type includes, for example, a first region (D1) and a second region (D2). A predetermined structure can be formed between the first region (D1) and the second region (D2). The latter double-stranded type includes, for example, a structure in which the first region and the second region are indirectly linked, and will be specifically described in the nucleic acid sensor (iv) described later.

The length of the single-stranded solid formation region (D) is not particularly limited, and the lower limit is, for example, 11 base length, 13 base length, 15 base length, and the upper limit is, for example, 60 base length, It is 36 bases long and 18 bases long.

In the double-stranded solid formation region (D), the lengths of the first region (D1) and the second region (D2) are not particularly limited, and both may be the same or different. . The length of the first region (D1) is not particularly limited, and the lower limit is, for example, 7 base length, 8 base length, 10 base length, and the upper limit is, for example, 30 base length, 20 base length, 10 The base length is, for example, 7 to 30 bases, 7 to 20 bases, or 7 to 10 bases. The length of the second region (D2) is not particularly limited, and the lower limit is, for example, 7 base length, 8 base length, 10 base length, and the upper limit is, for example, 30 base length, 20 base length, 10 The base length is, for example, 7 to 30 bases, 7 to 20 bases, or 7 to 10 bases.

In the present invention, the steroid compound means a compound having a steroid skeleton represented by the following formula (1). As a specific example, the steroid skeleton-containing compound includes, for example, cortisol, cholesterol, progesterone, 11-deonecicorticosterone, corticosterone, aldosterone, cortisone, dehydroepiandrosterone, dehydroepiandrosterone represented by the following formula (2): Androsterone sulfate, dihydrotestosterone, androsterone, epiandrosterone, testosterone, 17β-estradiol, estrone, estriol and the like. In the present invention, cortisol can be referred to as, for example, (11β) -17,21-trihydroxypregna-4-ene-3,20-dione, and is a chemical registered under CAS registration number 50-23-7. See material and chemical formula. The steroid compound may be, for example, a derivative such as an isomer, a salt, a hydrate, or a solvate. Hereinafter, the description regarding the said steroid compound can be used for the said derivative | guide_body.

The length of the binding region (A) is not particularly limited, and the lower limit is, for example, 12 base length, 15 base length, 18 base length, and the upper limit is, for example, 140 base length, 80 base length, 60 bases The range is, for example, 12 to 140 bases long, 15 to 80 bases long, 18 to 60 bases long.

In the present invention, the phrase “the other sequence is complementary to a certain sequence” means, for example, a sequence that can be annealed between the two. The annealing is also referred to as stem formation, for example. In the present invention, “complementary” means, for example, that complementarity when two kinds of sequences are aligned is, for example, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more. Yes, preferably 100%, ie fully complementary. In the nucleic acid sensor, the other sequence is complementary to a certain sequence when the sequence is directed from the 5 ′ side to the 3 ′ side, and the sequence is directed from the other 3 ′ side to the 5 ′ side. Means that the bases of each other are complementary.

In the present invention, examples of the sensor include the following sensors (I) and (II). In the present invention, the sensor arranged in the transistor may be, for example, one type or two or more types.

As an example of the sensor, each of the sensors (I) and (II) will be described below. In the following sensors, the predetermined three-dimensional structure is preferably a G-quartet structure, for example. In addition, unless otherwise indicated, description of each sensor can be used, respectively. In the description of the sensors (I) and (II) below, “three-dimensional structure” means “predetermined three-dimensional structure”.

1. Nucleic acid sensor (I)
The nucleic acid sensor (I) is, for example, a double-stranded nucleic acid sensor composed of a first strand (ss1) and a second strand (ss2),
The first strand (ss1) has the three-dimensional region (D) and the binding region (A) in this order,
The second strand (ss2) has a stem forming region (S _D ) and a stem forming region (S _A ) in this order,
The stem forming region (S _D ) has a sequence complementary to the three-dimensional forming region (D),
The stem forming region (S _A ) has a sequence complementary to the binding region (A),
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure and hybridizes with the second chain (ss2),
In the presence of the steroid skeleton-containing compound, the three-dimensional formation region (D) forms the three-dimensional structure by contacting the steroid skeleton-containing compound with the binding region (A) of the first chain (ss1), and Dissociates from the second strand (ss2),
In the formation of the three-dimensional structure, the nucleic acid sensor is a double-stranded nucleic acid sensor in which the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range is smaller than that in the inhibition of the formation of the three-dimensional structure.

In the nucleic acid sensor (I), the three-dimensional formation region (D) is, for example, the single-stranded type.

As shown in FIG. 1, the sensor (I) has an ON-OFF structure based on the following mechanism, for example, depending on the presence or absence of the steroid compound, the formation of the three-dimensional structure of the three-dimensional formation region (D). Thus, it is presumed that the number of nucleotide residues constituting the sensor decreases in the Debye length range. Note that the present invention is not limited to this mechanism. In general, nucleic acid sequences are considered to be thermodynamically fluctuating between structures that can be formed, and the abundance ratio of relatively stable ones is considered to be high. In addition, in the presence of the steroid compound, the binding nucleic acid molecule (binding region) such as an aptamer generally changes to a more stable structure by binding with the steroid compound and can bind to the steroid compound. Are known. In addition, the three-dimensional structure of a nucleic acid sequence such as a G-quartet structure is generally considered to have a higher abundance of relatively stable ones. As shown in FIG. 1A, in the absence of the steroid compound, the sensor (I) has the three-dimensional formation region (D) and the second chain (ss2) of the first chain (ss1). said stem forming region and the (S _D) is by annealing, formation of the three-dimensional structure of the three-dimensional formation region (D) is the inhibition of (switch -OFF). In addition, the binding region (A) of the first chain (ss1) and the stem formation region (S _A ) of the second chain (ss2) are annealed, so that in the binding region (A), the steroid The formation of a more stable structure for binding to the compound is blocked, and the structure in a state not bonded to the steroid compound is maintained. On the other hand, in the presence of the steroid compound, the sensor (I) can anneal the binding region (A) and the stem formation region (S _A ) by contacting the steroid compound with the binding region (A). When released, the binding region (A) changes to the stable structure. Accordingly, the annealing of the three-dimensional formation region (D) and the stem formation region (S _D ) is released, and the three-dimensional structure is formed in the region of the three-dimensional formation region (D) (switch-ON). . Also, as shown in FIG. 1B, annealing between the binding region (A) and the stem formation region (S _A ), and between the three-dimensional formation region (D) and the stem formation region (S _D ) When the annealing is released, the first strand (ss1) is dissociated from the second strand (ss2), and as a result, the first strand (ss1) can move out of the Debye length range. It becomes. Therefore, according to the sensor (I), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively. In FIG. 1, the second chain (ss2) is described as being disposed in the transistor. However, as will be described later, the first chain (ss1) is disposed in the transistor. Also good.

As described above, the sensor (I) includes the first chain (ss1) and the second chain (ss2), and in the presence of the steroid compound, the first chain (ss1) or the second chain (ss2). ) Dissociates and moves, for example, outside the Debye length range. For this reason, even when the steroid compound has a charge, in the presence of the steroid compound, the charge in the Debye length range is equal to the number of dissociated first chains (ss1) or second chains (ss2). Fluctuate accordingly. For this reason, the sensor (I) is excellent in versatility because, for example, the influence of the charge of the steroid compound is reduced.

For example, the stem formation region (S _D ) preferably has a sequence that is entirely or partially complementary to a part of the three-dimensional formation region (D). Moreover, it is preferable that the stem forming region (S _A ) is, for example, a sequence that is entirely or partially complementary to a part of the binding region (A).

In the sensor (I), the three-dimensional formation region (D) and the stem formation region (S _D ) are annealed in the order of the regions, and the binding region (A) and the stem formation region (S _A ) are annealed. And the order of annealing. The following order can be illustrated as a specific example.
(1) ss1 5'- AD-3 '
ss2 3'- S _A -S _D -5 '
(2) ss1 5'- DA-3 '
ss2 3'- S _D -S _A -5 '

In (1), the stem formation region (S _A ) is complementary to the 3′-side region of the binding region (A), and the stem formation region (S _D ) is the solid formation region (D). It is preferable to be complementary to the 5 ′ side region. In (2), the stem formation region (S _D ) is complementary to the 3′-side region of the three-dimensional formation region (D), and the stem formation region (S _A ) is the binding region (A). It is preferable to be complementary to the 5 ′ side region.

The sensor (I) may be connected, for example, directly or indirectly between the regions. The direct connection means that, for example, the 3 ′ end of one region and the 5 ′ end of the other region are directly bonded, and the indirect connection is, for example, 3 of one region. It means that the “end” and the 5 ′ end of the other region are bound via an intervening linker region. The intervening linker region may be, for example, a nucleic acid sequence or a non-nucleic acid sequence, preferably the former.

The sensor (I) includes, for example, the stem formation region (A) between the binding region (A) and the three-dimensional formation region (D) in the first strand (ss1) and the second strand (ss2). It is preferable to have the intervening linker region between S _D ) and the stem formation region (S _A ). The intervening linker region (L ₁ ) in the first strand (ss1) and the intervening linker region (L ₂ ) in the second strand (ss2) are preferably non-complementary sequences.

As a specific example, for example, the following order can be exemplified for the forms in which (1) and (2) have the intervening linker region in the first chain (ss1) and the second chain (ss2). In the following examples, an intervening linker region that connects the binding region (A) and the three-dimensional formation region (D) is (L ₁ ), the stem formation region (S _D ), and the stem formation region (S _A ) The intervening linker region linking is represented by (L ₂ ). The sensor (I) may have, for example, both (L ₁ ) and (L ₂ ) as an intervening linker region, or may have only one of them.
(1 ') ss1 5'- AL ₁ -D -3'
ss2 3'- S _A -L ₂ -S _D -5 '
(2 ') ss1 5'- DL ₁ -A -3'
ss2 3'- S _D -L ₂ -S _A -5 '

In the forms (1 ′) and (2 ′), for example, the formation of a three-dimensional structure is turned on and off as follows. In the absence of the steroid compound, for example, the binding region (A) and the stem formation region (S _A ), the three-dimensional formation region (D) and the stem formation region (S _D ) each form a stem, Between these two stems, the intervening linker region (L ₁ ) and the intervening linker region (L ₂ ) form an internal loop to inhibit the formation of the three-dimensional structure of the three-dimensional formation region (D). Then, in the presence of the steroid compound, the formation of each stem is released by the contact of the steroid compound with the binding region (A), and the three-dimensional structure is formed in the three-dimensional formation region (D).

In the sensor (I), the lengths of the stem formation region (S _A ) and the stem formation region (S _D ) are not particularly limited. The length of the stem formation region (S _A ) is, for example, 1 to 60 bases long, 1 to 10 bases long, or 1 to 7 bases long. The length of the stem formation region (S _D ) is, for example, 1 to 30 bases, 0 to 10 bases, 1 to 10 bases, 0 to 7 bases, or 1 to 7 bases. For example, the stem formation region (S _A ) and the stem formation region (S _D ) may have the same length, the former may be long, or the latter may be long.

The lengths of the intervening linker regions (L ₁ ) and (L ₂ ) are not particularly limited. The lengths of the intervening linker regions (L ₁ ) and (L ₂ ) are, for example, 0 to 30 bases, 1 to 30 bases, 1 to 15 bases, and 1 to 6 bases, respectively. The lengths of the intervening linker regions (L ₁ ) and (L ₂ ) may be the same or different, for example. In the latter case, the difference in length between the intervening linker regions (L ₁ ) and (L ₂ ) is not particularly limited, and is, for example, 1 to 10 bases long, 1 or 2 bases long, and 1 base long.

In the sensor (I), the lengths of the first strand (ss1) and the second strand (ss2) are not particularly limited. The length of the first strand (ss1) is, for example, 40 to 200 bases long, 42 to 100 bases long, 45 to 60 bases long. The length of the second strand (ss2) is, for example, 4 to 120 bases long, 5 to 25 bases long, or 10 to 15 bases long.

In the sensor (I), for example, the first chain (ss1) and the second chain (ss2) may be directly or indirectly linked. When the first strand (ss1) and the second strand (ss2) are linked, the sensor (I) can be referred to as a single-stranded nucleic acid sensor, for example, and the first strand (ss1) The second strand (ss2) can be referred to as a first region and a second region, respectively. The direct connection means that, for example, the 3 ′ end of one region and the 5 ′ end of the other region are directly bonded, and the indirect connection is, for example, 3 of one region. It means that the 'terminal and the 5' end of the other region are linked via an intervening linker region, specifically, the 3 'end of one region and the 5' end of the intervening linker region Means that the 3 ′ end of the intervening linker region and the 5 ′ end of the other region are directly bound. The intervening linker region may be, for example, a nucleic acid sequence or a non-nucleic acid sequence, preferably the former. The length of the intervening linker region is not particularly limited and is, for example, 1 to 60 bases long.

Regarding the order of the first region, the second region, and the intervening linker region, for example, the first region, the intervening linker region, and the second region may be connected in this order from the 5 ′ side. They may be connected in this order from the 3 ′ side, preferably the former.

In the sensor (I), for example, one end of the first chain (ss1) or the second chain (ss2) may be connected to the transistor.

In the sensor (I), for example, a linker region may be further added to the one end or both ends of the first strand (ss1) and the second strand (ss2). Hereinafter, the linker region added to the terminal is also referred to as an additional linker region. The length of the additional linker region is not particularly limited and is, for example, 1 to 60 bases long. In this case, in the sensor (I), for example, one end of the first strand (ss1) or the second strand (ss2) may be connected to the transistor via an additional linker region.

As a specific example of the sensor (I) that binds to cortisol, the first strand (ss1) includes, for example, the following polynucleotide (a). The second strand (ss2) includes, for example, the following polynucleotide (b).

(A) a polynucleotide comprising the base sequence of (a1), (a2) or (a3) below (a1) SEQ ID NO: 1 (a2) in the base sequence of SEQ ID NO: 1, wherein one or several bases are It consists of a base sequence deleted, substituted, inserted and / or added, the region corresponding to the binding region (A) binds to cortisol, and the region corresponding to the stereogenic region (D) is the predetermined three-dimensional structure The polynucleotide (a3) comprising the nucleotide sequence having the identity of 80% or more with respect to the nucleotide sequence of SEQ ID NO: 1, the region corresponding to the binding region (A) binds to cortisol, and the three-dimensional formation A polynucleotide in which a region corresponding to the region (D) forms the predetermined three-dimensional structure

(B) a polynucleotide consisting of the base sequence of (b1), (b2), or (b3) below (b1) SEQ ID NO: 2 (b2) in the base sequence of SEQ ID NO: 2, wherein one or several bases deleted, substituted, inserted and / or added in the nucleotide sequence, wherein the system forming area (S _a) a region corresponding to the said bound to the binding region (a) of the polynucleotide of (a) (annealing) A region corresponding to the stem-forming region (S _D ) with respect to the base sequence of the polynucleotide (b3) SEQ ID NO: 2 that binds (anneals) to the three-dimensional formation region (D) of the polynucleotide of (a), the base sequence having 80% or more identity, coupled to the coupling region of a polynucleotide of the stem forming regions (S _a) a region corresponding to said (a) (a) Annealing), and said stem forming regions (coupled to the three-dimensional formation region (D) of the polynucleotide S _D) a region corresponding to said (a) (annealing) polynucleotides

The polynucleotide (a1) is a polynucleotide having the base sequence of SEQ ID NO: 1 below. In the base sequence of SEQ ID NO: 1, the base sequence indicated by the underline at the 5 ′ end corresponds to the three-dimensional formation region (D), and the base sequence indicated by the underline enclosed in parentheses at the 3 ′ end is the binding The base sequence corresponding to the region (A) and not underlined corresponds to the intervening linker region (L ₁ ).
First strand (ss1) (SEQ ID NO: 1): 5'- GGGTGGGAGGGTCGGG TTT [ GCAAGTTCTTCGCTCGTACTTGC ] -3 '

In the polynucleotide of (a2), “one or several” means, for example, that the polynucleotide of (a2) binds to cortisol in the region corresponding to the binding region (A), and the three-dimensional region (D The region corresponding to) may be a range that forms the predetermined three-dimensional structure. The “1 or several” is, for example, 1 to 8, 1 to 4, 1 or 2, or 1 in the base sequence of (a1). In the present invention, the numerical range of numbers such as the number of bases and the number of sequences, for example, discloses all positive integers belonging to the range. That is, for example, the description “1 to 5 bases” means all disclosures of “1, 2, 3, 4, 5 bases” (the same applies hereinafter).

In the polynucleotide of (a3), “identity” means, for example, that the polynucleotide of (a3) binds to cortisol in the region corresponding to the binding region (A), and the stereogenic region (D) The corresponding region may be a range that forms the predetermined three-dimensional structure. The “identity” is, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more. The identity can be calculated with default parameters using analysis software such as BLAST and FASTA (hereinafter the same).

The polynucleotide (b1) is a polynucleotide having the base sequence of SEQ ID NO: 2 below. In the base sequence of SEQ ID NO: 2 below, the base sequence indicated by the underline at the 5 ′ end corresponds to the stem formation region (S _A ), and the base sequence indicated by the underline enclosed in parentheses at the 3 ′ end is The base sequence without underline corresponding to the stem formation region (S _D ) corresponds to the intervening linker region (L ₂ ).
Second strand (ss2) (SEQ ID NO: 2): 5'- AACTTGC TTT [ CCCGACCC ] -3 '

In the polynucleotide of (b2), “one or several” means, for example, that the polynucleotide of (b2) is a region corresponding to the stem forming region (S _A ) of the polynucleotide of (a). The region that binds to the binding region (A) and corresponds to the stem forming region (S _D ) may be in a range that binds to the three-dimensional forming region (D) of the polynucleotide of (a). The polynucleotide (b2) may be any of the polynucleotides (a), the stem formation region (S _A ), and the stem formation region (S _D ) as long as they can be combined as described above. The “1 or several” is, for example, 1 to 4, 1 to 3, 1 or 2, or 1 in the base sequence of (b1).

In the polynucleotide of (b3), “identity” means, for example, that the polynucleotide of (b3) is a region corresponding to the stem-forming region (S _A ), and the binding region of the polynucleotide of (a) The region that binds to (A) and corresponds to the stem forming region (S _D ) may be in a range that binds to the three-dimensional forming region (D) of the polynucleotide of (a). The polynucleotide (b3) may be any one of the polynucleotides (a), the stem formation region (S _A ), and the stem formation region (S _D ) as long as they can be combined as described above. The “identity” is, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more.

In the sensor (I), one of the first chain (ss1) and the second chain (ss2) may be disposed in the transistor, and the other chain may be included as a reagent. In this case, the chain disposed in the transistor is preferably the second chain (ss2), and the chain included as the reagent is preferably the first chain (ss1).

In the sensor (I), when one of the first chain (ss1) and the second chain (ss2) is arranged in the transistor and includes the other chain as a reagent, the sensor (I) is, for example, In the presence of the reagent, based on the following mechanism, the formation of the three-dimensional structure of the three-dimensional formation region (D) is controlled to ON-OFF depending on the presence or absence of the steroid compound. In range, it is estimated that the number of nucleotide residues constituting the sensor will decrease. As an example, the case where the second chain (ss2) is arranged in the transistor will be described as an example. However, the present invention is not limited to this mechanism. In the sensor (I), in the absence of the steroid compound, the binding region (A) does not form a more stable structure for binding to the steroid compound, and the stem-forming region (S _A ) However, by annealing to the binding region (A), the formation of the stable structure is blocked in the binding region (A), and the structure that is not bound to the steroid compound is maintained. Accordingly, the formation of the three-dimensional structure of the three-dimensional formation region (D) is inhibited (switch-OFF), and the stem formation region (S _D ) anneals to the three-dimensional formation region (D). . For this reason, in the sensor (I), in the absence of the steroid compound, the first strand (ss1) and the second strand (ss2) are hybridized. On the other hand, in the presence of the steroid compound, the sensor (I) changes the binding region (A) into the stable structure by the contact of the steroid compound with the binding region (A), thereby forming the stem formation. The region (S _A ) does not anneal to the binding region (A). Accordingly, the stem formation region (S _D ) does not anneal to the solid formation region (D), and the solid structure is formed in the region of the solid formation region (D) (switch -ON). Then, the annealing between the bonding region (A) and the stem formation region (S _A ) and the annealing between the three-dimensional formation region (D) and the stem formation region (S _D ) are not formed, so that the first The strand (ss1) does not hybridize to the second strand (ss2), and the first strand (ss1) can move out of the Debye length range. Therefore, according to the sensor (I), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively. In addition, although the second chain (ss2) has been described as an example arranged in the transistor, the first chain (ss1) may be arranged in the transistor.

2. Nucleic acid sensor (II)
The nucleic acid sensor (II) is, for example, a single-stranded nucleic acid sensor having the three-dimensional formation region (D) and the binding region (A),
In the absence of the steroid-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure,
In the presence of the steroid-containing compound, by the contact of the steroid-containing compound with the binding region (A), the three-dimensional formation region (D) forms the three-dimensional structure,
The single-stranded nucleic acid sensor in which the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range is greater than that in the inhibition of the formation of the three-dimensional structure when the three-dimensional structure is formed.

As shown in FIG. 2, the sensor (II) can be turned on and off by the three-dimensional structure of the three-dimensional formation region (D) depending on the presence or absence of the steroid compound based on the following mechanism, for example. It is presumed that the number of nucleotide residues constituting the sensor increases in the range of the Debye length. Note that the present invention is not limited to this mechanism. As shown in FIG. 2A, in the sensor (II), in the absence of the steroid compound, formation of the three-dimensional structure of the three-dimensional formation region (D) is inhibited in the molecule (switch-OFF ). On the other hand, in the presence of the steroid compound, the sensor (II) is more stable for the binding region (A) to bind to the steroid compound by the contact of the steroid compound with the binding region (A). Change to structure. Along with this, the three-dimensional structure is formed in the region of the three-dimensional formation region (D) (switch-ON). Further, as shown in FIG. 2B, the binding region (A) changes to the stable three-dimensional structure, and the three-dimensional formation region (D) forms a three-dimensional structure, whereby the sensor ( II) shrinks to the transistor side, for example. Therefore, according to the sensor (II), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively.

Specifically, the sensor (II) is, for example, at least one sensor selected from the group consisting of the following (i) to (iv) and (v). The sensor (II) may include, for example, one type of sensor or may include two or more types of sensors.

2-1. Nucleic acid sensor (i)
The sensor (i) has, for example, the three-dimensional formation region (D), the blocking region (B), and the binding region (A) in this order,
The blocking region (B) is complementary to a partial region (Dp) in the three-dimensional region (D);
A terminal region (Ab) on the blocking region (B) side in the binding region (A) is complementary to a region (Df) adjacent to the partial region (Dp) in the three-dimensional formation region (D), and In the binding region (A), the single-stranded nucleic acid sensor is complementary to a terminal region (Af) opposite to the blocking region (B).

In the sensor (i), the solid formation region (D) is, for example, the single-stranded type.

In the sensor (i), for example, based on the following mechanism, the formation of the three-dimensional structure of the three-dimensional formation region (D) is controlled to ON-OFF depending on the presence or absence of the steroid compound. In the Debye length range, the number of nucleotide residues constituting the sensor is estimated to increase. In the sensor (i), a partial region (Dp) of the three-dimensional formation region (D) is complementary to the blocking region (B), and an adjacent region (Df) in the three-dimensional formation region (D) is Since it is complementary to the terminal region (Ab) of the binding region (A), stem formation is possible in these complementary relationships. Therefore, in the absence of the steroid compound, stem formation between the partial region (Dp) of the stereogenic region (D) and the blocking region (B) and the adjacent region (Df) of the stereogenic region (D) And stem formation of the terminal region (Ab) of the binding region (A) occurs. The former stem formation inhibits the formation of the three-dimensional structure of the three-dimensional formation region (D) (switch-OFF), and the latter stem formation causes the binding region (A) to bind to the steroid compound. The formation of a more stable structure is blocked, and the structure that is not bonded to the steroid compound is maintained. On the other hand, in the presence of the steroid compound, the binding region (A) changes to the stable structure by the contact of the steroid compound with the binding region (A). Along with this, stem formation in the binding region (A) is released, and the steroid compound binds to the binding region (A) changed to the stable structure. Then, due to the structural change of the coupling region (A) accompanying the cancellation of the stem formation in the coupling region (A), the stem formation of the three-dimensional formation region (D) is also released, and the three-dimensional formation region (D) becomes more The structure changes to a stable structure, and as a result, a three-dimensional structure is formed in the region of the three-dimensional formation region (D) (switch-ON). In addition, when the binding region (A) changes to the stable structure and the three-dimensional formation region (D) forms the three-dimensional structure, the sensor (i) is, for example, on the transistor side. Shrink. Therefore, according to the sensor (i), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively.

The sensor (i) may further have a stabilization region (S). In this case, the solid formation region (D), the blocking region (B), the binding region (A), and the stabilization region (S). The conversion regions (S) are preferably connected in this order. Hereinafter, when the form of the single-stranded nucleic acid sensor having the stabilization region (S) is shown as the sensor (i), the stabilization region (S) is optional and may not be included.

The stabilization region (S) is, for example, a sequence for stabilizing the structure when the binding region (A) binds to the steroid compound. The stabilization region (S) is, for example, complementary to the blocking region (B) or complementary to a part thereof, specifically, on the binding region (A) side in the blocking region (B). It is preferably complementary to the terminal region (Ba). In this case, for example, when the stable structure of the binding region (A) is formed in the presence of the steroid compound, the stabilization region (S) connected to the binding region (A) and the binding region ( A stem is also formed between the blocking region (B) and the terminal region (Ba) connected to A). By forming such a stem in the region connected to the binding region (A), the stable structure of the binding region (A) that binds to the steroid compound is further stabilized.

In the sensor (i), the order of the three-dimensional formation region (D), the blocking region (B), the binding region (A), and the optional stabilization region (S) is not particularly limited. They may be connected in this order from the 5 ′ side, or may be connected in this order from the 3 ′ side, preferably the former.

In the sensor (i), the three-dimensional formation region (D), the blocking region (B), and the binding region (A), and optionally the stabilization region (S), for example, are each a spacer. Although it may be indirectly linked by the intervening sequence, it is preferably directly linked without the spacer sequence.

As described above, the three-dimensional formation region (D) has a sequence complementary to the blocking region (B), and also has a sequence complementary to a part of the binding region (A). In addition, as described above, the blocking region (B) is complementary to a part of the three-dimensional formation region (D), and when having the stabilization region (S), the stabilization region ( It is also complementary to S).

The arrangement and length of the blocking region (B) are not particularly limited, and can be appropriately set according to, for example, the arrangement and length of the three-dimensional formation region (D).

The length of the blocking region (B) is not particularly limited, and the lower limit is, for example, 1 base length, 2 base lengths, 3 base lengths, and the upper limit is, for example, 20 base lengths, 15 base lengths, 10 bases The range is, for example, 1 to 20 bases long, 2 to 15 bases long, and 3 to 10 bases long.

On the other hand, the length of the partial region (Dp) of the three-dimensional formation region (D) is not particularly limited, and the lower limit is, for example, 1 base length, 2 base lengths, 3 base lengths, and the upper limit is For example, the length is 20 base length, 15 base length, 10 base length, and the range is, for example, 1-20 base length, 2-15 base length, 3-10 base length. For example, the length of the blocking region (B) and the length of the partial region (Dp) of the three-dimensional formation region (D) are preferably the same.

In the sensor (i), the position of the partial region (Dp) in the solid formation region (D), that is, the annealing region of the blocking region (B) in the solid formation region (D) is not particularly limited. When the three-dimensional formation region (D), the blocking region (B), the binding region (A), and optionally the stabilization region (S) are connected in this order, the partial region (Dp) Can be set under the following conditions, for example.

The three-dimensional formation region (D) is a region adjacent to the partial region (Dp), which is the blocking region (B) side end of the partial region (Dp) and the three-dimensional formation region (D) in the blocking region (B). The lower limit of the length of the region (Db) between the side ends is, for example, 3 base length, 4 base length, 5 base length, and the upper limit is, for example, 40 base length, 30 base length, 20 base length. The range is, for example, 3 to 40 bases long, 4 to 30 bases long, and 5 to 20 bases long.

The lower limit of the length of the region (Df) adjacent to the partial region (Dp) in the three-dimensional region (D) and opposite to the blocking region (B) side is, for example, 0 base length, The upper limit is, for example, 40 base length, 30 base length, 20 base length, and the range is, for example, 0-40 base length, 1-30 base length, It is 20 bases long.

The terminal region (Ab) on the blocking region (B) side in the binding region (A) is complementary to the adjacent region (Df) of the three-dimensional formation region (D) as described above. Here, the terminal region (Ab) of the binding region (A) may be complementary to the entire region of the adjacent region (Df) of the three-dimensional region (D), or a portion of the adjacent region (Df) It may be complementary to the region. In the latter case, the terminal region (Ab) of the binding region (A) is complementary to the terminal region on the partial region (Dp) side of the three-dimensional formation region (D) in the adjacent region (Df). It is preferable.

The length of the terminal region (Ab) in the binding region (A) complementary to the adjacent region (Df) of the three-dimensional region (D) is not particularly limited, and the lower limit is, for example, one base length The upper limit is, for example, 20 base length, 8 base length, 3 base length, and the range is, for example, 1-20 base length, 1-8 base length, 1-3 base length.

As described above, the stabilization region (S) is, for example, complementary to the blocking region (B) or complementary to a part thereof, and specifically, the binding region (B) in the blocking region (B). It is preferably complementary to the terminal region (Ba) on the A) side.

The sequence and length of the stabilization region (S) are not particularly limited, and are appropriately determined according to, for example, the sequence and length of the blocking region (B), the sequence and length of the binding region (A), and the like. it can. The lower limit of the length of the stabilization region (S) is, for example, 0 base length and 1 base length, and the upper limit is, for example, 10 base length, 5 base length, 3 base length, and the range is For example, the length is 0 to 10 bases, 1 to 5 bases, or 1 to 3 bases. On the other hand, for example, when the stabilization region (S) is complementary to the entire blocking region (B), the blocking region (B) has the same length as the stabilization region (S). For example, when the stabilization region (S) is complementary to a part of the blocking region (B), a part of the blocking region (B), for example, the terminal region (Ba) It is the same length as (S).

The total length of the sensor (i) is not particularly limited, and the lower limit is, for example, 25 base length, 35 base length, 40 base length, and the upper limit is, for example, 200 base length, 120 base length, 80 The base length is, for example, 25 to 200 bases, 35 to 120 bases, 40 to 80 bases.

For example, one end of the sensor (i) may be connected to the transistor.

In the nucleic acid sensor (i), for example, the additional linker region may be further added to one end or both ends. The length of the additional linker region is not particularly limited, and for example, the above description can be used. In this case, for example, one end of the sensor (i) may be connected to the transistor via the additional linker region.

2-2. Nucleic acid sensor (ii)
The sensor (ii) has, for example, the three-dimensional formation region (D), the blocking region (B), the binding region (A), and the stabilization region (S) in this order,
The blocking region (B) is complementary to a partial region (Dp) of the three-dimensional formation region (D);
The terminal region (Ba) on the binding region (A) side of the blocking region (B) is a single-stranded nucleic acid sensor that is complementary to the stabilization region (S).

In the sensor (ii), the three-dimensional formation region (D) is, for example, the single-stranded type.

In the sensor (ii), the binding region (A) is preferably a sequence that alone does not form intramolecular annealing necessary for binding to the steroid compound. Then, the sensor (ii) is obtained by annealing the terminal region (Ba) of the blocking region (B) adjacent to the binding region (A) and the stabilization region (S) in the presence of the steroid compound. It is preferable that a stable structure for binding to the steroid compound is formed from the whole of the binding region (A), the terminal region (Ba), and the stabilization region (S).

In the sensor (ii), for example, based on the following mechanism, the formation of the three-dimensional structure of the three-dimensional formation region (D) is controlled to ON-OFF depending on the presence or absence of the steroid compound. In the Debye length range, the number of nucleotide residues constituting the sensor is estimated to increase. Note that the present invention is not limited to this mechanism. In the sensor (ii), since the partial region (Dp) of the three-dimensional formation region (D) is complementary to the blocking region (B), stem formation is possible in this complementary relationship. For this reason, in the absence of the steroid compound, stem formation occurs between the partial region (Dp) of the stereogenic region (D) and the blocking region (B). By this stem formation, formation of the three-dimensional structure of the three-dimensional formation region (D) is inhibited (switch-OFF). Further, since the binding region (A) is a sequence that does not form intramolecular annealing necessary for binding to the steroid compound by itself, formation of a more stable structure for binding to the steroid compound is blocked. The structure in a state where it is not bonded to the steroid compound is maintained. On the other hand, in the presence of the steroid compound, the binding region (A) changes to the stable structure by the contact of the steroid compound with the binding region (A). Along with this, the stem formation of the blocking region (B) and the partial region (Dp) of the three-dimensional formation region (D) is released, and the terminal region (Ba) of the blocking region (B) and the stable region are newly added. The stem is formed by annealing with the activating region (S), and this stem plays a role of intramolecular annealing necessary for the binding region (A) to bind to the steroid compound, and the stem and the binding region The stable structure is formed from the entirety of (A), and the steroid compound is bound to the binding region (A). Then, by releasing the stem formation between the blocking region (B) and the three-dimensional formation region (D), the three-dimensional formation region (D) newly forms a three-dimensional structure by intramolecular annealing (switch-ON). In addition, the coupling region (A) changes to the stable structure, and the three-dimensional formation region (D) forms the three-dimensional structure, so that the sensor (ii) is, for example, on the transistor side. Shrink. Therefore, according to the sensor (ii), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively.

In the sensor (ii), the order of the three-dimensional formation region (D), the blocking region (B), the binding region (A), and the stabilization region (S) is not particularly limited. For example, 5 ′ They may be connected in this order from the side, or may be connected in this order from the 3 ′ side, preferably the former.

In the sensor (ii), the description of the sensor (i) can be used unless otherwise indicated. In the sensor (ii), the three-dimensional formation region (D), the blocking region (B), and the stabilization region (S) are the same as, for example, the sensor (i).

As described above, the blocking region (B) has a complementary sequence to each of the three-dimensional formation region (D) and the stabilization region (S). Specifically, the blocking region (B) is complementary to the partial region (Dp) of the three-dimensional region (D), and the terminal region (B) on the binding region (A) side ( Ba) is also complementary to the stabilization region (S).

In the blocking region (B), the length of the terminal region (Ba) complementary to the stabilization region (S) is not particularly limited, and the lower limit is, for example, one base length, and the upper limit is, for example, 15 base length, 10 base length and 3 base length, and the range is, for example, 1 to 10 base length, 1 to 5 base length, and 1 to 3 base length.

The total length of the sensor (ii) is not particularly limited, and the lower limit is, for example, 25 base length, 35 base length, 40 base length, and the upper limit is, for example, 200 base length, 120 base length, 80 The base length is, for example, 25 to 200 bases, 35 to 120 bases, 40 to 80 bases.

For example, one end of the sensor (ii) may be connected to the transistor.

In the nucleic acid sensor (ii), for example, the additional linker region may be further added to one end or both ends. The length of the additional linker region is not particularly limited, and for example, the above description can be used. In this case, for example, one end of the sensor (ii) may be connected to the transistor via the additional linker region.

2-3. Nucleic acid sensor (iii)
The sensor (iii) includes, for example, the three-dimensional formation region (D), the stem formation region (S _D ), the binding region (A), and the stem formation region (S _A ).
The stem forming region (S _D ) has a sequence complementary to the three-dimensional forming region (D),
The stem forming region (S _A ) is a single-stranded nucleic acid sensor having a sequence complementary to the binding region (A).

In the sensor (iii), the three-dimensional formation region (D) is, for example, the single-stranded type.

In the sensor (iii), for example, based on the following mechanism, the formation of the three-dimensional structure of the three-dimensional formation region (D) is controlled to be ON-OFF depending on the presence or absence of the steroid compound. In the Debye length range, the number of nucleotide residues constituting the sensor is estimated to increase. Note that the present invention is not limited to this mechanism. In the absence of the steroid compound, the sensor (iii) anneals the three-dimensional formation region (D) and the stem formation region (S _D ) in the molecule, so that the three-dimensional formation region (D) The formation of the three-dimensional structure is inhibited (switch-OFF). Further, in the molecule, the binding region (A) and the stem formation region (S _A ) are annealed, so that the binding region (A) has a more stable structure for binding to the steroid compound. Formation is blocked and the structure is not bonded to the steroid compound. On the other hand, in the presence of the steroid compound, the sensor (iii) causes the annealing of the binding region (A) and the stem formation region (S _A ) by the contact of the steroid compound with the binding region (A). When released, the structure of the binding region (A) changes to the stable structure. Accordingly, the annealing of the three-dimensional formation region (D) and the stem formation region (S _D ) is released, and the three-dimensional structure is formed in the region of the three-dimensional formation region (D) (switch-ON). . Further, when the binding region (A) is changed to the stable structure and the three-dimensional formation region (D) forms the three-dimensional structure, the sensor (iii) is, for example, on the transistor side. Shrink. Therefore, according to the sensor (iii), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively.

In the sensor (iii), the three-dimensional formation region (D) and the stem formation region (S _D ) are annealed in the molecule, and the binding region (A) and the stem formation are performed in the sensor (iii). The order of annealing with the region (S _A ) is sufficient. The following order can be illustrated as a specific example.
_{(1) 5'- A-S D} -D-S A -3 '
(2) 5'-S _A -DSD _D -A -3 '
_{(3) 5'- D-S A} -A-S D -3 '
(4) 5'-S _D -AS _A -D -3 '

In the forms (1) to (4), for example, the formation of a three-dimensional structure is turned on and off as follows. In the absence of the steroid compound, the binding region (A) and the stem formation region (S _A ), the three-dimensional formation region (D) and the stem formation region (S _D ) each form a stem, and the three-dimensional formation The formation of the three-dimensional structure in the region (D) is inhibited. Then, in the presence of the steroid compound, the formation of the respective stems is released by the contact of the steroid compound with the binding region (A), and the three-dimensional structure is formed in the three-dimensional formation region (D).

In the above (1) and (3), the stem forming region (S _D ) is complementary to the 3′-side region of the three-dimensional forming region (D), and the stem forming region (S _A ) It is preferably complementary to the 3 ′ region of the region (A). In the above (2) and (4), the stem formation region (S _D ) is complementary to the 5′-side region of the three-dimensional formation region (D), and the stem formation region (S _A ) It is preferably complementary to the 5 ′ region of the region (A).

The sensor (iii) may be connected directly or indirectly between the regions, for example. The direct connection means that, for example, the 3 ′ end of one region and the 5 ′ end of the other region are directly bonded, and the indirect connection is, for example, 3 of one region. It means that the “end” and the 5 ′ end of the other region are bound via the intervening linker region. The intervening linker region may be, for example, a nucleic acid sequence or a non-nucleic acid sequence, preferably the former.

The sensor (iii) preferably has, for example, two intervening linker regions that are non-complementary to each other as the intervening linker region. The positions of the two intervening linker regions are not particularly limited.

As a specific example, for example, the following order can be exemplified for the forms (1) to (4) further having two intervening linker regions. In the following examples, the intervening linker region linked to the binding region (A) is indicated by (L ₁ ), and the intervening linker region linked to the stereogenic region (D) is indicated by (L ₂ ). The sensor (iii) may have, for example, both (L ₁ ) and (L ₂ ) as an intervening linker region, or may have only one of them.
_{(1 ') 5'- A-L} 1 -S D -D-L 2 -S A -3'
(2 ') 5'- S _A -L ₂ -DSD _D -L ₁ -A -3'
(3 ′) 5′-DL ₂ -S _A -AL ₁ -S _D -3 ′
_{(4 ') 5'- S D -L} 1 -A-S A -L 2 -D -3'

In the form (1 ′)-(4 ′), for example, the formation of the three-dimensional structure is turned on and off as follows. In the absence of the steroid compound, for example, the binding region (A) and the stem formation region (S _A ), the three-dimensional formation region (D) and the stem formation region (S _D ) each form a stem, Between the two stems, the intervening linker region (L ₁ ) and the intervening linker region (L ₂ ) form an internal loop to inhibit the formation of the three-dimensional structure of the three-dimensional formation region (D). Then, in the presence of the steroid compound, the formation of the respective stems is released by the contact of the steroid compound with the binding region (A), and a three-dimensional structure is formed in the three-dimensional formation region (D).

In the sensor (iii), the lengths of the stem formation region (S _A ) and the stem formation region (S _D ) are not particularly limited. The length of the stem formation region (S _A ) is, for example, 1 to 60 bases long, 1 to 10 bases long, or 1 to 7 bases long. The length of the stem formation region (S _D ) is, for example, 1 to 30 bases, 0 to 10 bases, 1 to 10 bases, 0 to 7 bases, or 1 to 7 bases. For example, the stem forming region (S _A ) and the stem forming region (S _D ) may have the same length, the former may be long, or the latter may be long.

The length of the sensor (iii) is not particularly limited. The length of the sensor (iii) is, for example, 40 to 120 bases long, 45 to 100 bases long, 50 to 80 bases long.

For example, one end of the sensor (iii) may be connected to the transistor.

As a specific example of the sensor (iii) that binds to cortisol, the sensor (iii) includes, for example, the following polynucleotide (c).

(C) polynucleotide (c2) comprising the nucleotide sequence of SEQ ID NO: 3 (c1), polynucleotide (c1), (c3) or (c3) below: (c1) In the nucleotide sequence of SEQ ID NO: 3, one or several bases It consists of a base sequence deleted, substituted, inserted and / or added, the region corresponding to the binding region (A) binds to cortisol, and the region corresponding to the stereogenic region (D) is the predetermined three-dimensional structure The region corresponding to the stem formation region (S _A ) is bonded (annealed) to the binding region (A), and the region corresponding to the stem formation region (S _D ) is the solid formation region (D). The polynucleotide (c3) that binds (anneals) to the nucleotide sequence of SEQ ID NO: 3 consists of a nucleotide sequence having at least 80% identity, and the region corresponding to the binding region (A) A region that binds to lutisol and that corresponds to the three-dimensional region (D) forms the predetermined three-dimensional structure, and a region that corresponds to the stem-forming region (S _A ) binds to the binding region (A) (annealing). polynucleotide, and said stem forming regions (S _D) corresponding to the region is bound (annealing) on the three-dimensional formation region (D)

The polynucleotide (c1) is a polynucleotide having the base sequence of SEQ ID NO: 3 below. In the base sequence of SEQ ID NO: 3 below, the base sequence indicated by the underline enclosed in parentheses is the stem-forming region (S _A ) and the intervening linker region from the 5 ′ end to the 3 ′ end, respectively ( L ₂ ), the three-dimensional formation region (D), the stem formation region (S _D ), the intervening linker region corresponds to (L ₁ ), and the binding region (A).
Single-stranded nucleic acid sensor (SEQ ID NO: 3): 5 '-[ ACCTCTG ] [ T ] [ GGGTGGGAGGGTCGGG ] [ CCC ] [ T ] [ CAGAGGTCTCTTTGCCCGTGAACTCTG ] -3'

In the polynucleotide (c2), “one or several” means, for example, that the polynucleotide (c2) has a region corresponding to the binding region (A) bound to cortisol, and the three-dimensional region (D ) Region corresponding to the stem formation region (S _A ), the region corresponding to the stem formation region (S _A ) is bonded to the binding region (A), and the region corresponding to the stem formation region (S _D ) May be in a range that binds to the three-dimensional formation region (D). The “1 or several” is, for example, 1 to 11, 1 to 6, 1 to 3, 1 or 2, or 1 in the base sequence of (c1).

In the polynucleotide of (c3), “identity” means, for example, that the polynucleotide of (c3) binds to cortisol in the region corresponding to the binding region (A), and the stereogenic region (D) The corresponding region forms the predetermined three-dimensional structure, the region corresponding to the stem forming region (S _A ) is bonded to the bonding region (A), and the region corresponding to the stem forming region (S _D ) is the What is necessary is just the range couple | bonded with a solid formation area | region (D). The “identity” is, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more.

In the nucleic acid sensor (iii), for example, the additional linker region may be further added to one end or both ends. The length of the additional linker region is not particularly limited, and for example, the above description can be used. In this case, for example, one end of the sensor (iii) may be connected to the transistor via the additional linker region.

2-4. Nucleic acid sensor (iv)
The sensor (iv) has, for example, the three-dimensional formation region (D) and the binding region (A),
The three-dimensional formation region (D) includes a first region (D1) and a second region (D2), and forms a three-dimensional structure with the first region (D1) and the second region (D2). Yes,
A single-stranded nucleic acid sensor having the first region (D1) on one end side of the binding region (A) and the second region (D2) on the other end side of the binding region (A) It is.

In the sensor (iv), the three-dimensional formation region (D) is, for example, the double-stranded type (hereinafter also referred to as “split type”). The split-type three-dimensional formation region (D) is a molecule that includes the first region (D1) and the second region (D2), and the pair forms a three-dimensional structure. In the sensor (iv), the first region (D1) and the second region (D2) may each be a sequence that forms the three-dimensional structure, and more preferably a guanine quadruplex structure. Is an array.

In the sensor (iv), for example, on the basis of the following mechanism, the formation of the three-dimensional structure of the three-dimensional formation region (D) is controlled to be ON-OFF depending on the presence or absence of the steroid compound. In the Debye length range, the number of nucleotide residues constituting the sensor is estimated to increase. Note that the present invention is not limited to this mechanism. As described above, the sensor (iv) includes a pair of the first region (D1) and the second region (D2) that form a three-dimensional structure via the coupling region (A). Are located apart. Thus, since the first region (D1) and the second region (D2) are arranged at a distance, in the absence of the steroid compound, the first region (D1) and the second region (D2). The formation of a three-dimensional structure is inhibited between the region (D2) (switch-OFF). On the other hand, in the sensor (iv), in the presence of the steroid compound, the structure of the binding region (A) has a stem-loop structure due to the contact of the steroid compound with the binding region (A). Changes to a more stable structure for bonding with. With the structural change of the coupling region (A), the first region (D1) and the second region (D2) approach each other, and the first region (D1) and the second region (D2) A three-dimensional structure is formed between them (switch-ON). In addition, the bonding region (A) changes to the stable structure, and the three-dimensional formation region (D) forms the three-dimensional structure, so that the sensor (iv) is, for example, on the transistor side. Shrink. Therefore, according to the sensor (iv), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively.

As described above, the sensor (iv) uses a double-stranded type as the three-dimensional formation region (D), and the first region (D1) and the second region via the binding region (A). Region (D2) is arranged. For this reason, for example, it is not necessary to set conditions for each type of aptamer, and since a desired aptamer can be set as the binding region (A), the versatility is excellent.

In the sensor (iv), the first region (D1) and the second region (D2) may be arranged via the coupling region (A), and any one of the five of the coupling regions (A). It may be arranged on the 'side or 3' side. Hereinafter, unless otherwise specified, for convenience, the first region (D1) is disposed on the 5 ′ side of the coupling region (A), and the second region (D2) is disposed on the 3 ′ side of the coupling region (A). An example is shown.

In the sensor (iv), for example, the first region (D1) and the binding region (A) may be directly or indirectly connected, or the second region (D2) and the The binding region (A) may be connected directly or indirectly. The direct connection means that, for example, the 3 ′ end of one region and the 5 ′ end of the other region are directly bonded, and the indirect connection is, for example, 3 of one region. Means that the 'terminal and the 5' end of the other region are linked via the intervening linker region; specifically, the 3 'end of one region and the 5' end of the intervening linker region Means that the 3 ′ end of the intervening linker region and the 5 ′ end of the other region are directly bound. The intervening linker region may be, for example, a nucleic acid sequence or a non-nucleic acid sequence, preferably the former.

As described above, the sensor (iv) includes the intervening linker region (first linker region (L ₁ )) between the first region (D1) and the binding region (A). It is preferable that the intervening linker region (second linker region (L ₂ )) is provided between two regions (D2) and the binding region (A). The first linker region (L ₁ ) and the second linker region (L ₂ ) may be either one or preferably both. When both the first linker region (L ₁ ) and the second linker region (L ₂ ) are included, the respective lengths may be the same or different.

The length of the linker region is not particularly limited, and the lower limit is, for example, 1, 3, 5, 7, 9 bases, and the upper limit is, for example, 20, 15, 10 bases.

The base sequence from the 5 ′ side of the first linker region (L ₁ ) and the base sequence from the 3 ′ side of the second linker region (L ₂ ) may be non-complementary to each other, for example. preferable. In this case, the base sequence from the 5 ′ side of the first linker region (L ₁ ) and the base sequence from the 3 ′ side of the second linker region (L ₂ ) are aligned, and the sensor (iv) It can also be said that the region forms an internal loop in the molecule. Thus, the first linker region (L ₁ ) and the second linker region that are non-complementary between the first region (D1) and the second region (D2) and the binding region (A). By having (L ₂ ), for example, the distance between the first region (D1) and the second region (D2) can be sufficiently maintained. For this reason, for example, in the absence of the steroid compound, the formation of the three-dimensional structure by the first region (D1) and the second region (D2) is sufficiently suppressed, and in the absence of the steroid compound, The background based on the formation of the three-dimensional structure can be sufficiently reduced.

When the sensor (iv) is represented by, for example, “D1-W-D2” and has only the first linker region (L ₁ ) as the intervening linker region, W in the formula is, for example, 5 ′ From the side, when having the first linker region (L ₁ ) and the binding region (A) in this order and having only the second linker region (L ₂ ), W in the formula is, for example, 5 ′ From the side, having the binding region (A) and the second linker region (L ₂ ) in this order, and having both the first linker region (L ₁ ) and the second linker region (L ₂ ) W in the formula has, for example, the first linker region (L ₁ ), the binding region (A), and the second linker region (L ₂ ) in this order from the 5 ′ side. In this case, the sensor represented by D1-W-D2 (iv), respectively, for _{example, D1-L 1 -A-D2} , D1-A-L 2 -D2 or _{_{D1-L 1 -A-L 2}} - It can be expressed as D2.

The sensor (iv) includes, for example, a sequence in which the first region (D1) and the second region (D2) are complementary to each other at the end opposite to the position of the binding region (A). It is preferable to have. Specifically, for example, when the first region (D1) is disposed on the 5 ′ side of the coupling region (A), the first region (D1) and the second region (D2) are: It is preferable that the 5 ′ end of the first region (D1) and the 3 ′ end of the second region (D2) have sequences complementary to each other. For example, when the first region (D1) is disposed on the 3 ′ side of the coupling region (A), the first region (D1) and the second region (D2) are the first region (D1). The 3 ′ end of the region (D1) and the 5 ′ end of the second region (D2) preferably have complementary sequences. Thus, since the first region (D1) and the second region (D2) have the complementary sequences at their respective ends, a stem structure can be formed between the sequences by intramolecular annealing. It becomes possible. Therefore, for example, in the presence of the steroid compound, when the first region (D1) and the second region (D2) approach each other due to the structural change of the binding region (A) due to contact with the steroid compound, Formation of a stem structure between the arrays facilitates formation of a three-dimensional structure of the first region (D1) and the second region (D2).

For example, as described above, the sensor (iv) can be represented by D1-W-D2, and specifically can be represented by the following formula (3).

In the formula (3),
5 'side sequence _{(N) n1 -GGG- (N)} n2 - (N) n3 - is the sequence of the first region (D1) (d1),
3 ′ sequence-(N) _m3- (N) _m2 -GGG- (N) _m1 is the sequence (d2) of the second region (D2),
W is a region between the first region (D1) and the second region (D2), including the coupling region (A),
N represents a base, and n1, n2, and n3, and m1, m2, and m3 represent the number of repetitions of the base N, respectively.

Formula (3) shows a state in which the first region (D1) and the second region (D2) are aligned in the molecule in the sensor (iv), which is the first region (D1). And the second region (D2) in the present invention, the first region (D1) and the second region (D2) take this state in the present invention It is not intended to limit.

In the arrangement (d1) of the first region (D1) and the arrangement (d2) of the second region (D2), for example, (N) _n1 and (N) _m1 satisfy the following condition (1): N) _n2 and (N) _m2 preferably satisfy the following condition (2), and (N) _n3 and (N) _m3 preferably satisfy the following condition (3).

Condition (1)
In (N) _n1 and (N) _m1 , the base sequence from the 5 ′ side of (N) _n1 and the base sequence from the 3 ′ side of (N) _m1 are complementary to each other, and n1 and m1 are The same 0 or a positive integer.
Condition (2)
In (N) _n2 and (N) _m2 , the base sequence from the 5 ′ side of (N) _n2 and the base sequence from the 3 ′ side of (N) _m2 are non-complementary to each other, and n2 and m2 are Are positive integers, which may be the same or different.
Condition (3)
(N) _n3 and (N) _m3 are those in which n3 and m3 are 3 or 4, respectively, and may be the same or different, have three bases G, and when n3 or m3 is 4, (N) _{In n3} and (N) _m3 , the second or third base is a base H other than G.

The condition (1) is a condition of (N) _n1 at the 5 ′ end and (N) _m1 at the 3 ′ end when the first region (D1) and the second region (D2) are aligned. . In the condition (1), the base sequence from the 5 ′ side of the (N) _n1 and the base sequence from the 3 ′ side of the (N) _m1 are complementary to each other and have the same length. Since (N) _n1 and (N) _m1 are complementary sequences of the same length, they can be said to be stem regions that form stems in an aligned state.

N1 and m1 may be the same 0 or a positive integer, and are, for example, 0, 1 to 10, and preferably 1, 2, or 3, respectively.

The condition (2) is a condition of (N) _n2 and (N) _m2 when the first region (D1) and the second region (D2) are aligned. In the condition (2), the base sequence of (N) _{n2 and} the base sequence of (N) _m2 are non-complementary to each other, and n2 and m2 may have the same length or different lengths. Since (N) _n2 and (N) _m2 are non-complementary sequences, they can be said to be regions that form an inner loop in an aligned state.

N2 and m2 are positive integers, for example, 1 to 10 respectively, preferably 1 or 2. n2 and m2 may be the same or different. For example, n2 = m2, n2> m2, and n2 <m2, and preferably n2> m2 and n2 <m2.

The condition (3) is a condition of (N) _n3 and (N) _m3 when the first region (D1) and the second region (D2) are aligned. In the condition (3), the base sequence of (N) _{n3 and} the base sequence of (N) _m3 are 3 or 4 base length sequences having 3 bases G, and the same or different May be. When n3 or m3 is 4, (N) _n3 and (N) _m3 are bases H other than G in the second or third base. (N) _n3 and (N) _m3 with three Gs together with GGG between (N) _n1 and (N) _n2 and GGG between (N) _m1 and (N) _m2 G formation region (G) forming the structure.

N3 and m3 may be any of n3 = m3, n3> m3, and n3 <m3, and preferably n3> m3 and n3 <m3.

Examples of the base H that is a base other than G include A, C, T, and U, and preferably A, C, or T.

Specific examples of the condition (3) include the following conditions (3-1), (3-2), and (3-3).
Condition (3-1)
Among (N) _n3 and (N) _m3 , the sequence from one 5 ′ side is GHGG, and the sequence from the other 5 ′ side is GGG.
Condition (3-2)
Among (N) _n3 and (N) _m3 , the sequence from one 5 ′ side is GGHG, and the sequence from the other 5 ′ side is GGG.
Condition (3-3)
Both (N) _n3 and (N) _m3 sequences are GGG.

The length of the first region (D1) is not particularly limited, and the lower limit is, for example, 7 base length, 8 base length, 10 base length, and the upper limit is, for example, 30 base length, 20 base length, 10 The base length is, for example, 7 to 30 bases, 7 to 20 bases, or 7 to 10 bases. The length of the second region (D2) is not particularly limited, and the lower limit thereof is, for example, 7 base length, 8 base length, 10 base length, and the upper limit thereof is, for example, 30 base length, 20 base length. The range is, for example, 7 to 30 bases, 7 to 20 bases, or 7 to 10 bases. The lengths of the first region (D1) and the second region (D2) may be the same or different.

The length of the sensor (iv) is not particularly limited. The lower limit of the length of the sensor (iv) is, for example, 25 base length, 30 base length, 35 base length, and the upper limit is, for example, 200 base length, 100 base length, 80 base length, and its range Is, for example, 25 to 200 bases long, 30 to 100 bases long, 35 to 80 bases long.

For example, one end of the sensor (iv) may be connected to the transistor.

In the sensor (iv), for example, the additional linker region may be further added to one end or both ends. The length of the additional linker region is not particularly limited, and for example, the above description can be used. In this case, for example, one end of the sensor (iv) may be connected to the transistor via the additional linker region.

2-5. Nucleic acid sensor (v)
The sensor (v) has the three-dimensional formation region (D) and the binding region (A) in this order,
The three-dimensional formation region (D) and the binding region (A) are single-stranded nucleic acid sensors having sequences complementary to each other.

In the sensor (v), the three-dimensional formation region (D) is, for example, the single-stranded type.

In the sensor (v), for example, based on the following mechanism, the formation of the three-dimensional structure of the three-dimensional formation region (D) is controlled to ON-OFF depending on the presence or absence of the steroid compound. In the Debye length range, the number of nucleotide residues constituting the sensor is estimated to increase. Note that the present invention is not limited to this mechanism. In the absence of the steroid compound, the sensor (v) anneals the stereogenic region (D) and the binding region (A) in the molecule, whereby the stereogenic region (D) The formation of the three-dimensional structure is inhibited (switch-OFF). In addition, the binding region (A) and the three-dimensional formation region (D) are annealed in the molecule, so that the binding region (A) forms a more stable structure for binding to the steroid compound. Is blocked, and the structure in a state where it is not bonded to the steroid compound is maintained. On the other hand, in the sensor (v), in the presence of the steroid compound, the structure of the binding region (A) changes to the stable structure by the contact of the steroid compound with the binding region (A). Along with this, the annealing in the region between the three-dimensional formation region (D) and the bonding region (A) is canceled, and the three-dimensional structure is formed in the region of the three-dimensional formation region (D) (switch-ON). . In addition, the coupling region (A) changes to the stable structure, and the three-dimensional formation region (D) forms the three-dimensional structure, so that the sensor (v) is, for example, on the transistor side. Shrink. Therefore, according to the sensor (v), in the presence of the steroid compound, that is, when the three-dimensional structure is formed, the number of nucleotides of the Debye length is in the absence of the steroid compound, that is, the formation of the three-dimensional structure. Therefore, the steroid compound can be analyzed qualitatively or quantitatively.

In the sensor (v), the three-dimensional formation region (D) and the binding region (A) are an arrangement from the 5 ′ side of the three-dimensional formation region (D) and a 3 ′ side of the binding region (A). Preferably have sequences complementary to each other. The complementary sequence in the stereogenic region (D) and the complementary sequence in the binding region (A) can also be referred to as stem-forming regions (St), respectively, and the complementary sequence in the former stereogenic region (D) is The stem formation region (S _A ) for the binding region (A) and the complementary sequence in the latter binding region (A) can also be referred to as the stem formation region (S _D ) for the three-dimensional formation region (D). For example, a part of the three-dimensional formation region (D) is the complementary sequence, that is, the stem formation region (S _A ), and a part of the binding region (A) is, for example, the complementary sequence. That is, it is preferably the stem formation region (S _D ). The position of the complementary sequence in the three-dimensional region (D) and the position of the complementary sequence in the binding region (A) are not particularly limited.

In the sensor (v), the length of each complementary sequence between the three-dimensional region (D) and the binding region (A) is not particularly limited. The length of each complementary sequence is, for example, 1 to 30 bases long, 1 to 10 bases long, or 1 to 7 bases long.

In the sensor (v), for example, the three-dimensional formation region (D) and the binding region (A) may be directly or indirectly connected. The direct connection means that, for example, the 3 ′ end of one region and the 5 ′ end of the other region are directly bonded, and the indirect connection is, for example, 3 of one region. It means that the “end” and the 5 ′ end of the other region are bonded via a linker region.

Hereinafter, the linker region connecting the regions is also referred to as an intervening linker region. The intervening linker region may be, for example, a nucleic acid sequence or a non-nucleic acid sequence, preferably the former. The length of the intervening linker region is not particularly limited and is, for example, 0 to 20 bases long, 1 to 10 bases long, or 1 to 6 bases long.

The length of the sensor (v) is not particularly limited. The length of the sensor (v) is, for example, 40 to 120 bases, 45 to 100 bases, 50 to 80 bases.

For example, one end of the sensor (v) may be connected to the transistor.

In the sensor (v), for example, the additional linker region may be further added to one end or both ends. The length of the additional linker region is not particularly limited, and for example, the above description can be used. In this case, for example, one end of the sensor (v) may be connected to the transistor via the additional linker region.

In the present invention, the sensor is a molecule including a nucleotide residue, and may be, for example, a molecule consisting of only a nucleotide residue or a molecule including a nucleotide residue. The nucleotide is, for example, ribonucleotide, deoxyribonucleotide and derivatives thereof. Specifically, the sensor may be, for example, DNA containing deoxyribonucleotide and / or a derivative thereof, RNA containing ribonucleotide and / or a derivative thereof, or a chimera (DNA / RNA) containing the former and the latter But you can. The sensor is preferably DNA.

The nucleotide may contain, for example, either a natural base (non-artificial base) or a non-natural base (artificial base) as a base. Examples of the natural base include A, C, G, T, U, and modified bases thereof. Examples of the modification include methylation, fluorination, amination, and thiolation. Examples of the unnatural base include 2′-fluoropyrimidine, 2′-O-methylpyrimidine and the like. Specific examples include 2′-fluorouracil, 2′-aminouracil, 2′-O-methyluracil, And 2'-thiouracil. The nucleotide may be, for example, a modified nucleotide, and the modified nucleotide is, for example, a 2′-methylated-uracil nucleotide residue, 2′-methylated-cytosine nucleotide residue, 2′-fluorinated-uracil nucleotide. Residue, 2′-fluorinated-cytosine nucleotide residue, 2′-aminated-uracil nucleotide residue, 2′-aminated-cytosine nucleotide residue, 2′-thiolated-uracil nucleotide residue, 2′- Thio-cytosine nucleotide residues and the like. The sensor may include non-nucleotides such as PNA (peptide nucleic acid) and LNA (Locked Nucleic Acid), for example.

The sensor is disposed in the transistor. For example, the sensor may be fixed directly or indirectly to the transistor. In the former case, for example, the sensor is preferably fixed to the transistor at the end of the sensor. In the latter case, for example, the sensor may be fixed to the transistor via a fixing linker. The linker may be, for example, a nucleic acid sequence or a non-nucleic acid sequence, and examples thereof include the above-described additional linker region. When the sensor is fixed to the transistor, the arrangement portion of the sensor can also be referred to as a detection portion in the transistor. Examples of the non-nucleic acid sequence include sequences containing an alkyl group. As a specific example, the sensor is immobilized on the transistor via the non-nucleic acid sequence, for example, as shown below. In the following formula (4), _n in (CH ₂ ) n is, for example, 1 to 10, 2 to 10, or 6.
[Transistor] -NH- (CH ₂ ) _n- [Sensor] (4)

In the formula (4), one end [—NH] of the non-nucleic acid sequence forms a single bond with an aldehyde group in the transistor, for example. The other end [CH _2- ] of the non-nucleic acid sequence forms a single bond by an ester bond with phosphoric acid in the sensor, for example.

The immobilization method is not particularly limited, and examples thereof include chemical bonding. As a specific example, for example, there is a method in which streptavidin or avidin is bound to one of the transistor and the sensor, biotin is bound to the other, and immobilization is performed using the binding between the former and the latter. It is done. When the transistor has a structure in which Au (gold) is formed on an insulating film, a method of adding a thiol group to the sensor and immobilizing the sensor via the thiol group (T.TGoda and) Y. Miyahara, “Label-free and reagent-less protein biosensing using aptamer-modified extended-gate field-effect transistors”, Biosensors and Bioelectronics, vol.45, 15 July 2013, pp. 89-94).

As the immobilization method, for example, other known nucleic acid immobilization methods can be adopted. Examples of the method include a method using photolithography, and specific examples thereof can be referred to US Pat. No. 5,424,186. The immobilization method includes, for example, a method of synthesizing the sensor on the transistor. As this method, for example, a so-called spot method can be mentioned. As specific examples, US Pat. No. 5,807,522, Japanese Patent Publication No. 10-503841 and the like can be referred to.

In the present invention, the transistor is not particularly limited, and examples thereof include a transistor capable of detecting a change in charge in the Debye length range, and a specific example thereof is a field effect transistor. As the field effect transistor, for example, a known field effect transistor can be used, and specific examples thereof include JP 2011-247795 A and International Publication No. 2014/024598.

In the present invention, the transistor includes, for example, a substrate, a source electrode, a drain electrode, a reference electrode, and a detection unit, and the source electrode, the drain electrode, and the detection unit are disposed on the substrate, and the detection The unit is disposed between the source electrode and the drain electrode, and the nucleic acid sensor is disposed in the detection unit. For example, when the steroid compound in the sample is detected, the reference electrode is disposed in a solution containing an electrolyte (for example, a sample containing the electrolyte) that comes into contact with the detection unit. For example, the reference electrode is disposed so as not to contact the source electrode and the drain electrode.

The substrate, the source electrode, the drain electrode, and the like can refer to the configuration of the above-described known field effect transistor. The transistor may include other configurations such as a gate electrode and an insulating film layer, for example, depending on the type of the field effect transistor. For the other configuration, for example, the configuration of the aforementioned known field effect transistor can be referred to.

The device of the present invention may include, for example, a plurality of transistors. In this case, it is preferable that each transistor includes a detection unit as described above, for example. In the device of the present invention, the number of sensors arranged in one detection unit is not particularly limited.

In the present invention, the Debye length means a Debye length of a solution (for example, an electrolyte solution) containing an electrolyte in contact with the transistor, and more specifically, a sample (for example, an electrolyte in contact with the detection unit of the transistor). Debye length of a sample including The Debye length is not particularly limited, and can be calculated by a general Debye length calculation formula. For example, the Debye length can be calculated by the following formula (5).

δ = (εε ₀ kT / 2q2I) ^1/2 (5)
δ: Debye length ε: Dielectric constant ε ₀ : Dielectric constant of vacuum k: Boltzmann constant T: Absolute temperature q: Charge I: Ionic strength

The method for using the detection device of the present invention is not particularly limited, and can be used for the method for detecting a steroid-containing compound of the present invention as follows.

<Method for detecting steroid-containing compound>
As described above, the method for detecting a steroid-containing compound of the present invention comprises a contacting step of bringing a sample into contact with the detection device of the present invention, and the number of nucleotide residues constituting a nucleic acid sensor within the Debye length range of the detection device. A detection step of detecting a steroid-containing compound in the sample by detecting an increase or a decrease in. The detection method of the present invention is characterized by using the detection device of the present invention, and other configurations and conditions are not particularly limited. For the detection method of the present invention, for example, the description of the detection device of the present invention can be used. In the detection method of the present invention, the detection may be detection of the presence or absence of a steroid compound (for example, qualitative analysis) or detection of the amount of the steroid compound (for example, quantitative analysis). it can.

The sample is not particularly limited. The sample may be, for example, either a sample containing the steroid compound or a sample in which it is unknown whether the steroid compound is contained. The sample is preferably a liquid sample, for example. For example, when the analyte is a liquid, the analyte may be used as it is as a sample, or a diluted solution mixed in a solvent may be used as a sample. When the analyte is, for example, a solid or a powder, a mixed solution mixed with a solvent, a suspension suspended in a solvent, or the like may be used as a sample. The solvent is not particularly limited, and examples thereof include water and a buffer solution. Examples of the specimen include specimens collected from living organisms, soil, seawater, river water, sewage, food and drink, purified water, air, and the like. The sample is preferably, for example, a liquid containing an electrolyte, that is, an electrolyte solution. In this case, the sample can also be referred to as a sample containing an electrolyte. When the sample does not contain the electrolyte, it is preferable that the electrolyte is added to the sample. The electrolyte is not particularly limited as long as it is a substance that separates into cations and anions in the liquid.

The contact step is a step of bringing a sample into contact with the detection device of the present invention. The contact can be performed, for example, by bringing the sample into contact with the transistor in the detection device, and specifically, by bringing the sample into contact with a detection unit of the transistor. The contact conditions (temperature, time) and the like in the contact step are not particularly limited.

When the detection device includes the reagent, the contact step may be performed, for example, by bringing the sample and the reagent into contact with the detection device, or by mixing the sample and the reagent in advance. The mixture may be contacted. In the latter case, the detection method of the present invention includes, for example, a mixing step of mixing the sample and the reagent, and a contacting step of bringing the mixture obtained into contact with the detection device. The mixing is not particularly limited and can be performed by a known mixing method, for example, by bringing the reagent into contact with the sample. The mixing conditions (temperature, time) and the like in the mixing step are not particularly limited. Examples of the reagent include a reagent containing the first strand (ss1) or the second strand (ss2).

The detection step detects a steroid compound in the sample by detecting an increase or decrease in the number of nucleotide residues constituting the nucleic acid sensor in the range of the Debye length of the detection device. In the presence of the steroid compound, that is, in the formation of the three-dimensional structure, the sensor increases or decreases the number of nucleotides of the Debye length as described above. Moreover, the nucleotide residue constituting the sensor has, for example, a negative charge. For this reason, in the presence of the steroid compound, the charge in the Debye length range is increased or decreased as compared to the absence of the steroid compound. Therefore, the detection step includes, for example, using the detection device to detect an increase or decrease in charge in the Debye length range, thereby increasing or decreasing the number of nucleotides in the Debye length, that is, a steroid in the sample. Compounds can be detected. Therefore, the detection step includes, for example, a charge measurement step of measuring a charge in a Debye length range of the detection device using the detection device, and the Debye length based on the charge (measurement charge) and a reference charge. A steroid compound detection step of detecting an increase or decrease in the number of nucleotide residues in a range and detecting the steroid compound.

In the measurement step, the charge is measured by, for example, measuring an electric signal. The electrical signal can be measured by, for example, a transistor of the detection device. Examples of the electrical signal include a voltage and a current. Specific examples thereof include a voltage at the gate electrode (gate voltage), a current value at the drain electrode (drain current), and the like. When measuring the voltage at the gate electrode, the current value at the drain electrode is preferably fixed. When measuring the current value at the drain electrode, it is preferable to fix the voltage at the gate electrode. The voltage at the gate electrode is, for example, a voltage when the current value at the drain electrode is 10 to 100 μA.

In the steroid compound detection step, examples of the reference charge include charges in the Debye length range in the absence of the steroid compound. Then, by detecting whether the measured charge is increased or decreased compared to the reference charge, for example, the presence or absence of a steroid compound in the sample can be analyzed (qualitative), and the reference charge and the By detecting the difference in charge from the measured charge, for example, the amount of the steroid compound in the sample can be analyzed (quantified). Specifically, when the number of nucleotide residues in the Debye length increases due to the presence of the steroid compound, when the charge is significantly lower than the reference charge, the presence of the steroid compound can be analyzed, and the reference charge and If it is the same or significantly higher than the reference charge, it can be analyzed without the steroid compound. When the number of nucleotide residues in the Debye length decreases due to the presence of the steroid compound, if the charge is significantly higher than the reference charge, the presence of the steroid compound can be analyzed and is the same as the reference charge, or the If it is significantly lower than the reference charge, it can be analyzed that there is no steroid compound.

In the steroid compound detection step, the reference charge may be a calibration curve indicating a correlation between the amount of the steroid compound and the measured charge. In this case, in the steroid compound detection step, for example, the amount of the steroid compound in the sample can be calculated based on the measured charge.

Next, examples of the present invention will be described. However, the present invention is not limited by the following examples. Commercial reagents were used based on those protocols unless otherwise indicated.

[Example 1]
It was confirmed that the steroid compound could be detected by the detection device of the present invention.

(1) Production of Detection Device As the double-stranded nucleic acid sensor (nucleic acid sensor (I)), a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 (first strand) and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 ( Second strand). In addition, a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3 was synthesized as the single nucleic acid sensor (sensor (iii)). Next, on the gate insulating film such as SiO ₂ or Si ₃ N _{4 in} an ion sensitive transistor ISFET (see P. Bergfeld, “ISFET, Theory and Practice,” IEEE Sensor Conference Toronto, October 2003) Organic monolayer was formed by self-organization method. With respect to the amino group of the organic monomolecular film, phosphoric acid in the first-strand and single-stranded nucleic acid sensors and the C-terminus via glutaraldehyde OHC (CH ₂ ) ₃ CHO which is an amine-reactive cross-linking agent A single bond was made with the amino terminus of the non-nucleic acid sequence represented by the above formula (4), which was ester-linked with. In the formula (4), n is 6.

(2) Detection of Cortisol For the detection device on which the single-stranded nucleic acid sensor was immobilized, cortisol was detected as follows. 500 μL of 0.04 × PB3 aqueous solution (hereinafter also referred to as “buffer”) was dropped into the detection device on which the single-stranded nucleic acid sensor obtained in Example (1) was immobilized, and Vg ( Gate voltage) -ID (drain current) characteristics were measured, and Vg (Vg ₀ ) at a drain current of 100 μA was measured. The composition of the buffer was 5.558328 mmol / L KCl, 0.0588 mmol / L KH ₂ PO ₄ and 0.32408 mmol / L K ₂ HPO ₄ . The conditions for measuring the Vg-ID characteristics were as follows.

(Vg-ID characteristics measurement conditions)
Gate voltage: -3V to + 0.5V
Drain voltage: +0.1 to + 6.0V
Drain current: 100 μA

Next, the buffer was removed, and 20 μL of a sample containing cortisol at a predetermined concentration (10, 50, 100, or 1000 μmol / L) was dropped onto the detection device, and incubated at room temperature (about 25 ° C.) for 30 minutes. The sample was a phosphate buffer solution (PBS) containing the predetermined concentration of cortisol. After the incubation, the PBS containing the cortisol was removed, and the detection device was washed 3 times with 1 mL of PBS. Further, the detection device was washed 3 times with 1 mL of the buffer.

Then, it was added dropwise the buffer of 500μL to the detection device, in the same manner as Vg-ID characteristic measurement described above was measured Vg (Vg _s). Then, to calculate the difference _(Vg s -Vg ₀ = _ΔVg) of the Vg _s and Vg ₀ for each sample.

The double-stranded nucleic acid sensor is prepared by mixing 10 μL of a solution containing 10 μmol / L of the first strand and 10 μL of a solution containing 10 μmol / L of the second strand, and using the obtained mixed solution as the buffer. The mixture was added, incubated at 95 ° C. for 5 minutes, allowed to stand at room temperature for 55 minutes, and slowly returned to room temperature to form a double strand. Then, ΔVg was calculated in the same manner as the single-stranded sensor except that the nucleic acid sensor after the double-stranded formation was immobilized on the ion-sensitive transistor ISFET as described above. These results are shown in FIGS.

FIG. 3 is a graph showing ΔVg when the single-stranded sensor is used. In FIG. 3, the horizontal axis indicates the concentration of cortisol, and the vertical axis indicates ΔVg. As shown in FIG. 3, ΔVg increased with increasing cortisol concentration. That is, it was found that the concentration of cortisol can be measured based on ΔVg.

FIG. 4 is a graph showing ΔVg when the double-stranded sensor is used. In FIG. 4, the horizontal axis indicates the concentration of cortisol, and the vertical axis indicates ΔVg. As shown in FIG. 4, ΔVg decreased with increasing cortisol concentration. That is, it was found that the concentration of cortisol can be measured based on ΔVg.

From the above results, it was found that the detection device of the present invention can detect a steroid compound containing cortisol.

As mentioned above, although this invention was demonstrated with reference to embodiment and an Example, this invention is not limited to the said embodiment and Example. Various changes that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

This application claims priority based on Japanese Patent Application No. 2017-61808 filed on Mar. 27, 2017, the entire disclosure of which is incorporated herein.

<Appendix>
A part or all of the above embodiments and examples can be described as, but not limited to, the following supplementary notes (Appendix 1)
Including a transistor in which a nucleic acid sensor for detecting a steroid skeleton-containing compound is disposed;
The nucleic acid sensor is
A stereogenic region (D) that forms a predetermined stereostructure and a binding region (A) that binds to the steroid skeleton-containing compound;
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure,
In the presence of the steroid skeleton-containing compound, by the contact of the steroid skeleton-containing compound with the binding region (A), the three-dimensional formation region (D) forms the three-dimensional structure,
During the formation of the three-dimensional structure,
The steroid skeleton-containing compound is present in a solution containing an electrolyte,
A device for detecting a steroid skeleton-containing compound, wherein the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range of the solution is increased or decreased as compared with the inhibition of the formation of the three-dimensional structure.
(Appendix 2)
The transistor includes a substrate, a source electrode, a drain electrode, a reference electrode, and a detection unit,
The source electrode, the drain electrode, and the detection unit are disposed on the substrate,
The detection unit is disposed between the source electrode and the drain electrode,
The detection device according to appendix 1, wherein the nucleic acid sensor is disposed in the detection unit.
(Appendix 3)
The detection device according to appendix 1 or 2, wherein the transistor is a transistor capable of detecting a change in charge in the Debye length range.
(Appendix 4)
The detection device according to any one of appendices 1 to 3, wherein the nucleic acid sensor is a nucleic acid sensor of the following (I).
(I) a double-stranded nucleic acid sensor composed of a first strand (ss1) and a second strand (ss2);
The first strand (ss1) has the three-dimensional region (D) and the binding region (A) in this order,
The second strand (ss2) has a stem forming region (S _D ) and a stem forming region (S _A ) in this order,
The stem forming region (S _D ) has a sequence complementary to the three-dimensional forming region (D),
The stem forming region (S _A ) has a sequence complementary to the binding region (A),
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure and hybridizes with the second chain (ss2),
In the presence of the steroid skeleton-containing compound, the three-dimensional formation region (D) forms the three-dimensional structure by contacting the steroid skeleton-containing compound with the binding region (A) of the first chain (ss1), and Dissociates from the second strand (ss2),
During the formation of the three-dimensional structure,
A double-stranded nucleic acid sensor in which the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range is smaller than that in the inhibition of formation of the three-dimensional structure.
(Appendix 5)
In the nucleic acid sensor of (I), one of the first strand (ss1) and the second strand (ss2) is disposed in the transistor,
The detection device according to appendix 4, comprising the other chain as a reagent.
(Appendix 6)
The first strand (ss1) includes the following polynucleotide (a):
The detection device according to appendix 4 or 5, wherein the second strand (ss2) includes a polynucleotide of the following (b).
(A) polynucleotide (a1) below (a1) polynucleotide consisting of the base sequence of SEQ ID NO: 1 (b) polynucleotide (b1) below (b1) polynucleotide consisting of the base sequence of SEQ ID NO: 2 (Appendix 7)
The detection device according to any one of appendices 1 to 3, wherein the nucleic acid sensor is a nucleic acid sensor of the following (II).
(II) a single-stranded nucleic acid sensor having the three-dimensional formation region (D) and the binding region (A),
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure,
In the presence of the steroid skeleton-containing compound, by the contact of the steroid skeleton-containing compound with the binding region (A), the three-dimensional formation region (D) forms the three-dimensional structure,
During the formation of the three-dimensional structure,
A single-stranded nucleic acid sensor, wherein the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range is greater than that at the time of inhibiting the formation of the three-dimensional structure.
(Appendix 8)
The detection device according to appendix 7, wherein the nucleic acid sensor (II) is at least one nucleic acid sensor selected from the group consisting of the following (i) to (iv) and (v).
(I) having the three-dimensional formation region (D), the blocking region (B), and the binding region (A) in this order;
The blocking region (B) is complementary to a partial region (Dp) in the three-dimensional region (D);
A terminal region (Ab) on the blocking region (B) side in the binding region (A) is complementary to a region (Df) adjacent to the partial region (Dp) in the three-dimensional formation region (D), and A single-stranded nucleic acid sensor which is complementary to a terminal region (Af) opposite to the blocking region (B) in the binding region (A).
(Ii) having the three-dimensional formation region (D), the blocking region (B), the binding region (A), and the stabilization region (S) in this order;
The blocking region (B) is complementary to a partial region (Dp) of the three-dimensional formation region (D);
A single-stranded nucleic acid sensor, wherein a terminal region (Ba) on the binding region (A) side of the blocking region (B) is complementary to the stabilization region (S).
(Iii) having the three-dimensional formation region (D), the stem formation region (S _D ), the binding region (A), and the stem formation region (S _A ),
The stem forming region (S _D ) has a sequence complementary to the three-dimensional forming region (D),
The stem-forming region (S _A ) is a single-stranded nucleic acid sensor having a sequence complementary to the binding region (A).
(Iv) having the three-dimensional formation region (D) and the binding region (A);
The three-dimensional formation region (D) includes a first region (D1) and a second region (D2), and forms a three-dimensional structure with the first region (D1) and the second region (D2). Yes,
A single-stranded nucleic acid sensor having the first region (D1) on one end side of the binding region (A) and the second region (D2) on the other end side of the binding region (A) .
(V) having the three-dimensional formation region (D) and the binding region (A) in this order;
The single-stranded nucleic acid sensor in which the three-dimensional region (D) and the binding region (A) have complementary sequences.
(Appendix 9)
In the above-mentioned (i) or (ii) single-stranded nucleic acid sensor,
The detection device according to supplementary note 8, including the three-dimensional formation region (D), the blocking region (B), and the binding region (A) in this order from the 5 ′ side.
(Appendix 10)
In the single-stranded nucleic acid sensor (iii),
As the stem formation region (St), it has a stem formation region (S _D ) and a stem formation region (S _A ),
The three-dimensional formation region (D) and the stem formation region (S _D ) have mutually complementary sequences,
The detection device according to appendix 8, wherein the binding region (A) and the stem formation region (S _A ) include sequences complementary to each other.
(Appendix 11)
In the single-stranded nucleic acid sensor of (iii), the three-dimensional formation region (D), the stem formation region (S _D ), the binding region (A), and the stem formation region (S _A ) are the following (1 ), (2), (3) or the detection device according to appendix 8, which is linked in the order (4).
(1) Order of the binding region (A), the stem formation region (S _D ), the solid formation region (D), and the stem formation region (S _A ) (2) The stem formation region (S _A ), Order of the three-dimensional formation region (D), the stem formation region (S _D ), and the binding region (A) (3) The three-dimensional formation region (D), the stem formation region (S _A ), the binding region (A) And order of the stem formation region (S _D ) (4) order of the stem formation region (S _D ), the binding region (A), the stem formation region (S _A ), and the three-dimensional formation region (D) (Notes) 12)
The detection device according to appendix 11, wherein the single-stranded nucleic acid sensor (iii) includes a polynucleotide (c) below.
(C) a polynucleotide of the following (c1) (c1) a polynucleotide comprising the base sequence of SEQ ID NO: 3 (Appendix 13)
In the single-stranded nucleic acid sensor (iv),
The first region (D1) and the second region (D2) are:
The detection device according to appendix 8, wherein the detection devices each include a sequence complementary to each other at the end opposite to the position of the binding region (A).
(Appendix 14)
In the (v) single-stranded nucleic acid sensor,
The detection device according to appendix 8, wherein the sequence from the 5 'side of the three-dimensional formation region (D) and the sequence from the 3' side of the binding region (A) have complementary sequences to each other.
(Appendix 15)
The three-dimensional formation region (D) is a G formation region (G) forming a G-quartet structure,
15. The detection device according to any one of appendices 1 to 14, wherein the three-dimensional structure is a G-quartet structure.
(Appendix 16)
The detection device according to any one of appendices 1 to 15, having a linker region between the three-dimensional formation region (D) and the binding region (A).
(Appendix 17)
The detection device according to any one of appendices 1 to 16, wherein the nucleic acid sensor is connected to the transistor via a linker region.
(Appendix 18)
A contact step of bringing a sample into contact with the detection device according to any one of appendices 1 to 17, and detecting an increase or decrease in the number of nucleotide residues constituting the nucleic acid sensor in the range of the Debye length of the detection device The detection method of detecting the steroid frame | skeleton containing compound in the said sample is included, The detection method of the steroid frame | skeleton containing compound characterized by the above-mentioned.
(Appendix 19)
Using the detection device described in Appendix 5,
A mixing step of mixing the sample and the reagent;
Contacting the resulting mixture with the detection device, and detecting the increase or decrease in the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range of the detection device, thereby the steroid in the sample The detection method according to appendix 18, including a detection step of detecting a skeleton-containing compound.
(Appendix 20)
The detection step comprises
A charge measuring step of measuring a charge in a debye length range of the detection device by the detection device;
Supplementary note 18 or 19, comprising detecting an increase or decrease in the number of the nucleotide residues in the Debye length range based on the charge and the reference charge, and detecting the steroid skeleton-containing compound. The detection method described.
(Appendix 21)
The detection method according to appendix 20, wherein the charge measurement is an electric signal measurement.
(Appendix 22)
The detection method according to appendix 21, wherein the electrical signal is at least one of voltage and current.

According to the detection device of the present invention, a steroid skeleton-containing compound containing cortisol can be detected. For this reason, the present invention can be said to be an extremely useful technique for research and examination in various fields such as clinical medicine, food, and environment.

Claims

Including a transistor in which a nucleic acid sensor for detecting a steroid skeleton-containing compound is disposed;
The nucleic acid sensor is
A stereogenic region (D) that forms a predetermined stereostructure and a binding region (A) that binds to the steroid skeleton-containing compound;
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure,
In the presence of the steroid skeleton-containing compound, by the contact of the steroid skeleton-containing compound with the binding region (A), the three-dimensional formation region (D) forms the three-dimensional structure,
During the formation of the three-dimensional structure,
The steroid skeleton-containing compound is present in a solution containing an electrolyte,
A device for detecting a steroid skeleton-containing compound, wherein the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range of the solution is increased or decreased as compared with the inhibition of the formation of the three-dimensional structure.
The transistor includes a substrate, a source electrode, a drain electrode, a reference electrode, and a detection unit,
The source electrode, the drain electrode, and the detection unit are disposed on the substrate,
The detection unit is disposed between the source electrode and the drain electrode,
The detection device according to claim 1, wherein the nucleic acid sensor is disposed in the detection unit.
The detection device according to claim 1, wherein the transistor is a transistor capable of detecting a change in charge in the Debye length range.
The detection device according to any one of claims 1 to 3, wherein the nucleic acid sensor is the following nucleic acid sensor (I).
(I) a double-stranded nucleic acid sensor composed of a first strand (ss1) and a second strand (ss2);
The first strand (ss1) has the three-dimensional region (D) and the binding region (A) in this order,
The second strand (ss2) has a stem forming region (S D ) and a stem forming region (S A ) in this order,
The stem forming region (S D ) has a sequence complementary to the three-dimensional forming region (D),
The stem forming region (S A ) has a sequence complementary to the binding region (A),
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure and hybridizes with the second chain (ss2),
In the presence of the steroid skeleton-containing compound, the three-dimensional formation region (D) forms the three-dimensional structure by contacting the steroid skeleton-containing compound with the binding region (A) of the first chain (ss1), and Dissociates from the second strand (ss2),
During the formation of the three-dimensional structure,
A double-stranded nucleic acid sensor in which the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range is smaller than that in the inhibition of formation of the three-dimensional structure.
In the nucleic acid sensor of (I), one of the first strand (ss1) and the second strand (ss2) is disposed in the transistor,
The detection device according to claim 4, comprising the other chain as a reagent.
The first strand (ss1) includes the following polynucleotide (a):
The detection device according to claim 4 or 5, wherein the second strand (ss2) comprises a polynucleotide of the following (b).
(A) a polynucleotide of (a1) below (a1) a polynucleotide comprising the base sequence of SEQ ID NO: 1 (b) a polynucleotide of (b1) below (b1) a polynucleotide comprising the base sequence of SEQ ID NO: 2
The detection device according to any one of claims 1 to 3, wherein the nucleic acid sensor is the following nucleic acid sensor (II).
(II) a single-stranded nucleic acid sensor having the three-dimensional formation region (D) and the binding region (A),
In the absence of the steroid skeleton-containing compound, the stereogenic region (D) is inhibited from forming the stereostructure,
In the presence of the steroid skeleton-containing compound, by the contact of the steroid skeleton-containing compound with the binding region (A), the three-dimensional formation region (D) forms the three-dimensional structure,
During the formation of the three-dimensional structure,
A single-stranded nucleic acid sensor, wherein the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range is greater than that at the time of inhibiting the formation of the three-dimensional structure.
The detection device according to claim 7, wherein the nucleic acid sensor (II) is at least one nucleic acid sensor selected from the group consisting of the following (i) to (iv) and (v).
(I) having the three-dimensional formation region (D), the blocking region (B), and the binding region (A) in this order;
The blocking region (B) is complementary to a partial region (Dp) in the three-dimensional region (D);
A terminal region (Ab) on the blocking region (B) side in the binding region (A) is complementary to a region (Df) adjacent to the partial region (Dp) in the three-dimensional formation region (D), and A single-stranded nucleic acid sensor which is complementary to a terminal region (Af) opposite to the blocking region (B) in the binding region (A).
(Ii) having the three-dimensional formation region (D), the blocking region (B), the binding region (A), and the stabilization region (S) in this order;
The blocking region (B) is complementary to a partial region (Dp) of the three-dimensional formation region (D);
A single-stranded nucleic acid sensor, wherein a terminal region (Ba) on the binding region (A) side of the blocking region (B) is complementary to the stabilization region (S).
(Iii) having the three-dimensional formation region (D), the stem formation region (S D ), the binding region (A), and the stem formation region (S A ),
The stem forming region (S D ) has a sequence complementary to the three-dimensional forming region (D),
The stem-forming region (S A ) is a single-stranded nucleic acid sensor having a sequence complementary to the binding region (A).
(Iv) having the three-dimensional formation region (D) and the binding region (A);
The three-dimensional formation region (D) includes a first region (D1) and a second region (D2), and forms a three-dimensional structure with the first region (D1) and the second region (D2). Yes,
A single-stranded nucleic acid sensor having the first region (D1) on one end side of the binding region (A) and the second region (D2) on the other end side of the binding region (A) .
(V) having the three-dimensional formation region (D) and the binding region (A) in this order;
The single-stranded nucleic acid sensor in which the three-dimensional region (D) and the binding region (A) have complementary sequences.
In the above-mentioned (i) or (ii) single-stranded nucleic acid sensor,
The detection device according to claim 8, comprising the three-dimensional formation region (D), the blocking region (B), and the binding region (A) in this order from the 5 'side.
In the single-stranded nucleic acid sensor (iii),
As the stem formation region (St), it has a stem formation region (S D ) and a stem formation region (S A ),
The three-dimensional formation region (D) and the stem formation region (S D ) have mutually complementary sequences,
The detection device according to claim 8, wherein the binding region (A) and the stem-forming region (S A ) comprise sequences complementary to each other.
In the single-stranded nucleic acid sensor of (iii), the three-dimensional formation region (D), the stem formation region (S D ), the binding region (A), and the stem formation region (S A ) are the following (1 ), (2), (3) or (4) are connected in the order of detection devices according to claim 8.
(1) Order of the binding region (A), the stem formation region (S D ), the solid formation region (D), and the stem formation region (S A ) (2) The stem formation region (S A ), Order of the three-dimensional formation region (D), the stem formation region (S D ), and the binding region (A) (3) The three-dimensional formation region (D), the stem formation region (S A ), the binding region (A) And the order of the stem formation region (S D ) (4) The order of the stem formation region (S D ), the binding region (A), the stem formation region (S A ), and the solid formation region (D)
The detection device according to claim 11, wherein the single-stranded nucleic acid sensor (iii) includes a polynucleotide (c) below.
(C) a polynucleotide of the following (c1) (c1) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3
In the single-stranded nucleic acid sensor (iv),
The first region (D1) and the second region (D2) are:
The detection device according to claim 8, comprising sequences complementary to each other at a terminal opposite to the position of the binding region (A).
In the (v) single-stranded nucleic acid sensor,
The detection device according to claim 8, wherein the sequence from the 5 'side of the three-dimensional formation region (D) and the sequence from the 3' side of the binding region (A) have complementary sequences to each other.
The three-dimensional formation region (D) is a G formation region (G) forming a G-quartet structure,
The detection device according to any one of claims 1 to 14, wherein the three-dimensional structure is a G-quartet structure.
The detection device according to any one of claims 1 to 15, further comprising a linker region between the three-dimensional formation region (D) and the binding region (A).
The detection device according to any one of claims 1 to 16, wherein the nucleic acid sensor is connected to the transistor via a linker region.
A contact step of contacting a sample with the detection device according to any one of claims 1 to 17, and an increase or decrease in the number of nucleotide residues constituting a nucleic acid sensor in a range of the Debye length of the detection device is detected. A detection method for detecting a steroid skeleton-containing compound in the sample, comprising the step of detecting the steroid skeleton-containing compound in the sample.
Using the detection device of claim 5,
A mixing step of mixing the sample and the reagent;
Contacting the resulting mixture with the detection device, and detecting the increase or decrease in the number of nucleotide residues constituting the nucleic acid sensor in the Debye length range of the detection device, thereby the steroid in the sample The detection method according to claim 18, further comprising a detection step of detecting a skeleton-containing compound.
The detection step comprises
A charge measuring step of measuring a charge in a debye length range of the detection device by the detection device;
A steroid skeleton-containing compound detection step of detecting an increase or decrease in the number of the nucleotide residues in the Debye length range based on the charge and the reference charge, and detecting the steroid skeleton-containing compound. 19. The detection method according to 19.
The detection method according to claim 20, wherein the measurement of the electric charge is measurement of an electric signal.
The detection method according to claim 21, wherein the electrical signal is at least one of a voltage and a current.