WO2018126468A1

WO2018126468A1 - Preparing method for ursodesoxycholic acid and enzyme 1 used in preparation of the ursodesoxycholic acid

Info

Publication number: WO2018126468A1
Application number: PCT/CN2017/070604
Authority: WO
Inventors: 傅荣昭; 刘立辉; 曹磊; 刘滔滔; 彭亭
Original assignee: 深圳市邦泰绿色生物合成研究院
Priority date: 2017-01-09
Filing date: 2017-01-09
Publication date: 2018-07-12
Also published as: CN107995929A; CN107995929B

Abstract

The present invention relates to a preparing method for an ursodesoxycholic acid by using a biological enzyme catalysis technology and 7β-hydroxysteroid dehydrogenase for preparation of the ursodesoxycholic acid. The method uses a 3α-hydroxyl-7-oxo-5β-cholanic acid as a substrate and uses the 7β-hydroxysteroid dehydrogenase to catalyze the 3α-hydroxyl-7-oxo-5β-cholanic acid in the presence of an NADP, glucose, glucose dehydrogenase and a buffer solution to prepare the ursodesoxycholic acid, the 7β-hydroxysteroid dehydrogenase being sourced from Ruminococcus torques ATCC 27756. The method has advantages of simple operation, mild and easily controlled reaction conditions and short reaction duration; and the conversion rate of the substrate can reach 99.7% or more, and the content of the obtained product is 98.5% or more.

Description

Preparation method of ursodeoxycholic acid and enzyme for preparation thereof 1 TECHNICAL FIELD

[0001] The present invention relates to the field of molecular biology and biotechnology, and more particularly to a method for preparing ursodeoxycholic acid by using a biological enzyme catalytic technique and a 7β-steroid dehydrogenase for preparation thereof.

Background technique

[0002] Ursodeoxycholic acid is the main active ingredient of the precious Chinese medicine bear bile. It has the effect of increasing bile acid secretion, changing bile composition, facilitating the gradual dissolution of cholesterol in gallstones, and lowering cholesterol and cholesterol in bile. Mainly used to treat gallstone disease. As we all know, bear bile is a very scarce resource, because the traditional way of its acquisition is mainly dependent on the method of artificially breeding live bears. At present, this traditional method with long cycle, low yield and inhumanity is gradually replaced by synthetic methods.

[0003] At first, the artificial synthesis methods of ursodeoxycholic acid were mostly chemical methods and were widely used in industrial production. However, the chemical method has disadvantages such as harsh operating conditions, low selectivity, environmental pollution, use of a large amount of organic solvents, residual organic solvents, toxic and harmful. In order to solve the many shortcomings of chemical law, people have taken a different approach to find better ways of production. Chinese invention patent application CN105368828A discloses a method for preparing 3α-hydroxy-7 oxo-5β-cholane ursodeoxycholic acid by whole cell catalysis, but this method requires cell fermentation culture, and there is a reaction time. Long, complicated operation, complex products and other shortcomings.

technical problem

[0004] An object of the present invention is to provide a novel preparation method of ursodeoxycholic acid, which solves the problem of residual organic solvents, harsh conditions, and long reaction time in the prior preparation methods mentioned in the above background art. The invention has the disadvantages of cumbersome operation, environmental pollution, and the like, and the present invention provides a biological enzyme suitable for the new preparation method.

Problem solution

Technical solution

[0005] In order to achieve the above object, the inventors have explored a biological enzyme suitable for extracellular biocatalysis to prepare ursodeoxycholic acid after a series of trials and experiments after a long period of trial and error, and in this sequence. Based on the optimization, a mutant enzyme with increased activity and substrate inhibition is obtained, thereby emitting a novel method for preparing ursodeoxycholic acid, which is characterized by: 3α-hydroxy-7oxo-5β- Choline acid Preparation of ursodeoxycholic acid, 7β-catalyzed by 7β-steroid dehydrogenase, in the presence of NADP, glucose, glucose dehydrogenase, and a buffer solution, 7β-steroid-7 ox-5β-cholanoic acid - the steroid dehydrogenase is derived from Ruminococcus torques ATCC 27756, which is derived from Bacillus megaterium &?d «^ mi^^WMm, the gene sequence of which is shown in SEQ ID NO: 3, In the entire catalytic reaction system, the concentration of the substrate is 50 to 100 mg/mL, the concentration of the NADP is 0.01 to 0.25 mg/mL, and the concentration of the glucose is 30 to 50 mg/mL.

[0006] The specific forms of the two enzymes used in the above methods include liquid enzyme solution, solid state, and various immobilized enzymes, which may be in the form of unpurified crude enzyme, or may be partially purified or completely purified. .

[0007] Preferably, the catalytic process is controlled at a temperature of 25 to 35 ° C and a pH of 7.5 to 8.5.

Preferably, the buffer solution is a 50-100 mM potassium phosphate buffer.

[0009] Preferably, the above preparation method further comprises the following purification step: after the end of the catalytic process, the pH is adjusted to 10.5 to 12.5, the insoluble matter is removed, and the pH is adjusted to 1.0 to 2.0, and the water bath is 50-60°. C, stirring for 20~30min, after cooling, filtering, washing three times with water and then vacuum drying to obtain the finished product of ursodeoxycholic acid.

[0010] More preferably, the above preparation method further comprises the following refining step: using the obtained ursodeoxycholic acid product as 10-20 times absolute ethanol 50-60. Under reflux with C water bath, 0.5-lh, heat filtration, take the filtrate and vacuum to concentrate to 1/4 - 1 / 5 volume, then add 5-10 times pure water for 1 hour to crystallize, filter, filter cake vacuum drying , that is, the refined product of ursodeoxycholic acid.

[0011] Preferably, the 7β-steroid dehydrogenase used in the above preparation method is a protein of the following (a) or (b):

(a) a protein having the amino acid sequence of SEQ ID NO: 2,

(b) substituting, deleting or adding one or several amino acids in the (a) defined amino acid sequence and having 3ot-hydroxy-7 ox-5β-cholanoic acid as a substrate in the presence of NADP The amino acid sequence is a protein derived from (a) having a high parental 7β-steroid dehydrogenase catalytic activity as shown in SEQ ID NO: 2.

More preferably, the 7β-steroid dehydrogenase has at least one mutation selected from at least one of the following positions compared to the amino acid sequence set forth in SEQ ID NO: 2: 66th, 90th Bit, 91st, 97th, 150th, 153th, 189th, 191st, and 200th.

More preferably, the 7β-steroid dehydrogenase has at least one of the following mutations: D66N, Y90W, V91 A F97W, S150K, N153D, T189A, T191A and G200K.

[0016] The present invention also provides a 7β-steroid dehydrogenase, characterized in that: the 7β-steroid dehydrogenase is derived from Ruminococcus torques ATCC 27756, which is used to catalyze 3α-hydroxy-7 oxo -5 β-cholanoic acid to prepare ursodeoxycholic acid, the 7β-steroid dehydrogenase is a protein of (a) or (b) below

(a) a protein having the amino acid sequence of SEQ ID NO: 2,

(b) substituting, deleting or adding one or several amino acids in the (a) defined amino acid sequence and having 3ot-hydroxy-7 ox-5β-cholanoic acid as a substrate in the presence of NADP Amino acid sequence such as SEQ ID

The parental high 7β-steroid dehydrogenase shown by NO: 2 is catalytically active from (a) derived protein.

Preferably, the 7β-steroid dehydrogenase has at least one mutation selected from at least one of the following positions compared to the amino acid sequence set forth in SEQ ID NO: 2: _66th , _90th _91st , _97th

, 150th, 153rd, 189th, 191st, and 200th.

Preferably, the 7β-steroid dehydrogenase has at least one of the following mutations: D66N, Y90W, V91A, F97W, S150K, N153D, T189A, T191A, and G200K.

Advantageous effects of the invention

Beneficial effect

[0021] 1. Compared with the existing preparation method of ursodeoxycholic acid, the method provided by the invention has the advantages of simple operation, mild and easy control of reaction conditions, short reaction time, no use of organic solvent, no toxicity and no pollution. The invention has the advantages of low cost, and has been proved by practice that the reaction time of the method provided by the invention only needs 6~12 hours, the conversion rate of the substrate is up to 99.7%, and the content of the obtained product is above 98.5%.

[0022] 2. The present invention screens a 7β-steroid dehydrogenase gene suitable for extracellular biocatalysis to prepare ursodeoxycholic acid, and optimizes on the basis of the sequence to obtain an activity enhancement and substrate removal inhibition. Mutant enzymes, these mutant enzymes exhibit high selectivity such that the method does not form by-products, and the high catalytic activity and high specificity of these mutant enzymes make the cost of mass production of ursodeoxycholic acidase more Low, with high industrial application value.

Embodiments of the invention

[0023] The present invention will be further described in detail below in conjunction with specific embodiments, which are illustrative of the present invention. It is to be understood that the present invention is not limited to the following examples, and the specific conditions are not indicated in the examples, and are carried out under the usual conditions or conditions recommended by the manufacturer.

[0024] The specific implementation process of the preparation method of ursodeoxycholic acid provided by the present invention is as follows:

[0025] 3α-hydroxy-7 ox-5β-cholanoic acid was suspended in 50~100 mM potassium phosphate buffer (pH 8.0), adjusted to pH 8.0 with 10 M NaOH, and then added to a final concentration of 30~ 50mg/mL glucose and adjust the pH to 7.8~8.0 with 10M Na OH, add 7β-steroid dehydrogenase and glucose dehydrogenase, and finally add NADP with final concentration of 0.01~0.25mg/mL, the final concentration of substrate is 50 ~100mg/mL, the reaction is carried out at a temperature of 25 to 35 ° C, 200 to 400 rpm and a pH of 7.5 to 8.5, and the reaction time is 6 to 12 hours. The reaction solution was diluted 50 to 100 times with the mobile phase at regular intervals, and the liquid phase was analyzed by microfiltration. Liquid phase testing using Phen omenx Gemini

110Α 250x4.6mm for the analytical column, the mobile phase is acetonitrile: buffer solution

(According to 0.78 g of sodium dihydrogen phosphate, dissolved in 1 L of water, adjusted to pH 3 with phosphoric acid): methanol = 30:37:40, filtered through a 0.45 um filter and used. The column temperature was 40 ° C, the differential detector (RID), and the flow rate was 0.8 mIJ min. After the reaction in the catalytic process is completed, 5~10 M NaOH is added under rapid stirring to adjust the pH of the reaction solution to 10.5 to 12.5, and the filtrate is filtered, and the filtrate is added with hydrochloric acid to a pH of 1.0 to 2.0, and the water bath is 50- At 60 ° C, stir for 20~30min, filter after cooling, wash three times with water and then vacuum dry to obtain the finished product of ursodeoxycholic acid. Then, the finished product is stirred with a 10-20 times absolute ethanol 50-60 ° C water bath under reflux for 0.5-lh, filtered hot, and the filtrate is concentrated under vacuum and concentrated to a volume of 1/4 - 1/5, and then added 5-10. The pure water was stirred for 1 hour to carry out crystallization, and the filter cake was vacuum dried overnight to obtain a refined product of ursodeoxycholic acid.

The specific forms of the two enzymes used in the above methods include liquid enzymes, solid enzymes, and various immobilized enzymes, either in the form of unpurified crude enzymes or in partially or completely purified form. .

Embodiment 1

Preparation of co-expression recombinant plasmid pET22b-BHSDH3-GDH containing the parental gene

[0029] The 7β-steroid dehydrogenase gene BHSDH3 derived from the genus Neisseria gonorrhoeae (73⁄4m^ococo« torques ATCC 27756) and the glucose dehydrogenase gene GDH derived from Bacillus megaterium) were respectively used with primer pairs 5' CGCCATATGATGAACCTGCGTGAGAAGTA3' and 5 'CCGGAATTCTTAGTAGAAGCTACCCATATAACG3' and bow|object pair 5'CCGGAATT

TTAGCCTCTTCCCGTTTGGA3' obtained PCR product by PCR amplification technique and then digested by PCR The homologous gene was inserted into the fe l and EcoR I sites of the expression vector pET22b (+) and the EcoR I site and the X/w I site to obtain a co-expression recombinant plasmid pET22b-BHSDH3-GDH. The nucleotide sequence of the cloned parent 7β-steroid dehydrogenase is determined by DNA sequencing as shown in SEQ ID NO: 1, and the amino acid sequence 歹IJ is as SEQ ID

NO: 2; the nucleotide sequence of the cloned parental glucose dehydrogenase is determined as shown in SEQ ID NO: 3, and the amino acid sequence thereof is shown in SEQ ID NO: 4.

[0030] Example 2

Preparation of co-expression recombinant plasmid containing 7β-steroid dehydrogenase mutant

[0032] Site-directed mutagenesis of 7β-steroid dehydrogenase parent by reverse PCR, design of reverse primer at the mutation position, amplification of the target fragment by upstream and downstream mutant primers, and introduction of corresponding mutations on the primer to recombinant plasmid pET22b-BHSDH3-GDH was used as a template for reverse PCR. The PCR product was transformed into E. coli Ro _Se tt _a (de3) by Dpn I digestion digestion template. After Amp screening, the colonies were picked for sequencing. The mutation sites and primer design are shown in Table 1.

[0033] The PCR system is: TaKaRa EX Taq HS 0.25ul; ΙΟχΕχ Taq Buffer

5 ul; template plasmid lul; dNTP (2.5 mM each) 4 ul; upstream primer lul; downstream primer lul; sterile water up to 50 ul.

[0034] The PCR procedure is: First 98. C2min; then 98. C10s, 50-65 ° C 30s, 72. C7min, 30 cycles

; Last 72 ° C 10 min.

Table 1

[Table 1]

Embodiment 3

[0037] Preparation of enzyme solution

[0038] The parental and mutant co-expression recombinant plasmids prepared in Example 1 and Example 2 were separately transferred into Escherichia coli Ro setta (de3), and the obtained recombinant Escherichia coli was inoculated into a small volume of LB medium (containing 10 (Vg/mL of Amp), after 30~37 °C overnight culture, transfer to a volume of LB medium (containing 10 (Vg/mL of Amp), in 30~ with an inoculation amount of 1~5<3⁄4 The OD _{600 was} further cultured at 37 ° C to reach 0.6 to 1.0, and isopropyl-β-D-thiogalactoside (IPTG) was added at a final concentration of 0.1 mM to 1 M, and the expression was induced at 20 to 37 ° C for 8 to 20 hours. cells were collected. fermenting cells were suspended in a volume of 50~100mM potassium phosphate buffer (pH8.0) and ultrasonic lysing, centrifugation and that was containing glucose dehydrogenase parent steroid dehydrogenase 7β- or ₇ and A crude enzyme solution of a β-steroid dehydrogenase mutant, which can be used for the determination of enzyme activity and biocatalytic preparation of ursodeoxycholic acid.

Example 4

[0040] Determination of enzyme activity

[0041] 7β-steroid dehydrogenase enzyme activity assay method: using 3ot-hydroxy-7 ox-5β-cholanoic acid as a substrate, in one lOuL of 150 mM 3a-hydroxy-7 oxo-5β-cholanoic acid, lOOuL diluted enzyme solution, NADP+ final concentration of 0.2 mM in a 3 mL reaction system, reacted at pH 8.0 and 25 ° C for a certain period of time. The increase in absorbance was measured at 340 nm.

[0042] Glucose dehydrogenase enzyme activity assay method: using glucose as a substrate, adding 100 uL of 50 mM glucose, lOOuL of diluted enzyme solution in a 3 mL reaction system, NADPH final concentration of 0.2 mM, at pH 8.0 and The reaction at 25 ° C was constant, and the decrease in absorbance was measured at 340 nm.

The results of the measurement of the enzyme activity are shown in Table 2, wherein GDH is glucose dehydrogenase and 7p-HSDH is 7β-steroid dehydrogenase.

Table 2

[] [Table 2]

[0045] Example 5

Preparation of ursodeoxycholic acid

[0047] Referring to the foregoing specific implementation process of the preparation method of ursodeoxycholic acid, the crude enzyme solution prepared in Example 3 is used, and the input amount of the enzyme solution is controlled by the weight of the enzyme solution in the whole reaction system, and the substrate 3d is controlled. The final concentration of -hydroxy-7 oxo-5β-cholanoic acid was 100 mg/mL, and the other specific parameters are shown in Table 3. After 6~12h reaction, the substrate conversion rate was above 99.7%, the finished product content was above 98.5%, and the yield was 85~93%.

Table 3

[] [table 3]

Example 6

[0050] Preparation of ursodeoxycholic acid

[0051] 1L of total system, take 50g of 99% content of 3α-hydroxy-7 ox-5β-cholanoic acid, suspended in 100 mM potassium phosphate buffer (pH 8.0), adjust pH with lO M NaOH to After 8.0, glucose was added to a final concentration of 50 g/L, and 0.09 g of 7p-steroid dehydrogenase lyophilized powder (G200K mutant enzyme) and 0.06 g of glucose dehydrogenase lyophilized powder were sequentially added, and finally added to a final concentration of 0.15 g/L. The NADP has a final substrate concentration of 50 g/L. The reaction was carried out at 25 ° C, 250 rpm and pH 8.0 for 6 h, and the conversion rate was 99.8 < 3⁄4. After the reaction, add lOM NaOH to pH 12.5 with rapid stirring, filter the filtrate, add hydrochloric acid to the pH value of 1.0, water bath 55 ° C, stir for 30 min, filter after cooling, wash water three times, vacuum Drying obtained 56 g of the finished product of ursodeoxycholic acid. The obtained ursodeoxycholic acid product was dissolved in 800 ml of absolute ethanol, 60. After stirring for 1 hour in a water bath, the mixture was filtered, and the filter cake was washed with a small amount of ethanol. The filtrate was concentrated to a concentration of 200 ml under reduced pressure. Then, 2 L of pure water was added and stirred for 1 hour, filtered, and the filter cake was washed three times with water, and the obtained cake was dried by vacuum. 50.5 g of ursodeoxycholic acid refined product.

Claims

Claim

A method for preparing ursodeoxycholic acid, characterized by: using 3d-hydroxy-7 ox-5β-cholanoic acid as a substrate, in the presence of NADP, glucose, glucose dehydrogenase and a buffer solution, Preparation of ursodeoxycholic acid by 7α-hydroxy-7 ox-5β-cholanoic acid catalyzed by 7β-steroid dehydrogenase, which is derived from Rwninococc torques ATCC 27756, the glucose The dehydrogenase is derived from Bacillus megaterium, and the gene sequence thereof is shown in SEQ ID NO: 3. In the entire catalytic reaction system, the concentration of the substrate is 50 to 100 mg/mL, and the concentration of the NADP is 0.01. ~0.25 mg/mL, the concentration of the glucose is 30 to 50 mg/mL.

The method for producing ursodeoxycholic acid according to claim 1, wherein the catalytic process is controlled at a temperature of 25 to 35 ° C and a pH of 7.5 to 8.5. The method for preparing ursodeoxycholic acid according to claim 1, wherein the buffer solution is 50 to 100 mM potassium phosphate buffer.

The method for preparing ursodeoxycholic acid according to claim 1, wherein the preparation method further comprises the following purification step: after the reaction of the catalytic process is finished, adjusting the pH value to 10.5 to 12.5 to remove insoluble matter , adjust the pH value to 1.0~2.0, water bath 50-60 ° C, stir for 20~30min, filter after cooling, wash three times with water and then vacuum dry to obtain the finished product of ursodeoxycholic acid.

The method for producing ursodeoxycholic acid according to any one of claims 1 to 4, wherein the 7?-steroid dehydrogenase is a protein of the following (a) or (b):

(a) a protein having the amino acid sequence of SEQ ID NO: 2,

(b) Substituting, deleting or adding one or several amino acids in the (a) defined amino acid sequence and using 3ot-hydroxy-7 ox-5β-cholanoic acid as a substrate in the presence of NADP has an amino acid sequence The (a)-derived protein having a high parental 7β-steroid dehydrogenase catalytic activity as shown in SEQ ID NO: 2.

The method for producing ursodeoxycholic acid according to claim 5, wherein the 7β-steroid dehydrogenase is selected from at least one of the following sites as compared with the amino acid sequence shown in SEQ ID NO: 2. Have at least one mutation: 66th, 90th, 91st, 97th , 150th, 153th, 189th, 191st, and 200th.

[Claim 7] The method for producing ursodeoxycholic acid according to claim 6, wherein the 7?-steroid dehydrogenase has at least one of the following mutations: D66N, Y90W, V91A, F97W,

S 150K, N153D, T189A, T191A and G200K.

[Claim 8] a 7β-steroid dehydrogenase, characterized in that: the 7β-steroid dehydrogenase is derived from Rusinococcus rhizococc torques ATCC 27756, which is used to catalyze 3α-hydroxy-7 oxo-5β- Preparation of ursodeoxycholic acid from choline acid, the 7β-steroid dehydrogenase being a protein of (a) or (b) below:

(a) a protein having the amino acid sequence of SEQ ID NO: 2,

[Claim 9] The 7β-steroid dehydrogenase according to claim 8, wherein the 7β-steroid dehydrogenase is selected from at least one of amino acid sequences as shown in SEQ ID NO: 2. There are at least one mutation at the position: 66th, 90th, 91st, 97th, 150th, 153th, 189th, 191st, and 200th.

[Claim 10] The 7β-steroid dehydrogenase according to claim 9, wherein the 7β-steroid dehydrogenase has at least one of the following mutations: D66N, Y90W, V91A, F97W, S 15 OK: N153D, T189A, T191A and G200K.