CN106609292B

CN106609292B - A kind of preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid and its alternation enzyme processed

Info

Publication number: CN106609292B
Application number: CN201710012365.XA
Authority: CN
Inventors: 傅荣昭; 刘立辉; 曹磊; 刘滔滔
Original assignee: BONTAC BIO-ENGINEERING (SHENZHEN) Co Ltd; Meishan New Biological Technology Co Ltd
Current assignee: BONTAC BIO-ENGINEERING (SHENZHEN) Co Ltd; Meishan New Biological Technology Co Ltd
Priority date: 2017-01-09
Filing date: 2017-01-09
Publication date: 2018-04-24
Anticipated expiration: 2037-01-09
Also published as: CN106609292A

Abstract

The present invention relates to a kind of 7 α steroid dehydrogenases of method and its preparation that 3 α hydroxyls, 7 oxo, 5 β cholanic acids are prepared using biological enzyme technology.This method is using chenodeoxycholic acid as substrate, under the conditions of existing for NAD, lactic dehydrogenase, Sodium Pyruvate and buffer solution, 3 α hydroxyls, 7 oxo, 5 β cholanic acids are prepared with 7 α steroid dehydrogenase enzymatics chenodeoxycholic acids, wherein 7 α steroid dehydrogenases derive from brucella melitensisBrucella melitensis.This method is easy to operate, reaction condition it is gentle it is easily-controllable, the reaction time is short, to the high conversion rate of substrate up to more than 99.8%, the content of the product obtained is more than 96.8%.

Description

A kind of preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid and its alternation enzyme processed

Technical field

It is more particularly to a kind of to be prepared using biological enzyme technology the present invention relates to molecular biology and biological technical field The method and its preparation 7 α-steroid dehydrogenase of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid.

Background technology

- 7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid also known as 7- Ketolithocholsaeures, are the important intermediates for preparing urso.And Urso is the principle active component of rare Chinese medicine bear gall, has increase bile acid secretion and changes bile component, drop Low bile cholesterol and cholesterol ester and other effects, are mainly used for treating cholelith disease.It is well known that bear gall is a kind of very dilute Scarce resource, reason are that its classical pathway obtained depends primarily on the method that artificial breeding bear living takes courage.At present, it is this Cycle is long, yield is low and inhuman classical pathway is gradually substituted by artificial synthesis, and the artificial synthesized bear now known goes In the method for oxycholic acid ,-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid is all particularly important intermediate.

The industrialized production of current-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid uses chemical method more, but there are operating condition It is harsh, selectivity it is low, pollution environment, using a large amount of organic solvents, there are organic solvent residual, it is poisonous and harmful the shortcomings of.In order to Shortcomings existing for chemical method are solved, people look for another way, and find more preferable production ways.Chinese invention patent CN1912192B discloses a kind of method that-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid is prepared using electrochemistry formated, but such a Method still needs to use organic solvent, and cost is higher.Chinese invention patent application CN105368828A discloses one kind The method that-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid is prepared using whole-cell catalytic, but such a method need to carry out cell fermentation training Support, there are the reaction time it is long, cumbersome, product is complicated the shortcomings of.

The content of the invention

It is an object of the invention to provide a kind of new preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid, to solve The organic solvent residual present in existing preparation method mentioned in above-mentioned background technology, condition are harsh, the reaction time is long, operation It is cumbersome, cost is higher, pollution environment the shortcomings of, invention also provides the biology enzyme that the new preparation process is applicable in.

To achieve the above object, inventor gropes by long-term substantial amounts of experiment, it is attempted in the failure for undergoing up to a hundred times Afterwards, the biology enzyme for being catalyzed suitable for extracellular biological and preparing-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid is filtered out finally, and in this sequence Optimized on the basis of row, obtain activity and improve and remove the mutant enzyme that substrate suppresses, so as to develop a kind of new system The method of-7-5 β of oxo of standby 3 Alpha-hydroxy-cholanic acid, it is characterised in that：Using chenodeoxycholic acid as substrate, in NAD, lactic dehydrogenase Under the conditions of enzyme, Sodium Pyruvate and buffer solution are existing, 3 α-hydroxyl is prepared with 7 α-steroid dehydrogenase enzymatic chenodeoxycholic acid - 5 β cholanic acids of the oxo of base -7,7 α-steroid dehydrogenase derive from brucella melitensisBrucella melitensis, institute State the nucleotide sequence such as SEQ ID NO of lactic dehydrogenase：Shown in 3, in whole catalystic converter system, the concentration of the substrate For 50~100mg/mL, the concentration of the NAD is 0.01~0.25mg/mL, and the concentration of the Sodium Pyruvate is 10~30mg/ mL。

The specific existence form of two kinds of enzymes used in the above method includes liquid enzyme, solid-state enzyme and various immobilizations Enzyme, can be not purified thick enzyme form or the form through partial purification or Economical Purification.

Preferably, control the catalytic process temperature be 25~35 DEG C, pH value be 7.5~8.5 under conditions of carry out.

Preferably, the buffer solution is 50~100mM kaliumphosphate buffers.

Preferably, above-mentioned preparation method further includes following purification step：Treat the catalytic process after reaction, adjust pH It is worth for 1.0~2.0, stirs 20~30min, after cooling again after filtered washing and drying up to-7-5 β of oxo of 3 Alpha-hydroxy-courage Alkanoic acid finished product.

It is highly preferred that above-mentioned preparation method further includes following purification step：By-7-5 β of oxo of 3 Alpha-hydroxy-cholane of acquisition Sour finished product is stirred at reflux 0.5-1h with 50-60 DEG C of water bath condition of 8-15 times of absolute ethyl alcohol, and filtering, takes filtrate to carry out vacuum decompression 1/4-1/5 volumes are concentrated into, add 4-5 times of pure water stirring 1h, filtering, filter cake is dried in vacuum overnight, up to 3 Alpha-hydroxies -7 The β of oxo-5-cholanic acid highly finished product.

Preferably, 7 α used in above-mentioned preparation method-steroid dehydrogenase is as follows（a）Or（b）Protein：

（a）Its amino acid sequence such as SEQ ID NO：Protein shown in 2,

（b）（a）In the amino acid sequence of restriction by substitution, lack or add one or several amino acid and Have in the presence of NAD by substrate of chenodeoxycholic acid than amino acid sequence such as SEQ ID NO：The high 7 α-class of parent shown in 2 is solid Alcohol dehydrogenase catalytic activity by（a）Derivative protein.

It is highly preferred that 7 α-steroid dehydrogenase and such as SEQ ID NO：Amino acid sequence shown in 2 compare selected from There is at least one mutation at least one following sites：91st, the 92nd, the 117th, the 118th, the 195th, 241 and the 243rd.

It is highly preferred that 7 α-steroid dehydrogenase has at least one following mutation：D91K、L92R、N117I、 V118R, S195A, I241R and T243A.

Present invention also offers one kind 7 α-steroid dehydrogenase, 7 α-steroid dehydrogenase derives from sheep kind cloth Lu Shi BacteriumBrucella melitensis, -5 β cholanic acids of -7 oxo of 3 Alpha-hydroxy, 7 α-class are prepared for being catalyzed chenodeoxycholic acid Sterol dehydrogenase is as follows（a）Or（b）Protein：

（a）Its amino acid sequence such as SEQ ID NO：Protein shown in 2,

Preferably, 7 α-steroid dehydrogenase and such as SEQ ID NO：Amino acid sequence shown in 2 is compared selected from extremely There is at least one mutation at few following sites：91st, the 92nd, the 117th, the 118th, the 195th, the 241st Position and the 243rd.

Preferably, 7 α-steroid dehydrogenase has at least one following mutation：D91K、L92R、N117I、V118R、 S195A, I241R and T243A.

Beneficial effect：

1st, compared with the preparation method of existing-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid, method provided by the invention has Easy to operate, reaction condition it is gentle it is easily-controllable, the reaction time is short, without using organic solvent, nontoxic and pollution-free and of low cost excellent Point, is proven, the reaction duration of method provided by the invention only need 4~12 it is small when, its high conversion rate to substrate reaches More than 99.8%, the content of the product obtained is more than 96.8%.

2nd, the present invention filtered out suitable for extracellular biological catalysis prepare 7 α of 3 Alpha-hydroxy-7-5 β of oxo-cholanic acid- Steroid dehydrogenase genes, and optimized in this sequence basis, obtain activity and improve and remove the mutation that substrate suppresses Body enzyme, these mutant enzymes show high selectivity so that this method will not form accessory substance, and the height of these mutant enzymes is urged Change active and high specificity and make it that the cost of-7-5 β of oxo of 3 Alpha-hydroxy-cholane acid-enzyme hydrolysis method large-scale production is lower, have higher Industrial application value.

Embodiment

With reference to specific embodiment, the present invention is described in further detail, and following embodiments are the solutions to the present invention Release, the person that is not specified actual conditions the invention is not limited in following embodiments, in embodiment, routinely condition or manufacturer build The condition of view carries out.

The specific implementation process of the preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid provided by the invention is as follows：

Chenodeoxycholic acid is suspended in 50~100mM kaliumphosphate buffers（pH8.0）In, adjust pH with the NaOH of 10M and arrive 8.0, add the Sodium Pyruvate of final concentration of 10~30mg/mL and adjust pH to 8.0 with the NaOH of 10M, add 7 α-steroids Dehydrogenase and lactic dehydrogenase, are eventually adding the NAD of final concentration of 0.01~0.25mg/mL, Final substrate concentrations for 50~ 100mg/mL, reacts and is carried out in 25~35 DEG C of temperature, 200~400rpm and pH7.5~8.5, the reaction time is 4h~12h.Often Extracted reaction solution every certain time with 50~100 times of phase dilution of flowing, sample introduction progress liquid phase analysis after micro porous filtration.Liquid phase detection makes It is analytical column with 5 μm of 250 × 4.6mm of NX-C18 110A of Phenomenx Gemini, mobile phase is acetonitrile:Buffer solution （Sodium dihydrogen phosphate 0.78g is taken, is dissolved in 1L water, is 3 with phosphoric acid tune pH value, you can）:Methanol=30:37:40, filtered with 0.45um It is spare after membrane filtration.Column temperature is 40 DEG C, Composition distribution（RID）, flow velocity 0.8mL/min.Treat catalytic process after reaction, It is 1.0~2.0 that hydrochloric acid is added in the case of quick stirring to pH, continues 20~30min of stirring, filters after cooling, through water Wash after being dried in vacuo afterwards three times up to-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid finished product.Finished product is again with 8-15 times of absolute ethyl alcohol 50-60 0.5-1h is stirred at reflux under DEG C water bath condition, is filtered, takes filtrate to carry out vacuum-concentrcted to 1/4-1/5 volumes, adds 4-5 Times pure water stirring 1h, filtering, filter cake is dried in vacuum overnight, up to-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid highly finished product.

Embodiment 1

The preparation of coexpression recombinant plasmid pET22b-AH2-LDH containing parental gene

Brucella melitensis will be derived from（Brucella melitensis）7 α-steroid dehydrogenase genes AH2 and come Come from Wei Si Salmonellas（Weissellasp）Lactate dehydrogenase gene LDH be utilized respectively primer pair 5' CGCCATATGATGGGCGCCGACCCGGTTTA3' and 5'CCGGAATTCTCAGTCGAGTTCCTGCACGCC3' and primer To 5'CCGGAATTCAAGGAGATATACATATGAAGATCTTCGCGTACGGTA3' and 5' CCGCTCGAGTTAATATTCCACCGCAATGC3' after PCR amplification acquisition PCR product by digestion by handling, at the same time It is inserted into expression vector pET22b（+）'sNdeI andEcoR I sites andEcoR I sites andXhoI site, obtains common table Up to recombinant plasmid pET22b-AH2-LDH.Through DNA sequencing, the nucleotide of 7 α of the parent-steroid dehydrogenase being cloned is determined Sequence such as SEQ ID NO：Shown in 1, its amino acid sequence such as SEQ ID NO：Shown in 2；Determine that the parent's lactic acid being cloned takes off The nucleotide sequence of hydrogen enzyme such as SEQ ID NO：Shown in 3, its amino acid sequence such as SEQ ID NO：Shown in 4.

Embodiment 2

The preparation of coexpression recombinant plasmid containing 7 α-steroid dehydrogenase enzyme mutant

Rite-directed mutagenesis is carried out to 7 α-steroid dehydrogenase parent by inverse PCR technique, it is anti-by designing in mutated site To primer, purpose fragment is expanded using upstream and downstream mutant primer, and corresponding mutation is introduced on primer, with recombinant plasmid PET22b-AH2-LDH carries out inverse PCR, PCR product warp as templateDpnLarge intestine bar is transformed into after the processing of I enzymic digestions template Bacterium Rosetta (de3), picking colony send sequencing after the screening of Amp.Mutational site and design of primers are as shown in table 1.

PCR system is：TaKaRa EX Taq HS 0.25ul；10×Ex Taq Buffer 5ul；Template plasmid 1ul； dNTP（2.5mM each）4ul；Sense primer 1ul;Anti-sense primer 1ul；50 ul of sterile water up to.

PCR programs are：98 DEG C of 2min first；Then 98 DEG C of 10s, 55-56 DEG C of 30s, 72 DEG C of 7min, 30 circulations；Finally 72℃10min。

Table 1

Primer	Primer sequence（5 ' to 3 '）
		D91K+L92R upstreams	GTC GTA ACC AAG AGG AAA AGC GAA
D91K+L92R downstreams	TTC GCT TTTT CCT CTT GGT TAC GAC
		N117I+V118R upstreams	CTT GAA TGC ATC AGA ACC GAC GAG
N117I+V118R downstreams	CTC GTC GGT TCT GAT GCA TTC AAG
		S195A upstreams	AAT ATT TCG GCC ATG GCC GGA
S195A downstreams	TCC GGC CAT GGC CGA AAT ATT
		I241R+T243A upstreams	GGC GCG AGA AAG GCC GAT GCG
I241R+T243A downstreams	CGC ATC GGC CTT TCT CGC GCC

Embodiment 3

The preparation of enzyme liquid

Parent prepared by embodiment 1 and embodiment 2 and mutant coexpression recombinant plasmid are transferred to Escherichia coli respectively Rosetta (de3), then the recombination bacillus coli of acquisition is seeded in the LB culture mediums of small size（Amp containing 100 μ g/mL）, After 30~37 DEG C are incubated overnight, it is transferred to 1~5% inoculum concentration in the LB culture mediums of certain volume（Contain 100 μ g/mL's Amp）, continue to cultivate OD at 30~37 DEG C₆₀₀Reach the isopropyl-β-D- sulphur of 0.6~1.0 final concentration of 0.1mM~1mM of addition For galactoside (IPTG), thalline is collected by centrifugation after 20~37 DEG C of 10~20h of induced expression.Fermentation thalli is suspended in certain body The kaliumphosphate buffer of 50 long-pending~100mM（pH8.0）In and ultrasonic wave break born of the same parents, centrifuge up to containing lactic dehydrogenase and 7 α- Steroid dehydrogenase parent or the crude enzyme liquid with 7 α-steroid dehydrogenase enzyme mutant, available for the measure of enzyme activity and 3 α- It is prepared by the living things catalysis of-5 β of the oxo of hydroxyl-7-cholanic acid.

Embodiment 4

The measure of enzyme activity

The enzyme activity determination method of 7 α-steroid dehydrogenase：Using chenodeoxycholic acid as substrate, in the reaction system of a 3mL The 150mM chenodeoxycholic acids of middle addition 10uL, the dilution enzyme liquid of 100uL, the final concentration of 0.2mM of NAD+ are anti-at pH8.0 and 25 DEG C Certain time is answered, light absorption value increase is measured at 340nm.

The enzyme activity determination method of lactic dehydrogenase：Using Sodium Pyruvate as substrate, added in the reaction system of a 3mL The 50mM Sodium Pyruvates of 100uL, the dilution enzyme liquid of 100uL, the final concentration of 0.2mM of NADH, in pH8.0 and 25 DEG C of timing of reaction one Between, light absorption value reduction is measured at 340nm.

The measurement result of enzyme activity is as shown in table 2, and wherein LDH is lactic dehydrogenase, and 7 α-HSDH are 7 α-steroid dehydrogenase Enzyme.

Table 2

Type	Enzyme activity U/ml	Temperature stability	PH stability
				LDH	1017.5±23.5	4-45℃	6.0-9.0
7 α-HSDH parents	787.4±14.4	4-50℃	6.0-9.0
				D91K+L92R	856.2±15.4	4-45℃	6.0-9.5
N117I+V118R	986.5±19.3	4-45℃	6.5-9.0
				S195A	806.4±16.8	4-50℃	6.0-9.0
I241R+T243A	795.3±13.8	4-50℃	6.0-9.0

Embodiment 5

The preparation of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid

With reference to the specific implementation process of the preparation method of foregoing-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid, made using embodiment 3 Standby crude enzyme liquid, the input amount of enzyme liquid account for the stereometer of whole reaction system with the weight of enzyme liquid, control substrate chenodeoxycholic acid Final concentration of 100mg/mL, remaining each design parameter is as shown in table 3.Measured after reaction 4h~12h, substrate conversion efficiency exists More than 99.8%, for finished product content more than 96.8%, yield is 85~95%.

Table 3

Type	Enzyme liquid input amount（W/V）	Sodium Pyruvate input amount	NAD⁺Input amount	Reaction temperature	React pH
						Parent	20%	20mg/ml	0.15mg/ml	25℃	8.0
D91K+L92R	20%	20mg/ml	0.1mg/ml	25℃	8.0
						N117I+V118R	15%	18mg/ml	0.1mg/ml	30℃	8.5
S195A	20%	20mg/ml	0.15mg/ml	20℃	8.0
						I241R+T243A	18%	20mg/ml	0.13mg/ml	30℃	8.0

Embodiment 6

The preparation of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid

Total system 1L, the chenodeoxycholic acid for taking 50g contents to be 99%, is suspended in the kaliumphosphate buffer of 100mM（pH8.0）, With adding the Sodium Pyruvate of final concentration 20g/L after the adjusting pH to 8.0 of 10 M NaOH, and sequentially add 0.09g7 α-steroids Dehydrogenase freeze-dried powder（S195A mutant enzymes）With 0.07g lactic dehydrogenase freeze-dried powders, it is eventually adding final concentration of 0.15g/L's NAD, Final substrate concentrations 50g/L.Reaction 4h is carried out in 25 DEG C, 250rpm and pH8.0 or so, and conversion ratio is up to 99.8%.Reaction knot Shu Hou, reaction solution be added dropwise hydrochloric acid solution to pH be 1.2, continue stir 30min after it is to be cooled filtering, through wash three times after vacuum do It is dry to obtain-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid finished product 67g.Finished product is stirred back with 60 DEG C of water bath conditions of 900ml absolute ethyl alcohols 1h is flowed, filtrate is filtered to take and carries out vacuum-concentrcted to 200ml volumes, add 1L pure water stirring 1h, filtering, by filter cake vacuum It is dried overnight up to-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid highly finished product 53g.

SEQUENCE LISTING

<110>Meishan City Xin Gong bio tech ltd, Thailand of nation bioengineering（Shenzhen）Co., Ltd

<120>A kind of preparation method and its alternation enzyme processed 4 of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 915

<212> DNA

<213>Brucella melitensis（Brucella melitensis）

<400> 1

atgggcgccg acccggttta cggattaccc ggatttggcg accatgaagg gcgaacgccc 60

tttaagcgcc ttcaggtctc agatatagtt gccatccgca cgccggtccg catcacgccg 120

gatcgcaaag ccttctggag aaaatatatg tcctatgaga gcccgttcca cctgaatgat 180

gctgttgcaa tcgtcaccgg agcggcggca ggtatcggac gggccatcgc cggaaccttc 240

gccaaggctg gtgcttcggt tgtcgtaacc gaccttaaaa gcgaaggcgc tgaagccgtt 300

gcagccgcaa taaggcaagc tggcggcaag gccatcgggc ttgaatgcaa cgtaaccgac 360

gagcagcatc gcgaagccgt catcaaagcg gccctcgatc agttcggcaa aatcactgtt 420

ctggtcaaca atgcgggtgg aggcggcccc aagcccttcg atatgccgat gagcgacttt 480

gaatgggcct tcaagctcaa tctcttttcc ctgtttcgcc tgtcgcaatt ggctgcccca 540

cacatgcaga aggctggcgg cggcgcaatt ctcaatattt cgtccatggc cggagaaaat 600

accaatgtcc ggatggcctc ctatggttcg tccaaggcgg cggtcaatca cctcacccgc 660

aacattgcct tcgatgtcgg cccaatgggc attcgcgtga atgccatcgc acccggcgcg 720

atcaagaccg atgcgctcgc aaccgttctg acgcctgaaa tcgaacgcgc catactcaag 780

cacaagccgc ttggccgcct cggcgaagcg caggatatcg ccaatgcggc gctgttcctc 840

tgttcgcccg ccgcagcatg gatcagcggt caggttctca cggtttccgg cggcggcgtg 900

caggaactcg actga 915

<210> 2

<211> 304

<212> PRT

<213>Brucella melitensis（Brucella melitensis）

<400> 2

Met Gly Ala Asp Pro Val Tyr Gly Leu Pro Gly Phe Gly Asp His Glu

1 5 10 15

Gly Arg Thr Pro Phe Lys Arg Leu Gln Val Ser Asp Ile Val Ala Ile

20 25 30

Arg Thr Pro Val Arg Ile Thr Pro Asp Arg Lys Ala Phe Trp Arg Lys

35 40 45

Tyr Met Ser Tyr Glu Ser Pro Phe His Leu Asn Asp Ala Val Ala Ile

50 55 60

Val Thr Gly Ala Ala Ala Gly Ile Gly Arg Ala Ile Ala Gly Thr Phe

65 70 75 80

Ala Lys Ala Gly Ala Ser Val Val Val Thr Asp Leu Lys Ser Glu Gly

85 90 95

Ala Glu Ala Val Ala Ala Ala Ile Arg Gln Ala Gly Gly Lys Ala Ile

100 105 110

Gly Leu Glu Cys Asn Val Thr Asp Glu Gln His Arg Glu Ala Val Ile

115 120 125

Lys Ala Ala Leu Asp Gln Phe Gly Lys Ile Thr Val Leu Val Asn Asn

130 135 140

Ala Gly Gly Gly Gly Pro Lys Pro Phe Asp Met Pro Met Ser Asp Phe

145 150 155 160

Glu Trp Ala Phe Lys Leu Asn Leu Phe Ser Leu Phe Arg Leu Ser Gln

165 170 175

Leu Ala Ala Pro His Met Gln Lys Ala Gly Gly Gly Ala Ile Leu Asn

180 185 190

Ile Ser Ser Met Ala Gly Glu Asn Thr Asn Val Arg Met Ala Ser Tyr

195 200 205

Gly Ser Ser Lys Ala Ala Val Asn His Leu Thr Arg Asn Ile Ala Phe

210 215 220

Asp Val Gly Pro Met Gly Ile Arg Val Asn Ala Ile Ala Pro Gly Ala

225 230 235 240

Ile Lys Thr Asp Ala Leu Ala Thr Val Leu Thr Pro Glu Ile Glu Arg

245 250 255

Ala Ile Leu Lys His Lys Pro Leu Gly Arg Leu Gly Glu Ala Gln Asp

260 265 270

Ile Ala Asn Ala Ala Leu Phe Leu Cys Ser Pro Ala Ala Ala Trp Ile

275 280 285

Ser Gly Gln Val Leu Thr Val Ser Gly Gly Gly Val Gln Glu Leu Asp

290 295 300

<210> 3

<211> 996

<212> DNA

<213>Wei Si Salmonellas（Weissella sp）

<400> 3

atgaagatct tcgcgtacgg tattcgtgaa gacgagcagc cggcgctgaa agcgtggatc 60

gcggcgcacc cggaagtgac cgttgaattc accgaccaac tgctggatcc ggagaccgcg 120

aagctggcgg aaggctttga cgcggtgaac gtttaccagc aactggatta tacccgtgag 180

accctgaccg cgctgcacga actgggtatc aacaaaatga gcctgcgtaa cgttggcacc 240

gacaacattg actttgatgc ggcgcgtgag ttcgatttta gcatcagcaa cgtgccggtt 300

tatagcccga acgcgattgc ggaacacagc atcattcaga tgagccgtct gctgcgtcgt 360

accaaggcga tggacgcgaa ggtggcgaaa cacgatctgc gttgggcgcc gaccatcggt 420

cgtgagatgc gtatgcaaac cgtgggtgtt atcggtaccg gcaacattgg ccgtgttgcg 480

atgaagatcc tgaaaggttt cggcgcgaaa gtgattgcgt acgacctgta tcacaacgcg 540

gaagttgagg cggaaggtct gtacgtggac accctggagg aactgtatgc gcaggcggat 600

gttattaccc tgtacgtgcc gggcgttccg gcgaatcacc acatgatcaa cgcggacagc 660

attgcgaaga tgaaagatgg tgtggttatc gttaactgca gccgtggcaa cctgatggac 720

atcgacgatg tgattgcggg tctggatagc ggcaagatta gcgactttgc gatggatgtg 780

tatgaggaag aggttggtct gttcaacgtg gattggagca acaaggagtt tccggacgcg 840

aaaatcgcgg atctgattgc gcgtgaaaac gtgctggtta ccccgcacac cgcgttctac 900

accaccaagg cggtgctgga aatggttacc caaagcatga acgcgagcct ggcgtttatc 960

aacggcgaga aaccgagcat tgcggtggaa tattaa 996

<210> 4

<211> 331

<212> PRT

<213>Wei Si Salmonellas（Weissella sp）

<400> 4

Met Lys Ile Phe Ala Tyr Gly Ile Arg Glu Asp Glu Gln Pro Ala Leu

1 5 10 15

Lys Ala Trp Ile Ala Ala His Pro Glu Val Thr Val Glu Phe Thr Asp

20 25 30

Gln Leu Leu Asp Pro Glu Thr Ala Lys Leu Ala Glu Gly Phe Asp Ala

35 40 45

Val Asn Val Tyr Gln Gln Leu Asp Tyr Thr Arg Glu Thr Leu Thr Ala

50 55 60

Leu His Glu Leu Gly Ile Asn Lys Met Ser Leu Arg Asn Val Gly Thr

65 70 75 80

Asp Asn Ile Asp Phe Asp Ala Ala Arg Glu Phe Asp Phe Ser Ile Ser

85 90 95

Asn Val Pro Val Tyr Ser Pro Asn Ala Ile Ala Glu His Ser Ile Ile

100 105 110

Gln Met Ser Arg Leu Leu Arg Arg Thr Lys Ala Met Asp Ala Lys Val

115 120 125

Ala Lys His Asp Leu Arg Trp Ala Pro Thr Ile Gly Arg Glu Met Arg

130 135 140

Met Gln Thr Val Gly Val Ile Gly Thr Gly Asn Ile Gly Arg Val Ala

145 150 155 160

Met Lys Ile Leu Lys Gly Phe Gly Ala Lys Val Ile Ala Tyr Asp Leu

165 170 175

Tyr His Asn Ala Glu Val Glu Ala Glu Gly Leu Tyr Val Asp Thr Leu

180 185 190

Glu Glu Leu Tyr Ala Gln Ala Asp Val Ile Thr Leu Tyr Val Pro Gly

195 200 205

Val Pro Ala Asn His His Met Ile Asn Ala Asp Ser Ile Ala Lys Met

210 215 220

Lys Asp Gly Val Val Ile Val Asn Cys Ser Arg Gly Asn Leu Met Asp

225 230 235 240

Ile Asp Asp Val Ile Ala Gly Leu Asp Ser Gly Lys Ile Ser Asp Phe

245 250 255

Ala Met Asp Val Tyr Glu Glu Glu Val Gly Leu Phe Asn Val Asp Trp

260 265 270

Ser Asn Lys Glu Phe Pro Asp Ala Lys Ile Ala Asp Leu Ile Ala Arg

275 280 285

Glu Asn Val Leu Val Thr Pro His Thr Ala Phe Tyr Thr Thr Lys Ala

290 295 300

Val Leu Glu Met Val Thr Gln Ser Met Asn Ala Ser Leu Ala Phe Ile

305 310 315 320

Asn Gly Glu Lys Pro Ser Ile Ala Val Glu Tyr

325 330

Claims

A kind of 1. preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid, it is characterised in that：Using chenodeoxycholic acid as substrate, NAD⁺, lactic dehydrogenase, Sodium Pyruvate and buffer solution it is existing under the conditions of, deoxygenated with 7 α-steroid dehydrogenase enzymatic goose Cholic acid prepares-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid, and 7 α-steroid dehydrogenase derives from brucella melitensis Brucella Melitensis, the nucleotide sequence such as SEQ ID NO of the lactic dehydrogenase:Shown in 3, in whole catalystic converter system, The concentration of the substrate is 50~100mg/mL, the NAD⁺Concentration be 0.1~0.25mg/mL, the Sodium Pyruvate it is dense Spend for 10~30mg/mL；

7 α-steroid dehydrogenase is in SEQ ID NO:Following mutation are carried out in amino acid sequence shown in 2：D91K+ The mutant obtained after L92R, N117I+V118R, S195A or I241R+T243A.
2. the preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid according to claim 1, it is characterised in that：Control institute It is 25~35 DEG C that catalytic reaction, which is stated, in temperature, and pH value carries out under conditions of being 7.5~8.5.
3. the preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid according to claim 1, it is characterised in that：It is described slow It is 50~100mM kaliumphosphate buffers to rush solution.
4. the preparation method of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid according to claim 1, it is characterised in that：The system Preparation Method further includes following purification step：After treating the catalytic reaction, it is 1.0~2.0 to adjust pH value, stirring 20~ 30min, after cooling again filtered, washing, it is dry after up to-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid finished product.
5. one kind 7 α-steroid dehydrogenase, it is characterised in that：7 α-steroid dehydrogenase derives from brucella melitensis Brucella melitensis, prepare-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid, 7 α-class is solid for being catalyzed chenodeoxycholic acid Alcohol dehydrogenase is in SEQ ID NO:Following mutation are carried out in amino acid sequence shown in 2：D91K+L92R、N117I+V118R、 The mutant obtained after S195A or I241R+T243A.