CN107995929B - Preparation method of ursodeoxycholic acid and enzyme 1 for preparation thereof - Google Patents
Preparation method of ursodeoxycholic acid and enzyme 1 for preparation thereof Download PDFInfo
- Publication number
- CN107995929B CN107995929B CN201780001722.0A CN201780001722A CN107995929B CN 107995929 B CN107995929 B CN 107995929B CN 201780001722 A CN201780001722 A CN 201780001722A CN 107995929 B CN107995929 B CN 107995929B
- Authority
- CN
- China
- Prior art keywords
- beta
- ursodeoxycholic acid
- steroid dehydrogenase
- acid
- dehydrogenase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/02—Dehydrogenating; Dehydroxylating
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Steroid Compounds (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a method for preparing ursodeoxycholic acid by utilizing a biological enzyme catalysis technology and 7 beta-steroid dehydrogenase for preparing the same. The method takes 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid as a substrate, and uses 7 beta-steroid dehydrogenase to catalyze 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid to prepare ursodeoxycholic acid in the presence of NADP, glucose dehydrogenase and a buffer solution, wherein the 7 beta-steroid dehydrogenase is derived from ruminococcus rhodochrousRuminococcus torquesATCC 27756. The method has the advantages of simple operation, mild and easily-controlled reaction conditions, short reaction time, high conversion rate of the substrate up to more than 99.7 percent, and high product content of more than 98.5 percent.
Description
Technical Field
The invention relates to the field of molecular biology and biotechnology, in particular to a method for preparing ursodeoxycholic acid by utilizing a biological enzyme catalysis technology and 7 beta-steroid dehydrogenase for preparation.
Background
Ursodeoxycholic acid is the main effective component of rare Chinese medicine bear bile, has the functions of increasing bile acid secretion, changing bile component, being favorable for gradually dissolving cholesterol in gallstone, reducing cholesterol and cholesterol ester in bile, etc., and is mainly used for treating cholelithiasis. As is well known, bear gall is a very scarce resource because the traditional way of obtaining the bear gall is mainly to rely on a method for artificially breeding live bears to obtain the gall. At present, the traditional approach with long period, low yield and incompleteness is gradually replaced by an artificial synthesis method.
Originally, the artificial synthesis method of ursodeoxycholic acid was mostly a chemical method, and widely used in industrial production. But the chemical method has the defects of harsh operating conditions, low selectivity, environmental pollution, use of a large amount of organic solvent, residual organic solvent, toxicity, harm and the like. In order to solve the defects of the chemical method, people develop a new way and search for a better production way. The Chinese patent application CN105368828A discloses a method for preparing 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid ursodesoxycholic acid by whole-cell catalysis, but the method needs cell fermentation culture and has the defects of long reaction time, complex operation, complex product and the like.
Disclosure of Invention
The invention aims to provide a novel preparation method of ursodeoxycholic acid, which aims to overcome the defects of residual organic solvent, harsh conditions, long reaction time, complex operation, environmental pollution and the like existing in the existing preparation method mentioned in the background art.
In order to achieve the above objects, the inventors have found through a large number of experiments for a long time that after hundreds of failed attempts, a biological enzyme suitable for preparing ursodeoxycholic acid by extracellular biocatalysis is finally selected and optimized on the basis of the sequence to obtain a mutant enzyme with improved activity and substrate inhibition removal, thereby developing a novel method for preparing ursodeoxycholic acid, which is characterized in that: 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid is used as a substrate, and under the conditions of NADP, glucose dehydrogenase and a buffer solution, the 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid is catalyzed by 7 beta-steroid dehydrogenase to prepare ursodeoxycholic acid, wherein the 7 beta-steroid dehydrogenase is derived from Ruminococcus torsion ATCC 27756, the glucose dehydrogenase is derived from Bacillus megaterium, and the gene sequence of the glucose dehydrogenase is shown as SEQ ID NO: 3, in the whole catalytic reaction system, the concentration of the substrate is 50-100 mg/mL, the concentration of the NADP is 0.01-0.25 mg/mL, and the concentration of the glucose is 30-50 mg/mL.
The two enzymes used in the above method may be present in liquid form, solid form, or immobilized enzymes, and may be in the form of crude enzyme without purification, or in the form of partially or completely purified enzyme.
Preferably, the catalysis process is controlled to be carried out at the temperature of 25-35 ℃ and the pH value of 7.5-8.5.
Preferably, the buffer solution is 50-100 mM potassium phosphate buffer solution.
Preferably, the above preparation method further comprises the following purification steps: and after the reaction in the catalytic process is finished, adjusting the pH value to 10.5-12.5, removing insoluble substances, adjusting the pH value to 1.0-2.0, carrying out water bath at 50-60 ℃, stirring for 20-30 min, cooling, filtering, washing for three times, and carrying out vacuum drying to obtain the finished product of the ursodeoxycholic acid.
More preferably, the above preparation method further comprises the following refining step: and (3) stirring and refluxing the obtained finished product of ursodeoxycholic acid for 0.5-1h in 10-20 times of absolute ethyl alcohol at the temperature of 50-60 ℃ in a water bath, carrying out heat filtration, carrying out vacuum reduced pressure concentration on the filtrate until the volume is 1/4-1/5, adding 5-10 times of pure water, stirring for 1h, crystallizing, filtering, and carrying out vacuum drying on a filter cake to obtain the refined product of ursodeoxycholic acid.
Preferably, the 7 β -steroid dehydrogenase used in the above production method is a protein of the following (a) or (b):
(a) the amino acid sequence is shown as SEQ ID NO: 2, or a protein represented by the formula (2),
(b) the amino acid sequence defined in (a) is substituted, deleted or added with one or more amino acids, and has a sequence shown in SEQ ID NO: 2, and (b) a protein derived from (a) having a high catalytic activity of 7 β -steroid dehydrogenase.
More preferably, the 7 β -steroid dehydrogenase has a higher affinity to the polypeptide as set forth in SEQ ID NO: 2 has at least one mutation compared to the amino acid sequence at a site selected from at least one of: 66 th, 90 th, 91 th, 97 th, 150 th, 153 th, 189 th, 191 th, and 200 th bits.
More preferably, the 7 β -steroid dehydrogenase has at least one of the following mutations: D66N, Y90W, V91A, F97W, S150K, N153D, T189A, T191A, and G200K.
The present invention also provides a 7 β -steroid dehydrogenase characterized in that: the 7 beta-steroid dehydrogenase is derived from Ruminococcus torques ATCC 27756 of Ruminococcus twisted chain, and is used for catalyzing 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid to prepare ursodeoxycholic acid, and the 7 beta-steroid dehydrogenase is protein of the following (a) or (b):
(a) the amino acid sequence is shown as SEQ ID NO: 2, or a protein represented by the formula (2),
(b) the amino acid sequence defined in (a) is substituted, deleted or added with one or more amino acids, and has a sequence shown in SEQ ID NO: 2, and (b) a protein derived from (a) having a high catalytic activity of 7 β -steroid dehydrogenase.
Preferably, the 7 β -steroid dehydrogenase has a sequence similar to that set forth in SEQ ID NO: 2 has at least one mutation compared to the amino acid sequence at a site selected from at least one of: 66 th, 90 th, 91 th, 97 th, 150 th, 153 th, 189 th, 191 th, and 200 th bits.
Preferably, the 7 β -steroid dehydrogenase has at least one of the following mutations: D66N, Y90W, V91A, F97W, S150K, N153D, T189A, T191A, and G200K.
Has the advantages that:
1. compared with the existing preparation method of ursodeoxycholic acid, the method provided by the invention has the advantages of simple operation, mild and easily-controlled reaction conditions, short reaction time, no use of organic solvent, no toxicity, no pollution and low cost, and the practice proves that the reaction time of the method provided by the invention is only 6-12 hours, the conversion rate of the method to a substrate is up to more than 99.7%, and the content of the obtained product is more than 98.5%.
2. The invention screens out the 7 beta-steroid dehydrogenase gene suitable for preparing ursodeoxycholic acid by extracellular biocatalysis, optimizes the gene on the basis of the sequence, obtains mutant enzymes with improved activity and substrate inhibition removal, the mutant enzymes show high selectivity so that the method can not form byproducts, and the high catalytic activity and the high specificity of the mutant enzymes ensure that the cost of large-scale production of the ursodeoxycholic acid enzyme method is lower, and the method has higher industrial application value.
Detailed Description
The present invention will be described in further detail with reference to specific examples, which are illustrative of the present invention, but the present invention is not limited to the following examples, which do not indicate specific conditions, and are carried out under conventional conditions or conditions suggested by the manufacturers.
The specific implementation process of the preparation method of ursodeoxycholic acid provided by the invention is as follows:
suspending 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid in 50-100 mM potassium phosphate buffer (pH8.0), adjusting the pH to 8.0 with 10M NaOH, adding glucose with a final concentration of 30-50 mg/mL, adjusting the pH to 7.8-8.0 with 10M NaOH, adding 7 beta-steroid dehydrogenase and glucose dehydrogenase, finally adding NADP with a final concentration of 0.01-0.25 mg/mL, wherein the final concentration of a substrate is 50-100 mg/mL, reacting at a temperature of 25-35 ℃, 200-400 rpm and a pH of 7.5-8.5, and reacting for 6-12 h. And (3) taking reaction liquid at regular intervals, diluting the reaction liquid by 50-100 times with a mobile phase, and carrying out liquid phase analysis by sample injection after microfiltration. The liquid phase detection is carried out by using Phenomenx Gemini 5 mu mNX-C18110A 250X 4.6mm as an analytical column, and acetonitrile as a mobile phase, wherein the mobile phase is a buffer solution (0.78 g of sodium dihydrogen phosphate is taken, dissolved in 1L of water, and the pH value is adjusted to 3 by phosphoric acid), and methanol is 30:37:40, and the mixture is filtered by a 0.45-micron filter membrane for later use. The column temperature was 40 ℃ and the differential detector (RID) flow rate was 0.8 mL/min. After the reaction in the catalytic process is finished, adding 5-10M NaOH under the condition of rapid stirring to adjust the pH value of the reaction solution to 10.5-12.5, filtering to obtain a filtrate, dropwise adding hydrochloric acid into the filtrate until the pH value is 1.0-2.0, carrying out water bath at 50-60 ℃, stirring for 20-30 min, cooling, filtering, washing with water for three times, and carrying out vacuum drying to obtain the finished product of ursodeoxycholic acid. And then stirring and refluxing the finished product for 0.5-1h under the condition of 50-60 ℃ water bath by using 10-20 times of absolute ethyl alcohol, carrying out hot filtration, carrying out vacuum reduced pressure concentration on the filtrate until the volume is 1/4-1/5, adding 5-10 times of pure water, stirring for 1h, crystallizing, filtering, and carrying out vacuum drying on a filter cake overnight to obtain the refined product of ursodeoxycholic acid.
The two enzymes used in the above method may be present in the form of liquid enzyme, solid enzyme, or immobilized enzymes, and may be in the form of crude enzyme without purification, or in the form of partially or completely purified enzyme.
Example 1
Preparation of Co-expressed recombinant plasmid pET22b-BHSDH3-GDH containing parental Gene
The 7 beta-steroid dehydrogenase gene BHSDH3 derived from Ruminococcus torques ATCC 27756 and the glucose dehydrogenase gene GDH derived from Bacillus megaterium are subjected to enzyme digestion treatment after PCR products are obtained by PCR amplification technology respectively through a primer pair 5'CGCCATATGATGAACCTGCGTGAGAAGTA3' and 5'CCGGAATTCTTAGTAGAAGCTACCCATATAACG3' and a primer pair 5'CCGGAATTCAAGGAGATATACATATGATGTATACAGATTTAAAAGA3' and 5'CCGCTCGAGTTAGCCTCTTCCCGTTTGGA3', and are simultaneously inserted into Nde I and EcoR I sites and Xho I sites of an expression vector pET22b (+) to obtain the co-expression recombinant plasmid pET22b-BH 3-GDH. Determining the nucleotide sequence of the cloned parent 7 beta-steroid dehydrogenase as shown in SEQ ID NO: 1, and the amino acid sequence is shown as SEQ ID NO: 2 is shown in the specification; determining the nucleotide sequence of the cloned parent glucose dehydrogenase as shown in SEQ ID NO: 3, and the amino acid sequence is shown as SEQ ID NO: 4, respectively.
Example 2
Preparation of Co-expression recombinant plasmid containing 7 beta-steroid dehydrogenase mutant
The 7 beta-steroid dehydrogenase parent is subjected to site-directed mutagenesis by an inverse PCR technology, a target fragment is amplified by using upstream and downstream mutation primers at a mutation position through designing the reverse primers, corresponding mutation is introduced on the primers, inverse PCR is carried out by using a recombinant plasmid pET22b-BHSDH3-GDH as a template, a PCR product is converted into escherichia coli Rosetta (de3) after being treated by a Dpn I enzyme digestion template, and a bacterial colony is selected for sequencing after Amp screening. The mutation sites and primer design are shown in Table 1.
The PCR system is as follows: TaKaRa EX Taq HS 0.25 ul; 10 XEx Taq Buffer 5 ul; 1ul of template plasmid; dNTP (2.5mM each)4 ul; 1ul of upstream primer; 1ul of downstream primer; sterile water up to 50 ul.
The PCR procedure was: firstly, the temperature is 98 ℃ for 2 min; then the temperature is 10s at 98 ℃, 30s at 50-65 ℃ and 7min at 72 ℃ for 30 cycles; finally, 10min at 72 ℃.
TABLE 1
Example 3
Preparation of enzyme solution
Respectively transferring the parental and mutant co-expression recombinant plasmids prepared in the example 1 and the example 2 into Escherichia coli Rosetta (de3), inoculating the obtained recombinant Escherichia coli into a small volume of LB culture medium (containing Amp of 100 mu g/mL), culturing overnight at 30-37 ℃, then transferring 1-5% of inoculum size into a certain volume of LB culture medium (containing Amp of 100 mu g/mL), and continuously culturing OD at 30-37 DEG C600Adding isopropyl-beta-D-thiogalactoside (IPTG) with the final concentration of 0.1 mM-1 mM when the concentration reaches 0.6-1.0, carrying out induced expression for 8-20 h at the temperature of 20-37 ℃, and then centrifuging to collect thalli. The fermentation thallus is suspended in a certain volume of 50-100 mM potassium phosphate buffer solution (pH8.0), broken by ultrasonic waves, and centrifuged to obtain a crude enzyme solution containing glucose dehydrogenase and a 7 beta-steroid dehydrogenase parent or a 7 beta-steroid dehydrogenase mutant, and the crude enzyme solution can be used for enzyme activity determination and biological catalysis preparation of ursodeoxycholic acid.
Example 4
Determination of enzyme Activity
The enzyme activity determination method of the 7 beta-steroid dehydrogenase comprises the following steps: 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid is taken as a substrate, 10uL of 150mM3 alpha-hydroxy-7 oxo-5 beta-cholanic acid and 100uL of diluted enzyme solution are added into a 3mL reaction system, the final concentration of NADP + is 0.2mM, the reaction is carried out for a certain time at pH8.0 and 25 ℃, and the increase of the absorbance is measured at 340 nm.
The enzyme activity determination method of the glucose dehydrogenase comprises the following steps: using glucose as a substrate, 100uL of 50mM glucose and 100uL of a diluted enzyme solution, NADPH at a final concentration of 0.2mM, were added to a 3mL reaction system, and the reaction was carried out at pH8.0 and 25 ℃ for a certain period of time, and the decrease in absorbance was measured at 340 nm.
The results of the enzyme activity measurement are shown in Table 2, in which GDH is glucose dehydrogenase and 7. beta. -HSDH is 7. beta. -steroid dehydrogenase.
TABLE 2
Example 5
Preparation of ursodeoxycholic acid
Referring to the specific implementation of the method for producing ursodeoxycholic acid, the crude enzyme solution prepared in example 3 was used, the amount of the enzyme solution added was controlled such that the final concentration of the substrate 3 α -hydroxy-7 oxo-5 β -cholanic acid was 100mg/mL, based on the weight of the enzyme solution in the entire volume of the reaction system, and the other specific parameters are shown in table 3. And after 6-12 h of reaction, the conversion rate of the substrate is over 99.7%, the content of the finished product is over 98.5%, and the yield is 85-93%.
TABLE 3
Example 6
Preparation of ursodeoxycholic acid
In the total system 1L, 50G of 99% 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid is suspended in 100mM potassium phosphate buffer (pH8.0), pH is adjusted to 8.0 by 10M NaOH, glucose with the final concentration of 50G/L is added, 0.09G of 7 beta-steroid dehydrogenase freeze-dried powder (G200K mutant enzyme) and 0.06G of glucose dehydrogenase freeze-dried powder are sequentially added, and NADP with the final concentration of 0.15G/L is finally added, and the final concentration of a substrate is 50G/L. The reaction is carried out for 6 hours at 25 ℃, 250rpm and pH8.0, and the conversion rate reaches 99.8 percent. After the reaction is finished, adding 10M NaOH under the condition of rapid stirring until the pH value is 12.5, filtering to obtain a filtrate, dropwise adding hydrochloric acid into the filtrate until the pH value is 1.0, carrying out water bath at 55 ℃, stirring for 30min, cooling, filtering, washing with water for three times, and carrying out vacuum drying to obtain 56g of finished products of ursodeoxycholic acid. Dissolving the obtained finished product of ursodeoxycholic acid with 800ml of absolute ethyl alcohol, stirring for 1h under the condition of 60 ℃ water bath, carrying out hot filtration, washing a filter cake with a small amount of ethyl alcohol, concentrating the filtrate under reduced pressure to 200ml, adding 2L of pure water, stirring for 1h, filtering, washing the filter cake with water for three times, and drying the obtained filter cake in vacuum to obtain 50.5g of a refined product of ursodeoxycholic acid.
Claims (5)
1. A preparation method of ursodeoxycholic acid is characterized by comprising the following steps: at 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid as a substrate, and catalyzing 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid with 7 beta-steroid dehydrogenase to prepare ursodeoxycholic acid in the presence of NADP, glucose dehydrogenase and a buffer solution, wherein the 7 beta-steroid dehydrogenase is derived from Ruminococcus streptococciRuminococcus torquesATCC 27756, said glucose dehydrogenase derived from Bacillus megateriumBacillus megateriumThe gene sequence is shown as SEQ ID NO: 3, in the whole catalytic reaction system, the concentration of the substrate is 50-100 mg/mL, the concentration of the NADP is 0.01-0.25 mg/mL, and the concentration of the glucose is 30-50 mg/mL; the 7 beta-steroid dehydrogenase is a mutant represented by SEQ ID NO: 2, the following mutations are carried out on the basis of the amino acid sequence shown in the specification: mutants obtained after D66N + F97W, Y90W + V91A, S150K + N153D, T189A + T191A or G200K.
2. The method for producing ursodeoxycholic acid according to claim 1, wherein: the catalytic process is controlled to be carried out under the conditions that the temperature is 25-35 ℃ and the pH value is 7.5-8.5.
3. The method for producing ursodeoxycholic acid according to claim 1, wherein: the buffer solution is 50-100 mM potassium phosphate buffer solution.
4. The method of claim 1, further comprising the step of purifying: after the reaction in the catalytic process is finished, adjusting the pH value to 10.5-12.5, removing insoluble substances, adjusting the pH value to 1.0-2.0, carrying out water bath at 50-60 ℃, stirring for 20-30 min, cooling, filtering, washing with water for three times, and carrying out vacuum drying to obtain the finished product of ursodeoxycholic acid.
5. A 7 β -steroid dehydrogenase comprising: the 7 beta-steroid dehydrogenase is derived from Ruminococcus torques ATCC 27756 of Ruminococcus twisted chain, and is used for catalyzing 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid to prepare ursodeoxycholic acid, wherein the 7 beta-steroid dehydrogenase is represented by SEQ ID NO: 2, the following mutations are carried out on the basis of the amino acid sequence shown in the specification: mutants obtained after D66N + F97W, Y90W + V91A, S150K + N153D, T189A + T191A or G200K.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2017/070604 WO2018126468A1 (en) | 2017-01-09 | 2017-01-09 | Preparing method for ursodesoxycholic acid and enzyme 1 used in preparation of the ursodesoxycholic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107995929A CN107995929A (en) | 2018-05-04 |
| CN107995929B true CN107995929B (en) | 2021-04-06 |
Family
ID=62041348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201780001722.0A Active CN107995929B (en) | 2017-01-09 | 2017-01-09 | Preparation method of ursodeoxycholic acid and enzyme 1 for preparation thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN107995929B (en) |
| WO (1) | WO2018126468A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235122B (en) * | 2019-01-29 | 2020-10-30 | 武汉生之源生物科技股份有限公司 | 3 alpha hydroxysteroid dehydrogenase mutant and application thereof in total bile acid detection |
| CN114854707B (en) * | 2022-06-14 | 2023-09-12 | 苏州百福安酶技术有限公司 | 7 beta-hydroxysteroid dehydrogenase mutant |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994604A (en) * | 2012-11-21 | 2013-03-27 | 上海凯宝药业股份有限公司 | Method for preparing binding-form ursodesoxycholic acid by two-step enzymatic method |
| CN104350157A (en) * | 2012-05-28 | 2015-02-11 | 化学药品与食品产品股份公司 | Process for the selective reduction of bile acids, salts or derivatives thereof, in biphasic system |
| CN105441399A (en) * | 2010-12-16 | 2016-03-30 | 细胞制药有限公司 | Novel 7 Beta-hydroxysteroid dehydrogenase mutants and process for the preparation of ursodeoxycholic acid |
| CN106086149A (en) * | 2016-06-20 | 2016-11-09 | 苏州汉酶生物技术有限公司 | A kind of chemical-enzymatic prepares the method for ursodesoxycholic acid |
-
2017
- 2017-01-09 CN CN201780001722.0A patent/CN107995929B/en active Active
- 2017-01-09 WO PCT/CN2017/070604 patent/WO2018126468A1/en active Application Filing
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441399A (en) * | 2010-12-16 | 2016-03-30 | 细胞制药有限公司 | Novel 7 Beta-hydroxysteroid dehydrogenase mutants and process for the preparation of ursodeoxycholic acid |
| CN104350157A (en) * | 2012-05-28 | 2015-02-11 | 化学药品与食品产品股份公司 | Process for the selective reduction of bile acids, salts or derivatives thereof, in biphasic system |
| CN102994604A (en) * | 2012-11-21 | 2013-03-27 | 上海凯宝药业股份有限公司 | Method for preparing binding-form ursodesoxycholic acid by two-step enzymatic method |
| CN106086149A (en) * | 2016-06-20 | 2016-11-09 | 苏州汉酶生物技术有限公司 | A kind of chemical-enzymatic prepares the method for ursodesoxycholic acid |
Non-Patent Citations (4)
| Title |
|---|
| Ming-Min Zheng等.Two-step enzymatic synthesis of ursodeoxycholic acid with a new 7-hydroxysteroid dehydrogenase from Ruminococcus torques.《Process Biochemistry》.2015,第50卷(第4期), * |
| Pajon,A.等.Short-chain dehydrogenases of various substrate specificities [[Ruminococcus] torques L2-14].《Genbank》.2015, * |
| Short-chain dehydrogenases of various substrate specificities [[Ruminococcus] torques L2-14];Pajon,A.等;《Genbank》;20150227;第1页 * |
| Two-step enzymatic synthesis of ursodeoxycholic acid with a new 7-hydroxysteroid dehydrogenase from Ruminococcus torques;Ming-Min Zheng等;《Process Biochemistry》;20150117;第50卷(第4期);第598页摘要，第599页第2.1-2.2节，第600页第2.7节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107995929A (en) | 2018-05-04 |
| WO2018126468A1 (en) | 2018-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636285B (en) | A kind of preparation method of urso and its alternation enzyme processed | |
| CN107995929B (en) | Preparation method of ursodeoxycholic acid and enzyme 1 for preparation thereof | |
| CN107980064B (en) | Preparation method of ursodeoxycholic acid and enzyme 2 for preparation | |
| EP2143785B1 (en) | Method for producing glucuronic acid by glucuronic acid fermentation | |
| CN107995928B (en) | Preparation method of 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid and enzyme 1 for preparation | |
| CN111269870A (en) | Recombinant escherichia coli with high cytidylic acid yield and application thereof | |
| JP6893000B2 (en) | Method for preparing acid phosphatase mutant and nicotinamide riboside | |
| CN109706189B (en) | Preparation method of D-chiro-inositol | |
| CN107980060B (en) | Preparation method of 3 alpha-hydroxy-7 oxo-5 beta-cholanic acid and enzyme 2 for preparation | |
| CN115927141B (en) | Double-enzyme co-expression strain for synthesizing NMN, construction method and application thereof | |
| CN115975989A (en) | III type pullulanase mutant for preparing corn resistant starch and preparation method and application thereof | |
| CN106520889B (en) | A kind of preparation method and its alternation enzyme processed 3 of-7-5 β of oxo of 3 Alpha-hydroxy-cholanic acid | |
| CN110804602B (en) | L-aspartic acid beta-decarboxylase mutant and application thereof | |
| CN110791483B (en) | Short-chain reductase and preparation method and application thereof | |
| CN108034649B (en) | Glucose isomerase mutant and application thereof | |
| KR101219685B1 (en) | L-Arabinose production in a packed-bed bioreactor containing immobilized alpha-L-arabinofuranosidase and endo-1,5-alpha-L-arabinanase | |
| CN114958815B (en) | D-psicose 3-epimerase and immobilization method thereof | |
| CN116254279B (en) | Method for catalyzing xylitol to biosynthesize L-xylose by using double-enzyme cascade recombinant escherichia coli | |
| CN115678879A (en) | Immobilization method of 7 beta-hydroxycholate dehydrogenase | |
| CN117402847A (en) | 4-aminobutyric acid transaminase and encoding gene and application thereof | |
| CN118291407A (en) | Application of short-chain dehydrogenase and mutant thereof | |
| CN118406667A (en) | Mannitol-1-phosphate dehydrogenase mutant and application thereof | |
| CN115976139A (en) | Method for synthesizing Gal-G2-CNP by enzyme method and application | |
| CN116287084A (en) | Method for synthesizing deoxycholic acid by enzyme conversion | |
| CN114774334A (en) | Microbacterium abyssinicus SUC7, sucrose phosphorylase produced by same and application of sucrose phosphorylase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |