WO2018121476A1

WO2018121476A1 - Single domain antibody which recognizes complex formed by hla-a2 molecule and nlvpmvatv short peptide

Info

Publication number: WO2018121476A1
Application number: PCT/CN2017/118291
Authority: WO
Inventors: 古明珠; 高斌; 吕丽慧; 刘莹; 梁猛
Original assignee: 天津天锐生物科技有限公司
Priority date: 2016-12-28
Filing date: 2017-12-25
Publication date: 2018-07-05
Also published as: CN107663239A

Abstract

Provided is a single domain antibody which recognizes an HLA-A2/NLVPMVATV complex. Further provided on the basis of said antibody is a fusion protein which may specifically recognize an HLA-A2/NLVPMVATV complex and an application in the biomedical field.

Description

Single domain antibody recognizing a complex of HLA-A2 molecule and NLVPMVATV short peptide

Technical field

The invention belongs to the technical field of tumor immunotherapy, and particularly relates to a single domain antibody which recognizes a complex formed by an HLA-A2 molecule and a NLVPMVATV short peptide.

Background technique

Cytomegalovirus (CMV) is a double-stranded DNA virus belonging to the herpesvirus family and has latent-activated biological properties. It can infect humans, cattle, horses, pigs and other mammals. The human CMV is called human cytomegalovirus (HCMV), and only HCMV infects humans. In developed countries, the infection rate of HCMV population is above 50%, while in China, the infection rate of HCMV population is 70%-90%, and the infection rate of children is high. Epidemiological data show that about 30% to 70% of American preschool children Infected with HCMV. Congenital and perinatal infection with HCMV is the main cause of birth defects, mainly leading to liver damage. In severe cases, it may be associated with liver failure, and abnormal coagulation function, which may cause biliary atresia and even endanger the life of the child. In addition, HCMV infection can also cause diseases such as the nervous system, genitourinary system, lung and blood system.

It is currently believed that in a normal susceptible population, HCMV infection will become a lifelong carrier of HCMV, presenting a state of recessive infection. The latent HCMV in the carrier does not have the ability to cause disease when the immune function of the body is normal. When the carrier is immunosuppressed or defective, the HCMV in the body may induce certain tumors.

The manifestations of brain developmental malformations caused by HCMV infection mainly include head deformity, intracranial calcification, hydrocephalus, brain atrophy, cerebral palsy, etc. Most of the symptoms appear in infancy, and CT manifestations include brain development abnormalities, brain softening, and medulla. Sheath retardation, hydrocephalus (including obstructive hydrocephalus and external hydrocephalus) and changes in brain atrophy. Neonatal mice have the highest infection rate, immature developmental brain is more susceptible to infection than mature brain, and the sensitivity of CMV in developing mice decreases with age. In the experiment, almost all cells in the brain slices of newly infected mice were infected. The infected cells in the 7-day-old brain slices had a tendency to concentrate in the subventricular zone and the subcortex, and 14 days after birth. Infected cells of 21d mouse brain slices were more distributed in the subventricular zone and less distributed in the subcortical layer. Although this phenomenon cannot be explained, it can be seen that this spatial difference in performance protects the cortex and white matter, delays the time of virus invasion, and reduces the irreversible damage of HCMV to the nervous system. The phase of the cell cycle in which the cell is infected is also closely related to the severity of the infection. This phase difference in cell cycle is the result of interactions between different cyclins and HCMV that act on each phase of the cell cycle.

To date, there are no specific treatments for HCMV infection. Clinically, the drugs in antiviral therapy are GCV, valganciclovir, foscarnet, cidofovir, and ganciclovir can be used in combination with gamma globulin to treat HCMV infection and enhance the efficacy. GCV is currently the most important therapeutic drug used clinically and is a derivative of acyclovir. However, GCV can only suppress viral infections and cannot completely eliminate the virus.

Through studies on animal models and CMV-infected individuals, it was found that the T cell immune response plays a decisive role in inhibiting CMV replication and preventing its pathogenesis. The body's immune response to CMV is mainly mediated by Pp65. Pp65 protein is the main component of viral particles and can be observed early in viral replication. It is also a strong antigen that stimulates the body's immune response and helps clear the virus. Pp65 _{495-503 (NLVPMVATV)} is a T cell primary recognition peptide presented by HLA-A2. The following HLA-A2/Pp65 _{495-503 (NLVPMVATV)} are abbreviated as HLA-A2/NLVPMVATV. Based on the above research, Pp65 antigen has become a research hotspot in the research of tumor biotherapy. Especially as a dominant target for genetically modified TCR, CART, TCR-like antibodies.

Although TCR can recognize both extracellular antigens and intracellular antigens that are presented to the cell surface by antigen processing, TCR usually needs to isolate specific αβTCR genes from T cell clones, which is difficult and reproducible. In addition, transgenic TCRs have potential safety hazards associated with TCR mismatches, and the two strands of exogenous TCR may be mismatched with endogenous TCR subunits to form a new TCR. This mismatched TCR creates an unknown specificity that may target normal tissues, resulting in a severe graft-versus-host response.

If an antibody molecule that recognizes the MHC polypeptide complex can be prepared and expressed on the cell surface, T cell immunity and mature antibody technology can be combined to develop a novel T cell modification treatment that combines the advantages of antibodies and T cells. technology. Compared with the CAR, the novel MHC polypeptide complex recognizes the tumor extracellular antigen and recognizes the antigen through the self-heterologous recognition mechanism obtained during the evolution of life. The formation of viral antigens, and thus has a wider range of applications, has a unique advantage.

Willensen et al. specific MAGE-A1 polypeptide, HLA-A1 restricted MAR armed with retrovirus T cells, proved that MAR-A1 specifically recognizes HLA-A1/MAGE-A1 double positive melanoma cells, induces T The cells release interferon and specifically kill these melanoma cells in vitro, confirming the biological function of these antibodies for the first time (Chames P et al: PANS 2000, 97(14): 7969-74). Andrea Schub et al. constructed CMV-TCRs using HLA-A2/NLVPMVATV-specific human SCFV genes, which specifically recognize endogenously processed Pp65, secrete IFN-γ and IL-2, cytotoxicity, and Enriched by antigen stimulation (Andrea Schub et al: J Immunol 2009; 183: 6819-6830).

Invention disclosure

It is an object of the present invention to provide a single domain antibody that recognizes HLA-A2/NLVPMVATV.

The single domain antibody recognizing HLA-A2/NLVPMVATV provided by the present invention comprises a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, and the single domain antibody is as follows (a) or (b):

(a) The complementarity determining region CDR1 of the single domain antibody is as follows (a1) or (a2) or (a3):

(a1) comprising the amino acid sequence of SEQ ID No. 1;

(a2) the amino acid sequence of SEQ ID No. 1;

(a3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 1 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR2 of the single domain antibody is as follows (a4) or (a5) or (a6):

(a4) comprising the amino acid sequence shown in SEQ ID No. 2;

(a5) Amino acid sequence shown in SEQ ID No. 2

(a6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 2 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR3 of the single domain antibody is as follows (a7) or (a8) or (a9):

(a7) comprising the amino acid sequence shown in SEQ ID No. 3;

(a8) an amino acid sequence of SEQ ID No. 3;

(a9) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 3 to substitution and/or deletion and/or addition of one or several amino acid residues;

(b) The complementarity determining region CDR1 of the single domain antibody is as follows (b1) or (b2) or (b3):

(b1) comprising the amino acid sequence shown in SEQ ID No. 4;

(b2) the amino acid sequence shown in SEQ ID No.

(b3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 4 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR2 of the single domain antibody is as follows (b4) or (b5) or (b6):

(b4) comprising the amino acid sequence of SEQ ID No. 5;

(b5) the amino acid sequence shown in SEQ ID No. 5

(b6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 5 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR3 of the single domain antibody is as follows (b7) or (b8) or (a9):

(b7) comprising the amino acid sequence of SEQ ID No. 6;

(b8) the amino acid sequence of SEQ ID No. 6;

(b9) An amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 6 to substitution and/or deletion and/or addition of one or several amino acid residues.

Specifically, the single domain antibody is as follows (c1) or (c2):

(c1) the amino acid sequence of SEQ ID No. 7 or SEQ ID No. 8;

(c2) An amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 7 or SEQ ID No. 8 to substitution and/or deletion and/or addition of one or several amino acid residues.

Another object of the present invention is to provide a derivative of the above single domain antibody.

The derivative provided by the present invention is any of the following (d1) to (d9):

(d1) a fusion protein prepared from the above single domain antibody and at least one polypeptide molecule having therapeutic or recognition function;

(d2) a multispecific or multifunctional molecule comprising the above single domain antibody;

(d3) a composition comprising the above single domain antibody;

(d4) an immunoconjugate comprising the above single domain antibody;

(d5) an antibody obtained by modifying and/or modifying the above single domain antibody or antigen binding portion thereof;

(d6) a heavy chain variable region or a light chain variable region comprising the above-described complementarity determining region;

(d7) an scFv or antibody comprising the above-described complementarity determining region;

(d8) comprising one or two or more amino acid sequences of said complementarity determining regions, and having at least 79% homology to an amino acid sequence of one complementarity determining region;

(d9) one or two or more amino acid sequences in the framework region of the above single domain antibody, and having at least 90% homology to the amino acid sequence of one framework region.

In the above derivative, the fusion protein is obtained by directly fusing the above single domain antibody with at least one polypeptide molecule having therapeutic or recognition function, or by a linker peptide and one or more therapeutic or recognition functions. The polypeptide molecules are linked together.

In the above derivatives, the polypeptide molecule having a therapeutic or recognition function is a human Fc protein. The fusion protein is an Fc fusion protein obtained by fusing the above single domain antibody with a human Fc protein. When the single domain antibody is fused to the human Fc protein, the monovalent antibody becomes a bivalent antibody, and the affinity is improved.

The specific preparation method of the Fc fusion protein comprises the steps of: introducing the coding gene of the single domain antibody and the coding gene of the human Fc protein into a host cell to obtain a recombinant cell; and culturing the recombinant cell to obtain the fusion protein.

Specifically, the coding gene of the single domain antibody and the coding gene of the human Fc protein are introduced into a host cell by a recombinant vector;

The recombinant vector is obtained by inserting a gene encoding the single domain antibody and a fragment encoding the human Fc protein into a multiple cloning site of an expression vector.

Specifically, the gene encoding the single domain antibody and the gene encoding the human Fc protein are the DNA molecules shown in SEQ ID No. 11.

Specifically, the expression vector may be pcDNA3.1; the host cell may be a 293F cell.

In the above derivatives, the composition may be a pharmaceutical composition containing a pharmaceutically acceptable carrier. The pharmaceutical compositions of the invention may be administered in combination therapy, i.e., in combination with other agents. The term "pharmaceutically acceptable carrier" as used herein includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like which are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active compound, ie, an antibody, immunoconjugate or bispecific molecule or multispecific molecule, can be coated in a material to protect the compound from acids and other natural compounds that can inactivate the compound. The role of the condition.

The pharmaceutical compositions of the invention may comprise one or more pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" as used herein refers to a salt which retains the desired biological activity of the parent compound and does not cause any unwanted toxicological effects. Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from non-toxic inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, phosphorous acid, and the like, as well as non-toxic organic acids such as aliphatic monocarboxylic acids and dicarboxylic acids. Derivatized salts of acids, phenyl substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, and the like. Base addition salts include those derived from alkaline earth metals such as sodium, potassium, magnesium, calcium, and the like, as well as non-toxic organic amines such as N,N'-dibenzylethylenediamine, N-methylglucamine, chlorine Salt derived from procaine, choline, diethanolamine, ethylenediamine, procaine, and the like.

The pharmaceutical compositions of the invention may also contain a pharmaceutically acceptable antioxidant. Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium hydrogen sulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants such as ascorbic acid palmitate Ester, butylated hydroxyanisole (BHA), butylated hydroxytoluene (DHT), lecithin, propyl gallate, alpha-tocopherol, etc.; (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA) , sorbitol, tartaric acid, phosphoric acid, etc.

Examples of suitable aqueous or nonaqueous vehicles which may be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils such as olive oil, And injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the application of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

In practical applications, these compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the presence of microorganisms can be ensured by a sterilization procedure or by the inclusion of various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol sorbic acid, and the like.

The compositions of the invention may be administered by one or more routes of administration using one or more methods well known in the art. Those skilled in the art will appreciate that the route and/or manner of administration will vary depending on the desired result.

The compositions of the invention have therapeutic applications in vitro and in vivo. For example, these molecules can be administered to cells cultured in vitro or ex vivo, or administered to a human subject in vivo to treat, prevent or diagnose a variety of diseases. The term "subject" as used herein includes both human and non-human animals. Non-human animals include all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles.

In the above derivative, the immunoconjugate may be a conjugate obtained by coupling the above single domain antibody with a therapeutic agent such as a cytotoxin, a drug (for example, an immunosuppressive agent) or a radioactive toxin. These conjugates are referred to as "immunoconjugates." An immunoconjugate comprising one or more cytotoxins is referred to as an "immunotoxin." Cytotoxins or cytotoxic agents include any agent that is detrimental to the cell (eg, kills). Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, ipecaine, mitomycin, epipodophyllotoxin, epipodophyllotoxin, vincristine, vinblastine , colchicine, doxorubicin, daunorubicin, dihydroxy anthrax dione, mitoxantrone, phosfomycin, actinomycin D, l-dehydrotestosterone, glucocorticoid, proca , tetracaine, lidocaine, propranolol and puromycin and their analogs or homologs. Therapeutic agents also include, for example, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, decarbazine, a burning agent ( For example, nitrogen mustard, thioepa chlorambucil, phenylalanine mustard, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, chain Oxazomycin, mitomycin C and cis-dichlorodiamine platinum (II) (DDP) cisplatin, anthracyclines (eg, daunorubicin (formerly known as daunorubicin) and trichothecene , antibiotics (eg, actinomycin D, bleomycin, phosfomycin, and amphotericin (AMC)), and anti-mitotic agents (eg, vincristine and vinblastine). Other preferred examples of antibody-conjugated therapeutic cytotoxins include doxorubicin, calicheamicin, maytansin, auristatin, and derivatives thereof. Coupling of a cytotoxin with an antibody of the invention can be utilized in the art. Joint technology.

The antibodies of the invention may also be conjugated to a radioisotope to produce a cytotoxic radiopharmaceutical, also known as a radioimmunoconjugate. Examples of radioisotopes that can be coupled to antibodies for diagnostic or therapeutic use include, but are not limited to, iodine ¹³¹ , indium ¹¹¹ , 钇^90, and 镥¹⁷⁷ . Methods of preparing radioactive immunoconjugates have been established in the art. Examples of radioimmunoconjugates are commercially available, including Zevalin ^(TM) (IDEC Pharmaceuticals) and Bexxar ^(TM) (Corixa Pharmaceuticals), which are capable of producing radioimmunoconjugates using similar methods using the antibodies of the invention.

The antibody conjugates of the invention can be used to modify a particular biological response, and the drug moiety should not be construed as being limited to classical chemotherapeutic agents. For example, the drug moiety can be a protein or polypeptide having the desired biological activity. Such proteins may include, for example, enzymatically active toxins or active fragments thereof, such as abrin, ricin A, Pseudomonas exotoxin or diphtheria toxin; proteins such as tumor necrosis factor or interferon- γ; or biological response regulators such as lymphokines, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophages Cell colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF) or other growth factors.

The antibody genetically engineered antibody obtained by modifying and/or modifying the above single domain antibody or antigen binding portion thereof is also within the scope of the present invention. The single domain antibodies provided herein comprise CDR1, CDR2 and CDR3 sequences, wherein one or more of these CDR sequences comprise a specific amino acid sequence based on a single domain antibody of the invention or a conservative modification thereof, and wherein the antibody retains an antibody of the invention It has the functional characteristics of identifying and/or combining HLA-A2/NLVPMVATV. The term "conservative sequence modification" as used herein refers to an amino acid modification that does not significantly affect or alter the binding characteristics of an antibody comprising the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the antibodies of the invention by techniques well known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitution refers to the replacement of an amino acid residue with an amino acid residue having a similar side chain. A family of amino acid residues having similar side chains has been defined in the art. These families include: basic side chains (eg, lysine, arginine, histidine), acidic side chains (eg, aspartic acid, glutamic acid), uncharged polar side chains (eg, glycine, Asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (eg alanine, valine, leucine, isoleucine) Acid, proline, phenylalanine, methionine), β-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, styrene Amino acids of amino acids, tryptophan, histidine). Thus, one or more amino acid residues within the CDR regions of an antibody of the invention can be substituted for other amino acid residues from the same side chain family, and the above-described functions of altered antibody retention can be detected using the in vitro affinity assays described herein. .

One type of variable region engineering that can be performed is CDR grafting. The antibody interacts with the target antigen primarily through amino acid residues located in the complementarity determining regions (CDRs). For this reason, the amino acid sequences within the CDRs are more diverse between the individual antibodies than the sequences outside the CDRs. Since the CDR sequences are responsible for most antibody-antigen interactions, recombinant antibodies that mimic the properties of the particular antibody present can be expressed by constructing an expression vector comprising a CDR sequence from a particular antibody present, which is grafted to From the backbone sequences of different antibodies with different properties, these backbone sequences can be obtained from public DNA databases or published references.

Another type of variable region modification is to mutate the amino acid sequence within the CDR1, CDR2 and/or CDR3 regions to improve one or more binding properties (e.g., affinity) of the antibody of interest. Site-directed mutagenesis or PCR-mediated mutagenesis can be performed to introduce mutations, effects on antibody binding, or other target functional properties, which can be evaluated using the assays described herein and provided in the Examples. Conservative sequence modifications (as described above) are preferably introduced. The mutation may be an amino acid substitution, addition or deletion, but is preferably substituted. Moreover, typically no more than 5 residues are altered within the CDR regions.

Engineered antibodies of the invention include, for example, antibodies whose backbone residues have been modified to improve the properties of the antibody. Such backbone modifications are generally made to reduce the immunogenicity of the antibody. The backbone modification involves mutating one or more residues within the framework region, or even one or more CDR regions, to remove T cell epitopes, thereby reducing the potential immunogenicity of the antibody.

In the above derivatives, the framework region is positions 1-26, 36-49, 56-97, 111-121 of SEQ ID No. 7, or positions 1-26 of SEQ ID No. 8. , 36-49, 56-97, 115-125.

The term "homology" as used herein may describe the degree of similarity between two or more amino acid sequences, and the percentage of homology between the first amino acid sequence and the second amino acid sequence may be determined by the formula: (first amino acid The number of amino acid residues in the sequence that is identical to the amino acid sequence at the corresponding position in the second amino acid sequence) / (total number of amino acids in the first amino acid sequence) * 100%, wherein the second amino acid sequence can only be Deletions, insertions, substitutions or additions of amino acids (compared to the first amino acid) are considered to be different. The percent homology can also be obtained using known computer algorithms for sequence matching such as NCBI Blast.

The present invention also provides a biological material related to the above single domain antibody or the above derivative.

The biomaterial provided by the present invention is any one of the following (e1) to (e4):

(e1) a nucleic acid molecule encoding the above single domain antibody;

(e2) a nucleic acid molecule encoding the above fusion protein;

(e3) a vector comprising the nucleic acid molecule of (e1) or (e2);

(e4) A host cell comprising the nucleic acid molecule of (e1) or (e2) or the vector of (e3).

In the above biological material, the nucleic acid molecule is any one of the following (f1) to (f3):

(f1) a DNA molecule represented by SEQ ID No. 9 or SEQ ID No. 10 or SEQ ID No. 11;

(f2) a DNA molecule having 75% or more of the identity of the nucleotide sequence defined by (f1) and encoding the above single domain antibody or fusion protein;

(f3) a DNA molecule which hybridizes under stringent conditions to a nucleotide sequence defined by (f1) or (f2) and which encodes the above single domain antibody or fusion protein.

In the above biological material, the nucleic acid molecule may be a nucleotide sequence encoding each complementarity determining region or a single domain antibody or a fusion protein amino acid sequence, and the specific sequence of the corresponding nucleic acid molecule can be obtained at any time by the genetic code. Due to the annexation of the genetic code, the nucleic acid molecule can be varied for different application purposes. The term "codon" as used herein, also referred to as a triplet codon, refers to a nucleotide triplet corresponding to an amino acid. The location of the amino acid insertion into the growing polypeptide chain is determined during translation.

The nucleic acid molecules of the invention can be obtained using conventional molecular biology techniques. For antibodies obtained from immunoglobulin gene libraries (eg, using phage display technology), nucleic acids encoding antibodies can be obtained from libraries.

In the above biological material, the nucleic acid sequence or at least part of the sequence in the vector can be expressed by a suitable expression system to obtain a corresponding protein or polypeptide; the expression system includes bacteria, yeast, filamentous fungus, lactation Animal cells, insect cells, plant cells or cell-free expression systems.

The present invention also provides the novel use of the above single domain antibody or the above derivative or the above biological material.

The present invention provides the use of the above single domain antibody or the above derivative or the above biological material in any of the following (g1) to (g4):

(g1) specifically recognizing and/or binding to HLA-A2/NLVPMVATV;

(g2) preparing a product that specifically recognizes and/or binds to HLA-A2/NLVPMVATV;

(g3) treating diseases caused by cytomegalovirus;

(g4) A product for treating a disease caused by cytomegalovirus.

In the above application, the product is a drug.

Specific examples of diseases caused by cytomegalovirus which can be treated with the antibody of the present invention include, but are not limited to, interstitial pneumonia caused by cytomegalovirus, hepatitis, gastroenteritis or retinitis.

In practical applications, the T cells can be modified in vitro by using the antibody or fusion protein of the present invention to obtain T cells after arming, and the T cells are amplified after being armed, and then returned to the subject, and the armed T cells can be specific. Identify cells infected with cytomegalovirus for the treatment of diseases caused by cytomegalovirus in vivo. Modification of T cells can be achieved by conventional methods well known to those skilled in the art.

The HLA-A2/NLVPMVATV of the present invention is an HLA-A2/NLVPMVATV antigen complex, which is a complex of the cytomegalovirus antigen peptide NLVPMVATV and the antigen molecule HLA-A2.

The HLA-A2/NLVPMVATV antibody referred to in this patent is a single domain antibody. A single domain antibody differs from SCFV in that it contains only one variable region of the antibody heavy chain, approximately half the size of SCFV, and is the smallest fully functional antigen-binding fragment with weak immunogenicity; easier to penetrate through the vessel wall Solid tumors are beneficial to the treatment of tumors. Single domain antibodies against HLA-A2/NLVPMVATV have not been reported.

The present invention is directed to the technical problems existing in the prior art, and the antibodies with higher affinity are screened from the phage single domain library by three rounds of biological panning, and the obtained antibodies are cloned into a prokaryotic/eukaryotic expression vector, and the human The Fc fusion gene is expressed, transfected into a host cell, and an Fc fusion protein is obtained. Verification of in vitro affinity: The single domain antibody and Fc fusion protein provided by the invention can specifically recognize and bind HLA-A2/NLVPMVATV (cytomegalovirus antigen) antigen complex, and can be developed into antibody drugs for treating tumors and other Beneficial effects Biotherapeutic products are of great importance for the treatment of diseases caused by cytomegalovirus.

The invention is further illustrated by the following examples, which should not be construed as further limiting.

DRAWINGS

Figure 1 is a diagram showing the first panel ELISA detection and data analysis after three rounds of panning in the present invention. A is the ELISA all the pore coated antigen HLA-A2/NLVPMVATV; B is the data analysis chart, the ordinate is the light absorption value of each hole at 650nm, the abscissa is 96 holes, of which, 1-8 is A1, B1 , C1, D1, E1, F1, G1, H1, 9-16 are A2, B2, C2, D2, E2, F2, G2, H2, and so on, 89-96 is A12, B12, C12, D12, E12, F12, G12, H12.

2 is an ELISA test and data analysis of a second plate after three rounds of panning in the present invention. A is the ELISA all the pore coated antigen HLA-A2/NLVPMVATV; B is the data analysis chart, the ordinate is the light absorption value of each hole at 650nm, the abscissa is 96 holes, of which, 1-8 is A1, B1 , C1, D1, E1, F1, G1, H1, 9-16 are A2, B2, C2, D2, E2, F2, G2, H2, and so on, 89-96 is A12, B12, C12, D12, E12, F12, G12, H12.

Figure 3 is a diagram showing the specificity detection and data analysis of two different single domain antibodies for different antigens in the present invention. A is the ELISA plate A and B coated antigen HLA-A2/ITDQVPFSV, C, D two lines coated antigen HLA-A2/NLVPMVATV, E, F two lines coated antigen HLA-A2/RMFPNAPYL, G, The H line is coated with the antigen HLA-A2/SLLMWITQC; the first antibody added to Line 1 is M4-F4, and the line 2 is the positive control; the line3 is an antibody MA that cross-reacts to the four antigens; the line 4 is M4-G5. B is a data analysis chart with ordinates at 650 nm,

abscissa

1, 2, 3, 4 for HLA-A2/ITDQVPFSV antigen, HLA-A2/NLVPMVATV antigen, HLA-A2/RMFPNAPYL antigen, HLA- A2/SLLMWITQC antigen. a, b, c, d are M4-F4, M5 control 1, MA control 2, M4-G5.

Figure 4 is a schematic representation of a plasmid map of a single domain antibody fused to Fc in pcDNA3.1 of the present invention. The single domain antibody was introduced into the BamHI restriction site, and the single domain antibody was ligated with HindIII restriction enzyme, and the Fc was digested with XbaI. The single domain antibody is preceded by a signal peptide and a kozak sequence.

Figure 5 is a SDS-PAGE of the fusion protein M4-G5-Fc of pcDNA3.1 expression in the present invention. Marker's strips are from 14, 25, 30, 40, 50, 70, 100, 120, 160 KD. Line 1 is a reduced form M4-G5-Fc and Line 2 is a non-reduced M4-G5-Fc.

Figure 6 is a specific detection and data analysis of different antigens of the fusion protein M4-G5-Fc in the present invention. The ordinate is the light absorption at 650 nm, and the

abscissa

1, 2, 3, 4 is the HLA-A2/ITDQVPFSV antigen, HLA-A2/NLVPMVATV antigen, HLA-A2/RMFPNAPYL antigen, HLA-A2/SLLMWITQC antigen. The sample was M4-G5-Fc, MB control.

The best way to implement the invention

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The HLA-A2/NLVPMVATV antigen complex in the following examples refers to a complex of the cytomegalovirus antigen peptide NLVPMVATV and the antigen molecule HLA-A2, which is described in the literature "Stephen J. Forman etc, Development of a Candidate HLA A*0201 Restricted Peptide-Based Vaccine Against Human Cytomegalovirus Infection, Blood, Vol 90, No 5 (September 1), 1997: pp 1751-1767" and "Epitope Sequence Presented by the HLA Ap0201 Allele among Human Cytomegalovirus Isolates; Journal of Virology, Mar. 2001, p.2472–2474”, the public is available from Tianjin Tianrui Biotechnology Co., Ltd.

Example 1 Screening for single domain antibodies that specifically bind to HLA-A2/NLVPMVATV complexes

1.1 Single domain antibody phage library preparation

1.1.1 Preparation of helper phage (BM13)

The replicon of M13KE phage (purchased from NEB#N0316S) was digested with AlwnI (purchased from NEB) and AfeI (purchased from NEB), and the synthetic gene fragment was also digested with AlwnI and AfeI (purchased from NEB). They are then ligated together using T4 ligase. After ligation, TG1 was transfected to obtain helper phage BM13. Thus, the following sequence in the replicon of the M13KE phage: tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctct is replaced by a synthetic gene sequence, in which a trypsin cleavage sequence is added to the phage GIII coding region, and once used as a helper phage, the trypsin digestion step is increased, and the decrease is not The number of phage containing the gene of interest fusion.

The synthetic gene sequences are as follows: CCA GCC GGC CTT TCT GAG GGG TCG ACT ATA GAA GGA CGA GGG GCC CAC GAA GGA GGT GGG GTA CCC GGT TCC GAG GGT.

1.1.2 phage library construction

1.1.2.1 Carrier construction

pUC19 (purchased from NEB) was digested with HindIII (purchased from NEB) and NdeI (purchased from NEB), and a heavy chain artificial single domain antibody sequence based on the DP47 antibody sequence was added. In the single domain antibody expression framework, the single domain antibody is fused to the GIII protein, and the Myc and VSV-G tags are added in the middle for purification or identification, and the phage display vector pBG3 is constructed.

1.1.2.2ssDNA template preparation

E. coli strain CJ236 (purchased from NEB) lacks functional uracil deoxyribonucleoside triphosphatase and uracil-N glycosidase to produce a uracilized single-stranded DNA template. The pBG3 plasmid was transfected into CJ236 and plated on agar plate containing Carbenicillin (50 μg/ml) and chloramphenicol (15 μg/ml) and cultured overnight. A single colony screened on the plate was selected into 3 ml of 2×TY broth medium (containing the same concentration of the above-mentioned double antibody), and cultured at 37 ° C, 250 rpm overnight. On the next day, 0.3 ml of the overnight culture was added to 30 ml of fresh 2×TY broth medium (Carbenicillin 50 μg/ml) for 3-4 hours, and the OD600 was 0.4-0.6, and the helper phage was added (by bacteria: number of phage) The ratio was 1:10, and the mixture was centrifuged at 37 ° C, 150 rpm for 1 hour, and the bacterial pellet was resuspended in 60 ml of 2 × TY double-antibody medium, and cultured at 25 ° C, 250 rpm for 22 hours. The precipitate was discarded by centrifugation. The phage-containing supernatant was precipitated with 5% PEG (PEG800 and 300 mM NaCl adjusted to a concentration of 5%), then resuspended in PBS, and ssDNA was prepared using QIAprep Spin M13 kit (purchased from Qiagen).

1.1.2.3 Library preparation

1.1.2.3.1 The following CDR mutant oligonucleotide strands (synthesized by Jin Weizhi) were prepared by the KunKel method:

Olig_CDR1:

Olig_CDR2:

Olig_CDR3a:

Olig_CDR3b:

1.1.2.3.2 Phosphorylation of Oligonucleotide Chains

The synthetic oligonucleotide strand was added to 100 ul of 50 mM Tris-HCl (Tris base was purchased from Soleil, adjusted to pH 7.5 with hydrochloric acid) to obtain a phosphorylation system containing the following components: 5 U T4 multinuclear Glycokinase, 10 mM MgCl ₂ , 1 mM ATP and 5 mM DTT. After the phosphorylation system was reacted at 37 ° C for 1 hour, a phosphorylated oligonucleotide was obtained. The phosphorylated oligonucleotide strand was purified using a PCR purification kit (purchased from Tiangen).

1.1.2.3.3 phosphorylated oligonucleotides anneal to ssDNA

The phosphorylated oligonucleotide and Uracilated ssDNA (phosphorylated oligonucleotide: ssDNA=3:1, ssDNA prepared from 1.1.2.2) were dissolved in 50 mM Tris-HCl buffer (pH of 10 mM MgCl _{2 )} . In 7.5), after heating at 90 ° C for 2 minutes, the temperature was lowered to 25 ° C at a rate of 1 ° C / min to obtain an annealing-bound phosphorylated oligonucleotide and ssDNA complex.

1.1.2.3.4 Synthesis of dsDNA

0.55 mM ATP, 0.8 mM dNTPs, 5 mM DTT, 15 U T4 DNA synthetase and 15 U T7 DNA synthetase were added to the annealing-bound phosphorylated oligonucleotide and the ssDNA complex, and after incubation at 20 ° C for 3 hours, dsDNA was obtained. The dsDNA was purified using Qiaquick PCR Purification Kit (purchased from Qiagen). The purified DNA was transformed into electrotransformed competent TG1.

1.2BM13 helper phage and proliferation of phage library

1.2.1 proliferation of BM13 helper phage

A fresh single colony of Escherichia coli TG1 (purchased from Wuhan Qiling) was picked from the basic agar medium plate, inoculated into 20 ml of 2×TY medium, and gently shaken, and cultured at 37 ° C until the OD600 was about 0.8. A series of 10-fold diluted BM13 phage were prepared from the original BM13 helper phage prepared in 1.1.1 using 2 x TY medium. Each dilution was mixed with 10 μl and 200 μl of TG1 (OD600=0.8), and the shaker was gently shaken for 3 s, mixed with the upper agar medium, and poured on a pre-equilibrated room temperature TY plate. Rotate the plate to ensure even distribution of the cells and the upper agar. After the supernatant medium was coagulated, it was cultured in an inverted culture at 37 ° C in a biochemical incubator overnight.

The next day, a well-separated single phage was selected and inoculated into a 15 ml culture tube containing 2 to 3 ml of 2 x TY medium containing 25 μg/ml kanamycin. Incubate at 37 ° C, 250 rpm for 12 to 16 h. The infected supernatant was transferred to a 1.5 ml sterile microcentrifuge tube and centrifuged at 4 ° C for 2 min at maximum speed on a microfuge. The supernatant was transferred to a new tube and stored at 4 °C.

1.2.2 Proliferation of phage library

2 × TY medium the prepared phage library was inoculated into 100ml containing 60μg / ml ampicillin, at 37 ℃, 250rpm shaking culture conditions to an OD600 of 0.8, BM13 was added to a concentration of 2 × 10 ⁷ pfu / ml . Incubate at 37 ° C, 300 rpm for 1 h, add 25 μg / ml kanamycin, continue to culture at 37 ° C for 14 ~ 18h. The bacterial solution was centrifuged, and the supernatant was precipitated with 5% PEG, and then resuspended in 5% MPBS for use.

1.3 Screening for single domain antibodies that specifically bind to HLA-A2/NLVPMVATV complexes

1.3.1 Biopanning

25 μl of streptavidin immunomagnetic beads (purchased from Invitrogen cat no. SKU #112-05D) was added to a quantity of biotinylated HLA-A2/NLVPMVATV for 5 min at room temperature. Wash PBST and

PBS

2 or 3 times. MPBS was blocked for 2 h, washed with PBST and PBS for 2 to 3 times. The phage library was added to the magnetic beads and incubated for 2 h at room temperature.

Unbound libraries were removed and magnetic beads were washed 10 times with PBST and PBS. 0.01% trypsin solution was added to the magnetic beads, and 1H was incubated at room temperature to obtain a trypsin eluate.

The trypsin eluate was added to 30 ml of TG1 (OD600 = 0.5), and the library was first eluted by the method of 1.2.

This is the second round and the third round of panning. Single colonies obtained after three rounds of panning were picked into 96-well plates. The culture supernatant was prepared according to the 1.2 Chinese library proliferation method.

1.3.2 ELISA identification

Take a certain amount of supernatant for ELISA. See Figure 1A and Figure 2A.

The specific steps of the ELISA are as follows: dilute the known antigen to 1 to 10 μg/ml with a coating buffer, add 0.1 ml per well, overnight at 4 ° C; wash 3 times a day; add 0.1 ml of the sample to be tested to the above In the coated reaction well, incubate at 37 ° C for 1 hour, wash; add freshly diluted enzyme-labeled secondary antibody (horseradish peroxidase HRP-labeled anti-phage antibody, 1:5000) 0.1 ml, incubate at 37 ° C Wash for 60 minutes; wash with DDW for the last time. 0.1 ml of a temporarily prepared TMB substrate solution was added to each reaction well, and allowed to stand at 37 ° C for 10 to 30 minutes. The plate was read at a wavelength of 650 nm using an advanced plate reader.

The results of ELISA identification are shown in Figures 1A and 2A, and the light absorption values of the respective wells are shown in Figures 1B and 2B. Among them, all wells of A: ELISA were coated with antigen HLA-A2/NLVPMVATV; the antibodies in each well were different. B: Data analysis, the ordinate is the light absorption value of each hole at 650 nm, and the abscissa is 96 holes, wherein 1-8 are A1, B1, C1, D1, E1, F1, G1, H1, 9-16 For A2, B2, C2, D2, E2, F2, G2, H2, and so on, 89-96 is A12, B12, C12, D12, E12, F12, G12, H12.

Clones with A650nm above 0.8 in Figures 1 and 2 were selected for sequencing to obtain a plurality of different amino acid sequences. The clone corresponding to the amino acid sequence shown in SEQ ID No. 7 was named M4-F4, and the corresponding single domain antibody was a single domain antibody M4-F4; the clone corresponding to the amino acid sequence shown in SEQ ID No. 8 was named M4-G5, the corresponding single domain antibody is a single domain antibody M4-G5.

The amino acid sequence of the single domain antibody M4-F4 is shown in SEQ ID No. 7, and the coding gene sequence is shown in SEQ ID No. 9. Wherein, the amino acid sequence of the CDR1 of the complementarity determining region of the single domain antibody M4-F4 is as shown in SEQ ID No. 1, the amino acid sequence of the CDR2 of the complementarity determining region is as shown in SEQ ID No. 2, and the amino acid sequence of the CDR3 of the complementarity determining region is SEQ. ID No.3 is shown.

The amino acid sequence of the single domain antibody M4-G5 is shown in SEQ ID No. 8, and the coding gene sequence is shown in SEQ ID No. 10. Wherein, the amino acid sequence of the complementarity determining region CDR1 is set forth in SEQ ID No. 4, the amino acid sequence of the complementarity determining region CDR2 is set forth in SEQ ID No. 5, and the amino acid sequence of the complementarity determining region CDR3 is set forth in SEQ ID No. 6.

The results of ELISA identification of the specificity and affinity of two different single domain antibodies: single domain antibody M4-F4 and single domain antibody M4-G5 for different antigens are shown in Figure 3A. After TMB was added for 20 min, the plate was read at a wavelength of 650 nm using an advanced plate reader, and the data was organized as shown in Fig. 3B.

Among them, in Figure 3A, the two rows of ELISA plate A and B were coated with antigen HLA-A2/ITDQVPFSV, C and D were coated with antigen HLA-A2/NLVPMVATV, and E and F were coated with antigen HLA-A2/RMFPNAPYL. The two lines of G and H were coated with the antigen HLA-A2/SLLMWITQC; the single domain antibody added to each well was added as a culture supernatant. Among them, the first antibody in the eight wells of Line 1 was M4-F4, the line 2 was the antibody of HLA-A2/RMFPNAPYL, and the positive control (M5 control 1); the line 3 was one for the four antigens. The reacted antibody MA (MA control 2); line 4 is M4-G5. Each antibody has two replicate wells for the affinity detection reaction of one antigen. Figure 3B shows the data analysis. The ordinate is the absorbance at 650 nm. The graph shows that A650 is the average of two replicate wells. The

abscissas

1, 2, 3 and 4 are HLA-A2/ITDQVPFSV antigen, HLA-A2. /NLVPMVATV antigen, HLA-A2/RMFPNAPYL antigen and HLA-A2/SLLMWITQC antigen. a, b, c, d are in turn M4-F4, M5 control 1, MA control 2 and M4-G5.

The results showed that the positive clones M4-F4 and M4-G5 showed high specific affinity for HLA-A2/NLVPMVATV, and did not bind to the other three antigens.

Example 2 Preparation of Fusion Protein M4-G5-Fc

1. Construction of recombinant vector

Cloning of the DNA molecule set forth in SEQ ID No. 11 (which includes the Kozak sequence and the signal peptide, the M4-G5 antibody sequence, the human Fc sequence and the tag sequence) into the HindIII and XbaI restriction endonuclease sites of pcDNA3.1 The recombinant vector pcDNA3.1-sdAb-Fc was obtained, and its structure is shown in Fig. 4.

2. Construction and culture of recombinant cells

The recombinant vector pcDNA3.1-sdAb-Fc was transiently transfected into 293F cells (ThermoFiherer, A14527), cultured for 4 days, centrifuged, and the supernatant was collected and purified with Protein A.

3. Identification of M4-G5-Fc fusion protein

The M4-G5-Fc fusion protein was purified and ran SDS-PAG. The results are shown in Fig. 5. 5A is a reduced electrophoresis pattern of the fusion protein M4-G5-Fc, and FIG. 5B is a non-reduced electrophoresis pattern of the fusion protein M4-G5-Fc. Marker's strips are from 14, 25, 30, 40, 50, 70, 100, 120, 160 KD. Line 1 is a reduced state M4-G5-Fc, approximately 43 KD, and Line 2 is a non-reduced M4-G5-Fc, approximately 100 KD.

Example 3 Fusion Protein M4-G5-Fc specifically recognizes HLA-A2/NLVPMVATV complex

The specific binding of the fusion protein M4-G5-Fc to different antigens was detected by ELISA. The detection method is the same as 1.3.2 in Example 1.

The result is shown in Figure 6. Among them, the ordinate has a light absorption value at 650 nm, and the

abscissas

1, 2, 3 and 4 are HLA-A2/ITDQVPFSV antigen, HLA-A2/NLVPMVATV antigen, HLA-A2/RMFPNAPYL antigen and HLA-A2/SLLMWITQC antigen, respectively. . The sample was a purified fusion protein M4-G5-Fc, and BM was an antibody of HLA-A2/RMFPNAPYL as a positive control. The results showed that the fusion protein M4-G5-Fc showed higher affinity for HLA-A2/NLVPMVATV and did not bind to the other three antigens.

The present invention has been described in detail by way of example only, and is not intended to limit the scope of the invention. The scope of the invention is defined by the claims. In the light of the technical solutions of the present invention, or by those skilled in the art, within the spirit and scope of the present invention, a similar technical solution is designed to achieve the above technical effects, or Equivalent changes and improvements in the scope of application shall remain within the scope of protection covered by the patents of the present invention.

Industrial application

The present invention provides a single domain antibody that specifically recognizes the HLA-A2/NLVPMVATV complex and its CDR1, CDR2 and CDR3 amino acid sequences for specific recognition. The present invention is also based on the provision of a fusion protein that specifically recognizes the HLA-A2/NLVPMVATV complex and its use in the biomedical field. The single domain antibody screened by the present invention can be developed into an antibody drug and other beneficial products for treating cytomegalovirus, and is important for treating diseases caused by cytomegalovirus.

Claims

A single domain antibody recognizing HLA-A2/NLVPMVATV, comprising a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, wherein the single domain antibody is as follows (a) or (b):

(a) The complementarity determining region CDR1 of the single domain antibody is as follows (a1) or (a2) or (a3):

(a1) comprising the amino acid sequence of SEQ ID No. 1;

(a2) the amino acid sequence of SEQ ID No. 1;

(a3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 1 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR2 of the single domain antibody is as follows (a4) or (a5) or (a6):

(a4) comprising the amino acid sequence shown in SEQ ID No. 2;

(a5) the amino acid sequence shown in SEQ ID No. 2;

(a6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 2 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR3 of the single domain antibody is as follows (a7) or (a8) or (a9):

(a7) comprising the amino acid sequence shown in SEQ ID No. 3;

(a8) an amino acid sequence of SEQ ID No. 3;

(a9) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 3 to substitution and/or deletion and/or addition of one or several amino acid residues;

(b) The complementarity determining region CDR1 of the single domain antibody is as follows (b1) or (b2) or (b3):

(b1) comprising the amino acid sequence shown in SEQ ID No. 4;

(b2) an amino acid sequence represented by SEQ ID No. 4;

(b3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 4 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR2 of the single domain antibody is as follows (b4) or (b5) or (b6):

(b4) comprising the amino acid sequence of SEQ ID No. 5;

(b5) an amino acid sequence of SEQ ID No. 5;

(b6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 5 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR3 of the single domain antibody is as follows (b7) or (b8) or (a9):

(b7) comprising the amino acid sequence of SEQ ID No. 6;

(b8) the amino acid sequence of SEQ ID No. 6;

(b9) An amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 6 to substitution and/or deletion and/or addition of one or several amino acid residues.
The single domain antibody according to claim 1, wherein the single domain antibody is as follows (c1) or (c2):

(c1) the amino acid sequence of SEQ ID No. 7 or SEQ ID No. 8;

(c2) An amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 7 or SEQ ID No. 8 to substitution and/or deletion and/or addition of one or several amino acid residues.
The derivative of the single domain antibody according to claim 1 or 2, which is any one of the following (d1) to (d9):

(d1) a fusion protein prepared by the single domain antibody of claim 1 or 2 and at least one polypeptide molecule having therapeutic or recognition function;

(d2) a multispecific or multifunctional molecule comprising the single domain antibody of claim 1 or 2;

(d3) a composition comprising the single domain antibody of claim 1 or 2;

(d4) an immunoconjugate comprising the single domain antibody of claim 1 or 2;

(d5) an antibody obtained by modifying and/or modifying the single domain antibody or antigen-binding portion thereof according to claim 1 or 2;

(d6) a heavy chain variable region or a light chain variable region comprising the complementarity determining region of claim 1;

(d7) an scFv or antibody comprising the complementarity determining region of claim 1;

(d8) comprising one or two or more amino acid sequences of the complementarity determining regions of claim 1, and having at least 79% homology with an amino acid sequence of one complementarity determining region;

(d9) one or two or more amino acid sequences in the framework region of the single domain antibody according to claim 1 or 2, and having at least 90% homology with the amino acid sequence of one framework region.
The derivative according to claim 3, characterized in that:

The fusion protein is obtained by directly fusing the single domain antibody of claim 1 or 2 with at least one polypeptide molecule having therapeutic or recognition function, or by treating or recognizing one or more peptides with a linker peptide. Functional peptide molecules are obtained by ligation.
The derivative according to claim 4, characterized in that:

The polypeptide molecule having therapeutic or recognition function is a human Fc protein.
The derivative according to claim 3, characterized in that:

The immunoconjugate comprises a pharmaceutically acceptable carrier.
The biomaterial related to the single domain antibody according to claim 1 or 2 or the derivative according to any one of claims 3 to 6 is any one of the following (e1) to (e4):

(e1) a nucleic acid molecule encoding the single domain antibody of claim 1 or 2;

(e2) a nucleic acid molecule encoding the fusion protein of claim 3;

(e3) a vector comprising the nucleic acid molecule of (e1) or (e2);

(e4) A host cell comprising the nucleic acid molecule of (e1) or (e2) or the vector of (e3).
The biomaterial according to claim 7, wherein:

The nucleic acid molecule is any one of the following (f1) to (f3):

(f1) a DNA molecule represented by SEQ ID No. 9 or SEQ ID No. 10 or SEQ ID No. 11;

(f2) a DNA molecule having 75% or more of the identity of the nucleotide sequence defined by (f1), and encoding the single domain antibody of claim 1 or 2 or the fusion protein of claim 3.

(f3) a DNA molecule which hybridizes under stringent conditions to a nucleotide sequence defined by (f1) or (f2) and which encodes the single domain antibody of claim 1 or 2 or the fusion protein of claim 3.
The single domain antibody according to claim 1 or 2 or the derivative according to any one of claims 3 to 6 or the biological material according to claim 7 or 8 in any one of the following (g1) to (g4) application:

(g1) specifically recognizing and/or binding to HLA-A2/NLVPMVATV;

(g2) preparing a product that specifically recognizes and/or binds to HLA-A2/NLVPMVATV;

(g3) treating diseases caused by cytomegalovirus;

(g4) A product for treating a disease caused by cytomegalovirus.
The use according to claim 9, wherein the product is a medicament.
The method for producing a fusion protein according to claim 3, comprising the steps of: introducing the gene encoding the single domain antibody of claim 1 or 2 and the gene encoding the human Fc protein into a host cell to obtain a recombinant cell; The recombinant cells are described to obtain the fusion protein.
The method according to claim 11, wherein the gene encoding the single domain antibody and the gene encoding the human Fc protein are introduced into a host cell by a recombinant vector;

The recombinant vector is obtained by inserting a gene encoding the single domain antibody and a fragment encoding the human Fc protein into a multiple cloning site of an expression vector.
The method according to claim 12, wherein the gene encoding the single domain antibody and the gene encoding the human Fc protein are the DNA molecule of SEQ ID No. 11.
The method according to claim 12, wherein the expression vector is pcDNA3.1.
The method according to claim 11 or 12, wherein the host cell is a 293F cell.