WO2018121473A1 - Single-domain antibody capable of recognizing human serum albumin - Google Patents

Abstract

Provided is a single-domain antibody capable of recognizing human serum albumin (HSA). By adopting a phage display technology, multiple strains of antibodies capable of specifically recognizing HSA are obtained by screening in a human single-domain antibody library. The antibodies contain only one variable region of an antibody heavy chain and are the smallest fully functional antigen-binding fragments, and have a smaller molecular weight and weaker immunogenicity than a single-chain antibody or antibody Fab fragment, and can function to extend the half-life of biological drugs when specifically bound to HSA. Single-domain antibodies with a high affinity are obtained by screening, and the antibodies can recognize specific human serum albumin and extend the half-life of biological drugs, facilitating the treatment of tumors.

Description

Single domain antibody recognizing human serum albumin Technical field

The invention belongs to the technical field of antibodies, and in particular relates to a single domain antibody for recognizing human serum albumin.

Background technique

Protein drugs have been successfully used in clinical treatments, and many protein drugs provide effective and unique therapeutic effects for some diseases. However, most proteins and peptides have a short half-life. One is because protein drugs are rapidly eliminated by protease degradation in the body, and the second is because glomerular filtration is a drug with a molecular weight of less than 60 kD that is easily removed in kidney metabolism. In order to achieve an effective therapeutic effect, high-dose or multiple-time, long-term use of drugs is often used, which on the one hand increases the toxic side effects, and also causes great inconvenience to the patients. Therefore, prolonging the half-life of protein drugs is beneficial both economically and therapeutically.

In order to prolong the half-life of protein drugs in the body, thereby enhancing the therapeutic effect of the drug, it is hoped that the body's degradation of protein drugs can be delayed. First, some people modify the protein drug molecule itself to change the protein protein recognition and protease decomposition of the body protein degradation system. The construction of the mutant can generally reduce the sensitivity of the polypeptide to the hydrolase, and effectively extend the half-life of the polypeptide biopharmaceutical, but many mutants with longer half-life will change the activity of the drug. PEG modification can improve the immunogenicity of a protein drug while improving the stability of the protein drug, but has the potential to affect the biological activity of the polypeptide biopharmaceutical.

Direct fusion with human proteins with longer half-lives is a viable and effective way to extend the half-life of drugs. Human serum albumin is the main protein in human blood, the most abundant protein in the human circulatory system, and the longest half-life protein in human body with a half-life of up to 19 days. It can be combined with some drug molecules to protect the drug molecules from being prematurely degraded by the body. Therefore, it is an ideal drug carrier molecule.

There are several strategies to prolong the serum half-life of a protein drug, such as fusion/binding of an antibody to HSA to prolong its serum half-life without altering the affinity of the antibody for binding to the antigen. This strategy is widely adopted by antibody engineers. The fusion/binding of the antibody with albumin not only increases the size of the molecule, but also promotes antibody reuse and prolongs the half-life. When albumin is absorbed by cells, it first binds to FcRn on the early endosomes, thereby avoiding damage. The albumin is then re-delivered to the plasma membrane and released into the plasma.

Maarten et al. reported a bispecific Nanobody with high affinity and potency for the IL-6 receptor (IL-6R) and extended half-life by targeting human serum albumin (Van Roy, M. et al. Arthritis Res) Ther (2015) 17: 135).

Ablynx successfully developed Ozoralizumab using this method. Ozoralizumab (ATN-103, Ablynx) is a 38 kDa trivalent bispecific Nanobody made from the heavy chain of camelids. In theory, such small molecule drugs are easily cleared by the kidneys. To solve this problem, ozoralizumab was designed to bind to HAS, retaining its specificity for binding to TNF-α. Ozoralizumab has been used in the treatment of rheumatoid arthritis (RA) for phase II clinical studies and has been shown to significantly improve the condition of patients with RA. Ozoralizumab is highly confident in its clinical application due to its unique molecular properties such as small size, low immunogenicity and long serum half-life. Ozoralizumab was approved by the FDA as a treatment for multiple sclerosis in March 2017 (Cohen et al., Expert opinion on drug safety. 16(1): 89–100, 2017; Hutas, G et al. Current Opinion in Investigational Drugs. 9(11): 1206–15, 2008).

Invention disclosure

A first object of the invention is to provide a single domain antibody that recognizes human serum albumin.

The single domain antibody provided by the present invention comprises a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, and the single domain antibody is any one of the following (a) to (c):

(a) The complementarity determining region CDR1 of the single domain antibody is as follows (a1) or (a2) or (a3):

(a1) comprising the amino acid sequence of SEQ ID No. 1;

(a2) the amino acid sequence of SEQ ID No. 1;

(a3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 1 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR2 of the single domain antibody is as follows (a4) or (a5) or (a6):

(a4) comprising the amino acid sequence shown in SEQ ID No. 2;

(a5) the amino acid sequence shown in SEQ ID No. 2;

(a6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 2 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR3 of the single domain antibody is as follows (a7) or (a8) or (a9):

(a7) comprising the amino acid sequence shown in SEQ ID No. 3;

(a8) an amino acid sequence of SEQ ID No. 3;

(a9) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 3 to substitution and/or deletion and/or addition of one or several amino acid residues;

(b) The complementarity determining region CDR1 of the single domain antibody is as follows (b1) or (b2) or (b3):

(b1) comprising the amino acid sequence shown in SEQ ID No. 4;

(b2) an amino acid sequence represented by SEQ ID No. 4;

(b3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 4 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR2 of the single domain antibody is as follows (b4) or (b5) or (b6):

(b4) comprising the amino acid sequence of SEQ ID No. 5;

(b5) an amino acid sequence of SEQ ID No. 5;

(b6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 5 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR3 of the single domain antibody is as follows (b7) or (b8) or (a9):

(b7) comprising the amino acid sequence of SEQ ID No. 6;

(b8) the amino acid sequence of SEQ ID No. 6;

(b9) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 6 to substitution and/or deletion and/or addition of one or several amino acid residues;

(c) The complementarity determining region CDR1 of the single domain antibody is as follows (c1) or (c2) or (c3):

(c1) comprising the amino acid sequence of SEQ ID No. 7;

(c2) an amino acid sequence of SEQ ID No. 7;

(c3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 7 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR2 of the single domain antibody is as follows (c4) or (c5) or (c6):

(c4) comprising the amino acid sequence of SEQ ID No. 8;

(c5) the amino acid sequence of SEQ ID No. 8;

(c6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 8 to substitution and/or deletion and/or addition of one or several amino acid residues;

The complementarity determining region CDR3 of the single domain antibody is as follows (c7) or (c8) or (c9):

(c7) comprising the amino acid sequence shown in SEQ ID No. 9;

(c8) an amino acid sequence of SEQ ID No. 9;

(c9) An amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 9 to substitution and/or deletion and/or addition of one or several amino acid residues.

Specifically, the single domain antibody is as follows (d1) or (d2):

(d1) the amino acid sequence of SEQ ID No. 10 or SEQ ID No. 11 or SEQ ID No. 12;

(d2) having the same function as the amino acid sequence represented by SEQ ID No. 10 or SEQ ID No. 11 or SEQ ID No. 12 by substitution and/or deletion and/or addition of one or several amino acid residues Amino acid sequence.

Another object of the present invention is to provide a derivative of the above single domain antibody.

The derivative of the above single domain antibody provided by the present invention is any one of the following (e1) to (e9):

(e1) a fusion protein prepared from the above single domain antibody and at least one polypeptide molecule having therapeutic or recognition function;

(e2) a multispecific or multifunctional molecule comprising the above single domain antibody;

(e3) a composition comprising the above single domain antibody;

(e4) an immunoconjugate comprising the above single domain antibody;

(e5) an antibody obtained by modifying and/or modifying the above single domain antibody or antigen binding portion thereof;

(e6) a heavy chain variable region or a light chain variable region comprising the above-described complementarity determining region;

(e7) an scFv or antibody comprising the above-described complementarity determining region;

(e8) comprising one or two or more amino acid sequences of said complementarity determining regions, and having at least 79% homology to an amino acid sequence of one complementarity determining region;

(e9) one or two or more amino acid sequences in the framework region of the above single domain antibody, and having at least 90% homology to the amino acid sequence of one framework region.

In the above derivative, the fusion protein is obtained by directly fusing the above single domain antibody with at least one polypeptide molecule having therapeutic or recognition function, or by a linker peptide and one or more therapeutic or recognition functions. The polypeptide molecules are linked together.

In the above derivatives, the polypeptide molecule having a therapeutic or recognition function is a human Fc protein.

The fusion protein is an Fc fusion protein obtained by fusing the above single domain antibody with a human Fc protein. When the single domain antibody is fused to the human Fc protein, the monovalent antibody becomes a bivalent antibody, and the affinity is improved.

The specific preparation method of the Fc fusion protein comprises the steps of: introducing the coding gene of the single domain antibody and the coding gene of the human Fc protein into a host cell to obtain a recombinant cell; and culturing the recombinant cell to obtain the fusion protein.

Specifically, the coding gene of the single domain antibody and the coding gene of the human Fc protein are introduced into a host cell by a recombinant vector;

The recombinant vector is obtained by inserting a gene encoding the single domain antibody and a fragment encoding the human Fc protein into a multiple cloning site of an expression vector.

Specifically, the gene encoding the single domain antibody and the gene encoding the human Fc protein are the DNA molecules shown in SEQ ID No. 16 or SEQ ID No. 17.

Specifically, the expression vector is a pET22b vector or a pcDNA3.1 vector.

Specifically, the host cell is an E. coli/DE3 cell or a 293F cell.

In the above derivatives, the composition may be a pharmaceutical composition containing a pharmaceutically acceptable carrier. The pharmaceutical compositions of the invention may be administered in combination therapy, i.e., in combination with other agents. The term "pharmaceutically acceptable carrier" as used herein includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like which are physiologically compatible. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active compound, ie, an antibody, immunoconjugate or bispecific molecule or multispecific molecule, can be coated in a material to protect the compound from acids and other natural compounds that can inactivate the compound. The role of the condition.

The pharmaceutical compositions of the invention may comprise one or more pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" as used herein refers to a salt which retains the desired biological activity of the parent compound and does not cause any unwanted toxicological effects. Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from non-toxic inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, phosphorous acid, and the like, as well as non-toxic organic acids such as aliphatic monocarboxylic acids and dicarboxylic acids. Derivatized salts of acids, phenyl substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, and the like. Base addition salts include those derived from alkaline earth metals such as sodium, potassium, magnesium, calcium, and the like, as well as non-toxic organic amines such as N,N'-dibenzylethylenediamine, N-methylglucamine, chlorine Salt derived from procaine, choline, diethanolamine, ethylenediamine, procaine, and the like.

The pharmaceutical compositions of the invention may also contain a pharmaceutically acceptable antioxidant. Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium hydrogen sulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants such as ascorbic acid palmitate Ester, butylated hydroxyanisole (BHA), butylated hydroxytoluene (DHT), lecithin, propyl gallate, alpha-tocopherol, etc.; (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA) , sorbitol, tartaric acid, phosphoric acid, etc.

Examples of suitable aqueous or nonaqueous vehicles which may be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils such as olive oil, And injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the application of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

In practical applications, these compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the presence of microorganisms can be ensured by a sterilization procedure or by the inclusion of various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol sorbic acid, and the like.

The compositions of the invention may be administered by one or more routes of administration using one or more methods well known in the art. Those skilled in the art will appreciate that the route and/or manner of administration will vary depending on the desired result.

The compositions of the invention have therapeutic applications in vitro and in vivo. For example, these molecules can be administered to cells cultured in vitro or ex vivo, or administered to a human subject in vivo to treat, prevent or diagnose a variety of diseases. The term "subject" as used herein includes both human and non-human animals. Non-human animals include all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles. These methods are particularly suitable for treating human patients with tumors.

In the above derivative, the immunoconjugate may be a conjugate obtained by coupling the above single domain antibody with a therapeutic agent such as a cytotoxin, a drug (for example, an immunosuppressive agent) or a radioactive toxin. These conjugates are referred to as "immunoconjugates." An immunoconjugate comprising one or more cytotoxins is referred to as an "immunotoxin." Cytotoxins or cytotoxic agents include any agent that is detrimental to the cell (eg, kills). Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, ipecaine, mitomycin, epipodophyllotoxin, epipodophyllotoxin, vincristine, vinblastine , colchicine, doxorubicin, daunorubicin, dihydroxy anthrax dione, mitoxantrone, phosfomycin, actinomycin D, l-dehydrotestosterone, glucocorticoid, proca , tetracaine, lidocaine, propranolol and puromycin and their analogs or homologs. Therapeutic agents also include, for example, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, decarbazine, a burning agent ( For example, nitrogen mustard, thioepa chlorambucil, phenylalanine mustard, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, chain Oxazomycin, mitomycin C and cis-dichlorodiamine platinum (II) (DDP) cisplatin, anthracyclines (eg, daunorubicin (formerly known as daunorubicin) and trichothecene , antibiotics (eg, actinomycin D, bleomycin, phosfomycin, and amphotericin (AMC)), and anti-mitotic agents (eg, vincristine and vinblastine). Other preferred examples of antibody-conjugated therapeutic cytotoxins include doxorubicin, calicheamicin, maytansin, auristatin, and derivatives thereof. Coupling of a cytotoxin with an antibody of the invention can be utilized in the art. Joint technology.

The antibodies of the invention may also be conjugated to a radioisotope to produce a cytotoxic radiopharmaceutical, also known as a radioimmunoconjugate. Examples of radioisotopes that can be coupled to antibodies for diagnostic or therapeutic use include, but are not limited to, iodine ¹³¹ , indium ¹¹¹ , 钇^90, and 镥¹⁷⁷ . Methods of preparing radioactive immunoconjugates have been established in the art. Examples of radioimmunoconjugates are commercially available, including Zevalin ^(TM) (IDEC Pharmaceuticals) and Bexxar ^(TM) (Corixa Pharmaceuticals), which are capable of producing radioimmunoconjugates using similar methods using the antibodies of the invention.

The antibody conjugates of the invention can be used to modify a particular biological response, and the drug moiety should not be construed as being limited to classical chemotherapeutic agents. For example, the drug moiety can be a protein or polypeptide having the desired biological activity. Such proteins may include, for example, enzymatically active toxins or active fragments thereof, such as abrin, ricin A, Pseudomonas exotoxin or diphtheria toxin; proteins such as tumor necrosis factor or interferon- γ; or biological response regulators such as lymphokines, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophages Cell colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF) or other growth factors.

The antibody genetically engineered antibody obtained by modifying and/or modifying the above single domain antibody or antigen binding portion thereof is also within the scope of the present invention. The single domain antibodies provided herein comprise CDR1, CDR2 and CDR3 sequences, wherein one or more of these CDR sequences comprise a specific amino acid sequence based on a single domain antibody of the invention or a conservative modification thereof, and wherein the antibody retains an antibody of the invention It has the functional properties of identifying and/or binding to human serum albumin. The term "conservative sequence modification" as used herein refers to an amino acid modification that does not significantly affect or alter the binding characteristics of an antibody comprising the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the antibodies of the invention by techniques well known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitution refers to the replacement of an amino acid residue with an amino acid residue having a similar side chain. A family of amino acid residues having similar side chains has been defined in the art. These families include: basic side chains (eg, lysine, arginine, histidine), acidic side chains (eg, aspartic acid, glutamic acid), uncharged polar side chains (eg, glycine, Asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (eg alanine, valine, leucine, isoleucine) Acid, proline, phenylalanine, methionine), β-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, styrene Amino acids of amino acids, tryptophan, histidine). Thus, one or more amino acid residues within the CDR regions of an antibody of the invention can be substituted for other amino acid residues from the same side chain family, and the above-described functions of altered antibody retention can be detected using the in vitro affinity assays described herein. .

One type of variable region engineering that can be performed is CDR grafting. The antibody interacts with the target antigen primarily through amino acid residues located in the complementarity determining regions (CDRs). For this reason, the amino acid sequences within the CDRs are more diverse between the individual antibodies than the sequences outside the CDRs. Since the CDR sequences are responsible for most antibody-antigen interactions, recombinant antibodies that mimic the properties of the particular antibody present can be expressed by constructing an expression vector comprising a CDR sequence from a particular antibody present, which is grafted to From the backbone sequences of different antibodies with different properties, these backbone sequences can be obtained from public DNA databases or published references.

Another type of variable region modification is to mutate the amino acid sequence within the CDR1, CDR2 and/or CDR3 regions to improve one or more binding properties (e.g., affinity) of the antibody of interest. Site-directed mutagenesis or PCR-mediated mutagenesis can be performed to introduce mutations, effects on antibody binding, or other target functional properties, which can be evaluated using the assays described herein and provided in the Examples. Conservative sequence modifications (as described above) are preferably introduced. The mutation may be an amino acid substitution, addition or deletion, but is preferably substituted. Moreover, typically no more than 5 residues are altered within the CDR regions.

Engineered antibodies of the invention include, for example, antibodies whose backbone residues have been modified to improve the properties of the antibody. Such backbone modifications are generally made to reduce the immunogenicity of the antibody. The backbone modification involves mutating one or more residues within the framework region, or even one or more CDR regions, to remove T cell epitopes, thereby reducing the potential immunogenicity of the antibody.

In the above derivative, the framework region is SEQ ID No. 10, positions 1-26, 36-49, 56-97, 113-123, or SEQ ID No. 11 positions 1-26. , 36-49, 56-97, 114-124, or SEQ ID No. 12, 1-26, 36-49, 56-97, 110-120.

The term "homology" as used herein may describe the degree of similarity between two or more amino acid sequences, and the percentage of homology between the first amino acid sequence and the second amino acid sequence may be determined by the formula: (first amino acid The number of amino acid residues in the sequence that is identical to the amino acid sequence at the corresponding position in the second amino acid sequence) / (total number of amino acids in the first amino acid sequence) * 100%, wherein the second amino acid sequence can only be Deletions, insertions, substitutions or additions of amino acids (compared to the first amino acid) are considered to be different. The percent homology can also be obtained using known computer algorithms for sequence matching such as NCBI Blast.

Still another object of the present invention is to provide a biological material related to the above single domain antibody or the above derivative.

The biological material related to the above single domain antibody or the above derivative provided by the present invention is any one of the following (f1) to (f4):

(f1) a nucleic acid molecule encoding the above single domain antibody;

(f2) a nucleic acid molecule encoding the above fusion protein;

(f3) a vector comprising the nucleic acid molecule of (f1) or (f2);

(f4) A host cell comprising the nucleic acid molecule of (f1) or (f2) or the vector of (f3).

In the above biological material, the nucleic acid molecule is any one of the following (g1) to (g3):

(g1) a DNA molecule represented by SEQ ID No. 13 or SEQ ID No. 14 or SEQ ID No. 15 or SEQ ID No. 16 or SEQ ID No. 17;

(g2) a DNA molecule having 75% or more of the identity with the (g1) defined nucleotide sequence, and encoding the above single domain antibody or the above fusion protein;

(g3) a DNA molecule which hybridizes under stringent conditions to a nucleotide sequence defined by (g1) or (g2) and which encodes the above single domain antibody or the above fusion protein.

In the above biological material, the nucleic acid molecule may be a nucleotide sequence encoding each of the complementarity determining regions or the single domain antibody or the amino acid sequence of the fusion protein, and the specific sequence of the corresponding nucleic acid molecule can be obtained at any time by the genetic code. Due to the annexation of the genetic code, the nucleic acid molecule can be varied for different application purposes. The term "codon" as used herein, also referred to as a triplet codon, refers to a nucleotide triplet corresponding to an amino acid. The location of the amino acid insertion into the growing polypeptide chain is determined during translation.

The nucleic acid molecules of the invention can be obtained using conventional molecular biology techniques. For antibodies obtained from immunoglobulin gene libraries (eg, using phage display technology), nucleic acids encoding antibodies can be obtained from libraries.

In the above biological material, the nucleic acid sequence or at least part of the sequence in the vector can be expressed by a suitable expression system to obtain a corresponding protein or polypeptide; the expression system includes bacteria, yeast, filamentous fungus, lactation Animal cells, insect cells, plant cells or cell-free expression systems.

Still another object of the present invention is to provide a novel use of the above single domain antibody or the above derivative or the above biological material.

The present invention provides the use of the above single domain antibody or the above derivative or the above biological material in any of the following (h1) to (h6):

(h1) specifically recognizing and/or binding to human serum albumin;

(h2) preparing a product that specifically recognizes and/or binds to human serum albumin;

(h3) prolonging the half-life of the protein drug and/or the polypeptide drug;

(h4) a product for preparing a half-life of a prolonged protein drug and/or a polypeptide drug;

(h5) tumor immunotherapy;

(h6) Preparation of a product for tumor immunotherapy.

In the above application, the product is a drug.

Tumors that can be treated with the antibodies of the invention include, but are not limited to, tumors such as melanoma, breast cancer, prostate cancer, lung cancer, ovarian cancer, thyroid cancer, liver cancer, bladder cancer or gastric cancer.

In a practical application, a drug for tumor treatment can be expressed by fusion with an antibody or a fusion protein of the present invention to obtain a protein drug for tumor treatment, and the protein drug can be administered to a subject having a tumor. Subjects received treatment. Fusion expression of a drug for tumor therapy with an antibody or fusion protein of the present invention can be achieved by conventional methods well known to those skilled in the art.

The human serum albumin antibody referred to in this patent is a human single domain antibody. A single domain antibody differs from SCFV in that it contains only one variable region of the antibody heavy chain, approximately half the size of SCFV, smaller than the camel-derived VHH antibody, and is the smallest fully functional antigen-binding fragment with immunogenicity. Weak; easier to pass through the blood vessel wall, penetrate the solid tumor, and help the treatment of the tumor. Single domain antibodies directed against human serum albumin antibodies have not been reported.

The present invention is directed to the technical problems existing in the prior art, and the antibodies with higher affinity are screened from the phage single domain library by three rounds of biological panning, and the obtained antibodies are cloned into a prokaryotic/eukaryotic expression vector, and the human The Fc fusion gene is expressed, transfected into a host cell, and an Fc fusion protein is obtained. Verification by in vitro affinity: Both the single domain antibody and the Fc fusion protein provided by the present invention can specifically recognize and bind human serum albumin. Compared with the prior art, the present invention has the beneficial effects that the present invention obtains a single domain antibody with high affinity by screening, and only contains one variable region of the antibody heavy chain, and is the smallest fully functional antigen-binding fragment. Compared with the single-chain antibody or antibody Fab segment, the molecular weight is smaller and the immunogenicity is weaker. When it specifically binds to HSA, it can prolong the half-life of biopharmaceuticals and can be developed to treat melanoma and breast cancer. , prostate cancer, lung cancer, ovarian cancer, thyroid cancer, liver cancer, bladder cancer, advanced gastric cancer and other antibody drugs, is conducive to the treatment of tumors.

The invention is further illustrated by the following examples, which should not be construed as further limiting.

DRAWINGS

Figure 1 is a diagram showing the ELISA detection and data analysis after three rounds of panning in the present invention. A: All wells of the ELISA were coated with antigen HSA; the antibodies in each well were different. B: Data analysis, the ordinate is the light absorption value of each hole at 650 nm, and the abscissa is 96 holes, wherein 1-8 are A1, B1, C1, D1, E1, F1, G1, H1, 9-16 For A2, B2, C2, D2, E2, F2, G2, H2, and so on, 89-96 is A12, B12, C12, D12, E12, F12, G12, H12.

Figure 2 is a graph showing the analysis of HSA and IgG specific affinity data of the HSA single domain antibody of the present invention. 33 positive clones were selected from Figure 1 for ELISA to detect the affinity of each single domain antibody for HSA and IgG. The data is organized as shown in Figure 2. Among them, the ordinate is the light absorption value at 650 nm, and the abscissa is 33 single domain antibodies. In each of the two adjacent bar graphs, the left side indicates that the antigen is coated with HSA, and the right side indicates that the antigen is coated with IgG.

Figure 3 is a schematic representation of a plasmid map of a single domain antibody of the present invention fused to express Fc in pET22b.

Figure 4 is a SDS-PAGE diagram of the fusion protein HB5-Fc expressed in pET22b of the present invention. Marker's strips are from 14, 25, 30, 40, 50, 70, 100, 120, 160 KD. Line1 is a reduced form of HB5-Fc, approximately 43 kD.

Figure 5 is a data analysis diagram of the specific recognition of HSA by the fusion protein HB5-Fc of the present invention. In the figure, the ordinate is the light absorption value at 650 nm, the abscissa is the two purified fusion antibodies, HB5 is the HB5-Fc antibody, and Blank is an antibody other than HSA.

Figure 6 is a schematic diagram of a plasmid map in which a single domain antibody of the present invention is fused to express Fc in pcDNA3.1. The single domain antibody and the Fc were introduced into the site by BamHI restriction, and the single domain antibody was preceded by HindIII restriction enzyme, and the Fc was digested with XbaI restriction enzyme. The single domain antibody is preceded by a signal peptide and a kozak sequence.

Figure 7 is a graph showing the data analysis of the specific recognition of different antigens by the fusion protein HF11-Fc of the present invention. The figure shows the affinity of the purified HF11-Fc fusion protein to four antigens of human serum albumin (HSA), bovine serum albumin (BSA), goat serum and horse serum by ELISA. The ordinate is the light absorption value at 650 nm, the abscissa is the four antigens, the sample HF11-Fc(-) indicates the control without the primary antibody HF11-Fc, and the HF11-FC(+) indicates the addition of the primary antibody HF11-Fc. .

The best way to implement the invention

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 Screening of single domain antibodies to HSA

1.1 Single domain antibody phage library preparation

1.1.1 Preparation of helper phage (BM13)

The M13KE phage (purchased from NEB#N0316S) replicon was digested with AlwnI (purchased from NEB) and AfeI (purchased from NEB), and the synthetic gene fragment was also digested with AlwnI and AfeI, and then ligated with T4 ligase. Together. After ligation, TG1 was transfected to obtain helper phage BM13. Thus, the following sequence in the M13KE phage replicon tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctct is replaced by a synthetic gene sequence, in which a trypsin cleavage sequence is added in the phage GIII coding region, and once used as a helper phage, the trypsin digestion step is increased to reduce the fusion-free fusion. The number of target gene protein phage.

The synthetic gene sequences are as follows: CCA GCC GGC CTT TCT GAG GGG TCG ACT ATA GAA GGA CGA GGG GCC CAC GAA GGA GGT GGG GTA CCC GGT TCC GAG GGT.

1.1.2 phage library construction

1.1.2.1 Carrier construction

pUC19 (purchased from NEB) was digested with HindIII (purchased from NEB) and NdeI (purchased from NEB), and a heavy chain artificial single domain antibody sequence based on the DP47 antibody sequence was added. In the single domain antibody expression framework, the single domain antibody is fused to the GIII protein, and the Myc and VSV-G tags are added in the middle for purification or identification, and the phage display vector pBG3 is constructed.

1.1.2.2 Preparation of ssDNA template

E. coli strain CJ236 (purchased from NEB) lacks functional dUTPase and uracil-N glycosylase to produce a uracilized single-stranded DNA template. The pBG3 plasmid was transfected into CJ236 and plated on agar plate containing Carbenicillin (50 μg/ml) and chloramphenicol (15 μg/ml) and cultured overnight. A single colony screened on the plate was selected into 3 ml of 2×TY broth medium (containing the same concentration of the above-mentioned double antibody), and cultured at 37 ° C, 250 rpm overnight. On the next day, 0.3 ml of the overnight culture was added to 30 ml of fresh 2×TY broth medium (Carbenicillin 50 μg/ml) for 3-4 hours, and the OD600 was 0.4-0.6, and the helper phage was added (by bacteria: number of phage) The mixture was centrifuged at 150 ° C for 1 hour at 37 ° C, and the bacterial pellet was resuspended in 60 ml of 2 × TY double-antibody medium, cultured at 25 ° C, 250 rpm for 22 hours, and the precipitate was centrifuged. The phage-containing supernatant was precipitated with 5% PEG (PEG800 and 300 mM NaCl adjusted to a concentration of 5%), then resuspended in PBS, and ssDNA was prepared using QIAprep Spin M13 kit (purchased from Qiagen).

1.1.2.3 Library preparation

1.1.2.3.1 The following CDR mutant oligonucleotide strands (synthesized by Jin Weizhi) were prepared by the KunKel method:

1.1.2.3.2 Phosphorylation of Oligonucleotide Chains

The synthetic oligonucleotide strand was added to 100 ul of 50 mM Tris-HCl (Tris base was purchased from Soleil, adjusted to pH 7.5 with hydrochloric acid) to obtain a phosphorylation system containing the following components: 5 U T4 polynucleotide kinase, 10mM MgCl _2, 1mM ATP and 5mM DTT. After the phosphorylation system was reacted at 37 ° C for 1 hour, a phosphorylated oligonucleotide was obtained. The phosphorylated oligonucleotide strand was purified using a PCR purification kit (purchased from Tiangen).

1.1.2.3.3 phosphorylated oligonucleotides anneal to ssDNA

The phosphorylated oligonucleotide and Uracilated ssDNA (phosphorylated oligonucleotide: ssDNA=3:1, prepared by ssDNA 1.1.2.2) were dissolved in 50 mM Tris-HCl buffer (pH 7.5) containing 10 mM MgCl ₂ . In the reaction at 90 ° C for 2 minutes, it was lowered to 25 ° C (1 ° C / min per minute) to obtain an annealing-bound phosphorylated oligonucleotide and ssDNA complex.

1.1.2.3.4 dsDNA synthesis

0.55 mM ATP, 0.8 mM dNTPs, 5 mM DTT, 15 U T4 DNA synthetase and 15 U T7 DNA synthetase were added to the annealing-bound phosphorylated oligonucleotide and ssDNA complex, and incubated at 20 ° C for 3 hours to obtain dsDNA. . The dsDNA was purified using Qiaquick PCR Purification Kit (purchased from Qiagen). The purified DNA was transformed into electrotransformed competent TG1.

1.2 BM13 helper phage and phage library proliferation

1.2.1 Proliferation of BM13 helper phage

A fresh single colony of Escherichia coli TG1 (purchased from Wuhan Qiling) was picked from the basic agar medium plate, inoculated into 20 ml of 2×TY medium, gently shaken, and cultured at 37 ° C until the OD600 was about 0.8. A series of 10-fold diluted BM13 phage were prepared from the original BM13 helper phage prepared in 1.1.1 using 2 x TY medium. Each dilution was mixed with 10 μl and 200 μl of TG1 (OD600=0.8), and the shaker was gently shaken for 3 s, mixed with the upper agar medium, and poured on a pre-equilibrated room temperature TY plate. Rotate the plate to ensure even distribution of the cells and the upper agar. After the supernatant medium was coagulated, it was cultured in an inverted culture at 37 ° C in a biochemical incubator overnight.

The next day, a well-separated single phage was selected and inoculated into a 15 ml culture tube containing 2 to 3 ml of 2 x TY medium containing 25 μg/ml kanamycin. Incubate at 37 ° C, 250 rpm for 12 to 16 h. The infected supernatant was transferred to a 1.5 ml sterile microcentrifuge tube and centrifuged at 4 ° C for 2 min at maximum speed on a microfuge. The supernatant was transferred to a new tube and stored at 4 °C.

1.2.2 Proliferation of phage library

The prepared phage library was inoculated into 100 ml of 2 x TY medium containing 60 μg/ml ampicillin, and cultured at 37 ° C, shaking at 250 rpm until the OD600 was 0.8, and BM13 was added to a concentration of 2 × 10 ⁷ pfu/ml. Incubate at 37 ° C, 300 rpm for 1 h, add 25 μg / ml kanamycin, continue to culture at 37 ° C for 14 ~ 18h. The bacterial solution was centrifuged, and the supernatant was precipitated with 5% PEG, and then resuspended in 5% MPBS for use.

1.3 Screening for single domain antibodies to HSA

1.3.1 Biopanning

The HSA was directly coated with the immunotube at room temperature for 2 h. Wash PBST and PBS 2 or 3 times. MPBS was blocked for 2 h, washed with PBST and PBS for 2 to 3 times. The phage library was added to the immunotube and incubated for 2 h at room temperature.

The unbound library was removed, and the immunotubes were washed 10 times with PBST and PBS. 0.01% trypsin solution was added to the immunotube and incubated for 1 h at room temperature. A trypsin eluate is obtained.

The trypsin eluate was added to 30 ml of TG1 (OD600 = 0.5), and the library was first eluted by the method of 1.2.

This is the second round and the third round of panning. Single colonies obtained after three rounds of panning were picked into 96-well plates. The culture supernatant was prepared according to the 1.2 Chinese library proliferation method.

1.3.2 ELISA identification

Take a certain amount of supernatant for ELISA. See Figure 1A.

The specific steps of the ELISA are as follows: dilute the known antigen to 1 to 10 μg/ml with a coating buffer, add 0.1 ml per well, overnight at 4 ° C; wash 3 times a day; add 0.1 ml of the sample to be tested to the above The coated wells were incubated at 37 ° C for 1 h, washed; freshly diluted enzyme-labeled secondary antibody (horseradish peroxidase HRP-labeled anti-phage secondary antibody, 1:5000) 0.1 ml was added and incubated at 37 ° C for 60 min. Wash; wash with DDW for the last time. 0.1 ml of a temporarily prepared TMB substrate solution was added to each reaction well, and reacted at 37 ° C for 10 to 30 minutes. The plate was read at a wavelength of 650 nm using an advanced plate reader.

The light absorption value of each well is shown in Fig. 1B. Among them, A: All wells of ELISA were coated with antigen HSA; the antibodies in each well were different. B: Data analysis, the ordinate is the light absorption value of each hole at 650 nm, and the abscissa is 96 holes, wherein 1-8 are A1, B1, C1, D1, E1, F1, G1, H1, 9-16 For A2, B2, C2, D2, E2, F2, G2, H2, and so on, 89-96 is A12, B12, C12, D12, E12, F12, G12, H12.

33 positive clones were selected from Figure 1 for ELISA, and the affinity of each single domain antibody for HSA and IgG was determined. The data is shown in Figure 2. Among them, the ordinate is the light absorption value at 650 nm, and the abscissa is 33 single domain antibodies. The blue strip antigen is coated with HSA and the green strip antigen is coated with IgG.

The clones with higher affinity for HSA in Figure 2 were selected, and clones with low IgG affinity (A650 < 0.3) were sequenced to obtain a plurality of different amino acid sequences. The clone corresponding to the amino acid sequence shown in SEQ ID No. 10 was named HB5, and the corresponding single domain antibody was a single domain antibody HB5; the clone corresponding to the amino acid sequence shown in SEQ ID No. 11 was named HE9, which corresponds to The single domain antibody is the single domain antibody HE9; the clone corresponding to the amino acid sequence shown in SEQ ID No. 12 is named HF11, and the corresponding single domain antibody is the single domain antibody HF11.

The amino acid sequence of the single domain antibody HB5 is shown in SEQ ID No. 10, and the coding gene sequence is shown in SEQ ID No. 13. Wherein, the amino acid sequence of the complementarity determining region CDR1 of the single domain antibody HB5 is as shown in SEQ ID No. 1, the amino acid sequence of the complementarity determining region CDR2 is as shown in SEQ ID No. 2, and the amino acid sequence of the complementarity determining region CDR3 is SEQ ID No. .3 is shown.

The amino acid sequence of the single domain antibody HE9 is shown in SEQ ID No. 11, and the coding gene sequence is shown in SEQ ID No. 14. Wherein, the amino acid sequence of the complementarity determining region CDR1 of the single domain antibody HE9 is as shown in SEQ ID No. 4, the amino acid sequence of the complementarity determining region CDR2 is as shown in SEQ ID No. 5, and the amino acid sequence of the complementarity determining region CDR3 is SEQ ID No. .6 is shown.

The amino acid sequence of the single domain antibody HF11 is shown in SEQ ID No. 12, and the coding gene sequence is shown in SEQ ID No. 15. Wherein, the amino acid sequence of the complementarity determining region CDR1 of the single domain antibody HF11 is as shown in SEQ ID No. 7, the amino acid sequence of the complementarity determining region CDR2 is as shown in SEQ ID No. 8, and the amino acid sequence of the complementarity determining region CDR3 is SEQ ID No. .9 is shown.

Example 2 Expression of Fusion Protein HB5-Fc and Its Binding Ability to HSA

1. Construction of recombinant vector

The DNA molecule shown in SEQ ID No. 16 (which includes the HB5 single domain antibody sequence, linker (G4S) and human Fc sequence) was cloned between the NcoI and XhoI restriction endonuclease sites of pET22b to obtain a recombinant vector pET22b. -HB5-linker-Fc, the structure of which is shown in Figure 3.

2. Construction and culture of recombinant cells

The recombinant vector pET22b-HB5-linker-Fc was transformed into E.coli/DE3 (Transgen Biotech, CD601-01), and the next day, the monoclonal antibody was picked up, shaken at 37 ° C, and shaken at 220 rpm until the OD600 was about 0.5, and IPTG was added (working After a concentration of 1 mM), expression was induced for 20 h at 18 ° C, 220 rpm. After collecting the cells, they were resuspended in PBS (pH 7.4) and then ultrasonically disrupted to obtain an ultrasonic supernatant of HB5-Fc. Ultrasonic crushing conditions: 600 W, ultrasound 2 sec, interval 6 sec, total 10 min, 16 ° C. After sonication, centrifuge at 10 ° C for 1 min at 10 ° C for 10 min.

3. Identification of fusion protein HB5-Fc

The HB5-Fc supernatant was purified with ProteinA and run SDS-PAG, see Figure 4. Marker's strips are from 14, 25, 30, 40, 50, 70, 100, 120, 160 KD. Line1 is a reduced form of HB5-Fc, which is approximately 43 kD.

4. Binding ability of fusion protein HB5-Fc to HSA

The ability of the purified fusion protein HB5-Fc to bind to HSA was examined by ELISA. Among them, the ELISA antigens were coated with HSA, the primary antibody samples were selected as HB5-Fc and one non-HSA antibody (Blank), and the secondary antibody was goat anti-human IgG 1:5000. The plate was added to the TMB for 20 min, and the plate was read at a wavelength of 650 nm using an advanced plate reader. The data was organized as shown in Fig. 5. The ordinate is the light absorption at 650 nm and the abscissa is two samples.

The results showed that the fusion vector HB5-Fc expressed by the recombinant vector pET22b-HB5-linker-Fc was able to bind to HSA.

Example 3 Expression of Fusion Protein HF11-Fc and Its Binding Ability to HSA

1. Construction of recombinant vector

Cloning of the DNA molecule set forth in SEQ ID No. 17 (which includes the Kozak sequence and the signal peptide, the HF11 single domain antibody sequence, the human Fc sequence and the tag sequence) into the HindIII and XbaI restriction endonuclease sites of pcDNA3.1 The recombinant vector pcDNA3.1-HF11-Fc was obtained, and its structure is shown in Fig. 6.

2. Construction and culture of recombinant cells

The recombinant vector pcDNA3.1-HF11-Fc was transiently transfected into 293F cells (ThermoFisher, A14527), cultured for 4 days, centrifuged, and the supernatant was collected and purified with Protein A.

3. Binding ability of fusion protein HF11-Fc to HSA

The affinity of the purified HF11-Fc fusion protein to human serum albumin (HSA), bovine serum albumin (BSA), goat serum (containing goat serum albumin), and horse serum (containing horse serum albumin) was measured by ELISA.

The results of the ELISA assay are shown in Figure 7. Wherein, HF11-Fc(-) indicates that no primary antibody is added, and only a secondary antibody is added; HF11-Fc(+) indicates that a primary anti-HF11-Fc fusion protein is added, and a secondary antibody is added. The results showed that the fusion antibody HF11-Fc expressed in the recombinant vector pcDNA3.1-HF11-Fc specifically binds to HSA and does not bind to BSA, and does not bind to goat serum, and has a weak degree of binding to horse serum.

The present invention has been described in detail by way of example only, and is not intended to limit the scope of the invention. The scope of the invention is defined by the claims. In the light of the technical solutions of the present invention, or by those skilled in the art, within the spirit and scope of the present invention, a similar technical solution is designed to achieve the above technical effects, or Equivalent changes and improvements in the scope of application shall remain within the scope of protection covered by the patents of the present invention.

Industrial application

The present invention utilizes phage display technology to screen a plurality of antibodies capable of specifically recognizing HSA in a human single-domain antibody library. The antibody of the present invention contains only one variable region of the heavy chain of the antibody, and is the smallest fully functional antigen-binding fragment, which has a smaller molecular weight and a weaker immunogenicity than the single-chain antibody or antibody Fab segment, when it is associated with HSA. Specific binding occurs to extend the half-life of biopharmaceuticals. Compared with the prior art, the present invention has the beneficial effects that the present invention can obtain a single-domain antibody with high affinity by screening, can recognize specific human serum albumin, prolong the half-life of biopharmaceutical, and is beneficial to the treatment of tumor. .

Claims (16)

1. A single domain antibody recognizing human serum albumin, comprising a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, wherein the single domain antibody is any one of the following (a) to (c) Kind:

   (a) The complementarity determining region CDR1 of the single domain antibody is as follows (a1) or (a2) or (a3):

   (a1) comprising the amino acid sequence of SEQ ID No. 1;

   (a2) the amino acid sequence of SEQ ID No. 1;

   (a3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 1 to substitution and/or deletion and/or addition of one or several amino acid residues;

   The complementarity determining region CDR2 of the single domain antibody is as follows (a4) or (a5) or (a6):

   (a4) comprising the amino acid sequence shown in SEQ ID No. 2;

   (a5) the amino acid sequence shown in SEQ ID No. 2;

   (a6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 2 to substitution and/or deletion and/or addition of one or several amino acid residues;

   The complementarity determining region CDR3 of the single domain antibody is as follows (a7) or (a8) or (a9):

   (a7) comprising the amino acid sequence shown in SEQ ID No. 3;

   (a8) an amino acid sequence of SEQ ID No. 3;

   (a9) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 3 to substitution and/or deletion and/or addition of one or several amino acid residues;

   (b) The complementarity determining region CDR1 of the single domain antibody is as follows (b1) or (b2) or (b3):

   (b1) comprising the amino acid sequence shown in SEQ ID No. 4;

   (b2) an amino acid sequence represented by SEQ ID No. 4;

   (b3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 4 to substitution and/or deletion and/or addition of one or several amino acid residues;

   The complementarity determining region CDR2 of the single domain antibody is as follows (b4) or (b5) or (b6):

   (b4) comprising the amino acid sequence of SEQ ID No. 5;

   (b5) an amino acid sequence of SEQ ID No. 5;

   (b6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 5 to substitution and/or deletion and/or addition of one or several amino acid residues;

   The complementarity determining region CDR3 of the single domain antibody is as follows (b7) or (b8) or (a9):

   (b7) comprising the amino acid sequence of SEQ ID No. 6;

   (b8) the amino acid sequence of SEQ ID No. 6;

   (b9) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 6 to substitution and/or deletion and/or addition of one or several amino acid residues;

   (c) The complementarity determining region CDR1 of the single domain antibody is as follows (c1) or (c2) or (c3):

   (c1) comprising the amino acid sequence of SEQ ID No. 7;

   (c2) an amino acid sequence of SEQ ID No. 7;

   (c3) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 7 to substitution and/or deletion and/or addition of one or several amino acid residues;

   The complementarity determining region CDR2 of the single domain antibody is as follows (c4) or (c5) or (c6):

   (c4) comprising the amino acid sequence of SEQ ID No. 8;

   (c5) the amino acid sequence of SEQ ID No. 8;

   (c6) an amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 8 to substitution and/or deletion and/or addition of one or several amino acid residues;

   The complementarity determining region CDR3 of the single domain antibody is as follows (c7) or (c8) or (c9):

   (c7) comprising the amino acid sequence shown in SEQ ID No. 9;

   (c8) an amino acid sequence of SEQ ID No. 9;

   (c9) An amino acid sequence having the same function obtained by subjecting the amino acid sequence represented by SEQ ID No. 9 to substitution and/or deletion and/or addition of one or several amino acid residues.
2. The single domain antibody according to claim 1, wherein the single domain antibody is as follows (d1) or (d2):

   (d1) the amino acid sequence of SEQ ID No. 10 or SEQ ID No. 11 or SEQ ID No. 12;

   (d2) having the same function as the amino acid sequence represented by SEQ ID No. 10 or SEQ ID No. 11 or SEQ ID No. 12 by substitution and/or deletion and/or addition of one or several amino acid residues Amino acid sequence.
3. The derivative of the single domain antibody according to claim 1 or 2, which is any one of the following (e1) to (e9):

   (e1) a fusion protein prepared by the single domain antibody of claim 1 or 2 and at least one polypeptide molecule having therapeutic or recognition function;

   (e2) a multispecific or multifunctional molecule comprising the single domain antibody of claim 1 or 2;

   (e3) a composition comprising the single domain antibody of claim 1 or 2;

   (e4) an immunoconjugate comprising the single domain antibody of claim 1 or 2;

   (e5) an antibody obtained by modifying and/or modifying the single domain antibody or antigen-binding portion thereof according to claim 1 or 2;

   (e6) a heavy chain variable region or a light chain variable region comprising the complementarity determining region of claim 1;

   (e7) an scFv or antibody comprising the complementarity determining region of claim 1;

   (e8) comprising one or two or more amino acid sequences of the complementarity determining regions of claim 1, and having at least 79% homology to an amino acid sequence of one complementarity determining region;

   (e9) one or two or more amino acid sequences in the framework region of the single domain antibody according to claim 1 or 2, and having at least 90% homology with the amino acid sequence of one framework region.
4. The derivative according to claim 3, characterized in that:

   The fusion protein is obtained by directly fusing the single domain antibody of claim 1 or 2 with at least one polypeptide molecule having therapeutic or recognition function, or by treating or recognizing one or more peptides with a linker peptide. Functional peptide molecules are obtained by ligation.
5. The derivative according to claim 4, characterized in that:

   The polypeptide molecule having therapeutic or recognition function is a human Fc protein.
6. The derivative according to claim 3, characterized in that:

   The immunoconjugate comprises a pharmaceutically acceptable carrier.
7. The biomaterial related to the single domain antibody according to claim 1 or 2 or the derivative according to any one of claims 3 to 6 is any one of the following (f1) to (f4):

   (f1) a nucleic acid molecule encoding the single domain antibody of claim 1 or 2;

   (f2) a nucleic acid molecule encoding the fusion protein of claim 3;

   (f3) a vector comprising the nucleic acid molecule of (f1) or (f2);

   (f4) A host cell comprising the nucleic acid molecule of (f1) or (f2) or the vector of (f3).
8. The biomaterial according to claim 7, wherein:

   The nucleic acid molecule is any one of the following (g1)-(g3):

   (g1) a DNA molecule represented by SEQ ID No. 13 or SEQ ID No. 14 or SEQ ID No. 15 or SEQ ID No. 16 or SEQ ID No. 17;

   (g2) a DNA molecule having 75% or more of the identity of the nucleotide sequence defined by (g1), and encoding the single domain antibody of claim 1 or 2 or the fusion protein of claim 3.

   (g3) a DNA molecule which hybridizes under strict conditions to a nucleotide sequence defined by (g1) or (g2) and which encodes the single domain antibody of claim 1 or 2 or the fusion protein of claim 3.
9. The single domain antibody according to claim 1 or 2, or the derivative according to any one of claims 3 to 6 or the biological material according to claim 7 or 8 in any one of the following (h1) to (h6) application:

   (h1) specifically recognizing and/or binding to human serum albumin;

   (h2) preparing a product that specifically recognizes and/or binds to human serum albumin;

   (h3) prolonging the half-life of the protein drug and/or the polypeptide drug;

   (h4) a product for preparing a half-life of a prolonged protein drug and/or a polypeptide drug;

   (h5) tumor immunotherapy;

   (h6) Preparation of a product for tumor immunotherapy.
10. The use according to claim 9, wherein the product is a medicament.
11. The use according to claim 9 or 10, characterized in that the tumor is melanoma, breast cancer, prostate cancer, lung cancer, ovarian cancer, thyroid cancer, liver cancer, bladder cancer or gastric cancer.
12. The method for producing a fusion protein according to claim 3, comprising the steps of: introducing the gene encoding the single domain antibody of claim 1 or 2 and the gene encoding the human Fc protein into a host cell to obtain a recombinant cell; The recombinant cells are described to obtain the fusion protein.
13. The method according to claim 12, wherein the gene encoding the single domain antibody and the gene encoding the human Fc protein are introduced into a host cell by a recombinant vector;

    The recombinant vector is obtained by inserting a gene encoding the single domain antibody and a fragment encoding the human Fc protein into a multiple cloning site of an expression vector.
14. The method according to claim 13, wherein said gene encoding said single domain antibody and said gene encoding said human Fc protein are represented by SEQ ID No. 16 or SEQ ID No. 17. DNA molecule.
15. The method according to claim 13, wherein the expression vector is a pET22b vector or a pcDNA3.1 vector.
16. The method according to claim 12 or 13, wherein the host cell is an E. coli/DE3 cell or a 293F cell.

Images