CN110872347A

CN110872347A - Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide

Info

Publication number: CN110872347A
Application number: CN201811003018.1A
Authority: CN
Inventors: 梁猛; 高斌; 梅小伟; 郭小飞; 郭志霞
Original assignee: Timmune Biotech Inc
Current assignee: SHENZHEN BEIKE BIO-TECHNOLOGY Co.,Ltd.
Priority date: 2018-08-30
Filing date: 2018-08-30
Publication date: 2020-03-10

Abstract

The invention discloses a single-domain antibody for recognizing a complex formed by an HLA-A2 molecule and ITDQVPFSV short peptide. The single domain antibody is an amino acid sequence shown as SEQ ID No.10 or SEQ ID No.11 or SEQ ID No. 12. The invention also discloses a fusion protein obtained by fusing the single domain antibody and the human Fc protein. Experiments prove that: the single domain antibody and the fusion protein not only can identify the artificially synthesized HLA-A2/ITDQVPFSV complex, but also can be combined with the HLA-A2/ITDQVPFSV complex which is processed by natural antigen and is expressed on the surface of a tumor cell, and can be further developed into related tumor treatment products.

Description

Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide

Technical Field

The invention belongs to the technical field of tumor treatment, and particularly relates to a single domain antibody for recognizing a complex formed by an HLA-A2 molecule and ITDQVPFSV short peptide.

Background

The incidence of melanoma has multiplied every year since the fortieth of the twentieth century. Currently, melanoma is ranked sixth in the most common cancers in men and seventh in women. The incidence of melanoma is increasing worldwide. The 5-year survival rate of melanoma patients is 30% to 40%, with the highest mortality rate due to metastasis of malignant melanoma; if the metastatic melanoma patients (stage IV) do not have an effective long-term treatment, standard chemotherapy regimens do not deliver significant long-term survival efficacy to these patients. Therefore, there is an urgent need to develop new targeted therapeutic approaches for melanoma, which can both prevent the development of cancer and treat advanced diseases.

The important role of MHC in immune recognition was first discovered in 1974 by Zinkernegel and Doherty. In experiments, they noted that virus-specific Cytotoxic T Lymphocytes (CTLs) can only kill virus-infected cells that have the same MHC molecules as themselves. This phenomenon is called MHC restriction, suggesting that MHC molecules play an important role in the killing process of CTLs. The mechanism of this phenomenon has been pending in the next last 10 years. Until 1982, the alainn townsend laboratory at oxford university demonstrated that CTL clones with influenza protein specificity did not recognize expressed intact viral glycoproteins. Subsequently, they demonstrated that uninfected syngeneic mouse fibroblasts loaded with influenza protein polypeptides were also recognized and killed by influenza-specific CTLs. These experiments demonstrate that intracellular tumor antigens are degraded by proteases or lysosomes into small peptides, which, after binding to HLA-I or HLA-II molecules, form peptide/HLA complexes that are presented on the surface of tumor cells and are then recognized by TCR receptors on the surface of T cells, mediating the killing of tumor cells by T cells.

T cells, a very promising effector cell for adoptive cell therapy, can detect transformed cells by specific recognition between the T Cell Receptor (TCR) and the peptide/human leukocyte antigen (peptide/HLA) complex, these peptides are derived from Tumor Associated Antigens (TAAs), which are usually mutated or overexpressed in tumor cells, more and more TAAs have been identified by T cell epitope cloning, higher genomics, transcriptomics and proteomics techniques, among which the melanocyte differentiation antigen glycoprotein 100(gp100) is highly immunogenic due to over-expression in over 90% of melanomas, and has received much attention, researchers have isolated α chain and β chain from T cells that are immunoreactive with gp100 and introduced into lymphocytes of melanoma patients, with a partial clearance of 19% of patients' tumors in 16 patients, despite the clinical efficacy of TCR acquisition difficulties and the potential risk of TCR mismatch, the adoptive immunotherapy based on transgenic TCR has progressed even slightly.

In order to overcome the problems with transgenic TCRs, several groups have developed antibodies with TCR-like specificity rather than native αβ TCR-specific antibodies that mimic the recognition of the TCR for a specific MHC complex of tumor cells, i.e., bind TAA-derived polypeptides in an HLA-restricted manner using phage display technology, TCR-like antibodies can be obtained by in vitro screening entirely, with a significant improvement in efficiency compared to TCR isolation.

Gp100 is a melanocyte differentiation antigen, localized inside the cell, processed and presented on the surface of tumor cells in the form of MHC/peptide complexes, which are recognized and killed by T cells. Research shows that the immunotoxin based on the Fab antibody capable of specifically recognizing HLA/gp 100-peptide complex can effectively inhibit the growth of human melanoma cell in nude mouse. HLA-A2-restricted CTLs derived from melanoma tumor infiltration recognize the gp100 epitope. The report proves that the HLA-A2/gp 100-peptide complex is an effective target for tumor targeted therapy. IMCgp100 is a product for the treatment of uveal melanoma, and is a bispecific protein consisting of a TCR targeting a tumor-specific gp100 polypeptide and a scFv against CD3, and has now entered the critical research phase of clinical trials, and the US FDA has granted IMCgp100 orphan drug qualification for the treatment of uveal melanoma. In addition to monotherapy, clinical studies of IMCgp100 in combination with the Aslicon PD-L1 antibody and the Aslicon CLTA-4 antibody are also in the second phase. At the 2017 ASCO annual meeting, the Immunocore company published a clinical outcome of IMCgp100, recruiting 19 metastatic uveal melanoma patients in a phase I study with increased in-patient dose and showing median progression-free survival (PFS) of 5.6 months, which was superior to the previously reported median PFS of 2.6-2.8 months. PFS rate at 24 weeks (6 months) was 57%, while data reported in previous clinical studies were only 19-27%.

Disclosure of Invention

Aiming at the technical problems in the prior art, the invention screens and obtains the single domain antibody for identifying the HLA-A2/ITDQVPFSV antigen complex, the single domain antibody can be specifically combined with the complex formed by the ITDQVPFSV antigen short peptide and the HLA-A2 molecule, and can be developed into antibody medicaments for treating tumors and other biological treatment products with beneficial effects.

The single domain antibody for recognizing HLA-A2/ITDQVPFSV provided by the invention comprises a complementarity determining region CDR1, a complementarity determining region CDR2 and a complementarity determining region CDR3, and is (a) or (b) or (c) as follows:

(a) the complementarity determining region CDR1 of the single domain antibody is (a1) or (a2) or (a3) or (a4) as follows:

(a1) comprises an amino acid sequence shown as SEQ ID No. 1;

(a2) an amino acid sequence shown as SEQ ID No. 1;

(a3) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 1;

(a4) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.1 and has the same function;

the complementarity determining region CDR2 of the single domain antibody is (a5) or (a6) or (a7) or (a8) as follows:

(a5) comprises an amino acid sequence shown as SEQ ID No. 2;

(a6) an amino acid sequence shown as SEQ ID No. 2;

(a7) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 2;

(a8) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.2 and has the same function;

the complementarity determining region CDR3 of the single domain antibody is (a9) or (a10) or (a11) or (a12) as follows:

(a9) comprises an amino acid sequence shown as SEQ ID No. 3;

(a10) an amino acid sequence shown as SEQ ID No. 3;

(a11) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 3;

(a12) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.3 and has the same function;

(b) the complementarity determining region CDR1 of the single domain antibody is (b1) or (b2) or (b3) or (b4) as follows:

(b1) comprises an amino acid sequence shown as SEQ ID No. 4;

(b2) an amino acid sequence shown as SEQ ID No. 4;

(b3) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 4;

(b4) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.4 and has the same function;

(b) the complementarity determining region CDR2 of the single domain antibody is (b5) or (b6) or (b7) or (b8) as follows:

(b5) comprises an amino acid sequence shown as SEQ ID No. 5;

(b6) an amino acid sequence shown as SEQ ID No. 5;

(b7) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 5;

(b8) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.5 and has the same function;

(b) the complementarity determining region CDR3 of the single domain antibody is (b9) or (b10) or (b11) or (b12) as follows:

(b9) comprises an amino acid sequence shown as SEQ ID No. 6;

(b10) an amino acid sequence shown as SEQ ID No. 6;

(b11) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 6;

(b12) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.6 and has the same function;

(c) the complementarity determining region CDR1 of the single domain antibody is (c1) or (c2) or (c3) or (c4) as follows:

(c1) comprises an amino acid sequence shown as SEQ ID No. 7;

(c2) an amino acid sequence shown as SEQ ID No. 7;

(c3) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 7;

(c4) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.7 and has the same function;

the complementarity determining region CDR2 of the single domain antibody is (c5) or (c6) or (c7) or (c8) as follows:

(c5) comprises an amino acid sequence shown as SEQ ID No. 8;

(c6) an amino acid sequence shown as SEQ ID No. 8;

(c7) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 8;

(c8) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.8 and has the same function;

the complementarity determining region CDR3 of the single domain antibody is (c9) or (c10) or (c11) or (c12) as follows:

(c9) comprises an amino acid sequence shown as SEQ ID No. 9;

(c10) an amino acid sequence shown as SEQ ID No. 9;

(c11) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No. 9;

(c12) an amino acid sequence which has 75 percent or more than 75 percent of homology with the amino acid sequence shown in SEQ ID No.9 and has the same function.

The above single domain antibody further comprises a framework region FR1, a framework region FR2, a framework region FR3 and a framework region FR 4;

in the step (a), the framework region FR1 of the single domain antibody is the 1 st to 25 th amino acid sequence shown in SEQ ID No.10, the framework region FR2 of the single domain antibody is the 35 th to 48 th amino acid sequence shown in SEQ ID No.10, the framework region FR3 of the single domain antibody is the 57 th to 95 th amino acid sequence shown in SEQ ID No.10, and the framework region FR4 of the single domain antibody is the 101 th and 111 th amino acid sequence shown in SEQ ID No. 10;

in the step (b), the framework region FR1 of the single domain antibody is the 1 st to 25 th amino acid sequence shown in SEQ ID No.10, the framework region FR2 of the single domain antibody is the 35 th to 48 th amino acid sequence shown in SEQ ID No.10, the framework region FR3 of the single domain antibody is the 57 th to 95 th amino acid sequence shown in SEQ ID No.10, and the framework region FR4 of the single domain antibody is the 101 th and 111 th amino acid sequence shown in SEQ ID No. 10;

in the step (c), the framework region FR1 of the single domain antibody is the 1 st to 25 th amino acid sequence shown in SEQ ID No.12, the framework region FR2 of the single domain antibody is the 35 th to 48 th amino acid sequence shown in SEQ ID No.12, the framework region FR3 of the single domain antibody is the 57 th to 95 th amino acid sequence shown in SEQ ID No.12, and the framework region FR4 of the single domain antibody is the 114 th and 124 th amino acid sequence shown in SEQ ID No. 12.

The amino acid sequence of the single-domain antibody is as follows (d1), (d2) or (d 3):

(d1) an amino acid sequence shown as SEQ ID No.10 or SEQ ID No.11 or SEQ ID No. 12;

(d2) an amino acid sequence with the same function is obtained by substituting and/or deleting and/or adding one or two amino acid residues of the amino acid sequence shown in SEQ ID No.10, SEQ ID No.11 or SEQ ID No. 12;

(d3) and the amino acid sequence has 75 percent or more than 75 percent of homology with the amino acid sequence shown by SEQ ID No.10, SEQ ID No.11 or SEQ ID No.12 and has the same function.

The term "homology" as used herein may describe the degree of similarity of two or more amino acid sequences, and the percentage of homology between a first amino acid sequence and a second amino acid sequence may be determined by the formula: (the number of amino acid residues in the first amino acid sequence that are identical to the amino acid sequence at the corresponding position in the second amino acid sequence)/(the total number of amino acids in the first amino acid sequence) × 100%, wherein only deletion, insertion, substitution or addition of an amino acid in the second amino acid sequence (as compared to the first amino acid) is considered as a difference. Percent homology can also be obtained using known computer algorithms for sequence matching such as NCBI Blast.

The coding gene sequence of the single-domain antibody is any one of the following (e1) - (e 3):

(e1) a DNA molecule shown as SEQ ID No.13 or SEQ ID No.14 or SEQ ID No. 15;

(e2) a DNA molecule having 75% or more identity to the nucleotide sequence defined in (e1) and encoding the above-mentioned single domain antibody;

(e3) a DNA molecule which hybridizes with the nucleotide sequence defined in (e1) or (e2) under stringent conditions and encodes the above-mentioned single domain antibody.

In order to solve the technical problems, the invention further provides a derivative of the single domain antibody.

The derivative of the single domain antibody provided by the invention is any one of the following (f1) - (f 6):

(f1) a fusion protein comprising the above-described single domain antibody;

(f2) a multispecific or multifunctional molecule comprising the above single domain antibody;

(f3) a composition comprising the above-described single domain antibody;

(f4) immunoconjugates comprising the above single domain antibodies;

(f5) an antibody obtained by modifying and/or modifying the above-mentioned single domain antibody or an antigen-binding portion thereof;

(f6) an antibody comprising the above-described complementarity determining region.

In the above derivatives, the fusion protein is obtained by fusing the above single domain antibody with at least 1 polypeptide molecule having a therapeutic or recognition function. The polypeptide molecule with the treatment or recognition function is specifically human Fc protein.

The fusion protein is an Fc fusion protein obtained by fusing the single-domain antibody and a human Fc protein. After the single-domain antibody is fused with the human Fc protein, the monovalent antibody becomes a bivalent antibody, and the affinity is improved.

In the above derivatives, the composition may be a pharmaceutical composition, which comprises a pharmaceutically acceptable carrier. The pharmaceutical compositions of the present invention may be administered in combination therapy, i.e. in combination with other agents. The term "pharmaceutically acceptable carrier" as used herein includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, which are physiologically compatible.

The pharmaceutical compositions of the present invention may comprise one or more pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" as used herein refers to a salt that retains the desired biological activity of the parent compound and does not cause any undesirable toxicological effects. Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from non-toxic inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous, and the like, as well as those derived from non-toxic organic acids such as aliphatic monocarboxylic and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, and the like. Base addition salts include those derived from alkaline earth metals such as sodium, potassium, magnesium, calcium, and the like, as well as those derived from non-toxic organic amines such as N, N' -dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine, and the like.

Examples of pharmaceutically acceptable antioxidants include (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like, (2) oil-soluble antioxidants such as ascorbyl palmitate, Butylated Hydroxyanisole (BHA), butylated hydroxytoluene (DHT), lecithin, propyl gallate, α -tocopherol, and the like, and (3) metal chelators such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

Examples of suitable aqueous or nonaqueous carriers that can be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the application of a coating material, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

In practice, these compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispersing agents. Prevention of the presence of microorganisms can be ensured by sterilization procedures or by the inclusion of various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol sorbic acid, and the like.

The compositions of the present invention may be administered by one or more routes of administration using one or more methods well known in the art. It will be appreciated by those skilled in the art that the route and/or mode of administration will vary depending on the desired result.

The compositions of the invention have in vitro and in vivo therapeutic applications. For example, these molecules can be administered to cells cultured in vitro or ex vivo, or to human subjects in vivo, to treat, prevent, or diagnose a variety of diseases. The term "subject" as used herein includes both human and non-human animals. Non-human animals include all vertebrates, such as mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles.

In the above derivatives, the immunoconjugate may be a conjugate obtained by conjugating the above single domain antibody with a therapeutic agent such as a cytotoxin, a drug (e.g., an immunosuppressant), or a radiotoxin. These conjugates are referred to as "immunoconjugates". Immunoconjugates comprising one or more cytotoxins are referred to as "immunotoxins". Cytotoxic or cytotoxic agents include any agent that is harmful (e.g., kills) on a cell. Examples include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, epipodophyllotoxin glucopyranoside, epipodophyllotoxin thiophenoside, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthrax dione, mitoxantrone, mithramycin, actinomycin D, l-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents also include, for example, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil cry, dacarbazine (decarbazine), burnable agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozocin, mitomycin C and cis-dichlorodiammineplatinum (II) (DDP) cisplatin), anidamycins (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., actinomycin D, bleomycin, mithramycin and Atramycin (AMC)), and antimitotic agents (e.g., vincristine and vinblastine) Spinosyns, maytansine, auristatins, and derivatives thereof.

The antibodies of the invention may also be conjugated to radioisotopes to produce cytotoxic radiopharmaceuticals, also known as radioimmunoconjugates. Examples of radioisotopes that can be conjugated to antibodies for diagnostic or therapeutic use include, but are not limited to, iodine¹³¹Indium, indium¹¹¹Yttrium, yttrium⁹⁰And lutetium¹⁷⁷. Methods for preparing radioimmunoconjugates are established in the art. Examples of radioimmunoconjugates are available as commercial products, including Zevalin^TM(IDEC Pharmaceuticals) and Bexxar^TM(Corixa Pharmaceuticals), a radioactive immunoconjugate can be prepared using the antibody of the invention using a similar method.

The antibody conjugates of the invention are useful for modifying specific biological responses, and the drug moiety should not be construed as being limited to classical chemotherapeutic agents. For example, the drug moiety may be a protein or polypeptide having a desired biological activity. Such proteins may include, for example, enzymatically active toxins or active fragments thereof, such as abrin, ricin a, pseudomonas exotoxin, or diphtheria toxin; proteins, such as tumor necrosis factor or interferon-gamma; or biological response modifiers such as lymphokines, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), or other growth factors.

The present invention provides single domain antibodies comprising CDR1, CDR2 and CDR3 sequences, wherein one or more of these CDR sequences comprise a specific amino acid sequence based on the single domain antibody of the present invention or conservative modifications thereof, and wherein the antibody retains the functional properties of recognizing and/or binding HLA-A2/ITDQVPFSV as provided by the present invention.

One type of variable region engineering that can be performed is CDR grafting. Antibodies interact with a target antigen primarily through amino acid residues located in the Complementarity Determining Regions (CDRs). For this reason, the amino acid sequences within the CDRs are more diverse between individual antibodies than sequences outside the CDRs. Since the CDR sequences are responsible for most antibody-antigen interactions, recombinant antibodies that mimic the properties of this particular existing antibody can be expressed by constructing an expression vector as follows: the expression vector comprises the CDR sequences of the above single domain antibodies grafted onto framework sequences from different antibodies with different properties, which can be obtained from public DNA databases or published references.

Another type of variable region modification is mutation of amino acid sequences within the CDR1, CDR2, and/or CDR3 regions to improve one or more binding properties (e.g., affinity) of the antibody of interest. Site-directed mutagenesis or PCR-mediated mutagenesis can be performed to introduce mutations, effects on antibody binding, or other functional properties of interest, which can be assessed using the assays described herein and provided in the examples. Preferably conservative sequence modifications (as described above) are introduced. The mutation may be an amino acid substitution, addition or deletion, but substitution is preferred. Moreover, there are typically no more than 5 residues changed within the CDR regions.

In order to solve the above technical problems, the present invention also provides a biomaterial related to the above single domain antibody or the above derivative.

The biomaterial related to the above single domain antibody or the above derivative provided by the present invention is any one of the following (g1) to (g 4):

(g1) nucleic acid molecules encoding the above single domain antibodies;

(g2) nucleic acid molecules encoding the above fusion proteins;

(g3) a vector comprising the nucleic acid molecule of (g1) or (g 2);

(g4) a host cell comprising the nucleic acid molecule of (g1) or (g2) or the vector of (g 3).

In the above-mentioned biomaterial, the nucleic acid molecule is any one of the following (h1) to (h 3):

(h1) a DNA molecule shown in SEQ ID No.13 or SEQ ID No.14 or SEQ ID No.15 or SEQ ID No.16 or SEQ ID No.17 or SEQ ID No. 18;

(h2) a DNA molecule which has 75% or more identity to the nucleotide sequence defined in (h1) and which encodes the above-mentioned single domain antibody or the above-mentioned fusion protein;

(h3) a DNA molecule which hybridizes with the nucleotide sequence defined in (h1) or (h2) under stringent conditions and encodes the above single domain antibody or the above fusion protein.

In the above biological material, the nucleic acid molecule may be a nucleotide sequence encoding each complementarity determining region or a single domain antibody or a fusion protein amino acid sequence, and a specific sequence of the corresponding nucleic acid molecule may be obtained at any time by genetic codons. Due to the degeneracy of the genetic code, the nucleic acid molecule can vary depending on the intended use. The term "codon" also known as a triplet codon, as used herein, refers to a triplet of nucleotides corresponding to a certain amino acid. The position of insertion of this amino acid into the growing polypeptide chain is determined during translation.

The nucleic acid molecules of the invention can be obtained using conventional molecular biology techniques. For antibodies obtained from immunoglobulin gene libraries (e.g., using phage display technology), nucleic acids encoding the antibodies can be obtained from the libraries.

In the above biological material, the nucleic acid sequence or at least a part of the sequence in the vector can be expressed by a suitable expression system to obtain the corresponding protein or polypeptide; the expression system includes bacterial, yeast, filamentous fungi, mammalian cells, insect cells, plant cells, or cell-free expression systems.

The application of the above single domain antibody or derivative or biomaterial in any one of the following (1) to (6) also falls within the scope of the present invention:

(1) specifically recognizes and/or binds HLA-A2/ITDQVPFSV;

(2) preparing a product which specifically recognizes and/or binds to HLA-A2/ITDQVPFSV;

(3) specifically recognizing and/or binding to tumor cells expressing HLA-A2/ITDQVPFSV;

(4) preparing a product that specifically recognizes and/or binds to tumor cells expressing HLA-a 2/ITDQVPFSV;

(5) immunotherapy of tumors;

(6) preparing a product for tumor immunotherapy;

tumors that can be treated with the antibodies of the present invention include, but are not limited to, melanoma, breast cancer, prostate cancer, lung cancer, ovarian cancer, thyroid cancer, liver cancer, bladder cancer, or stomach cancer.

In practice, T cells can be modified in vitro with the antibodies or fusion proteins of the invention to provide armed T cells, such as CAR-T cells; after armed T cells are expanded for proliferation and returned to the subject, armed T cells specifically recognize tumors for in vivo tumor immunotherapy. Modification of T cells can be accomplished by conventional methods well known to those skilled in the art.

The HLA-A2/ITDQVPFSV is an HLA-A2/ITDQVPFSV antigen complex, and the HLA-A2/ITDQVPFSV antigen complex is a complex formed by antigen peptide ITDQVPFSV and an antigen molecule HLA-A2.

In order to solve the above technical problems, the present invention finally provides a method for preparing the above fusion protein.

The preparation method of the fusion protein provided by the invention comprises the following steps: introducing the coding gene of the single domain antibody and the coding gene of the humanized Fc protein into a host cell to obtain a recombinant cell; and culturing the recombinant cell to obtain the fusion protein.

In the above method, the gene encoding the single domain antibody and the gene encoding the human Fc protein are introduced into a host cell by a recombinant vector;

the recombinant vector is obtained by inserting a fragment containing the coding gene of the single domain antibody and the coding gene of the humanized Fc protein into a multiple cloning site of an expression vector.

Specifically, the fragment containing the coding gene of the single domain antibody and the coding gene of the human Fc protein is a DNA molecule shown in SEQ ID No.16 or SEQ ID No.17 or SEQ ID No. 18.

Specifically, the expression vector is pcDNA3.1 vector.

Specifically, the host cell is a 293F cell.

The invention obtains single domain antibody with high affinity and capable of identifying and specifically binding HLA-A2/ITDQVPFSV antigen complex and sequence thereof by screening from phage single domain library through three rounds of biological panning, clones the obtained antibody into prokaryotic/eukaryotic expression vector, performs fusion expression with human Fc, and transfects host cells to obtain Fc fusion protein. In vitro experiments prove that: the single domain antibody and the Fc fusion protein provided by the invention can specifically recognize and combine with the HLA-A2/ITDQVPFSV antigen complex, can be developed into an antibody drug for treating melanoma, and have important significance for treating diseases caused by the melanoma.

Drawings

FIG. 1 shows the results of ELISA detection and data analysis of the first plate after three rounds of panning in the present invention. Panel A shows ELISA in which all wells were coated with antigen HLA-A2/ITDQVPFSV. FIG. B shows the data analysis results, with the ordinate representing the light absorption at 650nm of each well and the abscissa representing 96 wells, where 1-8 represent A1, B1, C1, D1, E1, F1, G1, H1, 9-16 represent A2, B2, C2, D2, E2, F2, G2, H2, and so on, and 89-96 represent A12, B12, C12, D12, E12, F12, G12, H12.

FIG. 2 shows the results of ELISA detection and data analysis of the second plate after three rounds of panning in the present invention. Panel A shows all ELISA wells coated with antigen HLA-A2/NLVPMVATV. FIG. B shows the data analysis results, with the ordinate representing the light absorption at 650nm of each well and the abscissa representing 96 wells, where 1-8 represent A1, B1, C1, D1, E1, F1, G1, H1, 9-16 represent A2, B2, C2, D2, E2, F2, G2, H2, and so on, and 89-96 represent A12, B12, C12, D12, E12, F12, G12, H12.

FIG. 3 shows the results of the specificity detection and data analysis of three different single-domain antibodies of the present invention for different antigens. The ordinate is the light absorption value under 650nm, the

abscissa

1, 2, 3 and 4 are respectively four antigens HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA-A2/TIHDIILECV and HLA-A2/SLYSFPEPEA, and a, B, c and D are respectively M4-A7 control, M3-E7, M3-B2 and M3-D9 in sequence.

FIG. 4 is a plasmid map of the fusion of the single domain antibody of the present invention to Fc in pcDNA3.1. A BamHI cleavage site is introduced between the single domain antibody and Fc, and HindIII restriction endonuclease is used before the single domain antibody, and XbaI restriction endonuclease is used after the Fc. Single domain antibodies are preceded by a signal peptide and a kozak sequence.

FIG. 5 is an SDS-PAGE of the fusion proteins M3-E7-Fc, M3-D9-Fc, M4-A7-Fc control, and M3-B2-Fc expressed from pcDNA3.1 in the present invention. The strips of Marker are 14, 25, 30, 40, 50, 70, 100, 120 and 160KD from small to large. FIG. A is a reduced electrophoresis chart of the fusion protein, Line1 is reduced M3-E7-Fc, Line2 is reduced M3-D9-Fc, Line3 is reduced M4-A7-Fc control, and Line4 is reduced M3-B2-Fc. FIG. B is a non-reduction electrophoretogram of the fusion protein, Line5 is non-reduction state M3-E7-Fc, Line6 is non-reduction state M3-D9-Fc, Line7 is non-reduction state M4-A7-Fc control, and Line8 is non-reduction state M3-B2-Fc.

FIG. 6 shows the results of the detection of the specificity of the fusion proteins M3-D9-Fc, M3-B2-Fc, M3-E7-Fc, M4-A7-Fc control to different antigens and the analysis of data. FIG. A shows that different wells of the ELISA plate are coated with different antigens, and the ELISA plate A, B, C, D (1-3) is coated with antigen HLA-A2/ITDQVPFSV; A. b, C, D (4-6) coating antigen HLA-A2/NLVPMVATV; E. f, G, H (1-3) coated with antigen HLA-A2/RMFPNAPYL; E. f, G, H (4-6) coated antigen HLA-A2/SLLMWITQC; A. the primary antibody added by E is M3-E7-Fc, the primary antibody added by B, F is M3-D9-Fc, the primary antibody added by C, G is M4-A7-Fc control, and the primary antibody added by D, H is M3-B2-Fc. FIG. B shows the results of data analysis, the ordinate of the light absorption value at 650nm, and the abscissa of the light absorption value at 1, 2, 3, 4 represents HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA-A2/RMFPNAPYL, HLA-A2/SLLMWITQ of the four antigens. a. B, c and D are sequentially M3-E7-Fc, M3-D9-Fc, M4-A7-Fc contrast and M3-B2-Fc.

FIG. 7 shows the results of cell specificity detection and data analysis of the fusion proteins M3-D9-Fc, M3-B2-Fc, M3-E7-Fc, M4-A7-Fc control of the present invention. Panel A shows the results of the detection of T2 cells loaded with polypeptide antigens, respectively. P3 and P4 represent ITDQVPFSV, NLVPMVATV respectively, and primary antibodies in a, B, c and D are M3-E7-Fc, M3-B2-Fc, M3-D9-Fc and M4-A7-Fc control respectively. Panel B shows the results of tumor cell detection. a. b, c and D are respectively 3M-luc, SK-MEL-28, MEL-624 and A375, and primary antibodies are respectively M3-D9-Fc, M3-E7-Fc and M4-A7-Fc control.

FIG. 8 is a graph of the determination of the molecular interaction and affinity constants of fusion proteins M3-D9-FC, M3-E7-FC and HLA-A2/ITDQVPFSV complex. FIG. A is M3-D9-FC; FIG. B shows M3-E7-FC. Wherein the abscissa is time and the ordinate is response value (RU) of intermolecular binding. Both plots a and B were background subtracted and fitted with the Bivalent analyze model.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

The HLA-A2/ITDQVPFSV antigen complex in the following examples refers to a complex of an antigenic Peptide ITDQVPFSV and an antigenic molecule HLA-A2, and is described in the literature "quantifying T cell Cross-Reactivity for expressed Peptide antibodies", publicly available from Tianjin Korea Biotech Co., Ltd.

EXAMPLE 1 screening of Single Domain antibodies to HLA-A2/ITDQVPFSV Complex

1.1 Single Domain antibody phage library preparation

1.1.1 preparation of helper phage (BM13)

The M13KE phage (from NEB # N0316S) replicon was double-cleaved with AlwnI (from NEB) and AfeI (from NEB), while the artificially synthesized gene fragment was also double-cleaved with AlwnI and AfeI (from NEB), and then ligated together with T4 ligase. TG1 was transfected after ligation to give the helper phage BM 13. Thus, the protoreplicon tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgagggaggcggttccggtggtggctct sequence was replaced with an artificially synthesized gene sequence, i.e., a trypsin cleavage sequence was added to the phage GIII coding region, and once used as a helper phage, the trypsin digestion step was increased to reduce the number of phage that did not contain the fusion target gene protein.

The artificially synthesized gene sequence is as follows: CCA GCC GGC CTT TCT GAG GGG TCG ACT ATA GAA GGACGA GGG GCC CAC GAA GGA GGT GGG GTA CCC GGT TCC GAG GGT are provided.

1.1.2 vector construction

The DP47 single domain antibody coding gene sequence (AY466510.1) was inserted between HindIII and NdeI cleavage sites of pUC19 vector (Beijing Quanji Biotechnology Co., Ltd.) to obtain phage display vector pBG 3. In the single domain antibody expression framework, DP47 single domain antibody was expressed as a fusion with the GIII protein, and the expressed fusion protein contained Myc and VSV-G tags for purification or identification.

1.1.3 phage library construction

1.1.3.1 extraction of alpaca (Vicugna pacos) peripheral blood mononuclear cell total RNA

100ml of alpaca blood is taken, 50ml of Ficoll solution is slowly added, centrifugation is carried out for 30min at 18 ℃ and 300g/min, peripheral blood mononuclear cell layer is gently sucked, 200ml of Ficoll solution is added, thorough washing is carried out, centrifugation is carried out for 5min at 400g/min, and supernatant is discarded. Total RNA from peripheral blood mononuclear cells was extracted and purified using a blood total RNA extraction kit (purchased from tiangen).

1.1.3.2 preparation of Single Domain alpaca antibody DNA library

The total RNA obtained in 1.1.3.1 was used for cDNA synthesis, which was performed using the RevertAID RT ReverseTranscription Kit (purchased from Thermo). DNA library preparation amplification of single domain antibody DNA was performed using degenerate oligonucleotide strands, synthesized by jingzhi corporation, with the following sequences:

Oligo_VHHF：CATGCCATGGGACAGGTGCAGCTBGTGGHGDCW；

Oligo_VHHR：AAGGAAGGAAAAAAGCGGCCGCHGAVGAGACRGTGACCTGGGTC。

the above-mentioned oligonucleotide chain, which was artificially synthesized, was added to 50. mu.l of a system containing the following components: 25 μ l PrimeSTARMAX Premix (from Takara), 2 μ l cDNA, 23 μ l deionized water, and the final oligonucleotide chain concentrations were all 0.2 μ M. Amplification of the alpaca single domain antibody DNA library was performed according to the conditions of PrimeSTAR MAX Premix product instructions. The amplified product was subjected to agarose Gel electrophoresis and then purified using Gel Extraction kit (purchased from Omega Bio-Tek), to prepare an alpaca single domain antibody DNA library.

1.1.3.3 construction of a library of Single Domain antibody phages for alpaca

The alpaca single domain antibody DNA libraries prepared in vectors pBG3 and 1.1.3.2 constructed in 1.1.2 were double digested with NcoI (purchased from Takara) and NotI (purchased from Takara), respectively, and the products were subjected to agarose gel electrophoresis, then purified using Gelextraction kit (purchased from Omega Bio-Tek), respectively, and ligated with T4DNA Ligase (purchased from Thermo). The ligation product was purified using Gel Extraction kit (purchased from Omega Bio-Tek), and E.coli TG1 (purchased from Wuhan vast Ling Biotech Co., Ltd.) competent cells were electroporated, plated on 2 XTY medium plates, and cultured overnight at 37 ℃. All clones on the plate were scraped and resuspended in 2 × TY liquid medium to obtain an alpaca single domain antibody phage library.

1.2 propagation of helper phages and phage libraries with BM13

1.2.1BM13 helper phage multiplication

A fresh single colony of E.coli TG1 (purchased from Wuhan vast Ling Biotech Co., Ltd.) was picked from a plate of minimal agar medium, inoculated into 20ml of 2 XTY medium, and incubated at 37 ℃ with gentle shaking until the OD600 was about 0.8 for use. The original BM13 helper phage prepared in 1.1.1 was used to prepare a series of 10-fold dilutions of BM13 phage in 2 × TY medium. Mu.l of each dilution was mixed with 200. mu.l of TG1(OD600 ═ 0.8) broth, shaken gently on a shaker for 3s, and mixed with the top agar medium and poured onto TY plates equilibrated to room temperature beforehand. The plate was rotated to ensure uniform distribution of the thalli and the upper agar. After the upper layer culture medium is solidified, the culture is carried out in an inverted culture way in a biochemical incubator at 37 ℃ overnight.

The next day, well separated individual phages were picked and inoculated into 15ml culture tubes containing 2-3 ml of 2 × TY medium containing 25 μ g/ml kanamycin. Shaking culture is carried out for 12-16 h at 37 ℃ and 250 rpm. The infected supernatant was transferred to a 1.5ml sterile microcentrifuge tube and centrifuged at 4 ℃ for 2min at maximum speed on a microcentrifuge. The supernatant was transferred to a new tube and stored at 4 ℃.

1.2.2 propagation of the phage library

The prepared phage library was inoculated into 100ml of 2 XTY medium containing 60. mu.g/ml ampicillin, shake-cultured at 37 ℃ and 250rpm until OD600 became 0.8, BM13 was added to a concentration of 2X 10⁷pfu/ml. Culturing at 37 deg.C and 300rpm for 1h, adding 25 μ g/ml kanamycin, and culturing at 37 deg.C for 14-18 h. The pellet was centrifuged and the supernatant was precipitated with 5% PEG and resuspended in 5% MPBS for use.

1.3 Single-domain antibodies for screening of HLA-A2/ITDQVPFSV complexes

1.3.1 biopanning

Streptavidin immunomagnetic beads (purchased from Invitrogen cat No. SKU #112-05D) 25. mu.l were added to a suitable amount of biotinylated HLA-A2/ITDQVPFSV and bound for 5min at room temperature. PBST and PBS washing 2 ~ 3 times. MPBS is sealed for 2h, and PBST and PBS are washed for 2-3 times. The phage library was added to magnetic beads and incubated for 2h at room temperature.

Unbound library was removed and the beads were washed 10 times with PBST and PBS each. Adding 0.01% pancreatin solution into the magnetic beads, and incubating for 1h at room temperature to obtain pancreatin eluent. The pancreatin eluate was added to 30ml of TG1(OD600 ═ 0.5), and the first elution library was propagated as in 1.2. Thus, the second and third rounds of panning were performed. Single colonies obtained after three rounds of panning were picked into 96-well plates. Culture supernatants were prepared according to the library propagation method of 1.2.

1.3.2ELISA identification

A quantity of the supernatant was taken for ELISA identification (fig. 1A and 2A). The specific steps of ELISA identification are as follows: diluting the known antigen to 1-10 mu g/ml by using a coating buffer solution, adding 0.1ml into each hole, and standing overnight at 4 ℃; washing for 3 times the next day; adding 0.1ml of a certain diluted sample to be detected into the reaction hole coated with the antigen, incubating for 1 hour at 37 ℃, and washing; adding 0.1ml of freshly diluted enzyme-labeled secondary antibody (horseradish peroxidase HRP-labeled anti-phage antibody, 1:5000), incubating at 37 ℃ for 30 minutes, and washing; the last wash was with DDW. 0.1ml of a TMB substrate solution prepared temporarily is added into each reaction hole, and the mixture is allowed to stand at 37 ℃ for 10 to 30 minutes. The plate was read with an advanced plate reader at a wavelength of 650 nm.

Schematic ELISA identification is shown in FIGS. 1A and 2A. Wherein, FIG. 1A shows that all ELISA wells are coated with antigen HLA-A2/ITDQVPFSV; FIG. 2A shows that all ELISA wells were coated with HLA-A2/NLVPMVATV; the antibody is different in each well. The results of measurement of the light absorption value at 650nm of each well are shown in FIGS. 1B and 2B. Clones which are negative in figure 2 and have a frequency of above 0.25 of A650nm in figure 1 are selected for sequencing to obtain the nucleotide sequences thereof respectively, and the amino acid sequences of the corresponding proteins encoded by the clones are determined according to the nucleotide sequences. The clone corresponding to the amino acid sequence shown in SEQ ID No.10 is named as M3-B2, and the corresponding single-domain antibody is a single-domain antibody M3-B2; the clone corresponding to the amino acid sequence shown in SEQ ID No.11 is named as M3-D9, and the corresponding single-domain antibody is the single-domain antibody M3-D9. The clone corresponding to the amino acid sequence shown in SEQ ID No.12 is named as M3-E7, and the corresponding single-domain antibody is the single-domain antibody M3-E7.

The amino acid sequence of the single-domain antibody M3-B2 is shown as SEQ ID No.10, and the coding gene sequence is shown as SEQ ID No. 13. Wherein, the amino acid sequence of the complementary determining region CDR1 of the single-domain antibody M3-B2 is shown in SEQ ID No.1, the amino acid sequence of the complementary determining region CDR2 is shown in SEQ ID No.2, and the amino acid sequence of the complementary determining region CDR3 is shown in SEQ ID No. 3.

The amino acid sequence of the single-domain antibody M3-D9 is shown as SEQ ID No.11, and the coding gene sequence is shown as SEQ ID No. 14. Wherein, the amino acid sequence of the complementary determining region CDR1 of the single-domain antibody M3-D9 is shown as SEQ ID No.4, the amino acid sequence of the complementary determining region CDR2 is shown as SEQ ID No.5, and the amino acid sequence of the complementary determining region CDR3 is shown as SEQ ID No. 6.

The amino acid sequence of the single-domain antibody M3-E7 is shown as SEQ ID No.12, and the coding gene sequence is shown as SEQ ID No. 15. Wherein, the amino acid sequence of the complementary determining region CDR1 of the single-domain antibody M3-E7 is shown as SEQ ID No.7, the amino acid sequence of the complementary determining region CDR2 is shown as SEQ ID No.8, and the amino acid sequence of the complementary determining region CDR3 is shown as SEQ ID No. 9.

ELISA was performed to examine the affinity of the culture supernatants M3-B2, M3-D9 and M3-E7 for different antigens, and the data are collated and shown in FIG. 3. Wherein the ordinate is light absorption value under 650nm, and the

abscissas

1, 2, 3 and 4 are respectively HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA-A2/TIHDIILECV, HLA-A2/SLYSFPEPEA of four antigens. a. B, c and D are M4-A7 contrast, M3-E7, M3-B2 and M3-D9 in sequence. The results show that the positive clones obtained by screening (M3-B2, M3-D9 and M3-E7) only show higher affinity to HLA-A2/ITDQVPFSV, and basically do not bind to other three antigens.

Example 2 preparation of fusion proteins M3-B2-Fc, M3-D9-Fc, M3-E7-Fc

1. Construction of recombinant vectors

The DNA molecule shown in SEQ ID No.16 (which includes a Kozak sequence and a signal peptide, an M3-B2 antibody sequence, a humanized Fc sequence and a tag sequence) is cloned between HindIII and XbaI restriction enzyme sites of pcDNA3.1 to obtain a recombinant vector pcDNA3.1-M3-B2-Fc.

The DNA molecule shown in SEQ ID No.17 (which includes Kozak sequence and signal peptide, M3-D9 antibody sequence, humanized Fc sequence and tag sequence) was cloned between HindIII and XbaI restriction enzyme sites of pcDNA3.1 to obtain recombinant vector pcDNA3.1-M3-D9-Fc.

The DNA molecule shown in SEQ ID No.18 (which includes a Kozak sequence and a signal peptide, an M3-E7 antibody sequence, a humanized Fc sequence and a tag sequence) is cloned between HindIII and XbaI restriction enzyme sites of pcDNA3.1 to obtain a recombinant vector pcDNA3.1-M3-E7-Fc.

The DNA molecule shown in SEQ ID No.19 (which includes Kozak sequence and signal peptide, M4-A7 antibody sequence, humanized Fc sequence and tag sequence) was cloned between HindIII and XbaI restriction enzyme sites of pcDNA3.1 to obtain recombinant vector pcDNA3.1-M4-A7-Fc (control).

The schematic structure of the recombinant vector is shown in FIG. 4.

2. Construction and culture of recombinant cells

The recombinant vectors pcDNA3.1-M3-B2-Fc, pcDNA3.1-M3-D9-Fc and pcDNA3.1-M3-E7-Fc were transiently transfected into 293F cells (ThermoFisher, A14527), cultured for 5 days, centrifuged, and the supernatant was collected and purified using Protein A.

3. Identification of fusion proteins

The fusion proteins M3-E7-Fc, M3-D9-Fc, M4-A7-Fc control, M3-B2-Fc purified after running SDS-PAG, the results are shown in FIG. 5. Wherein, FIG. 5A is a reduction electrophoresis chart of the fusion protein, and FIG. 5B is a non-reduction electrophoresis chart of the fusion protein. The Marker strips are 14, 25, 30, 40, 50, 70, 100, 120 and 160KD from small to large. Line1 is reduced M3-E7-Fc, about 42KD, Line2 is reduced M3-D9-Fc, about 40KD, Line3 is reduced M3-A7-Fc, about 43KD, Line4 is reduced M3-B2-Fc, about 40KD, Line5 is non-reduced M3-E7-Fc, about 94KD, Line6 is non-reduced M3-D9-Fc, about 90KD, Line7 is non-reduced M3-A7-Fc, about 100KD, Line8 is non-reduced M3-B2-Fc, about 90 KD.

Example 3 fusion proteins M3-B2-Fc, M3-D9-Fc, M3-E7-Fc specifically recognize the HLA-A2/ITDQVPFSV complex.

The fusion Protein M3-B2-Fc, M3-D9-Fc, M3-E7-Fc and M4-A7-Fc after Protein A purification are subjected to ELISA identification. The specific steps of ELISA identification are as follows: diluting the known antigen to 1-10 mu g/ml by using a coating buffer solution, adding 0.1ml into each hole, and standing overnight at 4 ℃; washing for 3 times the next day; adding 0.1ml of a certain diluted sample to be detected into the reaction hole coated with the antigen, incubating for 1 hour at 37 ℃, and washing; adding 0.1ml of freshly diluted enzyme-labeled secondary antibody (horseradish peroxidase HRP-labeled anti-human antibody, 1:5000), incubating at 37 ℃ for 30 minutes, and washing; the last wash was with DDW. 0.1ml of a TMB substrate solution prepared temporarily is added into each reaction hole, and the mixture is allowed to stand at 37 ℃ for 10 to 30 minutes. The plate was read with an advanced plate reader at a wavelength of 650 nm.

The results are shown in FIG. 6. Wherein, FIG. 6A shows that different wells of ELISA plate are coated with different antigens, and ELISA plate A, B, C, D (1-3) is coated with antigen HLA-A2/ITDQVPFSV; A. b, C, D (4-6) coating antigen HLA-A2/NLVPMVATV; E. f, G, H (1-3) coated with antigen HLA-A2/RMFPNAPYL; E. f, G, H (4-6) coated antigen HLA-A2/SLLMWITQC; A. the primary antibody added by E is M3-E7-Fc, the primary antibody added by B, F is M3-D9-Fc, the primary antibody added by C, G is M4-A7-Fc control, and the primary antibody added by D, H is M3-B2-Fc. FIG. 6B shows the data analysis results, the ordinate of the light absorption value at 650nm, the abscissa of 1, 2, 3, 4 is four antigens HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA-A2/RMFPNAPYL, HLA-A2/SLLMWITQ. a. B, c and D are sequentially M3-E7-Fc, M3-D9-Fc, M4-A7-Fc contrast and M3-B2-Fc. The results show that the fusion proteins M3-B2-Fc, M3-D9-Fc and M3-E7-Fc only show higher affinity to HLA-A2/ITDQVPFSV, and basically do not bind to other three antigens.

Example 4 specific recognition of tumor cells by the fusion proteins M3-B2-Fc, M3-D9-Fc, M3-E7-Fc

Detection of specific recognition of fusion proteins M3-B2-Fc, M3-D9-Fc and M3-E7-Fc on T2 cells by FACS

To test whether the fusion proteins M3-B2-Fc, M3-E7-Fc and M3-D9-Fc can specifically bind to HLA-A expressed on the cell surface₂/gp100_ITDQVPFSV(abbreviation P3) and unrelated peptide HLA-A₂/_NLVPMVATV(abbreviated as P4), peptide-pulsed T2 cells (T2 cells contain HLA-A)₂Genes, but expressing very low levels of HLA-A on the cell surface₂Molecule, unable to present endogenous antigen. Impulse of exogenous peptide can stabilize HLA-A₂The molecule, in turn, increases HLA-A on the surface of T2 cells₂Molecular expression level) as target cells, the binding ability of the fusion proteins M3-B2-Fc, M3-D9-Fc, M3-E7-Fc to peptide-pulsed T2 cells was analyzed by FACS analysis. The specific detection steps are as follows: to 3X 10⁵To each T2 cell was added polypeptide (P3 or P4, available from Gill Biochemical Shanghai Co., Ltd.) to 50. mu.g, 0.1ml of RPMI-1640 medium (available from Gibco) was added per tube, and the mixture was allowed to stand overnight at 37 ℃; washing with 1ml PBS buffer solution for 1 time; adding 2 mu g of a diluted sample to be detected (Protein A purified fusion Protein M3-B2-Fc or fusion Protein M3-E7-Fc or fusion Protein M3-D9-Fc or fusion Protein M4-A7-Fc) into the EP tube, incubating for 1 hour at room temperature, and washing with 1ml of PBS buffer; then a fresh dilution (diluted with 0.1ml PBS buffer) of a fluorescent antibody (Dy 650-labeled anti-human antibody, 1:5000, purchased from Abcam) was added; incubate for 30 minutes at room temperature and wash with 0.3ml PBS buffer. Detection was carried out using a FACScan instrument (Guava easy mini). The results were analyzed using Flowjo software.

The results are shown in FIG. 7A. As can be seen from the figure: the fusion proteins M3-B2-Fc, M3-D9-Fc and M3-E7-Fc were all verified to bind specifically to T2 cells loaded with ITDQVPFSV.

Secondly, detecting the specific recognition of the fusion proteins M3-D9-Fc and M3-E7-Fc to 3M-luc, SK-Mel-28, Mel-624 and A375 tumor cells by flow cytometry

The flow cytometry is used for detecting the specific recognition effect of the fusion proteins M3-D9-Fc, M3-E7-Fc and M4-A7-Fc on 3M-luc, SK-Mel-28, Mel-624 and A375 tumor cells. The specific detection steps are as follows: will be 1 × 10⁵Tumor cells (3M-luc or SK-28 or Mel-624 or A375, from Nantong epi-Biotechnology Ltd.), 0.1ml of DMEM medium (from Gibco), 2. mu.g of a diluted sample to be tested (Protein A purified fusion Protein M3-E7-Fc or fusion Protein M3-D9-Fc or fusion Protein M4-A7-Fc) were mixed in an EP tube at room temperature 4 ℃ overnight,washing with 1ml of PBS buffer; adding 0.1ml of a fluorescent antibody (Dy 650-labeled anti-human antibody, 1:5000) freshly diluted (diluted with 0.1ml of PBS buffer), incubating at 4 ℃ for 30 minutes, and washing with 1ml of PBS buffer; 0.3ml of PBS buffer was added. The detection was carried out using a FACScan instrument (Guava easy cytolimin), and the results were analyzed using Flowjo software.

The results are shown in FIG. 7B. As can be seen from the figure: the fusion proteins M3-D9-Fc and M3-E7-Fc can be specifically combined with 3M-Luc and Mel-624 tumor cells, and M3-D9-Fc has stronger affinity than M3-E7-Fc.

Example 5, determination of the molecular interaction and affinity constants of the fusion proteins M3-D9-FC and M3-E7-FC and the HLA-A2/ITDQVPFSV complex.

And (3) carrying out interaction and affinity constant determination on the antibody fusion proteins M3-D9-FC and M3-E7-FC and ITDQVPFSV/HLA-A2 by using a plasma resonance technology. Streptavidin coupled sensor chip (senser chipSA) was used for the experiment, and HBS + EP was used as mobile phase buffer. Irrelevant antigens RMFPNAPY/HLA-A2 and NLVPMVATV/HLA-A2 are fixed on the 1 and 3 channels of the sensing chip as reference antigens, and ITDQVPFSV/HLA-A2 are fixed on the 2 and 4 channels of the sensing chip as experimental antigens, and the reference antigens are used for detecting the background binding condition. Fusion antibodies M3-D9-FC and M3-E7-FC were diluted separately and injected at a concentration of 1nM to 20nM, and the samples were run simultaneously over the surfaces of

channels

1 and 2 and

channels

3 and 4. The data obtained from the experiment were collected and analyzed by a biacore t200 instrument, the reaction kinetics curves were fitted with a Bivalent analytical model, and the association rate constant (Ka), dissociation rate constant (Kd), and affinity constant (Kd) were calculated. Wherein the abscissa is time and the ordinate is response value (RU) of intermolecular binding.

The results are shown in FIG. 8. FIG. A is M3-D9-FC; FIG. B shows M3-E7-FC. The experimental result shows that the fusion antibody M3-D9-FC and ITDQVPFSV/HLA-A2 are specifically combined, and have no cross reaction with reference antigen and are not combined; the association rate constant 6.779E +5(1/Ms), the dissociation rate constant 0.01711(1/s), and the affinity constant 2.5E-8 (M). The fusion antibody M3-E7-FC is specifically combined with ITDQVPFSV/HLA-A2, and has no cross reaction with reference antigen and no combination; the association rate constant 3.431E +6(1/Ms), the dissociation rate constant 0.03088(1/s), and the affinity constant 9E-9 (M).

Sequence listing

<110> Tianjin Tianrui Biotechnology Co., Ltd

<120> a single domain antibody recognizing a complex formed by HLA-A2 molecule and ITDQVPFSV short peptide

<160>19

<170>PatentIn version 3.5

<210>1

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Phe Thr Phe Ser Asp Tyr Ala Ile Gln

1 5

<210>2

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Tyr Ile Asn Ser Gly Gly Asp Thr

1 5

<210>3

<211>5

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Tyr Ala Gly Gly Tyr

1 5

<210>4

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Arg Thr Phe Asn Val Asp Ala Met Ala

1 5

<210>5

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Ala Ile Ser Arg Ser Gly Gly Ser

1 5

<210>6

<211>5

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Tyr Ala Gly Gly Tyr

1 5

<210>7

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

Arg Thr Phe Asn Val Asp Ala Met Ala

1 5

<210>8

<211>8

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>8

Ala Ile Ser Arg Ser Gly Gly Ser

1 5

<210>9

<211>18

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

Ala Ala Ala Ile Tyr Trp Arg Gly Ser Tyr Tyr Thr Glu Gly Asn Tyr

1 5 10 15

Asp Tyr

<210>10

<211>111

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>10

Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser

1 5 10 15

Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Ala

20 25 30

Ile Gln Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Gly Arg Val Ser

35 40 45

Tyr Ile Asn Ser Gly Gly Asp Thr Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Ser Ile Ala Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Tyr

85 9095

Ala Gly Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

100 105 110

<210>11

<211>111

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>11

Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Pro Gly Gly Ser

1 5 10 15

Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Ala

20 25 30

Ile Gln Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Gly Arg Val Ser

35 40 45

Tyr Ile Asn Ser Gly Gly Asp Thr Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Ser Ile Ala Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Tyr

85 90 95

Ala Gly Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

100 105 110

<210>12

<211>124

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>12

Val Gln Leu Val Ala Ser Gly Gly Gly Leu Val Pro Pro Gly Gly Ser

1 5 10 15

Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Asn Val Asp Ala

20 25 30

Met Ala Trp Phe Arg Gln Thr Arg Gly Lys Glu Arg Glu Phe Val Ala

35 40 45

Ala Ile Ser Arg Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Ser Ile Ser Lys Asp Asn Ala Lys Asn Thr Met Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ile Tyr Tyr Cys Ala

85 90 95

Ala Ala Ile Tyr Trp Arg Gly Ser Tyr Tyr Thr Glu Gly Asn Tyr Asp

100 105 110

Tyr Trp Gly Gln Arg Thr Gln Val Thr Val Ser Ser

115 120

<210>13

<211>333

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

gtgcagctgg tggagtctgg gggaggcttg gtgcagcctg gggggtctct gagactctcc 60

tgtgcagcct ctggattcac cttcagcgat tatgccatac agtgggtccg ccaggctcca 120

ggaaaggggc tcgggcgggt ctcatatatt aatagtggtg gtgataccac atattacgca 180

gactccgtga agggccggtt cagcatcgcc agagacaacg ccaagaacac ggtgtattta 240

caaatgaaca gcctgaaacc tgaggacacg gcggtctatt actgttatgc ggggggctac 300

tggggccagg ggacccaggt caccgtctct tcg 333

<210>14

<211>333

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gtgcagctcg tggagactgg gggaggcttg gtgcagcctg gggggtctct gagactctcc 60

tgtgcagcct ctggattcac cttcagcgat tatgccatac agtgggtccg ccaggctcca 120

ggaaaggggc tcgggcgggt ctcatatatt aatagtggtg gtgataccac atattacgca 180

gactccgtga agggccggtt cagcatcgcc agagacaacg ccaagaacac ggtgtattta 240

caaatgaaca gcctgaaacc tgaggacacg gcggtctatt actgttatgc ggggggctac 300

tggggccagg ggacccaggt cactgtctcc tcg 333

<210>15

<211>372

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gtgcagctgg tggcgtcagg gggaggcttg gtgccgcctg gggggtctct gagactctcc 60

tgtgcagcct ctggacgcac cttcaatgtc gatgctatgg cttggttccg ccagactcgc 120

gggaaggagc gtgagtttgt agcagctatt agccggagtg gtggtagcac gtactatgca 180

gactccgtga agggccgatt cagcatctcc aaagacaacg ccaaaaacac gatgtatctg 240

caaatgaaca gcctcaaacc tgaggacacg gccatttatt actgtgcagc tgcaatctac 300

tggcgtggta gttactacac tgaaggcaac tatgactact ggggccagag gacccaggtc 360

actgtctcct cg 372

<210>16

<211>1035

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

gtgcagctgg tggagtctgg gggaggcttg gtgcagcctg gggggtctct gagactctcc 60

tgtgcagcct ctggattcac cttcagcgat tatgccatac agtgggtccg ccaggctcca 120

ggaaaggggc tcgggcgggt ctcatatatt aatagtggtg gtgataccac atattacgca 180

gactccgtga agggccggtt cagcatcgcc agagacaacg ccaagaacac ggtgtattta 240

caaatgaaca gcctgaaacc tgaggacacg gcggtctatt actgttatgc ggggggctac 300

tggggccagg ggacccaggt caccgtctct tcgggatccg agcccaaatc ttgtgagaag 360

acccacacat gcccaccgtg cccagcacct gaactcctgg ggggaccgtc agtgttcctc 420

ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg 480

gtggtggacg tgagccacga ggaccctgag gtcaagttca actggtacgt ggacggcgtg 540

gaggtgcata atgccaagac aaagccgcgggaggagcagt acaacagcac gtaccgtgtg 600

gtcagcgtcc tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag 660

gtctccaaca aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag 720

ccccgagaac cacaggtgta caccctgccc ccatcccggg atgagctgac caagaaccag 780

gtcagcctga cttgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag 840

agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 900

tccttcttcc tctactccaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtg 960

ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc 1020

ctgtctccgg gtaaa 1035

<210>17

<211>1035

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gtgcagctcg tggagactgg gggaggcttg gtgcagcctg gggggtctct gagactctcc 60

tgtgcagcct ctggattcac cttcagcgat tatgccatac agtgggtccg ccaggctcca 120

ggaaaggggc tcgggcgggt ctcatatatt aatagtggtg gtgataccac atattacgca 180

gactccgtga agggccggtt cagcatcgcc agagacaacg ccaagaacac ggtgtattta 240

caaatgaaca gcctgaaacc tgaggacacg gcggtctatt actgttatgc ggggggctac 300

tggggccagg ggacccaggt cactgtctcc tcgggatccg agcccaaatc ttgtgagaag 360

acccacacat gcccaccgtg cccagcacct gaactcctgg ggggaccgtc agtgttcctc 420

ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg 480

gtggtggacg tgagccacga ggaccctgag gtcaagttca actggtacgt ggacggcgtg 540

gaggtgcata atgccaagac aaagccgcgg gaggagcagt acaacagcac gtaccgtgtg 600

gtcagcgtcc tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag 660

gtctccaaca aagccctccc agcccccatc gagaaaacca tctccaaagc caaagggcag 720

ccccgagaac cacaggtgta caccctgccc ccatcccggg atgagctgac caagaaccag 780

gtcagcctga cttgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtgggag 840

agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 900

tccttcttcc tctactccaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtg 960

ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc 1020

ctgtctccgg gtaaa 1035

<210>18

<211>1074

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gtgcagctgg tggcgtcagg gggaggcttg gtgccgcctg gggggtctct gagactctcc 60

tgtgcagcct ctggacgcac cttcaatgtc gatgctatgg cttggttccg ccagactcgc 120

gggaaggagc gtgagtttgt agcagctatt agccggagtg gtggtagcac gtactatgca 180

gactccgtga agggccgatt cagcatctcc aaagacaacg ccaaaaacac gatgtatctg 240

caaatgaaca gcctcaaacc tgaggacacg gccatttatt actgtgcagc tgcaatctac 300

tggcgtggta gttactacac tgaaggcaac tatgactact ggggccagag gacccaggtc 360

actgtctcct cgggatccga gcccaaatct tgtgagaaga cccacacatg cccaccgtgc 420

ccagcacctg aactcctggg gggaccgtca gtgttcctct tccccccaaa acccaaggac 480

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgag 540

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 600

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 660

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 720

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 780

accctgcccc catcccggga tgagctgacc aagaaccagg tcagcctgac ttgcctggtc 840

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 900

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctactccaag 960

ctcaccgtgg acaagagcag gtggcagcag gggaacgtgt tctcatgctc cgtgatgcat 1020

gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg taaa 1074

<210>19

<211>324

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

gtgcagctcg tggagactgg gggaggcttg gtgcagccgg gggggtctct gagactctcc 60

tgtgcagcct ccggaacctt cggccaaatc tatgttatgg gctggtatcg ccaggctcca 120

gggaaggagc gcgagttcgt cgcattcgcc actagtgctg gtaccataaa ctatggaggt 180

tccgtgaagg gccgattcag catctccaga gacaagaata cggtgtatct acaaatgaac 240

agcctgaaac ctgaggacac ggccgtgtat tcctgcaaca ctggtggatt ttggggccag 300

gggacccagg tcaccgtctc ctca 324

Claims

1. A single domain antibody recognizing HLA-A2/ITDQVPFSV, the single domain antibody comprising a complementarity determining region CDR1, a complementarity determining region CDR2, and a complementarity determining region CDR3, the single domain antibody being (a) or (b) or (c) below:

(a1) comprises an amino acid sequence shown as SEQ ID No. 1;

(a2) an amino acid sequence shown as SEQ ID No. 1;

(a5) comprises an amino acid sequence shown as SEQ ID No. 2;

(a6) an amino acid sequence shown as SEQ ID No. 2;

(a9) comprises an amino acid sequence shown as SEQ ID No. 3;

(a10) an amino acid sequence shown as SEQ ID No. 3;

(b1) comprises an amino acid sequence shown as SEQ ID No. 4;

(b2) an amino acid sequence shown as SEQ ID No. 4;

(b5) comprises an amino acid sequence shown as SEQ ID No. 5;

(b6) an amino acid sequence shown as SEQ ID No. 5;

(b9) comprises an amino acid sequence shown as SEQ ID No. 6;

(b10) an amino acid sequence shown as SEQ ID No. 6;

(c1) comprises an amino acid sequence shown as SEQ ID No. 7;

(c2) an amino acid sequence shown as SEQ ID No. 7;

(c5) comprises an amino acid sequence shown as SEQ ID No. 8;

(c6) an amino acid sequence shown as SEQ ID No. 8;

(c9) comprises an amino acid sequence shown as SEQ ID No. 9;

(c10) an amino acid sequence shown as SEQ ID No. 9;

2. The single domain antibody of claim 1, characterized in that: the single domain antibody further comprises framework region FR1, framework region FR2, framework region FR3, and framework region FR 4;

in the step (b), the framework region FR1 of the single domain antibody is the 1 st to 25 th amino acid sequence shown in SEQ ID No.11, the framework region FR2 of the single domain antibody is the 35 th to 48 th amino acid sequence shown in SEQ ID No.11, the framework region FR3 of the single domain antibody is the 57 th to 95 th amino acid sequence shown in SEQ ID No.11, and the framework region FR4 of the single domain antibody is the 101 th and 111 th amino acid sequence shown in SEQ ID No. 12;

3. The single domain antibody of claim 1 or 2, characterized in that: the amino acid sequence of the single-domain antibody is as follows (d1), (d2) or (d 3):

4. The single domain antibody of any one of claims 1-3, wherein: the encoding gene sequence of the single-domain antibody is any one of the following (e1) - (e 3):

(e1) a DNA molecule shown as SEQ ID No.13 or SEQ ID No.14 or SEQ ID No. 15;

(e2) a DNA molecule having 75% or more identity to the nucleotide sequence defined in (e1) and encoding the single domain antibody of any one of claims 1-3;

(e3) a DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in (e1) or (e2) and which encodes the single domain antibody of any one of claims 1 to 3.

5. The derivative of the single domain antibody of any one of claims 1 to 4, which is any one of (f1) - (f6) as follows:

(f1) a fusion protein comprising the single domain antibody of any one of claims 1-4;

(f2) a multispecific or multifunctional molecule comprising a single domain antibody according to any one of claims 1 to 4;

(f3) a composition comprising a single domain antibody of any one of claims 1-4;

(f4) an immunoconjugate comprising the single domain antibody of any one of claims 1-4;

(f5) an antibody obtained by modifying and/or engineering a single domain antibody or antigen binding portion thereof according to any one of claims 1 to 4;

(f6) an antibody comprising the complementarity determining region of any one of claims 1-4.

6. The derivative according to claim 5, characterized in that: the fusion protein is obtained by fusing the single-domain antibody of any one of claims 1-4 with at least 1 polypeptide molecule with a therapeutic or recognition function;

or, the polypeptide molecule with the treatment or recognition function is human Fc protein.

7. The biological material related to the single domain antibody of any one of claims 1 to 4 or the derivative of claim 5 or 6, which is any one of the following (g1) to (g 4):

(g1) a nucleic acid molecule encoding the single domain antibody of any one of claims 1-4;

(g2) a nucleic acid molecule encoding the fusion protein of claim 5 or 6;

(g3) a vector comprising the nucleic acid molecule of (g1) or (g 2);

8. The biomaterial of claim 7, wherein: the nucleic acid molecule is any one of the following (h1) - (h 3):

(h1) a DNA molecule shown as SEQ ID No.13 or SEQ ID No.14 or SEQ ID No.15 or SEQ ID No.16 or SEQ ID No.17 or SEQ ID No. 18;

(h2) a DNA molecule having 75% or more identity to the nucleotide sequence defined in (h1) and encoding the single domain antibody of any one of claims 1 to 4 or the fusion protein of claim 5 or 6;

(h3) a DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in (h1) or (h2) and encodes the single domain antibody of any one of claims 1 to 4 or the fusion protein of claim 5 or 6.

9. Use of a single domain antibody according to any one of claims 1 to 4 or a derivative according to claim 5 or 6 or a biomaterial according to claim 7 or 8 in any one of the following (1) to (6):

(1) specifically recognizes and/or binds HLA-A2/ITDQVPFSV;

(5) immunotherapy of tumors;

(6) preparing a product for tumor immunotherapy;

or, the product is a medicament;

or, the tumor is melanoma.

10. A method for preparing a fusion protein as claimed in claim 5 or 6, comprising the steps of: introducing a gene encoding the single domain antibody of any one of claims 1 to 4 and a gene encoding the human Fc protein into a host cell to obtain a recombinant cell; and culturing the recombinant cell to obtain the fusion protein.