WO2018100420A1 - Method and diagnostic kit for detecting phytopathogenic viruses - Google Patents

Method and diagnostic kit for detecting phytopathogenic viruses Download PDF

Info

Publication number
WO2018100420A1
WO2018100420A1 PCT/IB2016/057313 IB2016057313W WO2018100420A1 WO 2018100420 A1 WO2018100420 A1 WO 2018100420A1 IB 2016057313 W IB2016057313 W IB 2016057313W WO 2018100420 A1 WO2018100420 A1 WO 2018100420A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
virus
oligonucleotides
solution
papaya
Prior art date
Application number
PCT/IB2016/057313
Other languages
Spanish (es)
French (fr)
Inventor
Domitila JARQUÍN ROSALES
Fulgencio ESPEJEL CARRASCO
Selene AGUILERA AGUIRRE
Marisol HERNÁNDEZ CASTELLANO
Blanca Estela GONZÁLEZ PACHECO
Laura SILVA ROSALES
Original Assignee
Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional filed Critical Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional
Priority to PCT/IB2016/057313 priority Critical patent/WO2018100420A1/en
Publication of WO2018100420A1 publication Critical patent/WO2018100420A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage

Definitions

  • the present invention relates to the diagnosis of viral diseases that affect plant species using molecular techniques and more particularly is related to a diagnostic kit (kit) and a simple method for the detection of pathogens in plant cells that is performed at room temperature and by example, in field conditions.
  • kit a diagnostic kit
  • Plant pathogens represent a problem for farmers since they affect crop yield or quality, generating considerable economic losses and sometimes even total crop loss.
  • papaya is a crop of great potential for the export market, with Mexico being one of the main papaya producers as well as Brazil, Indonesia, India, the Philippines, China, Peru, Colombia and Nigeria. In 2007, Mexico ranked first in export and third in the world in production, with a total of 919,000 tons (FAOSTAT, 201 1).
  • papaya cultivation has a high susceptibility to phytopathogenic viruses, which cause devastating diseases for crops due to its prevalence and rapid spread, being this situation and the effect of climate change what has caused the decline in productivity and how result, high economic losses (Mosqueda, 1983).
  • 201 1 Mexico lowered its production to 707,000 tons and as a result, it positioned itself in sixth place (FAOSTAT, 201 1).
  • the detection has been carried out through the implementation of techniques such as, for example, ELISA PCR, RT-PCR, and IC-RT-PCR (Pérez et al., 2004; Leonard et al., 1993; Robles et al., 2010). These techniques are used due to their speed, specificity and high degree of reliability, in addition to detecting phytopathogenic agents of various species in a single trial (Higuchi et al., 1993; Noa Carrazana et al., 2006, Rodr ⁇ guez et al., 1993 ).
  • novel molecular strategies for the timely detection of phytopathogens is an alternative that helps to control and maintain the phytosanity and quality of papaya according to the standards that the market demands, but the disadvantage is that these techniques require specialized equipment so that only They are carried out in laboratories by specialized people. Therefore, it is necessary to simplify the procedures of the detection methods as well as to reduce the use of sophisticated equipment.
  • TMA Transcription Mediated Amplification, for its acronym in English
  • TMA Transcription Mediated Amplification, for its acronym in English
  • RNA can amplify 2 or more targets at once (multiplex) and is performed in less time.
  • This technique has been used to detect various viruses such as hepatitis C in clinical samples (Hofmann et al., 2005; Ross et al., 2001; Sarrazin et al., 2000) and the acquired immunodeficiency virus. type 1 (Kwoh et al., 1989), in addition to some microorganisms such as Trichomonas vaginalis (Huppert et al., 2007).
  • the TMA technique performs the amplification of target RNA where two enzymes (reverse transcriptase (RT) and RNA polymerase) are used.
  • RT reverse transcriptase
  • RNA polymerase RNA polymerase
  • cDNA complementary DNA
  • HCV Hepatitis C virus
  • cDNA complementary DNA
  • RNA resulting from the RNA-DNA duplex is degraded by the RNase H activity of the RT.
  • Another primer binds to the cDNA that already contains the T7 promoter sequence from the first primer and a double stranded DNA is synthesized by the RT DNA polymerase activity.
  • RNA polymerase recognizes the 3 ' sequence of the T7 promoter within the double stranded DNA molecule and synthesizes numerous transcripts of antisense RNA. Each of the newly produced RNA amplicons re-enters the TMA process and serves as a template for a new round of RT to double-stranded DNA including the T7 promoter and transcription of the antisense amplicons.
  • the circulation of the antisense transcripts in the amplification process results in the exponential amplification of the target RNA.
  • HPA hybridization protection assay
  • the reaction in the TMA is achieved with a system known as the hybridization protection assay (HPA), which is based on the use of oligonucleotides (specific for the target sequence to be amplified), coupled to the chemiluminescent label given by the acridinium ester and when the TMA reaction is carried out in the presence of excess of this probe, quantitative results are produced; after hybridization that is typically performed at this stage for 30 minutes at 60 ° C, an alkaline selection reagent is added; Under alkaline conditions, the acridinium ester associated with the non-hybridized probe is hydrolyzed to a non-chemiluminescent form, and when associated with the hybridized probe is protected from such hydrolysis and therefore has chemiluminescence when exposed to a suitable detection reagent.
  • HPA hybridization protection assay
  • Another way to detect nucleic acids is to use dyes such as SYBR GREEN that fluoresces when binding to double strands of DNA, where the resulting DNA-SYBR Green complex has an absorption peak at a wavelength ( ⁇ ) of 498 nm and a emission peak at a wavelength ( ⁇ ) of 522 nm (corresponding to the green zone of the spectrum, hence its name).
  • Said dye is used in the laboratory in DNA staining for electrophoresis analysis of PCR products, or as a fluorochrome used as a means of direct visualization of PCR products in real time.
  • Other studies show that the Victoria Puré Blue Bo dye has the ability to bind to the minor groove of the dsDNA, but staining is observed with visible light.
  • an aqueous preparation which comprises a pH sensitive pigment, a DNA polymerase and dNTPs in a weak Tris buffer (or equivalent) in less than 1 mM, which is described as suitable for PCR or for isothermal amplification.
  • the pigment can be by fluorescence or by visually detectable color.
  • a device or kit for detecting a nucleic acid in a sample comprising a carrier (a) containing at least one dye that can bind to a nucleic acid, a path (c) for passing the sample through the support (a), and an evaluation part (d) to observe a substance produced by the reaction between the sample and the dye with visible light, and visually assess the presence or absence of a nucleic acid in the sample.
  • the substance reactive with the dye consists of an oxidizing agent, a reducing agent, an acid, a base and a pH buffering agent, and in which the reducing agent is at least one reducing agent selected from the group consisting of sodium borohydride.
  • Figure 1 The components of the kit of the present invention are shown. A) maceration bag, B) container for amplification reaction and C) container for colorimetric reaction are observed.
  • FIG. 2 A schematic representation of the method of the invention is shown. It is observed (A) the placement of a piece of the size of a 20 cent coin, of a leaf of the plant to be inspected, in the macerated bag, to subsequently (B) rub the tissue against the mesh contained in the bag with help the coin until the leaf sap is released, (C) let stand 5 minutes, and (D) drop two drops of leaf sap in the corresponding container that contains the mixture for the amplification reaction for each of the virus to be detected of interest and allowed to stand for one hour at room temperature; After one hour, (E) a stick is soaked in the amplification reaction mixture, which is then transferred (F) to the container containing the mixture for colorimetric reaction to finally observe if there is a color change in said container, which indicates the presence of the virus of interest in the plant.
  • A the placement of a piece of the size of a 20 cent coin, of a leaf of the plant to be inspected, in the macerated bag, to subsequently (B) rub the tissue against the
  • FIG. 3 The use of the method of the invention for the detection of papaya PRSV and PapMV viruses is shown, using a colorimetric mixture containing Victoria Puré Blue BO and Red congo 1/1 dyes. A change in color in the samples positive to PapMV (+) to a red-orange color is observed in comparison to the healthy plant without infection of the virus (-) that is seen in yellow.
  • PapMV can be detected by being as a single virus (tubes 1 and 2) or in combination with the PRSV virus (tubes 3 and 4) and its comparison with a healthy plant without virus infection (tube 5) or with a tube where water was used as a negative control (tube 6); (B) samples infected with PRSV (+) change to yellow compared to healthy samples, without virus infection (-) that appear red-orange.
  • PRSV can be detected as a single virus (tubes 1, 2 and 3) or in combination with the PapMV virus (tubes 4 and 5) compared to the healthy plant sample without virus (tube 6) or with a tube where water was used as a negative control (tube 7). Photos taken as seen in visible light.
  • Figure 4 The use of the method of the invention is shown in four replicates for the detection of PapMV, (panels A and B) and four replicas for the detection of PRSV (panels C and D).
  • Three replicates of the reaction (A and C) were stained with SYBR GREEN as a dye and observed with blue light at a wavelength of 460 nm in a photodocumentor.
  • the fourth replica (B and D) was stained with the Victoria Puree Blue BO and Congo Red 1/1 dye mixture and observed with natural light.
  • Containers with water (1), raw extract of a healthy plant (2), extracts of plants infected with PapMV (3 to 8) and extracts of plants infected with PapMV and PRSV (9 to 14) are observed in A and B that in C and D containers with water (1), extraction solution (2), extracts from a healthy plant (3 and 4) extracts from a plant infected with PRSV (5 to 8) and extracts from plants infected with PRSV and PapMV (9 to 12).
  • Electrophoresis of the products amplified by conventional RT-PCR is shown by the same oligonucleotides that were used in the method of the invention, using total RNA extracted from samples of plants infected with PapMV (lanes 1 to 5) and from plants infected with PRSV (lanes 10 and 1 1).
  • As negative controls (C-) water samples (lane 7), extraction solution (lane 8) and healthy plant (lane 9) are observed.
  • the observed intensity of the resulting bands depends on the amount of material present in each sample.
  • FIG. 6 The use of the method of the invention is shown in multiple detection format (multiple containers) with specific oligonucleotides for viruses that infect papaya (CMV, CYVMV, MWMV, PaLCrV, PaLCuV, PapMV, PLDMV, PLYV, PMeV, PRSV and TSWV), in addition to an internal gene (EF1A) of the plant.
  • CMV CMV
  • CYVMV MWMV
  • PaLCrV PaLCuV
  • PapMV PapMV
  • PLDMV PLYV
  • FIG. 7 The use of the method of the invention is shown for the detection of two viruses that infect corn plants, such as SCMV and MCMV, as well as the endogenous beta tubulin gene of the plant where oligonucleotides specific to each were used. of the amplified genes, using positive samples for each virus from extracts of total RNA from leaves. The amplification reaction for the viruses was visualized using the SYBR GREEN dye and compared to a reaction where water was used as a negative control. Samples are observed for MCMV (A1, A2, B1, B2, D1, D2), SCMV (E1, E2, G1, G2), TSWV (F1, F2), beta tubulin control (C1, C2) and negative control with water (H1, H2). Detailed description of the invention.
  • the present invention relates to a method for detecting the presence of at least one microorganism of interest in plant cells, particularly a pathogenic microorganism for plant cells, where this method is characterized in that it comprises:
  • step (B) of enzymatic treatment to obtain an enzymatic solution of cDNA in which the RNA solution is contacted with an oligonucleotide corresponding to the microorganism of interest and with an enzyme reverse transcriptase or retrotranscriptase with polymerase activity, wherein from the RNA of each microorganism, double stranded cDNA (dsDNA) is synthesized and amplified when the RNA of the microorganism is present in the enzymatic solution, and
  • the colorimetric solution contains at least one dye capable of changing or developing color with the naked eye when it is bound to dsDNA so that either color development or color change is observed.
  • the enzyme used during the enzymatic treatment stage is a reverse (or reverse) (RT) transcriptase with polymerase activity, which can be for example the M-MLV reverse transcriptase enzyme (Moloney Murine Leukemia Virus Reverse Transcriptase). English), commercially available and which was tested in the development of the present invention.
  • M-MLV reverse transcriptase enzyme Moloney Murine Leukemia Virus Reverse Transcriptase
  • M-MLV reverse transcriptase enzyme Moloney Murine Leukemia Virus Reverse Transcriptase
  • M-MLV also has polymerase activity, since it can synthesize double stranded DNA (dsDNA) using RNA hybrid cDNA: cDNA as template.
  • the polymerase activity of M-MLV occurs both using the sense oligonucleotide and the cDNA (antisense) chain that synthesized from the positive viral RNA as the antisense oligonucleotide and the cDNA (sense) chain, which was synthesized from the viral RNA negative (which is an intermediary of virus replication). In this way the synthesis of double stranded cDNA comes from both the sense viral RNA and the antisense viral RNA, which doubles the amount of double stranded DNA substrate as the final product.
  • the enzyme has reduced RNase H activity (elimination of RNA chains in hybrids formed during cDNA synthesis), it was able to remove RNA from RNA: cDNA hybrids, so it was not necessary to add RNase H to the reaction, while the remaining RNA: cDNA hybrid is used as a substrate for intercalating the dye mixture used.
  • a pair of containers is required, which can be of plastic material and sterile, as they are for example, microcentrifuge tubes (Eppendorf TM type).
  • Eppendorf TM type microcentrifuge tubes
  • it can be placed in another pair of containers different from the initial ones to detect another different microorganism, for example a pathogenic microorganism, using the corresponding specific oligonucleotides and following the methodology of the present invention.
  • the number of pairs of containers corresponding to the number of different microorganisms to be detected or diagnosed is required, so that another aspect of the present invention relates to a diagnostic kit comprising at least one pair of containers where:
  • a first container contains an RNA extraction solution adapted to receive a sample of plant tissue and allow mixing with the RNA extraction solution to obtain an RNA solution (step A);
  • a second container adapted to receive a portion of the sample of the RNA solution and proceed with the enzymatic obtaining of cDNA, wherein the second container comprises a cDNA amplification solution which in turn comprises a specific oligonucleotide corresponding to each microorganism of interest, for example a pathogenic microorganism, a reverse transcriptase enzyme with polymerase activity, and free nucleotides in sufficient amounts to allow amplification of the cDNA of each microorganism of interest upon contact with the RNA solution (step B).
  • the colorimetric reaction stage is then performed when the colorimetric solution (step C) is added, and c)
  • the colorimetric reaction stage (stage C) can be performed in a third vessel.
  • another aspect of the present invention relates to a diagnostic kit of at least two pathogenic microorganisms, specifically two phytopathogenic viruses, including, for example, the PapMV and PRSV viruses (which affect the species Carica papaya L ), separately, comprising at least two pairs of containers in which the first pair is used for the detection of the first pathogen to be diagnosed (for example PapMV) and the second pair is used for the detection of the second pathogen to be diagnosed (by PRSV example).
  • Another aspect of the present invention relates to a diagnostic kit for detecting two microorganisms, for example 2 pathogenic microorganisms, simultaneously, which comprises a single pair of containers as follows:
  • a first container containing an RNA extraction solution adapted to receive a sample of plant tissue and allow mixing with the RNA extraction solution to obtain an RNA solution
  • a second container adapted to receive a sample of an RNA solution and obtain an enzymatic cDNA solution, wherein the second container comprises a solution of cDNA amplification which in turn comprises two oligonucleotides corresponding to each of the two microorganisms of interest to be detected, for example two pathogenic microorganisms, a reverse transcriptase enzyme with polymerase activity, and free nucleotides in amounts sufficient to allow amplification of the cDNA of each microorganism of interest upon contact with the RNA solution; and it contains a colorimetric solution capable of changing color to the naked eye in the presence of amplified cDNA of at least one of the microorganisms, for example PRSV or PapMV virus, which comprises a mixture of the Victoria Puré Blue BO dye (VPBBO) and the Congo Red coloring.
  • PRSV Victoria Puré Blue BO dye
  • the method of the present invention has the preferred modality of detecting the pathogenic viruses PRSV and PapMV in plant tissue that is suspected to be infected or also to prevent infection by them, where once confirmed it is an infection-free culture thanks to diagnosis made by the method described here.
  • the method of the invention comprises three stages, such as crude RNA extraction, the generation of double strands of viral DNA copying (amplification) and finally a colorimetric reaction for visualization;
  • a colorimetric reaction for visualization for example, for the detection of PRSV and / or PapMV papaya pathogenic viruses, fresh tissue from healthy and infected papaya plants is needed to make the comparison and have the possibility of efficiently detecting said phytopathogenic viruses.
  • the following steps can be performed:
  • the first stage of the method of the invention referring to the crude extraction of nucleic acids was modified for better handling in the field. It is not an extraction of nucleic acids proper, but it is about obtaining a crude extract from fresh tissue, which was also modified from the original source.
  • RNA extraction protocol previously described is using a piece of leaf from the plant of interest to be inspected, approximately 1 cm 2 in such a way that 300 ⁇ of buffer 1 (20 mM Tris HCI pH 7.5 is added to that piece of leaf) , 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01% Igepal, 50% Glycerol v / v) and 100 ⁇ of 0.2 M KOH in the case of PapMV and 100 ⁇ of 0.5 M KOH for PRSV.
  • the second stage is RNA amplification by adding the specific oligonucleotides of the PRSV or PapMV virus, the M-MLV enzyme and the other necessary reagents.
  • the third stage is the colorimetric reaction with a mixture of two dyes that have the ability to bind to double strands of DNA (dsDNA), for visualization of the reaction product.
  • dsDNA double strands of DNA
  • the colorimetric solution comprises a mixture of Victoria Puré Blue BO dye (VPBBO) and Congo Red dye.
  • the dyes are in a concentration between 0.0096% w / v and 0.03% w / v and in a proportion of 0.5: 1.3 to 1: 2.6 of VPBBO and Congo Red correspondingly.
  • Another embodiment of the invention relates to a diagnostic kit or kit comprising the means for detecting the microorganism of interest, for example a phytopathogenic virus, with the method described herein, where a pair of containers is required where:
  • a first container contains an RNA extraction solution adapted to receive a sample of plant tissue and allow mixing with the RNA extraction solution to obtain an RNA solution (step A), and
  • a second container adapted to receive a sample of an RNA solution (crude extraction product) and finally obtain an enzymatic cDNA solution, wherein the second container comprises a cDNA amplification solution consisting of:
  • the specific oligonucleotides for the microorganism for example 1 ⁇ of the oligonucleotides at a concentration of 10 ⁇ ,
  • a reverse transcriptase enzyme with polymerase activity preferably the M- enzyme
  • MLV for example 1 ⁇ of the enzyme M-MLV (200U; Invitrogen TM), and
  • DTT dithiothreitol
  • free nucleotides may be 2.5 ⁇ dNTP 's 2mM and 0.25 ⁇ bovine serum albumin (BSA) at 0.1%.
  • BSA bovine serum albumin
  • stage A the crude extraction obtained in stage A and contained in the first vessel is added, in order to initiate the reaction, where the M-MLV enzyme takes as a template the RNA of the microorganism using the specific oligonucleotides, to generate cDNA that It is subsequently used by the same enzyme for the generation of double stranded DNA derived from the microorganism.
  • the colorimetric reaction stage is then carried out when the colorimetric solution is added (step C), which may involve the use of the mixture of two dyes capable of binding to the dsDNA, or to the cDNA: RNA, so that contacting the reaction there is an evident color shift between each of the samples.
  • the colorimetric reaction step (step C) can be performed in a third vessel.
  • the method of the present invention requires only one enzyme, for which it was necessary to find the appropriate buffer for crude extraction and which keeps the RNA of the microorganism viable without degrading, which allows for a good substrate for the subsequent reaction.
  • the method of the invention does not need oligonucleotides with T7 promoter sequences, as in the case of TMA, but only the specific sequences of the microorganism to be detected.
  • an enzyme (the M-MLV already described) is used with the ability to generate only dsDNA and also works at low temperatures, thereby ensuring that the reaction is carried out at room temperature and that the products are dsDNA and not single stranded RNA as in the TMA.
  • the amplification reaction is carried out at 37 ° C and not at 60 ° C as in the TMA, which facilitates its realization for example in the field at room temperature, needing only 30 minutes to one hour compared to the TMA that needs a minimum of 2 hours.
  • the detection method of the invention is based on the development of color in the visible range and not through chemiluminescence as is the case with TMA. While in the method of the present invention, the selected dyes have the ability to bind to the minor groove of the dsDNA so that it easily binds to the dsDNA of the microorganism product of the reaction for visualization without the use of equipment, so no detection and measurement instruments are required (for example, luminometer or other specialized equipment), since the result obtained is distinguishable by the naked eye.
  • the operation of the method of the present invention is mainly (although not exclusively) due to two reasons, on the one hand, to the great capacity of replication of microorganisms such as these viruses, whose genome serves as a template for the specific synthesis of double cDNAs. chain that are generated by the activity of the reverse transcription and polymerase of the M-MLV enzyme and on the other hand, the high specificity of the double-stranded DNA binding dyes and their visual ability to change color.
  • FIG. 1 illustrates the manipulation that is carried out with the method of the invention (figure 1) through the diagnostic kit described here, which comprises for example in the case of Papaya plants, collect a piece of papaya leaf the size of a 20 cent coin (1.3 cm in diameter) (figure 2, A), place in a container, for example a plastic bag (figure 2, B) and macerate the tissue with the same coin and then let stand for 5 to 10 minutes at room temperature (Figure 2, C).
  • the present invention it is possible to detect, with the method of the invention, various viruses of interest in crops of agricultural importance. For example, it is possible to detect infectious viruses of tomato or corn (see examples).
  • the aforementioned viruses were tested with the SYBER GREEN dye in purified RNA, that is, without making the crude RNA extraction and applying the amplification procedure of the invention, that is, amplifying the RNA of interest with the corresponding specific oligonucleotides (see table 1), performing the reaction at room temperature.
  • the method of the invention it is possible to determine the presence of the virus of interest.
  • the pathogens of interest detected in plant cells comprise the papaya ring spot virus (PRSV) and / or the papaya mosaic virus (PapMV).
  • the RNA extraction step in general comprises any known technique for extracting the RNA contained in the capsid of a virus that is within a plant cell.
  • the RNA extraction technique comprises maceration of the infected plant tissue sample in the presence of an RNA extraction solution. Table 1. Oligonucleotides used in the present invention to detect other viruses.
  • PC Capsid protein PNC Nucleocapsid protein; CP. Cover protein; RNA pol. RNA polymerase; PAIR. Replication associated protein; GP Endogenous papaya gene; Rep. Replicase; Nlb r. Nlb replicase; Girl p. Nia proteinase.
  • the RNA solution is contacted with a specific oligonucleotide and corresponding to the pathogen of interest and with a reverse transcriptase enzyme with polymerase activity, where from of the RNA of the pathogen of interest is synthesized and amplified double-stranded cDNA when the RNA of the pathogen is present in the enzymatic solution.
  • the enzymatic treatment step is based on a transcription-mediated amplification reaction in which the RNA solution is contacted with an oligonucleotide corresponding to each pathogen of interest and with a reverse transcriptase enzyme. with polymerase activity, where double stranded cDNA is synthesized and amplified from the RNA of each pathogen when the pathogen RNA is present in the enzymatic solution.
  • the oligonucleotide is a chain of nucleic acid or a related molecule that specifically binds to a single nucleic acid chain and initiates the synthesis of that chain in the presence of DNA polymerase and nucleotides, and which serves as a starting point for DNA replication.
  • the oligonucleotide is obtained based on sequences known in the state of the art from which very conserved sections of each pathogen of interest are taken (Engel et al., 2010).
  • the colorimetric reaction step allows by color change, with respect to the control, to identify the presence or absence of the microorganism of interest in the sample of analyzed plant tissue.
  • the reaction that is carried out is based on the interaction between the cationic ethylamine or diethylamine groups at the p-position of the phenyl group of the VPBBO dye with the minor groove of the amplified double-stranded cDNA of the microorganism of interest.
  • the colorimetric solution comprises a mixture of Victoria Puré Blue BO dye (VPBBO) and Congo Red dye, preferably in a concentration between 0.0096% w / v and 0.03% w / v and in a proportion of 0.5: 1 to 1: 0.5 of the VPBBO dye solution and the Congo Red dye solution accordingly.
  • VPBBO Victoria Puré Blue BO dye
  • Congo Red dye preferably in a concentration between 0.0096% w / v and 0.03% w / v and in a proportion of 0.5: 1 to 1: 0.5 of the VPBBO dye solution and the Congo Red dye solution accordingly.
  • the RNA extraction solution comprises a mixture of buffer solution and a basic solution.
  • the buffer solution is any solution that, with the addition of an acid or base, is capable of maintaining the constant pH within the range of pH 8.0 for PapMV and pH 10 for PRSV.
  • the buffer solution comprises at least one weak acid and a hydrolytically active salt.
  • buffer solutions containing 100 mM Tris HCI pH 7.5, 50 to 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, with or without 0.01% Igepal, 20 to 50% Glycerol v / vy are used 100 ⁇ of KOH of 0.1 to 0.5 M, and potassium phosphate at 240 mM, among others that can be used to achieve the effects described here.
  • the cDNA amplification solution optionally contains a protein reducing agent and / or a polymerase chain reaction (PCR) inhibitor.
  • the protein reducing agent maintains the conditions necessary for the transcription reaction to be properly carried out and helps maintain the stability of the reverse transcriptase enzyme with polymerase activity; preferably, the selected protein reducing agent is DDT (Dichloro Diphenyl Trichloroethane).
  • the PCR inhibitor reducing agent can be any substance that reduces its effect, such PCR inhibitors may be present in the reaction medium, which interfere with the polymerization of the dNTPs, which can result in false negative results.
  • the selected PCR inhibitor reducing agent is bovine serum albumin (BSA).
  • the cDNA enzyme solution obtained comprises traces of the RNA solution, traces of an oligonucleotide corresponding to each microorganism of interest, traces of a reverse transcriptase enzyme with polymerase activity, double stranded cDNA when the RNA of the microorganism is present in the enzymatic solution, and, optionally, dNTPs, a protein reducing agent and / or a reducing agent of PCR inhibitors.
  • the diagnostic kit or kit optionally comprises a third container containing a colorimetric solution capable of changing color to the naked eye in the presence of double-stranded cDNA of at least one microorganism of interest and is adapted to receive a sample of the cDNA enzyme solution.
  • the colorimetric solution comprises a mixture of Victoria Puré Blue BO dye (VPBBO) and Congo Red dye, preferably in a concentration between 0.0096% w / v and 0.03% w / v and in a proportion of 0.5: 1 to 1: 0.5 of VPBBO and Congo Red correspondingly.
  • VPBBO Victoria Puré Blue BO dye
  • Congo Red dye
  • Another aspect of the present invention relates to a colorimetric solution capable of changing color to the naked eye in the presence of double-stranded cDNA, for example of at least one of the PRSV or PapMV pathogenic viruses, which comprises a mixture of the dye.
  • Victoria Puré Blue BO (VPBBO) and the Congo Red dye preferably mixed in a 1: 1 ratio and where the concentration of each of the VPBBO and Congo Red dyes in the colorimetric solution is 0.0096% w / v and 0.03% p / v correspondingly.
  • this mixture of dyes can be used to detect other viruses with the specific oligonucleotides for each virus to be detected.
  • the preparation of the colorimetric solution can be carried out from concentrated solutions (stock) of each dye, from which diluted solutions of each of them are obtained and subsequently mixed in the appropriate proportions to obtain the solution.
  • the diluted solution of the VPBBO dye is preferably prepared by diluting a stock solution of the VPBBO dye with a concentration of 0.48% w / v, with 5 mM MgCl 2 TE (1 mM Tris pH 8, 0.1 mM EDTA) pH 6 until reaching a concentration of 0.0096% w / v of VPBBO.
  • the diluted Congo Red solution is preferably prepared by diluting a stock solution of the Congo Red dye with a concentration of 0.1% w / v, with sterile MiliQ water until reaching a concentration of 0.03% w / v Congo Red.
  • Example 1 Detection method of the invention.
  • Sections of leaves of the plant of interest of 1.3 cm in diameter were collected using a 20 cent coin as a mold of the size to be trimmed manually.
  • the extraction of nucleic acids from the leaf was basically done using the protocol described by Fakuta et al. (2003), and with modifications to finally take parts of sheets of 1.3 cm in diameter using a 20 cent coin as a mold.
  • the piece of sheet was macerated in a plastic bag containing a plastic mesh containing 300 ⁇ of buffer solution (20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01% Igpal, 50% Glycerol v / v) and 100 ⁇ of 0.2 M KOH in the case of PapMV and 100 ⁇ of 0.5 M KOH for PRSV. Let stand 10 minutes at room temperature.
  • TMA reaction For the generation of double chains from the sample obtained from crude RNA extract, a TMA reaction was used as a base which was modified, to achieve an even simpler technique in less time, as described below.
  • a swab was taken a drop of crude extract of RNA and to a tube containing 1 .5 ⁇ DTT 0.1 M, 2.5 ⁇ dNTP 's 2 mM, 1 ⁇ of each of the oligonucleotide of interest (front was added or Fw and reverse or Rv) at a concentration of 10 ⁇ , 0.25 ⁇ of bovine serum albumin (BSA) at 0.1% and 1 ⁇ of the enzyme M-MLV (200U; Invitrogen). Made the mixture, then it was incubated one hour at room temperature.
  • BSA bovine serum albumin
  • the standardization of the reaction of the method of the invention was carried out using the 2X SYBR GREEN dye as a control dye, taking 1 ⁇ of the reaction in a final volume of 20 ⁇ and subsequently visualized with blue light in a photodocumentor.
  • Colorimetric mixing was performed using a stock of Victoria Puré Blue Bo dye at 0.48% w / v previously obtained by mixing 0.06 g of VPBBO dye with 12.5 mL of 99.5% cold ethanol by magneto for 10 minutes, and a stock of Congo Red dye 0.1% w / v obtained by mixing 0.01 g of the dye with 10 ml of 99.5% v / v glycerol by vigorous stirring.
  • a stick was immersed in the amplification reaction (dsDNA generation) and passed to the container containing the dye mixture to perform the colorimetric reaction, for which it was mixed with the same stick and the green color turn was observed to red in the case of samples positive to PapMV and from green to orange in the case of samples positive to PRSV.
  • dsDNA generation amplification reaction
  • the colorimetric reaction for which it was mixed with the same stick and the green color turn was observed to red in the case of samples positive to PapMV and from green to orange in the case of samples positive to PRSV.
  • Example 2 Detection of PRSV or PapMV viruses by the method of the invention.
  • An assay was performed to detect PRSV or PapMV viruses in a sample of plant tissue from the papaya plant (Carica papaya L.) in accordance with the principles of the present invention.
  • greenhouse papaya plants were selected that were healthy without any symptoms of illness or physical damage.
  • carborundum was used as abrasive and 20 ⁇ of macerated solution of tissue infected with 0.001 M sodium phosphate at pH 8 and a 0.001 M EDTA buffer solution were placed for mechanical inoculation. Plants were inoculated with PapMV, PRSV and other healthy plants were not inoculated.
  • the sampling of infected papaya plant tissue was at 10 dpi (days after inoculation).
  • a sample of plant tissue consisting of a piece of papaya leaf is placed.
  • the sample has a diameter of 1.3 cm that was obtained using a 20 cent coin as a mold of the size to be trimmed manually and comes from the leaves of the plant.
  • the buffer solution and the basic solution were previously placed inside the plastic mesh bag, where the buffer solution consists of 300 ⁇ of aqueous solution containing 20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT (prevents oxidation of nucleic acids and therefore facilitates their extraction), 0.01% v / v of Igepal CA-630 and 50% glycerol v / v, and the basic solution consists of 100 ⁇ of an aqueous solution of KOH in a concentration of 0.2 M in the case of PapMV or of 100 ⁇ of an aqueous solution of KOH in a concentration of 0.5 M in the case of PRSV.
  • the buffer solution consists of 300 ⁇ of aqueous solution containing 20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT (prevents oxidation of nucleic acids and therefore facilitates their extraction),
  • This step of extracting raw RNA from papaya plants was performed following the protocol previously described by Fukuta, Lida et al. (2003).
  • the sample was macerated inside the plastic mesh bag containing the buffer solution and the basic solution and allowed to stand 10 minutes at room temperature to obtain an RNA solution.
  • the specific oligonucleotides used to detect the PapMV virus were:
  • Fw-PapMV (CCTGAGGCCCAACACAGATT) (SEQ.ID.No.1)
  • Fw-PRSV TAATACGACTCACTATAGGGGATTGATCACAGTAAGGGTTATGAG
  • Rv-PRSV TAATACGACTCACTATAGGGTCAGGTATGTTTATGAGCATCGC
  • RNA solution obtained in the RNA extraction stage was taken with a swab and added to a tube containing 1.5 ⁇ of 0.1 M DTT , 2.5 ⁇ of 2 mM dNTP, 1 ⁇ of each of the specific oligonucleotides mentioned for PapMV and PRSV in a concentration 10 ⁇ , 0.25 ⁇ of 0.1% v / v BSA, and 1 ⁇ of the enzyme Moloney Murine Leukemia Virus (M -MLV) 200U of Invitrogen The mixture was allowed to stand for one hour at room temperature to obtain an enzymatic solution of cDNA.
  • M -MLV Moloney Murine Leukemia Virus
  • a wooden stick was impregnated with the cDNA enzyme solution for eight seconds and inserted into a tube containing 100 ⁇ of colorimetric solution, which was prepared by mixing in a 1: 1 ratio two solutions diluted to 0.015% w / v of the dyes VPBBO and Congo Red. Diluted solutions of the VPBBO and Congo Red dyes were prepared as described in example 1.
  • the standardization of the colorimetric reaction was carried out using the 2X SYBR GREEN dye, as a control dye, taking 1 ⁇ of the reaction in a final volume of 20 ⁇ .
  • the step of the colorimetric reaction was carried out by mixing by stirring the stick.
  • Example 3 Detection of other infectious viruses by the method of the invention.
  • oligonucleotides were designed targeting conserved regions of ten viruses that can infect papaya and that have been reported in other countries other than Mexico, such as CMV (Cucumber mosaic virus), CYMV (Croton yellow vein mosaic virus), MWMV (Moroccan watermelon mosaic virus), PaLCrV (Papaya leaf crumple virus), PaLCuV (Papaya leaf curl virus), PLDMV (Papaya leaf -distortion mosaic virus), PLYV (Papaya lethal yellowing virus), PMeV (Papaya meleira virus), TSWV (Tomato spotted wilt virus) and ToRSV (Tomato ringspot virus).
  • CMV Cucumber mosaic virus
  • CYMV Croton yellow vein mosaic virus
  • MWMV Mooroccan watermelon mosaic virus
  • PaLCrV Papaya leaf crumple virus
  • PaLCuV Papaya leaf curl virus
  • PLDMV Papaya leaf -distortion mosaic virus
  • RNA was used as well as commercial and laboratory positive controls (infected tissue), for each of these viruses.
  • the amplification reactions were done at room temperature and without the use of equipment and were observed with the SYBR GREEN dye using blue light and taking a black and white photograph.
  • leaves of corn plants infected with the MCMV (Maize chlorotic mosaic virus) and SCMV (Sugarcane mosaic virus) viruses were used using as control endogenous positive reaction the gene that codes for beta tubulin.
  • MCMV Maize chlorotic mosaic virus
  • SCMV Sudcane mosaic virus
  • total RNA extracted from leaves was used and the amplification reactions were done using oligonucleotides directed to conserved regions of the viral genome (eg, coat protein, see table 1) under ambient temperature conditions and without additional equipment. The reactions were observed after adding SYBR GREEN and with blue light, taking black and white photographs.
  • the method of the invention allows the detection of the aforementioned viruses when differences in color development are obtained in samples that are positive to the presence of the virus of interest, compared with the controls established in the proof.
  • the method of the invention allows the timely, reliable and efficient detection of different pathogenic viruses in plants of agronomic interest, also allowing its simple implementation in the field, which makes it timely for in situ detection of phytopathogens. References.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a simple field method for detecting microorganisms, such as pathogenic agents, in plants of agronomic interest, which comprises extracting the genetic material of the plant, performing isothermic amplification of the genetic material of the microorganism at ambient temperature, and detecting same by means of colorimetric reaction in the visible spectrum, wherein the microorganism can be a phytopathogenic virus infecting plant tissue, such as foliar tissue. In particular, the invention allows, for example, the presence of papaya ringspot virus (PRSV) and papaya mosaic virus (PapMV) in papaya plants, to be easily detected in the field, without the use of devices or equipment commonly used for the detection thereof in laboratory facilities.

Description

Método y estuche diagnóstico para la detección de virus fitopatogenos  Method and diagnostic kit for the detection of phytopathogenic viruses
Campo de la invención. Field of the invention.
La presente invención se refiere al diagnóstico de enfermedades virales que afectan especies de plantas utilizando técnicas moleculares y más particularmente está relacionada con un estuche diagnóstico (kit) y un método sencillo para la detección de patógenos en células vegetales que se realiza a temperatura ambiente y por ejemplo, en condiciones de campo.  The present invention relates to the diagnosis of viral diseases that affect plant species using molecular techniques and more particularly is related to a diagnostic kit (kit) and a simple method for the detection of pathogens in plant cells that is performed at room temperature and by example, in field conditions.
Antecedentes de la invención. Background of the invention.
Los patógenos vegetales representan un problema para los agricultores puesto que afectan el rendimiento o calidad de los cultivos, generando pérdidas económicas considerables e incluso en algunas ocasiones la pérdida total de la cosecha. Plant pathogens represent a problem for farmers since they affect crop yield or quality, generating considerable economic losses and sometimes even total crop loss.
A nivel mundial el papayo es un cultivo de gran potencial para el mercado de las exportaciones, siendo México uno de los principales productores de papaya al igual que Brasil, Indonesia, India, Filipinas, China, Perú, Colombia y Nigeria. En el 2007, México ocupó el primer lugar en exportación y el tercer lugar a nivel mundial en producción, con un total de 919,000 toneladas (FAOSTAT, 201 1). Sin embargo, el cultivo de la papaya presenta alta susceptibilidad a virus fitopatogenos, que causan enfermedades devastadoras para los cultivos debido a su prevalencia y rápida diseminación, siendo esta situación y el efecto del cambio climático lo que ha ocasionado la disminución de la productividad y como resultado, elevadas pérdidas económicas (Mosqueda, 1983). De esta manera, en el 201 1 México bajó su producción a 707,000 toneladas y a consecuencia de esto, se posicionó en el sexto lugar (FAOSTAT, 201 1).  Globally, papaya is a crop of great potential for the export market, with Mexico being one of the main papaya producers as well as Brazil, Indonesia, India, the Philippines, China, Peru, Colombia and Nigeria. In 2007, Mexico ranked first in export and third in the world in production, with a total of 919,000 tons (FAOSTAT, 201 1). However, papaya cultivation has a high susceptibility to phytopathogenic viruses, which cause devastating diseases for crops due to its prevalence and rapid spread, being this situation and the effect of climate change what has caused the decline in productivity and how result, high economic losses (Mosqueda, 1983). Thus, in 201 1 Mexico lowered its production to 707,000 tons and as a result, it positioned itself in sixth place (FAOSTAT, 201 1).
Ante la falta de métodos de control directos para la virosis (Mosqueda, 1983; Noa-Carrazana y Silva-Rosales, 2001 ), las enfermedades han llevado a los productores a cortar y destruir áreas extensas de cultivos una vez detectada la infección debido a que ya está muy diseminada, lo cual genera grandes pérdidas económicas. En este caso, la única opción viable es la utilización de variedades resistentes a virus o el uso de métodos de prevención oportunos (SAGARPA, 2013), donde también es importante implementar estrategias sustentables que permitan la detección oportuna de los agentes virales.  In the absence of direct control methods for virosis (Mosqueda, 1983; Noa-Carrazana and Silva-Rosales, 2001), diseases have led producers to cut and destroy large areas of crops once the infection is detected because the infection It is already very widespread, which generates large economic losses. In this case, the only viable option is the use of virus-resistant varieties or the use of timely prevention methods (SAGARPA, 2013), where it is also important to implement sustainable strategies that allow timely detection of viral agents.
La técnica más antigua utilizada para la identificación de los virus ha estado basada en la observación de los síntomas en las plantas. No obstante, muchas veces esto no ha sido suficiente, ya que los síntomas pueden confundirse con deficiencias nutricionales o metabólicas. Por esta razón es importante implementar estrategias que permitan la detección oportuna de los agentes virales, tales como por ejemplo a través del ensayo ELISA (Enzyme Linked Inmunosorbent Assay, por sus siglas en inglés) así como a través del ensayo basado en PCR (Polymerase Chain Reaction, por sus siglas en inglés), RT-PCR (Reverse Transcription Polymerase Chain Reaction, por sus siglas en inglés) e IC-RT-PCR (Inmunocapture Reverse Transcription Polymerase Chain Reaction, por sus siglas en inglés), siendo estas técnicas rápidas y con alto grado de confiabilidad, además de poder detectar agentes fitopatogenos de diversas especies en un solo ensayo. Sin embargo requieren de equipos especializados, por lo que solo se realizan en laboratorios por personal capacitado y especializado. The oldest technique used to identify viruses has been based on the observation of symptoms in plants. However, many times this has not been enough, since the symptoms can be confused with nutritional or metabolic deficiencies. For this reason it is important to implement strategies that allow the timely detection of viral agents, such as through the ELISA (Enzyme Linked Immunosorbent Assay) test, as well as through the PCR-based test (Polymerase Chain Reaction, RT-PCR (Reverse Transcription Polymerase Chain Reaction) and IC-RT-PCR (Immunocapture Reverse Transcription Polymerase Chain Reaction), these techniques being fast and with a high degree of reliability, in addition to being able to detect phytopathogenic agents of various species in a single test. Without However, they require specialized equipment, so they are only carried out in laboratories by trained and specialized personnel.
Por consecuencia de lo anterior, se ha buscado suprimir los inconvenientes que presentan los métodos de diagnóstico de virus en vegetales utilizados en la actualidad, desarrollando un método de detección de patógenos en células vegetales, adaptable en un kit, que además de no requerir de equipos especiales, genere un resultado rápido y que pueda percibirse a simple vista.  As a result of the above, it has been sought to eliminate the inconveniences presented by the methods of diagnosis of viruses in plants currently used, developing a method of detection of pathogens in plant cells, adaptable in a kit, which in addition to not requiring equipment special, generate a quick result and that can be perceived with the naked eye.
De esta manera, para tener una identificación confiable, la detección se ha llevado a cabo mediante la implementación de técnicas tales como por ejemplo, ELISA PCR, RT-PCR, e IC-RT-PCR (Pérez et al., 2004; Leonard et al., 1993; Robles et al., 2010). Estas técnicas son utilizadas debido a su rapidez, especificidad y alto grado de confiabilidad, además de detectar agentes fitopatógenos de diversas especies en un solo ensayo (Higuchi et al., 1993; Noa Carrazana et al., 2006, Rodríguez et al., 1993). Thus, to have a reliable identification, the detection has been carried out through the implementation of techniques such as, for example, ELISA PCR, RT-PCR, and IC-RT-PCR (Pérez et al., 2004; Leonard et al., 1993; Robles et al., 2010). These techniques are used due to their speed, specificity and high degree of reliability, in addition to detecting phytopathogenic agents of various species in a single trial (Higuchi et al., 1993; Noa Carrazana et al., 2006, Rodríguez et al., 1993 ).
Las estrategias moleculares novedosas para la detección oportuna de fitopatógenos es una alternativa que contribuye a controlar y mantener la fitosanidad y calidad de la papaya de acuerdo a los estándares que el mercado demanda, pero la desventaja es que estas técnicas requieren equipos especializados por lo que solo se realizan en laboratorios por personas especializadas. Por lo que se requiere de la simplificación de los procedimientos de los métodos de detección así como la disminución de la utilización de equipos sofisticados.  The novel molecular strategies for the timely detection of phytopathogens is an alternative that helps to control and maintain the phytosanity and quality of papaya according to the standards that the market demands, but the disadvantage is that these techniques require specialized equipment so that only They are carried out in laboratories by specialized people. Therefore, it is necessary to simplify the procedures of the detection methods as well as to reduce the use of sophisticated equipment.
Una de las técnicas sencillas de amplificación de ácidos nucleicos es TMA (Transcription Mediated Amplification, por sus siglas en inglés), la cual consiste en una serie de reacciones isotérmicas que permiten amplificar ácidos nucleicos sin la necesidad de termociclador ni de diversos equipos específicos para cada etapa. La TMA a diferencia de la amplificación por PCR amplifica RNA, puede amplificar 2 o más blancos a la vez (multiplex) y se realiza en menor tiempo. Esta técnica ha sido utilizada para realizar la detección de diversos virus como el de la hepatitis C en muestras clínicas (Hofmann y col., 2005; Ross y col., 2001 ; Sarrazin y col., 2000) y el virus de la inmunodeficiencia adquirida tipo 1 (Kwoh y col., 1989), además de algunos microorganismos tales como Trichomonas vaginalis (Huppert y col., 2007).  One of the simple nucleic acid amplification techniques is TMA (Transcription Mediated Amplification, for its acronym in English), which consists of a series of isothermal reactions that allow nucleic acid amplification without the need for thermocycler or various specific equipment for each stage. TMA, unlike PCR amplification, amplifies RNA, can amplify 2 or more targets at once (multiplex) and is performed in less time. This technique has been used to detect various viruses such as hepatitis C in clinical samples (Hofmann et al., 2005; Ross et al., 2001; Sarrazin et al., 2000) and the acquired immunodeficiency virus. type 1 (Kwoh et al., 1989), in addition to some microorganisms such as Trichomonas vaginalis (Huppert et al., 2007).
La técnica TMA lleva a cabo la amplificación de RNA diana donde se utilizan dos enzimas (transcriptasa inversa (RT) y RNA polimerasa). En el caso del virus de la Hepatitis C (VHC), el DNA complementario (cDNA) del RNA del virus es generado por RT con la actividad retrotranscriptasa y un cebador que contiene un promotor de T7 en el extremo 5'. El RNA resultante del dúplex de RNA- DNA se degrada por la actividad RNasa H de la RT. Otro cebador se une al cDNA que ya contiene la secuencia de promotor T7 desde el primer cebador y un DNA de doble cadena se sintetiza por la actividad de DNA polimerasa de la RT. La RNA polimerasa reconoce la secuencia 3' del promotor de T7 dentro de la molécula de DNA de doble cadena y sintetiza numerosos transcritos de RNA antisentido. Cada uno de los amplicones de RNA recién producidos vuelve a entrar en el proceso de TMA y sirve como molde para una nueva ronda de RT al DNA de doble hebra incluyendo el promotor T7 y la transcripción de los amplicones antisentido. La circulación de los transcritos antisentido en el proceso de amplificación resulta en la amplificación exponencial del RNA diana. Estos amplicones se detectan a través de ensayo de protección de hibridación (HPA) en el que sólo sondas hibridadas permanecen quimioluminiscentes y se detectan en un luminómetro (Hofmann y col., 2005). The TMA technique performs the amplification of target RNA where two enzymes (reverse transcriptase (RT) and RNA polymerase) are used. In the case of the Hepatitis C virus (HCV), the complementary DNA (cDNA) of the virus RNA is generated by RT with the retrotranscriptase activity and a primer containing a T7 promoter at the 5 'end. The RNA resulting from the RNA-DNA duplex is degraded by the RNase H activity of the RT. Another primer binds to the cDNA that already contains the T7 promoter sequence from the first primer and a double stranded DNA is synthesized by the RT DNA polymerase activity. RNA polymerase recognizes the 3 ' sequence of the T7 promoter within the double stranded DNA molecule and synthesizes numerous transcripts of antisense RNA. Each of the newly produced RNA amplicons re-enters the TMA process and serves as a template for a new round of RT to double-stranded DNA including the T7 promoter and transcription of the antisense amplicons. The circulation of the antisense transcripts in the amplification process results in the exponential amplification of the target RNA. These amplicons are detected through the hybridization protection assay (HPA) in which only hybridized probes remain chemiluminescent and are detected in a luminometer (Hofmann et al., 2005).
La reacción en la TMA se logra con un sistema conocido como el ensayo de protección por hibridación (hybridization protection assay (HPA)), el cual se basa en el uso de oligonucleótidos (específicos para la secuencia blanco a ser amplificada), acoplados a la marca quimioluminiscente que da el éster de acridinio y cuando se lleva a cabo la reacción TMA en presencia de exceso de esta sonda, se producen resultados cuantitativos; después de la hibridación que típicamente se realiza en esta etapa durante 30 minutos a 60°C, se adiciona un reactivo de selección alcalino; bajo condiciones alcalinas, el éster de acridinio asociado con la sonda no hibridizada se hidroliza a una forma no quimioluminiscente, y cuando se asocia con la sonda hibridizada se protege de tal hidrólisis y por lo tanto presenta quimioluminiscencia al exponerse a un reactivo de detección adecuado.  The reaction in the TMA is achieved with a system known as the hybridization protection assay (HPA), which is based on the use of oligonucleotides (specific for the target sequence to be amplified), coupled to the chemiluminescent label given by the acridinium ester and when the TMA reaction is carried out in the presence of excess of this probe, quantitative results are produced; after hybridization that is typically performed at this stage for 30 minutes at 60 ° C, an alkaline selection reagent is added; Under alkaline conditions, the acridinium ester associated with the non-hybridized probe is hydrolyzed to a non-chemiluminescent form, and when associated with the hybridized probe is protected from such hydrolysis and therefore has chemiluminescence when exposed to a suitable detection reagent.
Otra forma de detección de ácidos nucleicos es utilizar colorantes como el SYBR GREEN que fluoresce al unirse a dobles cadenas de DNA, donde el complejo resultante DNA-SYBR Green presenta un pico de absorción a una longitud de onda (λ) de 498 nm y un pico de emisión a una longitud de onda (λ) de 522 nm (correspondiente a la zona verde del espectro, de ahí su nombre). Dicho colorante es utilizado en el laboratorio en la tinción de DNA para el análisis por electroforesis de productos de PCR, o como fluorocromo utilizado como medio de visualización directa de los productos de la PCR en tiempo real. Otros estudios muestran que el colorante Victoria Puré Blue Bo, tiene la capacidad de unirse al surco menor del dsDNA, pero la tinción se observa con luz visible. Utilizando un stock del colorante al 0.5% con 50% etanol, que es utilizada para preparar una dilución del colorante al 0.005% utilizando etanol al 10%, es la concentración que fue utilizada por ejemplo por Weitao y col. (2013) para tinción de geles de agarosa y acrilamida.  Another way to detect nucleic acids is to use dyes such as SYBR GREEN that fluoresces when binding to double strands of DNA, where the resulting DNA-SYBR Green complex has an absorption peak at a wavelength (λ) of 498 nm and a emission peak at a wavelength (λ) of 522 nm (corresponding to the green zone of the spectrum, hence its name). Said dye is used in the laboratory in DNA staining for electrophoresis analysis of PCR products, or as a fluorochrome used as a means of direct visualization of PCR products in real time. Other studies show that the Victoria Puré Blue Bo dye has the ability to bind to the minor groove of the dsDNA, but staining is observed with visible light. Using a stock of the dye at 0.5% with 50% ethanol, which is used to prepare a dilution of the dye at 0.005% using 10% ethanol, is the concentration that was used for example by Weitao et al. (2013) for staining agarose and acrylamide gels.
En la patente US9034606, se describe una preparación acuosa que comprende un pigmento pH sensible, una DNA polimerasa y dNTPs en un buffer débil de Tris (o equivalente) en menos de 1 mM, el cual se describe como adecuado para PCR o para amplificación isotérmica, y el pigmento puede ser por fluorescencia o por color visualmente detectable. In US9034606, an aqueous preparation is described which comprises a pH sensitive pigment, a DNA polymerase and dNTPs in a weak Tris buffer (or equivalent) in less than 1 mM, which is described as suitable for PCR or for isothermal amplification. , and the pigment can be by fluorescence or by visually detectable color.
En la patente US8546131 1 , se describe un dispositivo o kit para detectar un ácido nucleico en una muestra, que comprende un portador (a) que contiene al menos un colorante que puede unirse a un ácido nucleico, una trayectoria (c) para pasar la muestra a través del soporte (a), y una parte de evaluación (d) para observar una sustancia producida por la reacción entre la muestra y el colorante con luz visible, y evaluar visualmente la presencia o ausencia de un ácido nucleico en la muestra. La sustancia reaccionable con el colorante consiste en un agente oxidante, un agente reductor, un ácido, una base y un agente buffer del pH, y en el que el agente reductor es al menos un agente reductor seleccionado del grupo que consiste de borohidruro de sodio, cianoborohidruro de sodio, bisulfito de sodio, sulfito sódico, hiposulfito sódico, pirosulfito potásico, tiosulfato sódico, glutatión, ácido ascórbico, 2-mercaptoetanol, DL-ditiotreitol, 1-tioglicerol, cisteína, tributilfosfina, aminoetanotiol y tris (2-carboxietil) fosfina. Teniendo en cuenta los inconvenientes de las técnicas anteriores, es necesario contar con metodologías que permitan una detección sencilla y confiable en campo para la identificación de virus potencialmente patógenos para plantas. Objetivos de la invención. In US8546131 1, a device or kit for detecting a nucleic acid in a sample is described, comprising a carrier (a) containing at least one dye that can bind to a nucleic acid, a path (c) for passing the sample through the support (a), and an evaluation part (d) to observe a substance produced by the reaction between the sample and the dye with visible light, and visually assess the presence or absence of a nucleic acid in the sample. The substance reactive with the dye consists of an oxidizing agent, a reducing agent, an acid, a base and a pH buffering agent, and in which the reducing agent is at least one reducing agent selected from the group consisting of sodium borohydride. , sodium cyanoborohydride, sodium bisulfite, sodium sulphite, sodium hyposulphite, potassium pyrosulphite, sodium thiosulfate, glutathione, ascorbic acid, 2-mercaptoethanol, DL-dithiothreitol, 1-thioglycerol, cysteine, tributylphosphine, aminoethanethiol-trisboxylcarboxyethane phosphine Taking into account the disadvantages of the prior techniques, it is necessary to have methodologies that allow a simple and reliable detection in the field for the identification of potentially pathogenic viruses for plants. Objectives of the invention.
Es un objetivo de la presente invención proveer un método y un kit para la detección de patógenos en células vegetales que genere un resultado observable bajo luz visible y que no requiera de equipos especiales y que pueda ser aplicable por personal no especializado.  It is an objective of the present invention to provide a method and kit for the detection of pathogens in plant cells that generate an observable result under visible light and that does not require special equipment and that can be applicable by non-specialized personnel.
Es un objeto adicional de la presente invención proveer de un método capaz de discernir entre más de un tipo de virus o especie viral ya sea a partir de una misma muestra o en al menos dos, dependiendo de la factibilidad técnica, donde el método detecta al menos dos virus diferentes en células vegetales que genere un resultado observable bajo luz visible y que no requiera de equipos especiales y que pueda ser aplicable por personal no especializado. Breve descripción de las figuras. It is a further object of the present invention to provide a method capable of distinguishing between more than one type of virus or viral species either from the same sample or at least two, depending on the technical feasibility, where the method detects the At least two different viruses in plant cells that generate an observable result under visible light and that do not require special equipment and that can be applied by non-specialized personnel. Brief description of the figures.
Figura 1. Se muestran los componentes del kit de la presente invención. Se observa A) bolsa de macerado, B) contenedor para reacción de amplificación y C) contenedor para reacción colorimétrica.  Figure 1. The components of the kit of the present invention are shown. A) maceration bag, B) container for amplification reaction and C) container for colorimetric reaction are observed.
Figura 2. Se muestra una representación esquemática del método de la invención. Se observa (A) la colocación de un trozo del tamaño de una moneda de 20 centavos, de una hoja de la planta a inspeccionar, en la bolsa de macerado, para posteriormente (B) frotar el tejido contra la malla contenida en la bolsa con ayuda de la moneda hasta liberar la savia de la hoja, (C) dejar reposar 5 minutos, y (D) dejar caer dos gotas de savia de hoja en el contenedor correspondiente que contiene la mezcla para la reacción de amplificación para cada uno de los virus a detectar de interés y se deja reposar una hora a temperatura ambiente; transcurrida una hora, (E) se remoja un palillo en la mezcla de reacción de amplificación, el cual posteriormente (F) se transfiere al contenedor que contiene la mezcla para reacción colorimétrica para finalmente observar si se presenta un cambio de color en dicho contenedor, lo que indica la presencia del virus de interés en la planta.  Figure 2. A schematic representation of the method of the invention is shown. It is observed (A) the placement of a piece of the size of a 20 cent coin, of a leaf of the plant to be inspected, in the macerated bag, to subsequently (B) rub the tissue against the mesh contained in the bag with help the coin until the leaf sap is released, (C) let stand 5 minutes, and (D) drop two drops of leaf sap in the corresponding container that contains the mixture for the amplification reaction for each of the virus to be detected of interest and allowed to stand for one hour at room temperature; After one hour, (E) a stick is soaked in the amplification reaction mixture, which is then transferred (F) to the container containing the mixture for colorimetric reaction to finally observe if there is a color change in said container, which indicates the presence of the virus of interest in the plant.
Figura 3. Se muestra el uso del método de la invención para la detección de los virus PRSV y PapMV de la papaya, utilizando una mezcla colorimétrica que contiene los colorantes Victoria Puré Blue BO y Rojo congo 1/1 . Se observa (A) un cambio de coloración en las muestras positivas a PapMV (+) a un color rojo-naranja en comparación con la planta sana sin infección del virus (-) que se ve en color amarillo. El PapMV se puede detectar estando como un solo virus (tubos 1 y 2) o en combinación con el virus PRSV (tubos 3 y 4) y su comparación con una planta sana sin infección de virus (tubo 5) o con un tubo en donde se usó agua como control negativo (tubo 6); (B) las muestras infectadas con PRSV (+) cambian a color amarillo en comparación con las muestras sanas, sin infección del virus (-) que se ven de color rojo-naranja. El PRSV se puede detectar como un solo virus (tubos 1 , 2 y 3) o en combinación con el virus PapMV (tubos 4 y 5) en comparación con la muestra de planta sana sin virus (tubo 6) o con un tubo en donde se usó agua como control negativo (tubo 7). Fotos tomadas tal y como se ven en luz visible. Figure 3. The use of the method of the invention for the detection of papaya PRSV and PapMV viruses is shown, using a colorimetric mixture containing Victoria Puré Blue BO and Red congo 1/1 dyes. A change in color in the samples positive to PapMV (+) to a red-orange color is observed in comparison to the healthy plant without infection of the virus (-) that is seen in yellow. PapMV can be detected by being as a single virus (tubes 1 and 2) or in combination with the PRSV virus (tubes 3 and 4) and its comparison with a healthy plant without virus infection (tube 5) or with a tube where water was used as a negative control (tube 6); (B) samples infected with PRSV (+) change to yellow compared to healthy samples, without virus infection (-) that appear red-orange. PRSV can be detected as a single virus (tubes 1, 2 and 3) or in combination with the PapMV virus (tubes 4 and 5) compared to the healthy plant sample without virus (tube 6) or with a tube where water was used as a negative control (tube 7). Photos taken as seen in visible light.
Figura 4. Se muestra el uso del método de la invención en cuatro réplicas para la detección de PapMV, (paneles A y B) y cuatro réplicas para la detección de PRSV (paneles C y D). Tres réplicas de la reacción (A y C) se tiñeron con SYBR GREEN como colorante y se observaron con luz azul a una longitud de onda de 460 nm en un fotodocumentador. La cuarta réplica (B y D) se tiñó con la mezcla de colorante Victoria Puré Blue BO y Rojo Congo 1/1 y se observó con luz natural. Se observa en A y B contenedores con agua (1 ), extracto crudo de una planta sana (2), extractos de plantas infectadas con PapMV (3 a 8) y extractos de plantas infectadas con PapMV y PRSV (9 a 14), mientras que en C y D contenedores con agua (1), solución de extracción (2), extractos de una planta sana (3 y 4) extractos de una planta infectada con PRSV (5 a 8) y extractos de plantas infectadas con PRSV y PapMV (9 a 12).  Figure 4. The use of the method of the invention is shown in four replicates for the detection of PapMV, (panels A and B) and four replicas for the detection of PRSV (panels C and D). Three replicates of the reaction (A and C) were stained with SYBR GREEN as a dye and observed with blue light at a wavelength of 460 nm in a photodocumentor. The fourth replica (B and D) was stained with the Victoria Puree Blue BO and Congo Red 1/1 dye mixture and observed with natural light. Containers with water (1), raw extract of a healthy plant (2), extracts of plants infected with PapMV (3 to 8) and extracts of plants infected with PapMV and PRSV (9 to 14) are observed in A and B that in C and D containers with water (1), extraction solution (2), extracts from a healthy plant (3 and 4) extracts from a plant infected with PRSV (5 to 8) and extracts from plants infected with PRSV and PapMV (9 to 12).
Figura 5. Se muestra la electroforesis de los productos amplificados por RT-PCR convencional mediante los mismos oligonucleótidos que se utilizaron en el método de la invención, usando RNA total extraído de muestras de plantas infectadas con PapMV (carriles 1 a 5) y de plantas infectadas con PRSV (carriles 10 y 1 1 ). Como controles negativos (C-) se observan muestras de agua (carril 7), de solución de extracción (carril 8) y de planta sana (carril 9). La intensidad observada de las bandas resultantes depende de la cantidad de material presente en cada muestra.  Figure 5. Electrophoresis of the products amplified by conventional RT-PCR is shown by the same oligonucleotides that were used in the method of the invention, using total RNA extracted from samples of plants infected with PapMV (lanes 1 to 5) and from plants infected with PRSV (lanes 10 and 1 1). As negative controls (C-), water samples (lane 7), extraction solution (lane 8) and healthy plant (lane 9) are observed. The observed intensity of the resulting bands depends on the amount of material present in each sample.
Figura 6. Se muestra el uso del método de la invención en formato de detección múltiple (múltiples contenedores) con oligonucleótidos específicos para virus que infectan papaya (CMV, CYVMV, MWMV, PaLCrV, PaLCuV, PapMV, PLDMV, PLYV, PMeV, PRSV y TSWV), además de un gen interno (EF1A) de la planta. Se observan las reacciones de amplificación resultantes en una placa de 96 pozos de reacción conteniendo los oligonucleótidos referidos en la tabla 1 según las posiciones indicadas por letra y número con diferentes secuencias de DNA de copia para cada uno de los virus candidatos a partir de la extracción de RNA de cada una de las muestras de plantas a inspeccionar. Como control positivo se usó un control endógeno, el factor de elongación EF1A, y como control negativo la solución amortiguadora de extracción (ver ejemplos). Se observan muestras para CMV (A1 , A2, B1 , B2), CYVMV (C1 , C2), beta tubulina (D1 , D2, E1 , E2), MWMV (F1 , F2), PaLCrV (G1 , G2, A4, A5), PaLCuV (B4, B5), PapMV (C4, C5, D4, D5), PaLCuV (E4, E5), PLDMV (F4, F5, G4, G5), PLYV (A7, A8), PMeV (B7, B8), PRSV (C7, C8, D7, D8), ToRSV (E7, E8), TSWV (F7, F8), control endógeno de ubiquitina (G7, G8) y control negativo con agua (H1 , H2, H3). Figura 7. Se muestra el uso del método de la invención para la detección de dos virus que infectan plantas de maíz, tales como SCMV y MCMV, así como el gen endógeno de beta tubulina de la planta en donde se usaron oligonucleótidos específicos para cada uno de los genes amplificados, usándose muestras positivas para cada virus a partir de extractos de RNA total de hojas. La reacción de amplificación para los virus se visualizó usando el colorante SYBR GREEN y se comparó con una reacción en donde se usó agua como control negativo. Se observan muestras para MCMV (A1 , A2, B1 , B2, D1 , D2), SCMV (E1 , E2, G1 , G2), TSWV (F1 , F2), control de beta tubulina (C1 , C2) y control negativo con agua (H1 , H2). Descripción detallada de la invención. Figure 6. The use of the method of the invention is shown in multiple detection format (multiple containers) with specific oligonucleotides for viruses that infect papaya (CMV, CYVMV, MWMV, PaLCrV, PaLCuV, PapMV, PLDMV, PLYV, PMeV, PRSV and TSWV), in addition to an internal gene (EF1A) of the plant. The resulting amplification reactions are observed on a 96-well reaction plate containing the oligonucleotides referred to in Table 1 according to the positions indicated by letter and number with different DNA sequences of copy for each of the candidate viruses from extraction. RNA of each of the plant samples to be inspected. An endogenous control, the elongation factor EF1A, was used as a positive control, and the extraction buffer solution as a negative control (see examples). Samples are observed for CMV (A1, A2, B1, B2), CYVMV (C1, C2), beta tubulin (D1, D2, E1, E2), MWMV (F1, F2), PaLCrV (G1, G2, A4, A5 ), PaLCuV (B4, B5), PapMV (C4, C5, D4, D5), PaLCuV (E4, E5), PLDMV (F4, F5, G4, G5), PLYV (A7, A8), PMeV (B7, B8 ), PRSV (C7, C8, D7, D8), ToRSV (E7, E8), TSWV (F7, F8), endogenous ubiquitin control (G7, G8) and negative control with water (H1, H2, H3). Figure 7. The use of the method of the invention is shown for the detection of two viruses that infect corn plants, such as SCMV and MCMV, as well as the endogenous beta tubulin gene of the plant where oligonucleotides specific to each were used. of the amplified genes, using positive samples for each virus from extracts of total RNA from leaves. The amplification reaction for the viruses was visualized using the SYBR GREEN dye and compared to a reaction where water was used as a negative control. Samples are observed for MCMV (A1, A2, B1, B2, D1, D2), SCMV (E1, E2, G1, G2), TSWV (F1, F2), beta tubulin control (C1, C2) and negative control with water (H1, H2). Detailed description of the invention.
La presente invención se refiere a un método para detectar la presencia de por lo menos un microorganismo de interés en células vegetales, particularmente un microorganismo patógeno para células vegetales, donde este método se caracteriza porque comprende:  The present invention relates to a method for detecting the presence of at least one microorganism of interest in plant cells, particularly a pathogenic microorganism for plant cells, where this method is characterized in that it comprises:
- Una etapa (A) de extracción de RNA a partir de una muestra de tejido vegetal para obtener una solución de RNA, - A step (A) of RNA extraction from a sample of plant tissue to obtain an RNA solution,
- Una etapa (B) de tratamiento enzimático para obtener una solución enzimática de cDNA, en la cual se pone en contacto la solución de RNA con un oligonucleótido correspondiente al microorganismo de interés y con una enzima transcriptasa inversa o retrotranscriptasa con actividad polimerasa, en donde a partir del RNA de cada microorganismo se sintetiza y amplifica cDNA de doble cadena (dsDNA) cuando el RNA del microorganismo está presente en la solución enzimática, y  - A step (B) of enzymatic treatment to obtain an enzymatic solution of cDNA, in which the RNA solution is contacted with an oligonucleotide corresponding to the microorganism of interest and with an enzyme reverse transcriptase or retrotranscriptase with polymerase activity, wherein from the RNA of each microorganism, double stranded cDNA (dsDNA) is synthesized and amplified when the RNA of the microorganism is present in the enzymatic solution, and
- Una etapa (C) de reacción colorimétrica en la cual se pone en contacto la solución enzimática de cDNA con una solución colorimétrica capaz de cambiar de color a simple vista cuando el cDNA de por lo menos un microorganismo de interés fue amplificado en la etapa de tratamiento enzimático. La solución colorimétrica contiene al menos un colorante capaz de cambiar o desarrollar color a simple vista cuando se une a dsDNA por lo que se observa ya sea desarrollo de color o viraje de color.  - A colorimetric reaction stage (C) in which the cDNA enzyme solution is contacted with a colorimetric solution capable of changing color to the naked eye when the cDNA of at least one microorganism of interest was amplified in the stage of enzymatic treatment The colorimetric solution contains at least one dye capable of changing or developing color with the naked eye when it is bound to dsDNA so that either color development or color change is observed.
La enzima utilizada durante la etapa de tratamiento enzimático, es una transcriptasa inversa (o reversa) (RT) con actividad polimerasa, la cual puede ser por ejemplo la enzima transcriptasa reversa M-MLV (Moloney Murine Leukemia Virus Reverse Transcriptase, por sus siglas en inglés), disponible comercialmente y que fue ensayada en el desarrollo de la presente invención. Una de las características de la M-MLV es que trabaja a bajas temperaturas (37°C), por ejemplo temperatura ambiente, y usa como molde cadenas de RNA para generar DNA complementario utilizando un cebador.  The enzyme used during the enzymatic treatment stage is a reverse (or reverse) (RT) transcriptase with polymerase activity, which can be for example the M-MLV reverse transcriptase enzyme (Moloney Murine Leukemia Virus Reverse Transcriptase). English), commercially available and which was tested in the development of the present invention. One of the characteristics of M-MLV is that it works at low temperatures (37 ° C), for example room temperature, and uses RNA chains as a template to generate complementary DNA using a primer.
La M-MLV también tiene actividad polimerasa, ya que puede sintetizar DNA de doble cadena (dsDNA) usando como molde DNAs de híbridos de RNA:cDNA. La actividad polimerasa de la M- MLV se da tanto usando el oligonucleótido sentido y la cadena de cDNA (antisentido) que sintetizó a partir del RNA viral positivo como el oligonucleótido antisentido y la cadena de cDNA (sentido), que se sintetizó del RNA viral negativo (que es un intermediario de la replicación del virus). De esta forma la síntesis de cDNA de doble cadena proviene tanto del RNA viral sentido como del RNA viral antisentido, lo que duplica la cantidad de sustrato de DNA de doble cadena como producto final. A pesar de que la enzima tiene reducida actividad RNasa H (eliminación de las cadenas de RNA en los híbridos que se forman durante la síntesis de cDNA), fue capaz de eliminar el RNA de los híbridos RNA:cDNA por lo que no fue necesario adicionar RNasa H a la reacción, mientras que el híbrido remanente de RNA:cDNA es usado como sustrato para la intercalamiento de la mezcla de colorante usado.  M-MLV also has polymerase activity, since it can synthesize double stranded DNA (dsDNA) using RNA hybrid cDNA: cDNA as template. The polymerase activity of M-MLV occurs both using the sense oligonucleotide and the cDNA (antisense) chain that synthesized from the positive viral RNA as the antisense oligonucleotide and the cDNA (sense) chain, which was synthesized from the viral RNA negative (which is an intermediary of virus replication). In this way the synthesis of double stranded cDNA comes from both the sense viral RNA and the antisense viral RNA, which doubles the amount of double stranded DNA substrate as the final product. Although the enzyme has reduced RNase H activity (elimination of RNA chains in hybrids formed during cDNA synthesis), it was able to remove RNA from RNA: cDNA hybrids, so it was not necessary to add RNase H to the reaction, while the remaining RNA: cDNA hybrid is used as a substrate for intercalating the dye mixture used.
Para detectar un solo microorganismo, por ejemplo un solo microorganismo patógeno, de acuerdo con el método de la invención se requiere un par de recipientes, que pueden ser de material plástico y estéril, como lo son por ejemplo, tubos de microcentrífuga (tipo Eppendorf™). Utilizando parte de la misma muestra de la planta a inspeccionar, se puede colocar en otro par de recipientes diferentes a los iniciales para detectar otro microorganismo diferente, por ejemplo un microorganismo patógeno, utilizando los oligonucleótidos específicos correspondientes y siguiendo la metodología de la presente invención. To detect a single microorganism, for example a single pathogenic microorganism, according to the method of the invention a pair of containers is required, which can be of plastic material and sterile, as they are for example, microcentrifuge tubes (Eppendorf ™ type). Using part of the same sample of the plant to be inspected, it can be placed in another pair of containers different from the initial ones to detect another different microorganism, for example a pathogenic microorganism, using the corresponding specific oligonucleotides and following the methodology of the present invention.
Puede también ser suficiente con un solo par de recipientes para detectar dos microorganismos simultáneamente, siempre y cuando la coloración así lo permita.  It may also be sufficient with a single pair of containers to detect two microorganisms simultaneously, as long as the coloration so permits.
Para detectar al menos dos microorganismos de manera separada con el método de la invención, se requiere el número de pares de recipientes correspondientes al número de microorganismos diferentes que se desee detectar o diagnosticar, de manera que otro aspecto de la presente invención se refiere a un kit de diagnóstico que comprende al menos un par de recipientes en donde:  To detect at least two microorganisms separately with the method of the invention, the number of pairs of containers corresponding to the number of different microorganisms to be detected or diagnosed is required, so that another aspect of the present invention relates to a diagnostic kit comprising at least one pair of containers where:
a) un primer recipiente contiene una solución de extracción de RNA adaptado para recibir una muestra de tejido vegetal y permitir su mezclado con la solución de extracción de RNA para obtener una solución de RNA (etapa A); a) a first container contains an RNA extraction solution adapted to receive a sample of plant tissue and allow mixing with the RNA extraction solution to obtain an RNA solution (step A);
b) un segundo recipiente adaptado para recibir una parte de la muestra de la solución de RNA y proceder con la obtención enzimática de cDNA, en donde el segundo recipiente comprende una solución de amplificación de cDNA que a su vez comprende un oligonucleótido específico correspondiente a cada microorganismo de interés, por ejemplo un microorganismo patógeno, una enzima transcriptasa inversa con actividad polimerasa, y nucleótidos libres en cantidades suficientes para permitir la amplificación del cDNA de cada microorganismo de interés al entrar en contacto con la solución de RNA (etapa B). En este segundo recipiente se realiza luego la etapa de reacción colorimétrica cuando se adiciona la solución colorimétrica (etapa C), y c) Alternativamente, la etapa de reacción colorimétrica (etapa C) puede realizarse en un tercer recipiente. b) a second container adapted to receive a portion of the sample of the RNA solution and proceed with the enzymatic obtaining of cDNA, wherein the second container comprises a cDNA amplification solution which in turn comprises a specific oligonucleotide corresponding to each microorganism of interest, for example a pathogenic microorganism, a reverse transcriptase enzyme with polymerase activity, and free nucleotides in sufficient amounts to allow amplification of the cDNA of each microorganism of interest upon contact with the RNA solution (step B). In this second vessel, the colorimetric reaction stage is then performed when the colorimetric solution (step C) is added, and c) Alternatively, the colorimetric reaction stage (stage C) can be performed in a third vessel.
De manera más específica otro aspecto de la presente invención se refiere a un kit de diagnóstico de por lo menos dos microorganismos patógenos, específicamente dos virus fitopatógenos, incluyendo entre estos por ejemplo a los virus PapMV y PRSV (que afectan a la especie Carica papaya L), de manera separada, que comprende al menos dos pares de recipientes en donde el primer par se utiliza para la detección del primer patógeno a diagnosticar (por ejemplo PapMV) y el segundo par se utiliza para la detección del segundo patógeno a diagnosticar (por ejemplo PRSV). Otro aspecto de la presente invención se refiere a un kit de diagnóstico para detectar dos microorganismos, por ejemplo 2 microorganismos patógenos, de manera simultánea, el que comprende un solo par de recipientes como sigue:  More specifically, another aspect of the present invention relates to a diagnostic kit of at least two pathogenic microorganisms, specifically two phytopathogenic viruses, including, for example, the PapMV and PRSV viruses (which affect the species Carica papaya L ), separately, comprising at least two pairs of containers in which the first pair is used for the detection of the first pathogen to be diagnosed (for example PapMV) and the second pair is used for the detection of the second pathogen to be diagnosed (by PRSV example). Another aspect of the present invention relates to a diagnostic kit for detecting two microorganisms, for example 2 pathogenic microorganisms, simultaneously, which comprises a single pair of containers as follows:
1 . Un primer recipiente que contiene una solución de extracción de RNA adaptado para recibir una muestra de tejido vegetal y permitir su mezclado con la solución de extracción de RNA para obtener una solución de RNA, y one . A first container containing an RNA extraction solution adapted to receive a sample of plant tissue and allow mixing with the RNA extraction solution to obtain an RNA solution, and
2. Un segundo recipiente adaptado para recibir una muestra de una solución de RNA y obtener una solución enzimática de cDNA, en donde el segundo recipiente comprende una solución de amplificación de cDNA que a su vez comprende dos oligonucleótidos correspondientes a cada uno de los dos microorganismos de interés a detectar, por ejemplo dos microorganismos patógenos, una enzima transcriptasa inversa con actividad polimerasa, y nucleótidos libres en cantidades suficientes para permitir la amplificación del cDNA de cada microorganismo de interés al entrar en contacto con la solución de RNA; y contiene una solución colorimétrica capaz de cambiar de color a simple vista ante la presencia de cDNA amplificado de por lo menos uno de los microorganismos, por ejemplo virus PRSV o PapMV, que comprende una mezcla del colorante Victoria Puré Blue BO (VPBBO) y el colorante de Rojo Congo. 2. A second container adapted to receive a sample of an RNA solution and obtain an enzymatic cDNA solution, wherein the second container comprises a solution of cDNA amplification which in turn comprises two oligonucleotides corresponding to each of the two microorganisms of interest to be detected, for example two pathogenic microorganisms, a reverse transcriptase enzyme with polymerase activity, and free nucleotides in amounts sufficient to allow amplification of the cDNA of each microorganism of interest upon contact with the RNA solution; and it contains a colorimetric solution capable of changing color to the naked eye in the presence of amplified cDNA of at least one of the microorganisms, for example PRSV or PapMV virus, which comprises a mixture of the Victoria Puré Blue BO dye (VPBBO) and the Congo Red coloring.
El método de la presente invención tiene como modalidad preferida detectar a los virus patógenos PRSV y PapMV en tejido de la planta que se sospecha está infectada o también para prevenir infección por los mismos, donde una vez confirmado se trata de cultivos libres de infección gracias al diagnóstico hecho mediante el método descrito aquí.  The method of the present invention has the preferred modality of detecting the pathogenic viruses PRSV and PapMV in plant tissue that is suspected to be infected or also to prevent infection by them, where once confirmed it is an infection-free culture thanks to diagnosis made by the method described here.
Como lo hemos mencionado, el método de la invención comprende tres etapas, tales como la extracción cruda de RNA, la generación de dobles cadenas de DNA de copia viral (amplificación) y por último una reacción colorimétrica para su visualización; por ejemplo, para la detección de los virus patógenos de papaya PRSV y/o PapMV, se necesita de tejido fresco de plantas de papaya sanas e infectadas para realizar la comparación y tener la posibilidad de detectar de manera eficiente dichos virus fitopatógenos. Por ejemplo y para efectos de la presente invención, para el caso específico de la detección de los virus patógenos de papaya PRSV y/o PapMV, se pueden realizar las siguientes etapas:  As we have mentioned, the method of the invention comprises three stages, such as crude RNA extraction, the generation of double strands of viral DNA copying (amplification) and finally a colorimetric reaction for visualization; For example, for the detection of PRSV and / or PapMV papaya pathogenic viruses, fresh tissue from healthy and infected papaya plants is needed to make the comparison and have the possibility of efficiently detecting said phytopathogenic viruses. For example and for the purposes of the present invention, for the specific case of the detection of the pathogenic viruses of papaya PRSV and / or PapMV, the following steps can be performed:
A. La primera etapa del método de la invención, referente a la extracción cruda de ácidos nucleicos fue modificada para su mejor manejo en campo. No es una extracción de ácidos nucleicos propiamente dicha, sino que se trata de la obtención de un extracto crudo desde tejido fresco, que además fue modificado de la fuente original. El protocolo de extracción de RNA previamente descrito es utilizando un trozo de hoja de la planta de interés a inspeccionar, de aproximadamente 1 cm2 de tal manera que a ese trozo de hoja se adicionan 300 μΙ de buffer 1 (20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01 % Igepal, 50% Glicerol v/v) y 100 μΙ de KOH 0.2 M en el caso de PapMV y 100 μΙ de KOH 0.5 M para PRSV. Cabe aclarar que debido a que los buffers de extracción son diferentes para cada uno de estos virus PRSV y PapMV, en este caso de diagnóstico en particular, no es posible llevar a cabo de manera simultánea en el mismo contenedor de reacción la detección de los dos virus, pero se puede realizar en reacciones separadas (contenedores separados), pero paralelas al mismo tiempo sin mayor complicación. A. The first stage of the method of the invention, referring to the crude extraction of nucleic acids was modified for better handling in the field. It is not an extraction of nucleic acids proper, but it is about obtaining a crude extract from fresh tissue, which was also modified from the original source. The RNA extraction protocol previously described is using a piece of leaf from the plant of interest to be inspected, approximately 1 cm 2 in such a way that 300 μΙ of buffer 1 (20 mM Tris HCI pH 7.5 is added to that piece of leaf) , 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01% Igepal, 50% Glycerol v / v) and 100 μΙ of 0.2 M KOH in the case of PapMV and 100 μΙ of 0.5 M KOH for PRSV. It should be clarified that because the extraction buffers are different for each of these PRSV and PapMV viruses, in this particular diagnostic case, it is not possible to simultaneously detect in the same reaction container the detection of the two virus, but it can be performed in separate reactions (separate containers), but parallel at the same time without further complication.
B. La segunda etapa es la de amplificación de RNA agregando los oligonucleótidos específicos del virus PRSV o PapMV, la enzima M-MLV y los demás reactivos necesarios.  B. The second stage is RNA amplification by adding the specific oligonucleotides of the PRSV or PapMV virus, the M-MLV enzyme and the other necessary reagents.
C. La tercera etapa es la reacción colorimétrica con una mezcla de dos colorantes que tienen la capacidad de unirse a dobles cadenas de DNA (dsDNA), para la visualización del producto de la reacción. Se observará el viraje de color de verde a rojo en caso de PapMV y de verde a naranja en caso de PRSV en las muestras positivas. En una modalidad preferida de la presente invención, la solución colorimétrica comprende una mezcla del colorante Victoria Puré Blue BO (VPBBO) y el colorante de Rojo Congo. Preferiblemente en dicha solución colorimétrica, los colorantes se encuentran en una concentración de entre 0.0096% p/v y 0.03% p/v y en una proporción de 0.5:1.3 a 1 :2.6 de VPBBO y Rojo Congo correspondientemente. C. The third stage is the colorimetric reaction with a mixture of two dyes that have the ability to bind to double strands of DNA (dsDNA), for visualization of the reaction product. The color change from green to red in the case of PapMV and from green to orange in the case of PRSV will be observed in the positive samples. In a preferred embodiment of the present invention, the colorimetric solution comprises a mixture of Victoria Puré Blue BO dye (VPBBO) and Congo Red dye. Preferably in said colorimetric solution, the dyes are in a concentration between 0.0096% w / v and 0.03% w / v and in a proportion of 0.5: 1.3 to 1: 2.6 of VPBBO and Congo Red correspondingly.
Otra modalidad de la invención se refiere a un kit o estuche de diagnóstico que comprende los medios para detectar al microorganismo de interés, por ejemplo un virus fitopatógeno, con el método descrito aquí, donde se requiere un par de recipientes en donde:  Another embodiment of the invention relates to a diagnostic kit or kit comprising the means for detecting the microorganism of interest, for example a phytopathogenic virus, with the method described herein, where a pair of containers is required where:
a) Un primer recipiente contiene una solución de extracción de RNA adaptado para recibir una muestra de tejido vegetal y permitir su mezclado con la solución de extracción de RNA para obtener una solución de RNA (etapa A), y a) A first container contains an RNA extraction solution adapted to receive a sample of plant tissue and allow mixing with the RNA extraction solution to obtain an RNA solution (step A), and
b) Un segundo recipiente adaptado para recibir una muestra de una solución de RNA (producto de extracción cruda) y obtener al final una solución enzimática de cDNA, en donde el segundo recipiente comprende una solución de amplificación de cDNA que consiste de: b) A second container adapted to receive a sample of an RNA solution (crude extraction product) and finally obtain an enzymatic cDNA solution, wherein the second container comprises a cDNA amplification solution consisting of:
i. Los oligonucleótidos específicos para el microorganismo, por ejemplo 1 μΙ de los oligonucleótidos a una concentración 10 μΜ,  i. The specific oligonucleotides for the microorganism, for example 1 μΙ of the oligonucleotides at a concentration of 10 μΜ,
¡i. Una enzima transcriptasa inversa con actividad polimerasa, preferentemente la enzima M- I. A reverse transcriptase enzyme with polymerase activity, preferably the M- enzyme
MLV, por ejemplo 1 μΙ de la enzima M-MLV (200U; Invitrogen™), y MLV, for example 1 μΙ of the enzyme M-MLV (200U; Invitrogen ™), and
Ni. 1.5 μΙ de ditiotreitol (DTT) 0.1 M, nucleótidos libres en cantidades suficientes pudiendo ser 2.5 μΙ de dNTP's 2 mM y 0.25 μΙ de albúmina sérica bovina (BSA) al 0.1 %. Neither. 1.5 μΙ dithiothreitol (DTT) 0.1 M, in sufficient amounts free nucleotides may be 2.5 μΙ dNTP 's 2mM and 0.25 μΙ bovine serum albumin (BSA) at 0.1%.
En esta fase se añade la extracción cruda obtenida en la etapa A y contenida en el primer recipiente, para así dar inicio a la reacción, donde la enzima M-MLV toma como molde el RNA del microorganismo utilizando los oligonucleótidos específicos, para generar cDNA que es utilizado posteriormente por la misma enzima para la generación de DNA de doble cadena derivado del microorganismo.  In this phase the crude extraction obtained in stage A and contained in the first vessel is added, in order to initiate the reaction, where the M-MLV enzyme takes as a template the RNA of the microorganism using the specific oligonucleotides, to generate cDNA that It is subsequently used by the same enzyme for the generation of double stranded DNA derived from the microorganism.
En este segundo recipiente se realiza luego la etapa de reacción colorimétrica cuando se adiciona la solución colorimétrica (etapa C), pudiendo implicar el uso de la mezcla de dos colorantes con capacidad de unirse al dsDNA, o al cDNA:RNA, por lo que al ponerse en contacto con la reacción hay un viraje de color evidente entre cada una de las muestras. Alternativamente, la etapa de reacción colorimétrica (etapa C) puede realizarse en un tercer recipiente.  In this second vessel, the colorimetric reaction stage is then carried out when the colorimetric solution is added (step C), which may involve the use of the mixture of two dyes capable of binding to the dsDNA, or to the cDNA: RNA, so that contacting the reaction there is an evident color shift between each of the samples. Alternatively, the colorimetric reaction step (step C) can be performed in a third vessel.
Es importante destacar las diferencias entre el método de la invención y el método TMA conocido en el arte, donde ambos sistemas se basan en la actividad RT RNA polimerasa y se realizan amplificaciones en condiciones isotérmicas.  It is important to highlight the differences between the method of the invention and the TMA method known in the art, where both systems are based on RT RNA polymerase activity and amplifications are performed under isothermal conditions.
En el caso del método TMA se utilizan dos enzimas (transcriptasa inversa (RT) y la T7 RNA polimerasa), mientras que el método de la presente invención necesita una sola enzima, para lo cual fue necesario encontrar el buffer adecuado para la extracción cruda y que mantiene al RNA del microorganismo viable sin degradarse, lo que permite que haya un buen sustrato para la reacción posterior. Además, el método de la invención no necesita de oligonucleótidos con secuencias del promotor T7, como en el caso de TMA, sino solamente de las secuencias específicas del microrganismo que pretende detectarse. In the case of the TMA method, two enzymes (reverse transcriptase (RT) and T7 RNA polymerase) are used, while the method of the present invention requires only one enzyme, for which it was necessary to find the appropriate buffer for crude extraction and which keeps the RNA of the microorganism viable without degrading, which allows for a good substrate for the subsequent reaction. In addition, the method of the invention does not need oligonucleotides with T7 promoter sequences, as in the case of TMA, but only the specific sequences of the microorganism to be detected.
En el método de la invención se utiliza una enzima (la M-MLV ya descrita) con la capacidad de generar solo dsDNA y además trabaja a bajas temperaturas, con lo que se asegura que la reacción se lleve a cabo a temperatura ambiente y que los productos sean dsDNA y no RNA de cadena sencilla como en el TMA.  In the method of the invention an enzyme (the M-MLV already described) is used with the ability to generate only dsDNA and also works at low temperatures, thereby ensuring that the reaction is carried out at room temperature and that the products are dsDNA and not single stranded RNA as in the TMA.
En el método de la invención además de ser la reacción isotérmica, la reacción de amplificación se realiza a 37°C y no a 60°C como en el TMA, lo que facilita su realización por ejemplo en campo a temperatura ambiente, necesitando solo de 30 minutos a una hora en comparación del TMA que necesita mínimo 2 horas.  In the method of the invention in addition to being the isothermal reaction, the amplification reaction is carried out at 37 ° C and not at 60 ° C as in the TMA, which facilitates its realization for example in the field at room temperature, needing only 30 minutes to one hour compared to the TMA that needs a minimum of 2 hours.
El método de detección de la invención se basa en el desarrollo del color en el rango visible y no a través de quimioluminiscencia como es el caso del TMA. Mientras que en el método de la presente invención, los colorantes seleccionados tienen la capacidad de unirse al surco menor del dsDNA por lo que se une con facilidad al dsDNA del microorganismo producto de la reacción para su visualización sin la utilización de equipos, por lo que no se requieren instrumentos de detección y medición (por ejemplo, luminómetro u otros equipos especializados), ya que el resultado que se obtiene es distinguible a simple vista.  The detection method of the invention is based on the development of color in the visible range and not through chemiluminescence as is the case with TMA. While in the method of the present invention, the selected dyes have the ability to bind to the minor groove of the dsDNA so that it easily binds to the dsDNA of the microorganism product of the reaction for visualization without the use of equipment, so no detection and measurement instruments are required (for example, luminometer or other specialized equipment), since the result obtained is distinguishable by the naked eye.
Es también importante destacar que durante el desarrollo de la invención se requirió verificar la especificidad de la reacción para el microorganismo, por ejemplo virus patógenos de plantas, a detectar y lograr la eliminación de fondo inespecífico, donde para esta etapa es esencial el uso de oligonucleótidos específicos para cada microorganismo, esto es esencial para asegurarse de que la reacción sea específica y que no ocurran reacciones cruzadas. Así mismo, se verificó la presencia del microorganismo de interés en las muestras que desarrollaron cambio de color (positivas a la presencia del microorganismo de interés), mediante el uso de otras pruebas de uso común en el laboratorio (RT-PCR, ver figura 5), lo que confirmó el uso confiable del método de la invención. También fue necesaria una búsqueda de colorantes y selección de los adecuados para la detección visual sin equipo de laboratorio, encontrándose así las concentraciones o diluciones adecuadas de cada colorante y combinaciones de éstos para lograr el contraste óptimo respecto al control negativo para una buena detección. Para el caso de detección de los virus PRSV y PapMV, la clave del contraste se logró con una mezcla de dos colorantes.  It is also important to note that during the development of the invention it was required to verify the specificity of the reaction for the microorganism, for example plant pathogenic viruses, to detect and achieve the unspecific background elimination, where for this stage the use of oligonucleotides is essential specific to each microorganism, this is essential to ensure that the reaction is specific and that no cross reactions occur. Likewise, the presence of the microorganism of interest was verified in the samples that developed color change (positive to the presence of the microorganism of interest), through the use of other tests commonly used in the laboratory (RT-PCR, see figure 5 ), which confirmed the reliable use of the method of the invention. It was also necessary a search for dyes and selection of suitable for visual detection without laboratory equipment, thus finding the appropriate concentrations or dilutions of each dye and combinations of these to achieve the optimal contrast with respect to the negative control for a good detection. In the case of detection of PRSV and PapMV viruses, the contrast key was achieved with a mixture of two dyes.
El funcionamiento del método de la presente invención se debe principalmente (aunque no exclusivamente) a dos razones, por un lado, a la gran capacidad de replicación de microorganismos tales como estos virus, cuyo genoma sirve de molde para la síntesis específica de cDNAs de doble cadena que se generan por la actividad de la transcripción reversa y polimerasa de la enzima M- MLV y por otro lado, a la alta especificidad de los colorantes de unión a DNA de doble cadena y a su capacidad visual de cambio de color.  The operation of the method of the present invention is mainly (although not exclusively) due to two reasons, on the one hand, to the great capacity of replication of microorganisms such as these viruses, whose genome serves as a template for the specific synthesis of double cDNAs. chain that are generated by the activity of the reverse transcription and polymerase of the M-MLV enzyme and on the other hand, the high specificity of the double-stranded DNA binding dyes and their visual ability to change color.
En las figuras se ilustra la manipulación que se lleva a cabo con el método de la invención (figura 1 ) a través del estuche diagnóstico descrito aquí, el cual comprende por ejemplo para el caso de plantas de papaya, colectar un trozo de hoja de papaya del tamaño de una moneda de 20 centavos (1.3 cm de diámetro) (figura 2, A), colocar en contenedor, por ejemplo una bolsa plástica (figura 2, B) y macerar el tejido con la misma moneda para después dejar reposar de 5 a 10 minutos a temperatura ambiente (figura 2, C). Posteriormente dejar caer dos gotas del macerado a la reacción de incubación sin tocar la reacción e incubar 1 hora a temperatura ambiente (figura 2, D); finalmente, humedecer un palillo con la reacción de incubación (figura 2, E) y pasarlo al tubo de reacción colorimétrica, mezclar la reacción con el palillo (figura 2, F) y observar si hay cambio de color, lo que indicaría la presencia del microorganismo de interés en la muestra. The figures illustrate the manipulation that is carried out with the method of the invention (figure 1) through the diagnostic kit described here, which comprises for example in the case of Papaya plants, collect a piece of papaya leaf the size of a 20 cent coin (1.3 cm in diameter) (figure 2, A), place in a container, for example a plastic bag (figure 2, B) and macerate the tissue with the same coin and then let stand for 5 to 10 minutes at room temperature (Figure 2, C). Subsequently drop two drops of the macerate to the incubation reaction without touching the reaction and incubate 1 hour at room temperature (Figure 2, D); finally, moisten a stick with the incubation reaction (figure 2, E) and pass it to the colorimetric reaction tube, mix the reaction with the stick (figure 2, F) and observe if there is a color change, which would indicate the presence of the microorganism of interest in the sample.
En una modalidad de la presente invención, es posible detectar con el método de la invención, diversos virus de interés en cultivos de importancia agrícola. Por ejemplo, es posible detectar virus infectantes del jitomate o del maíz (ver ejemplos). In one embodiment of the present invention, it is possible to detect, with the method of the invention, various viruses of interest in crops of agricultural importance. For example, it is possible to detect infectious viruses of tomato or corn (see examples).
Por otra parte, en otra modalidad preferida de la presente invención, los microorganismos patógenos de interés en células vegetales que pueden detectarse mediante el método de la invención comprenden los virus PaLCrV (Papaya leaf crumple virus, por sus siglas en inglés), PaLCuV (Papaya leaf curl virus, por sus siglas en inglés), PapMV (Papaya mosaic virus, por sus siglas en inglés), PRSV (Papaya ringspot virus, por sus siglas en inglés), ToRSV (Tomato ringspot virus, por sus siglas en inglés), PMeV (Papaya meleira virus, por sus siglas en inglés), TSWV (Tomato spotted wilt virus, por sus siglas en inglés), PLYV (Papaya lethal yellowing virus, por sus siglas en inglés), PLDMV (Papaya leaf-distortion mosaic virus, por sus siglas en inglés), PDNV (Papaya droopy necrosis virus, por sus siglas en inglés), PANV (Papaya apical necrosis virus, por sus siglas en inglés), MWMV (Moroccan watermelon mosaic virus, por sus siglas en inglés), CYVMV (Crotón yellow vein mosaic virus, por sus siglas en inglés), TobRV (Tobacco ringspot virus, por sus siglas en inglés), CMV (Cucumber mosaic virus, por sus siglas en inglés), MCMV (Maize chiorotic mosaic virus, por sus siglas en inglés) y/o SCMV (Sugarcane mosaic virus, por sus siglas en inglés). Como puede verse más adelante (ejemplo 3), los virus mencionados se probaron con el colorante SYBER GREEN en RNA purificado, es decir sin hacer la extracción cruda de RNA y aplicando el procedimiento de amplificación de la invención, es decir, amplificando el RNA de interés con los oligonucleótidos específicos correspondientes (ver tabla 1 ), realizando la reacción a temperatura ambiente. Como resultado, mediante el método de la invención es posible determinar, la presencia del virus de interés.  On the other hand, in another preferred embodiment of the present invention, pathogenic microorganisms of interest in plant cells that can be detected by the method of the invention comprise PaLCrV (Papaya leaf crumple virus), PaLCuV (Papaya) leaf curl virus, PapMV (Papaya mosaic virus), PRSV (Papaya ringspot virus), ToRSV (Tomato ringspot virus), PMeV (Papaya meleira virus), TSWV (Tomato spotted wilt virus), PLYV (Papaya lethal yellowing virus), PLDMV (Papaya leaf-distortion mosaic virus, by its acronym in English), PDNV (Papaya droopy necrosis virus), PANV (Papaya apical necrosis virus), MWMV (Moroccan watermelon mosaic virus, by its acronym in English), CYVMV (Croton yellow vein mosaic virus, for its acronym in English), TobRV (Tobacco ringspot virus), CMV (Cucumber mosaic virus), MCMV (Maize chiorotic mosaic virus) and / or SCMV (Sugarcane mosaic virus, for its acronym in English). As can be seen later (example 3), the aforementioned viruses were tested with the SYBER GREEN dye in purified RNA, that is, without making the crude RNA extraction and applying the amplification procedure of the invention, that is, amplifying the RNA of interest with the corresponding specific oligonucleotides (see table 1), performing the reaction at room temperature. As a result, by the method of the invention it is possible to determine the presence of the virus of interest.
En una modalidad más preferida de la presente invención, los patógenos de interés que se detectan en células vegetales comprenden el virus de la mancha anular de la papaya (PRSV) y/o el virus del mosaico de la papaya (PapMV).  In a more preferred embodiment of the present invention, the pathogens of interest detected in plant cells comprise the papaya ring spot virus (PRSV) and / or the papaya mosaic virus (PapMV).
Conforme a la presente invención, la etapa de extracción de RNA en general comprende cualquier técnica conocida para extraer el RNA contenido en la cápside de un virus que se encuentra dentro de una célula vegetal. En una modalidad preferida de la presente invención, la técnica de extracción de RNA comprende la maceración de la muestra de tejido vegetal infectado en presencia de una solución de extracción de RNA. Tabla 1. Oligonucleótidos usados en la presente invención para detectar otros virus In accordance with the present invention, the RNA extraction step in general comprises any known technique for extracting the RNA contained in the capsid of a virus that is within a plant cell. In a preferred embodiment of the present invention, the RNA extraction technique comprises maceration of the infected plant tissue sample in the presence of an RNA extraction solution. Table 1. Oligonucleotides used in the present invention to detect other viruses.
Figure imgf000014_0001
Figure imgf000014_0001
PC. Proteína de la cápside; PNC. Proteína de la nucleocápside; CP. Proteína de cubierta; RNA pol. RNA polimerasa; PAR. Proteína asociada a la replicación; GP. Gen endógeno de papaya; Rep. Replicasa; Nlb r. Nlb replicasa; Nía p. Nía proteinasa.  PC Capsid protein; PNC Nucleocapsid protein; CP. Cover protein; RNA pol. RNA polymerase; PAIR. Replication associated protein; GP Endogenous papaya gene; Rep. Replicase; Nlb r. Nlb replicase; Girl p. Nia proteinase.
En la etapa de tratamiento enzimático para obtener una solución enzimática de cDNA, en general, se pone en contacto la solución de RNA con un oligonucleótido específico y que corresponde al patógeno de interés y con una enzima transcriptasa inversa con actividad polimerasa, en donde a partir del RNA del patógeno de interés se sintetiza y amplifica cDNA de doble cadena cuando el RNA del patógeno está presente en la solución enzimática. In the stage of enzymatic treatment to obtain an enzymatic solution of cDNA, in general, the RNA solution is contacted with a specific oligonucleotide and corresponding to the pathogen of interest and with a reverse transcriptase enzyme with polymerase activity, where from of the RNA of the pathogen of interest is synthesized and amplified double-stranded cDNA when the RNA of the pathogen is present in the enzymatic solution.
En una modalidad preferida de la presente invención, la etapa de tratamiento enzimático toma como base una reacción de amplificación mediada por transcripción en la cual se pone en contacto la solución de RNA con un oligonucleótido correspondiente a cada patógeno de interés y con una enzima transcriptasa inversa con actividad polimerasa, en donde a partir del RNA de cada patógeno se sintetiza y amplifica cDNA de doble cadena cuando el RNA de patógeno está presente en la solución enzimática. El oligonucleótido es una cadena de ácido nucleico o de una molécula relacionada que se une en forma complementaria específica a una cadena única de ácido nucleico e inicia la síntesis de esa cadena en presencia de DNA polimerasa y nucleótidos, y que sirve como punto de partida para la replicación del DNA. Preferiblemente, el oligonucleótido se obtiene con base en secuencias conocidas en el estado de la técnica de donde se toman secciones muy conservadas de cada patógeno de interés (Engel y col., 2010). In a preferred embodiment of the present invention, the enzymatic treatment step is based on a transcription-mediated amplification reaction in which the RNA solution is contacted with an oligonucleotide corresponding to each pathogen of interest and with a reverse transcriptase enzyme. with polymerase activity, where double stranded cDNA is synthesized and amplified from the RNA of each pathogen when the pathogen RNA is present in the enzymatic solution. The oligonucleotide is a chain of nucleic acid or a related molecule that specifically binds to a single nucleic acid chain and initiates the synthesis of that chain in the presence of DNA polymerase and nucleotides, and which serves as a starting point for DNA replication. Preferably, the oligonucleotide is obtained based on sequences known in the state of the art from which very conserved sections of each pathogen of interest are taken (Engel et al., 2010).
Conforme a la presente invención, la etapa de reacción colorimétrica permite por cambio de color, respecto al control, identificar la presencia o ausencia del microorganismo de interés en la muestra de tejido vegetal analizada. La reacción que se lleva a cabo se basa en la interacción entre los grupos catiónicos etilamina o dietilamina en la posición p del grupo fenilo del colorante VPBBO con el surco menor del cDNA de doble cadena amplificado del microorganismo de interés. En una modalidad preferida de la presente invención, la solución colorimétrica comprende una mezcla del colorante Victoria Puré Blue BO (VPBBO) y el colorante Rojo Congo, preferiblemente en una concentración de entre 0.0096% p/v y 0.03% p/v y en una proporción de 0.5:1 a 1 :0.5 de la solución del colorante VPBBO y de la solución del colorante Rojo Congo correspondientemente.  In accordance with the present invention, the colorimetric reaction step allows by color change, with respect to the control, to identify the presence or absence of the microorganism of interest in the sample of analyzed plant tissue. The reaction that is carried out is based on the interaction between the cationic ethylamine or diethylamine groups at the p-position of the phenyl group of the VPBBO dye with the minor groove of the amplified double-stranded cDNA of the microorganism of interest. In a preferred embodiment of the present invention, the colorimetric solution comprises a mixture of Victoria Puré Blue BO dye (VPBBO) and Congo Red dye, preferably in a concentration between 0.0096% w / v and 0.03% w / v and in a proportion of 0.5: 1 to 1: 0.5 of the VPBBO dye solution and the Congo Red dye solution accordingly.
En una modalidad preferida de la presente invención, la solución de extracción de RNA comprende una mezcla de solución amortiguadora y una solución básica. La solución amortiguadora es cualquier solución que ante la adición de un ácido o base sea capaz de mantener el pH constante dentro del intervalo de pH 8.0 para PapMV y de pH 10 para PRSV. Preferiblemente, la solución amortiguadora comprende por lo menos un ácido débil y una sal hidrolíticamente activa. Para efectos de la invención, por ejemplo se utilizan soluciones amortiguadoras conteniendo 100 mM Tris HCI pH 7.5, 50 a 100 mM de NaCI, 0.1 mM EDTA, 1 mM DTT, con o sin 0.01 % Igepal, 20 a 50% Glicerol v/v y 100 μΙ de KOH de 0.1 a 0.5 M, y fosfato de potasio a 240 mM, entre otras que puedan servir para lograr los efectos descritos aquí.  In a preferred embodiment of the present invention, the RNA extraction solution comprises a mixture of buffer solution and a basic solution. The buffer solution is any solution that, with the addition of an acid or base, is capable of maintaining the constant pH within the range of pH 8.0 for PapMV and pH 10 for PRSV. Preferably, the buffer solution comprises at least one weak acid and a hydrolytically active salt. For purposes of the invention, for example, buffer solutions containing 100 mM Tris HCI pH 7.5, 50 to 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, with or without 0.01% Igepal, 20 to 50% Glycerol v / vy are used 100 μΙ of KOH of 0.1 to 0.5 M, and potassium phosphate at 240 mM, among others that can be used to achieve the effects described here.
En una modalidad preferida de la presente invención, la solución de amplificación de cDNA contiene de forma opcional un agente reductor de proteínas y/o un agente reductor de inhibidores de la reacción en cadena de la polimerasa (PCR, por sus siglas en inglés). El agente reductor de proteínas mantiene las condiciones necesarias para que la reacción de transcripción se lleve adecuadamente y ayuda a mantener la estabilidad de la enzima transcriptasa inversa con actividad polimerasa; preferiblemente, el agente reductor de proteínas seleccionado es DDT (Dicloro Difenil Tricloroetano). El agente reductor de inhibidores de PCR puede ser cualquier sustancia que reduzca su efecto, tales inhibidores de PCR pueden estar presentes en el medio de la reacción, los cuales interfieren con la polimerización de los dNTP, lo cual puede resultar en resultados negativos falsos. Preferiblemente, el agente reductor de inhibidores de PCR seleccionado es albúmina de suero bovino (BSA). In a preferred embodiment of the present invention, the cDNA amplification solution optionally contains a protein reducing agent and / or a polymerase chain reaction (PCR) inhibitor. The protein reducing agent maintains the conditions necessary for the transcription reaction to be properly carried out and helps maintain the stability of the reverse transcriptase enzyme with polymerase activity; preferably, the selected protein reducing agent is DDT (Dichloro Diphenyl Trichloroethane). The PCR inhibitor reducing agent can be any substance that reduces its effect, such PCR inhibitors may be present in the reaction medium, which interfere with the polymerization of the dNTPs, which can result in false negative results. Preferably, the selected PCR inhibitor reducing agent is bovine serum albumin (BSA).
De acuerdo con lo anterior, la solución enzimática de cDNA obtenida comprende trazas de la solución de RNA, trazas de un oligonucleótido correspondiente a cada microorganismo de interés, trazas de una enzima transcriptasa inversa con actividad polimerasa, cDNA de doble cadena cuando el RNA del microorganismo está presente en la solución enzimática, y, opcionalmente, dNTPs, un agente reductor de proteínas y/o un agente reductor de inhibidores de PCR. In accordance with the above, the cDNA enzyme solution obtained comprises traces of the RNA solution, traces of an oligonucleotide corresponding to each microorganism of interest, traces of a reverse transcriptase enzyme with polymerase activity, double stranded cDNA when the RNA of the microorganism is present in the enzymatic solution, and, optionally, dNTPs, a protein reducing agent and / or a reducing agent of PCR inhibitors.
Es una modalidad preferida de la invención, el kit o estuche diagnóstico opcionalmente comprende un tercer recipiente que contiene una solución colorimétrica capaz de cambiar de color a simple vista ante la presencia de cDNA de doble cadena de por lo menos un microorganismo de interés y está adaptado para recibir una muestra de la solución enzimática de cDNA. It is a preferred embodiment of the invention, the diagnostic kit or kit optionally comprises a third container containing a colorimetric solution capable of changing color to the naked eye in the presence of double-stranded cDNA of at least one microorganism of interest and is adapted to receive a sample of the cDNA enzyme solution.
En una modalidad preferida de la presente invención, la solución colorimétrica comprende una mezcla del colorante Victoria Puré Blue BO (VPBBO) y el colorante Rojo Congo, preferiblemente en una concentración de entre 0.0096% p/v y 0.03% p/v y en una proporción de 0.5:1 a 1 :0.5 de VPBBO y Rojo Congo correspondientemente.  In a preferred embodiment of the present invention, the colorimetric solution comprises a mixture of Victoria Puré Blue BO dye (VPBBO) and Congo Red dye, preferably in a concentration between 0.0096% w / v and 0.03% w / v and in a proportion of 0.5: 1 to 1: 0.5 of VPBBO and Congo Red correspondingly.
Otro aspecto de la presente invención se refiere a una solución colorimétrica capaz de cambiar de color a simple vista ante la presencia de cDNA de doble cadena, por ejemplo de por lo menos uno de los virus patógenos PRSV o PapMV, que comprende una mezcla del colorante Victoria Puré Blue BO (VPBBO) y el colorante Rojo Congo, preferiblemente mezclados en una proporción 1 :1 y en donde la concentración de cada uno de los colorantes VPBBO y Rojo Congo en la solución colorimétrica es de 0.0096% p/v y 0.03% p/v correspondientemente. Para efectos de la invención, esta mezcla de colorantes puede usarse para detectar otros virus con los oligonucleótidos específicos para cada virus que se quiera detectar.  Another aspect of the present invention relates to a colorimetric solution capable of changing color to the naked eye in the presence of double-stranded cDNA, for example of at least one of the PRSV or PapMV pathogenic viruses, which comprises a mixture of the dye. Victoria Puré Blue BO (VPBBO) and the Congo Red dye, preferably mixed in a 1: 1 ratio and where the concentration of each of the VPBBO and Congo Red dyes in the colorimetric solution is 0.0096% w / v and 0.03% p / v correspondingly. For purposes of the invention, this mixture of dyes can be used to detect other viruses with the specific oligonucleotides for each virus to be detected.
La preparación de la solución colorimétrica se puede llevar a cabo a partir de soluciones concentradas (stock) de cada colorante, a partir de las cuales se obtienen soluciones diluidas de cada uno de ellos y que posteriormente se mezclan en las proporciones adecuadas para obtener la solución colorimétrica. Por ejemplo, la solución diluida del colorante VPBBO se prepara preferiblemente diluyendo una solución stock del colorante VPBBO con una concentración del 0.48 % p/v, con MgCI2 5 mM TE (Tris 1 mM pH 8, EDTA 0.1 mM) pH 6 hasta alcanzar una concentración de 0.0096% p/v de VPBBO. Por su lado, la solución diluida de Rojo Congo se prepara preferiblemente diluyendo una solución stock del colorante Rojo Congo con una concentración del 0.1 % p/v, con agua MiliQ estéril hasta alcanzar una concentración de 0.03% p/v de Rojo Congo. La presente invención será mejor entendida a partir de los siguientes ejemplos, los cuales se presentan únicamente con fines ilustrativos para permitir la comprensión cabal de las modalidades preferidas de la presente invención a través de pruebas con virus de distinto tipo y para una especie vegetal en particular, sin que por ello se implique que no existen otras modalidades no ilustradas que puedan llevarse a la práctica con base en la descripción anterior, toda vez que los principios de la presente invención son aplicables a cualquier microorganismo, por ejemplo virus y/o planta, siempre y cuando se cuente con los oligonucleótidos específicos que correspondan y se utilice la solución colorimétrica de la presente invención. The preparation of the colorimetric solution can be carried out from concentrated solutions (stock) of each dye, from which diluted solutions of each of them are obtained and subsequently mixed in the appropriate proportions to obtain the solution. colorimetric For example, the diluted solution of the VPBBO dye is preferably prepared by diluting a stock solution of the VPBBO dye with a concentration of 0.48% w / v, with 5 mM MgCl 2 TE (1 mM Tris pH 8, 0.1 mM EDTA) pH 6 until reaching a concentration of 0.0096% w / v of VPBBO. On the other hand, the diluted Congo Red solution is preferably prepared by diluting a stock solution of the Congo Red dye with a concentration of 0.1% w / v, with sterile MiliQ water until reaching a concentration of 0.03% w / v Congo Red. The present invention will be better understood from the following examples, which are presented for illustrative purposes only to allow full understanding of the preferred embodiments of the present invention through tests with viruses of different types and for a particular plant species , without implying that there are no other non-illustrated modalities that can be implemented based on the above description, since the principles of the present invention are applicable to any microorganism, for example viruses and / or plants, as long as the corresponding specific oligonucleotides are available and the colorimetric solution of the present invention is used.
Ejemplo 1. Método de detección de la invención. Example 1. Detection method of the invention.
- Muestreo y obtención de extracto crudo de RNA. Se colectaron secciones de hojas de la planta de interés de 1.3 cm de diámetro usando una moneda de 20 centavos como molde del tamaño a recortar manualmente. La extracción de ácidos nucleicos de la hoja se realizó básicamente utilizando como base el protocolo descrito por Fakuta y col. (2003), y con modificaciones para finalmente tomar partes de hojas de 1 .3 cm de diámetro usando una moneda de 20 centavos como molde. El trozo de hoja se maceró en una bolsa plástica conteniendo una malla plástica que contenía 300 μΙ de solución amortiguadora (20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01 % Igpal, 50% Glicerol v/v) y 100 μΙ de KOH 0.2 M en el caso de PapMV y 100 μΙ de KOH 0.5 M para PRSV. Se dejó reposar 10 minutos a temperatura ambiente. - Sampling and obtaining crude RNA extract. Sections of leaves of the plant of interest of 1.3 cm in diameter were collected using a 20 cent coin as a mold of the size to be trimmed manually. The extraction of nucleic acids from the leaf was basically done using the protocol described by Fakuta et al. (2003), and with modifications to finally take parts of sheets of 1.3 cm in diameter using a 20 cent coin as a mold. The piece of sheet was macerated in a plastic bag containing a plastic mesh containing 300 μΙ of buffer solution (20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01% Igpal, 50% Glycerol v / v) and 100 μΙ of 0.2 M KOH in the case of PapMV and 100 μΙ of 0.5 M KOH for PRSV. Let stand 10 minutes at room temperature.
- Generación de dobles cadenas de DNA. - Generation of double strands of DNA.
Para la generación de dobles cadenas a partir de la muestra obtenida de extracto crudo de RNA, se tomó como base una reacción de TMA la cual fue modificada, para lograr una técnica aún más sencilla en menor tiempo, como se describe a continuación.  For the generation of double chains from the sample obtained from crude RNA extract, a TMA reaction was used as a base which was modified, to achieve an even simpler technique in less time, as described below.
Con un hisopo se tomó una gota del extracto crudo de RNA y se adicionó a un tubo que contenía 1 .5 μΙ de DTT 0.1 M, 2.5 μΙ de dNTP's 2 mM, 1 μΙ de cada uno de los oligonucleótidos de interés (delantero o Fw y reversa o Rv) a una concentración 10 μΜ, 0.25 μΙ de albúmina sérica bovina (BSA) al 0.1 % y 1 μΙ de la enzima M-MLV (200U; Invitrogen). Hecha la mezcla, posteriormente se incubó una hora a temperatura ambiente. A swab was taken a drop of crude extract of RNA and to a tube containing 1 .5 μΙ DTT 0.1 M, 2.5 μΙ dNTP 's 2 mM, 1 μΙ of each of the oligonucleotide of interest (front was added or Fw and reverse or Rv) at a concentration of 10 μΜ, 0.25 μΙ of bovine serum albumin (BSA) at 0.1% and 1 μΙ of the enzyme M-MLV (200U; Invitrogen). Made the mixture, then it was incubated one hour at room temperature.
- Reacción colorimétrica. - Colorimetric reaction.
La estandarización de la reacción del método de la invención se llevó a cabo utilizando el colorante SYBR GREEN al 2X como colorante control, tomando 1 μΙ de la reacción en un volumen final de 20 μΙ para posteriormente visualizarse con luz azul en un fotodocumentador.  The standardization of the reaction of the method of the invention was carried out using the 2X SYBR GREEN dye as a control dye, taking 1 μΙ of the reaction in a final volume of 20 μΙ and subsequently visualized with blue light in a photodocumentor.
Se realizó la mezcla colorimétrica utilizando un stock de colorante Victoria Puré Blue Bo al 0.48% p/v obtenido previamente mezclando 0.06 g del colorante VPBBO con 12.5 mL de etanol frío al 99.5% mediante magneto por 10 minutos, y un stock de colorante Rojo Congo al 0.1 % p/v obtenido al mezclar 0.01 g del colorante con 10 mi de glicerol al 99.5% v/v mediante agitación vigorosa. Posteriormente 20 μΙ del stock del colorante VPBBO se mezclaron con 980 μΙ_ de una solución MgCI2 TE (Tris 1 mM pH 8, EDTA 0.1 mM) pH 6.0, generando una solución al 0.0096% p/v del colorante; de manera similar, 300 μΙ del stock del colorante Rojo Congo se mezclaron con 700 μΙ_ de agua MiliQ estéril, generando una solución al 0.03% p/v de dicho colorante. Finalmente, las soluciones del colorante VPBBO al 0.0096% p/v y del colorante Rojo Congo al 0.03% p/v se mezclaron en partes iguales en volumen (1 :1) para generar la solución colorimétrica de la invención para después ser alicuotada en 150 μΙ_. Colorimetric mixing was performed using a stock of Victoria Puré Blue Bo dye at 0.48% w / v previously obtained by mixing 0.06 g of VPBBO dye with 12.5 mL of 99.5% cold ethanol by magneto for 10 minutes, and a stock of Congo Red dye 0.1% w / v obtained by mixing 0.01 g of the dye with 10 ml of 99.5% v / v glycerol by vigorous stirring. Subsequently, 20 μΙ of the stock of the VPBBO dye was mixed with 980 μΙ_ of a MgCI 2 TE solution (1 mM Tris pH 8, 0.1 mM EDTA) pH 6.0, generating a 0.0096% w / v solution of the dye; Similarly, 300 μΙ of the stock of Congo Red dye was mixed with 700 μΙ_ of sterile MiliQ water, generating a 0.03% w / v solution of said dye. Finally, solutions of the VPBBO dye at 0.0096% w / v and the Congo Red dye at 0.03% w / v were mixed in equal parts by volume (1: 1) to generate the colorimetric solution of the invention and then aliquoted at 150 μΙ_ .
Posteriormente se sumergió un palillo en la reacción de amplificación (generación de dsDNA) y se pasó al contenedor que contenía la mezcla de colorantes para realizar la reacción colorimétrica, para lo cual se mezcló con el mismo palillo y se observó el viraje de color de verde a rojo en el caso de muestras positivas a PapMV y de verde a naranja en el caso de muestras positivas a PRSV. Ejemplo 2. Detección de los virus PRSV o PapMV mediante el método de la invención. Subsequently, a stick was immersed in the amplification reaction (dsDNA generation) and passed to the container containing the dye mixture to perform the colorimetric reaction, for which it was mixed with the same stick and the green color turn was observed to red in the case of samples positive to PapMV and from green to orange in the case of samples positive to PRSV. Example 2. Detection of PRSV or PapMV viruses by the method of the invention.
- Tratamiento de la muestra de tejido vegetal para extracción de RNA.  - Treatment of the plant tissue sample for RNA extraction.
Se realizó un ensayo para detectar los virus PRSV o PapMV en una muestra de tejido vegetal de la planta de la papaya (Carica papaya L.) de acuerdo con los principios de la presente invención. Para este ensayo se seleccionaron plantas de papaya de invernadero que estuvieran sanas sin ningún síntoma de enfermedad o daño físico. Para provocar la infección, se utilizó como abrasivo carborundum y se colocaron 20 μΙ de solución macerada de tejido infectado con 0.001 M de fosfato de sodio a un pH 8 y una solución tampón de EDTA 0.001 M para la inoculación mecánica. Se inocularon plantas con PapMV, PRSV y otras plantas sanas no fueron inoculadas.  An assay was performed to detect PRSV or PapMV viruses in a sample of plant tissue from the papaya plant (Carica papaya L.) in accordance with the principles of the present invention. For this test, greenhouse papaya plants were selected that were healthy without any symptoms of illness or physical damage. To cause infection, carborundum was used as abrasive and 20 μΙ of macerated solution of tissue infected with 0.001 M sodium phosphate at pH 8 and a 0.001 M EDTA buffer solution were placed for mechanical inoculation. Plants were inoculated with PapMV, PRSV and other healthy plants were not inoculated.
La toma de muestra de tejido vegetal de papaya infectada fue a los 10 dpi (días post inoculación). En una bolsa con malla plástica, se coloca una muestra de tejido vegetal que consiste de un trozo de hoja de papaya. La muestra tiene un diámetro de 1 .3 cm que se obtuvo usando una moneda de 20 centavos como molde del tamaño a recortar manualmente y proviene de las hojas de la planta. Dentro de la bolsa con malla plástica fueron colocadas previamente la solución amortiguadora y la solución básica, donde la solución amortiguadora consiste de 300 μΙ de solución acuosa que contiene 20 mM de Tris HCI pH 7.5, 100 mM de NaCI, 0.1 mM de EDTA, 1 mM de DTT (previene la oxidación de ácidos nucleicos y por lo tanto facilita su extracción), 0.01 % v/v de Igepal CA-630 y 50% de glicerol v/v, y la solución básica consiste de 100 μΙ de una solución acuosa de KOH en una concentración de 0.2 M en el caso de PapMV o de 100 μΙ de una solución acuosa de KOH en una concentración de 0.5 M para el caso de PRSV. Esta etapa de extracción de RNA crudo a partir de plantas de papaya, se realizó siguiendo el protocolo descrito previamente por Fukuta, Lida y col. (2003). La muestra se maceró dentro de la bolsa con malla plástica que contiene la solución amortiguadora y la solución básica y se dejó reposar 10 minutos a temperatura ambiente para obtener una solución de RNA. The sampling of infected papaya plant tissue was at 10 dpi (days after inoculation). In a plastic mesh bag, a sample of plant tissue consisting of a piece of papaya leaf is placed. The sample has a diameter of 1.3 cm that was obtained using a 20 cent coin as a mold of the size to be trimmed manually and comes from the leaves of the plant. The buffer solution and the basic solution were previously placed inside the plastic mesh bag, where the buffer solution consists of 300 μΙ of aqueous solution containing 20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT (prevents oxidation of nucleic acids and therefore facilitates their extraction), 0.01% v / v of Igepal CA-630 and 50% glycerol v / v, and the basic solution consists of 100 μΙ of an aqueous solution of KOH in a concentration of 0.2 M in the case of PapMV or of 100 μΙ of an aqueous solution of KOH in a concentration of 0.5 M in the case of PRSV. This step of extracting raw RNA from papaya plants was performed following the protocol previously described by Fukuta, Lida et al. (2003). The sample was macerated inside the plastic mesh bag containing the buffer solution and the basic solution and allowed to stand 10 minutes at room temperature to obtain an RNA solution.
- Amplificación de secuencias y detección colorimétrica de los virus PRSV o PapMV. - Sequence amplification and colorimetric detection of PRSV or PapMV viruses.
Para la etapa de tratamiento enzimático, los oligonucleótidos específicos utilizados para detectar el virus PapMV fueron:  For the enzymatic treatment stage, the specific oligonucleotides used to detect the PapMV virus were:
Fw-PapMV (CCTGAGGCCCAACACAGATT) (SEQ.ID.No.1 ) y  Fw-PapMV (CCTGAGGCCCAACACAGATT) (SEQ.ID.No.1) and
Rv-PapMV (TCAGCCCACTTGAATCTGCC) (SEQ.ID.No.2), Rv-PapMV (TCAGCCCACTTGAATCTGCC) (SEQ.ID.No.2),
mientras que para detectar el virus PRSV, los oligonucleótidos utilizados fueron: while to detect the PRSV virus, the oligonucleotides used were:
Fw-PRSV (TAATACGACTCACTATAGGGGATTGATCACAGTAAGGGTTATGAG) (SEQ.ID.No.3), y Rv-PRSV (TAATACGACTCACTATAGGGTCAGGTATGTTTATGAGCATCGC) (SEQ.ID.No.4). Fw-PRSV (TAATACGACTCACTATAGGGGATTGATCACAGTAAGGGTTATGAG) (SEQ.ID.No.3), and Rv-PRSV (TAATACGACTCACTATAGGGTCAGGTATGTTTATGAGCATCGC) (SEQ.ID.No.4).
Para obtener una solución enzimática de cDNA en esta etapa de tratamiento enzimático, con un hisopo se tomó una gota de la solución de RNA obtenida en la etapa de extracción de RNA y se adicionó a un tubo que contenía 1 .5 μΙ de DTT 0.1 M, 2.5 μΙ de dNTP 2 mM, 1 μΙ de cada uno de los oligonucleótidos específicos mencionados para PapMV y PRSV en una concentración 10 μΜ, 0.25 μΙ de BSA 0.1 % v/v, y 1 μΙ de la enzima Moloney Murine Leukemia Virus (M-MLV) 200U de Invitrogen. La mezcla se dejó en reposo durante una hora a temperatura ambiente para obtener una solución enzimática de cDNA. To obtain an enzymatic solution of cDNA at this stage of enzymatic treatment, a drop of the RNA solution obtained in the RNA extraction stage was taken with a swab and added to a tube containing 1.5 μΙ of 0.1 M DTT , 2.5 μΙ of 2 mM dNTP, 1 μΙ of each of the specific oligonucleotides mentioned for PapMV and PRSV in a concentration 10 μΜ, 0.25 μΙ of 0.1% v / v BSA, and 1 μΙ of the enzyme Moloney Murine Leukemia Virus (M -MLV) 200U of Invitrogen The mixture was allowed to stand for one hour at room temperature to obtain an enzymatic solution of cDNA.
Posteriormente, para la etapa de la reacción colorimétrica, se impregnó un palillo de madera con la solución enzimática de cDNA durante ocho segundos y se insertó en un tubo que contenía 100 μΙ de solución colorimétrica, la cual se preparó mezclando en una relación 1 :1 dos soluciones diluidas al 0.015% p/v de los colorantes VPBBO y Rojo Congo. Las soluciones diluidas de los colorantes VPBBO y Rojo Congo se prepararon conforme se describe en el ejemplo 1.  Subsequently, for the colorimetric reaction stage, a wooden stick was impregnated with the cDNA enzyme solution for eight seconds and inserted into a tube containing 100 μΙ of colorimetric solution, which was prepared by mixing in a 1: 1 ratio two solutions diluted to 0.015% w / v of the dyes VPBBO and Congo Red. Diluted solutions of the VPBBO and Congo Red dyes were prepared as described in example 1.
La estandarización de la reacción colorimétrica se llevó a cabo utilizando el colorante SYBR GREEN al 2X, como colorante control, tomando 1 μΙ de la reacción en un volumen final de 20 μΙ. En el tubo que contenía la solución colorimétrica se llevó a cabo la etapa de la reacción colorimétrica al mezclar agitando el palillo.  The standardization of the colorimetric reaction was carried out using the 2X SYBR GREEN dye, as a control dye, taking 1 μΙ of the reaction in a final volume of 20 μΙ. In the tube containing the colorimetric solution the step of the colorimetric reaction was carried out by mixing by stirring the stick.
Como puede observarse en las figuras 3 y 4, el cambio de coloración en las muestras analizadas respecto del control negativo indicó la presencia de PapMV o PRSV.  As can be seen in Figures 3 and 4, the change in color in the samples analyzed with respect to the negative control indicated the presence of PapMV or PRSV.
Por otro lado y como una forma de validar los resultados obtenidos mediante el método de la invención, se realizó un análisis electroforético de las muestras analizadas después de su amplificación mediante RT-PCR convencional usando los mismos oligonucleótidos que se utilizaron en la prueba, usando RNA total extraído de muestras de plantas infectadas con PapMV y de plantas infectadas con PRSV (figura 5), confirmando la presencia de la banda característica resultante de la amplificación de PapMV o PRSV en las muestras que resultaron positivas conforme al cambio de coloración observado. Estos resultados confirmaron que en las muestras que resultaron positivas por el cambio de coloración conforme a la presente invención, se detecta la presencia de PapMV o PRSV.  On the other hand and as a way of validating the results obtained by the method of the invention, an electrophoretic analysis of the samples analyzed was performed after amplification by conventional RT-PCR using the same oligonucleotides that were used in the test, using RNA Total extracted from samples of plants infected with PapMV and plants infected with PRSV (Figure 5), confirming the presence of the characteristic band resulting from the amplification of PapMV or PRSV in the samples that were positive according to the change in color observed. These results confirmed that in the samples that were positive for the change in color according to the present invention, the presence of PapMV or PRSV is detected.
Ejemplo 3. Detección de otros virus infectantes mediante el método de la invención. Example 3. Detection of other infectious viruses by the method of the invention.
Para corroborar que el método de la invención se puede usar para detectar la presencia de otros virus diferentes a PRSV y PapMV, se diseñaron oligonucleótidos (tabla 1) dirigidos a regiones conservadas de diez virus que pueden infectar papaya y que se han reportado en otros países diferentes a México, tales como CMV (Cucumber mosaic virus), CYMV (Crotón yellow vein mosaic virus), MWMV (Moroccan watermelon mosaic virus), PaLCrV (Papaya leaf crumple virus), PaLCuV (Papaya leaf curl virus), PLDMV (Papaya leaf-distortion mosaic virus), PLYV (Papaya lethal yellowing virus), PMeV (Papaya meleira virus), TSWV (Tomato spotted wilt virus) y ToRSV (Tomato ringspot virus). Para hacer estas pruebas se usó RNA purificado así como controles positivos comerciales y de colecciones de laboratorios (tejido infectado), para cada uno de dichos virus. Las reacciones de amplificación se hicieron a temperatura ambiente y sin uso de equipo y se observaron con el colorante SYBR GREEN usando luz azul y tomando una fotografía en blanco y negro. To corroborate that the method of the invention can be used to detect the presence of viruses other than PRSV and PapMV, oligonucleotides (table 1) were designed targeting conserved regions of ten viruses that can infect papaya and that have been reported in other countries other than Mexico, such as CMV (Cucumber mosaic virus), CYMV (Croton yellow vein mosaic virus), MWMV (Moroccan watermelon mosaic virus), PaLCrV (Papaya leaf crumple virus), PaLCuV (Papaya leaf curl virus), PLDMV (Papaya leaf -distortion mosaic virus), PLYV (Papaya lethal yellowing virus), PMeV (Papaya meleira virus), TSWV (Tomato spotted wilt virus) and ToRSV (Tomato ringspot virus). To perform these tests, purified RNA was used as well as commercial and laboratory positive controls (infected tissue), for each of these viruses. The amplification reactions were done at room temperature and without the use of equipment and were observed with the SYBR GREEN dye using blue light and taking a black and white photograph.
Por otra parte, para corroborar que el método de la invención permite detectar virus de otras especies de plantas diferentes a papaya, se usaron hojas de plantas de maíz infectadas con los virus MCMV (Maize chlorotic mosaic virus) y SCMV (Sugarcane mosaic virus) usando como control positivo endógeno de la reacción el gen que codifica para la beta tubulina. En este caso se usó RNA total extraído de hojas y las reacciones de amplificación se hicieron usando oligonucleótidos dirigidos a regiones conservadas del genoma viral (por ejemplo, proteína de la cubierta, ver tabla 1) en condiciones de temperatura ambiente y sin equipo adicional. Las reacciones se observaron luego de añadir SYBR GREEN y con luz azul, tomando fotografías en blanco y negro. On the other hand, to corroborate that the method of the invention allows to detect viruses from other plant species other than papaya, leaves of corn plants infected with the MCMV (Maize chlorotic mosaic virus) and SCMV (Sugarcane mosaic virus) viruses were used using as control endogenous positive reaction the gene that codes for beta tubulin. In this case, total RNA extracted from leaves was used and the amplification reactions were done using oligonucleotides directed to conserved regions of the viral genome (eg, coat protein, see table 1) under ambient temperature conditions and without additional equipment. The reactions were observed after adding SYBR GREEN and with blue light, taking black and white photographs.
Como puede observarse en las figuras 6 y 7, el método de la invención permite la detección de los virus mencionados al obtenerse diferencias en el desarrollo de color en muestras que resultan positivas a la presencia del virus de interés, comparadas con los controles establecidos en la prueba.  As can be seen in Figures 6 and 7, the method of the invention allows the detection of the aforementioned viruses when differences in color development are obtained in samples that are positive to the presence of the virus of interest, compared with the controls established in the proof.
Por lo anterior, el método de la invención permite la detección oportuna, confiable y eficiente de diferentes virus patógenos en plantas de interés agronómico, permitiendo también su implementación sencilla en campo, lo que la hace oportuna para la detección in situ de fitopatógenos. Referencias. Therefore, the method of the invention allows the timely, reliable and efficient detection of different pathogenic viruses in plants of agronomic interest, also allowing its simple implementation in the field, which makes it timely for in situ detection of phytopathogens. References.
- Engel, E. A., et. al. 2010. Journal of Virological Methods, 163:445-451.  - Engel, E. A., et. to the. 2010. Journal of Virological Methods, 163: 445-451.
- FAOSTAT. 201 1. http://www.faostat.fao.org. Leído el 24 de noviembre del 2012.  - FAOSTAT. 201 1. http://www.faostat.fao.org. Read on November 24, 2012.
- Fukuta, S., Lida, T., et.al. 2003. Achieves of Virology, 148:1713-1720.  - Fukuta, S., Lida, T., et.al. 2003. Achieves of Virology, 148: 1713-1720.
- Fukuta, S., et.al. 2003. Journal of Virological Methods, 1 12, no 1 , p. 35-40.  - Fukuta, S., et.al. 2003. Journal of Virological Methods, 1 12, no 1, p. 35-40.
- Higuchi R, et.al. 1993. Biotechnology Research, 1026-1030. - Higuchi R, et.al. 1993. Biotechnology Research, 1026-1030.
- Hofmann W. P., et.al. 2005. Journal of Clinical Virology, 32:289-293.  - Hofmann W. P., et.al. 2005. Journal of Clinical Virology, 32: 289-293.
- Huppert, J. S., et.al. 2007. Clinical Infectious Diseases, 45:194-198.  - Huppert, J. S., et.al. 2007. Clinical Infectious Diseases, 45: 194-198.
- Kwoh, D. Y., et.al. 1989. Proc. Nati. Acad. Sci., 86: 1 173-1 177.  - Kwoh, D. Y., et.al. 1989. Proc. Nati Acad. Sci., 86: 1 173-1 177.
- Leonard, S.M., et.al. 1993. Diversidad Científica y tecnológica de la Asociación ciencia hoy, 2-4. - Mosqueda V, R. 1983. Logros aportaciones de la investigación agrícola en el cultivo de frutas tropicales y subtropicales. México, Limusa.  - Leonard, S.M., et.al. 1993. Scientific and technological diversity of the Science Association today, 2-4. - Mosqueda V, R. 1983. Achievements contributions of agricultural research in the cultivation of tropical and subtropical fruits. Mexico, Limusa.
- Noa-Carrazana J. C, Silva-Rosales L. 2001. Plant Disease, 90 (8):1004-1011 .  - Noa-Carrazana J. C, Silva-Rosales L. 2001. Plant Disease, 90 (8): 1004-1011.
- Noa-Carrazana, González D., Silva R.L 2006. Virus Genes, 35 (1 ): 109-1 17.  - Noa-Carrazana, González D., Silva R.L 2006. Virus Genes, 35 (1): 109-1 17.
- Pérez L, et.al. 2004, Revista Mexicana de Fitopatología, 22 (2): 187-197.  - Pérez L, et.al. 2004, Mexican Journal of Phytopathology, 22 (2): 187-197.
- Robles H.L., et.al. 2010. Tecnociencia Chihuahua, 5: 72-86. - Robles H.L., et.al. 2010. Technoscience Chihuahua, 5: 72-86.
- Rodríguez S.l, et.al. 2004. Ciencia UANL, 7:3.  - Rodríguez S.l, et.al. 2004. UANL Science, 7: 3.
- Ross, R. S., et.al. 2001 . Journal of Clinical Laboratory Analysis, 15:308-13.  - Ross, R. S., et.al. 2001 Journal of Clinical Laboratory Analysis, 15: 308-13.
- SAGARPA 2008. Disponible en: http://www.SAGARPA.org. Leído el 24 de junio del 2013.  - SAGARPA 2008. Available at: http://www.SAGARPA.org. Read on June 24, 2013.
- Sarrazin, C, et.al. 2000. Hepatology, 32:818-23.  - Sarrazin, C, et.al. 2000. Hepatology, 32: 818-23.
- Weitao Cong, et.al. 2012. Analyst, 137: 1466-1472. - Weitao Cong, et.al. 2012. Analyst, 137: 1466-1472.

Claims

Reivindicaciones. Claims
1 . Un método para detectar a temperatura ambiente la presencia de un microorganismo de interés en células vegetales, caracterizado porque comprende las etapas de:  one . A method to detect the presence of a microorganism of interest in plant cells at room temperature, characterized in that it comprises the steps of:
a) Extraer RNA a partir de una muestra de tejido vegetal para obtener una solución de RNA, b) Obtener una solución enzimática de cDNA a partir del RNA extraído, poniendo en contacto el RNA con un oligonucleótido específico correspondiente al microorganismo de interés y con una enzima transcriptasa inversa con actividad polimerasa, en donde a partir del RNA del microorganismo se sintetiza y amplifica cDNA de doble cadena (dsDNA) cuando el RNA del microorganismo está presente en la solución enzimática, y  a) Extract RNA from a sample of plant tissue to obtain an RNA solution, b) Obtain an enzymatic solution of cDNA from the extracted RNA, contacting the RNA with a specific oligonucleotide corresponding to the microorganism of interest and with a Reverse transcriptase enzyme with polymerase activity, where double stranded cDNA (dsDNA) is synthesized and amplified from the microorganism's RNA when the organism's RNA is present in the enzymatic solution, and
c) Detectar la presencia del microorganismo mediante una reacción colorimétrica en la cual se pone en contacto la solución enzimática de cDNA con una solución colorimétrica que contiene al menos un colorante capaz de cambiar de color a simple vista cuando el cDNA del microorganismo fue amplificado en la etapa de tratamiento enzimático, donde el colorante presente en la solución colorimétrica se une al dsDNA generado del microorganismo y consecuentemente se observa desarrollo de color o cambio de color, indicando la presencia del microorganismo.  c) Detect the presence of the microorganism by a colorimetric reaction in which the cDNA enzyme solution is contacted with a colorimetric solution containing at least one dye capable of changing color to the naked eye when the microorganism cDNA was amplified in the Enzymatic treatment stage, where the dye present in the colorimetric solution binds to the dsDNA generated from the microorganism and consequently color development or color change is observed, indicating the presence of the microorganism.
El método de conformidad con la reivindicación 1 , caracterizado porque el microorganismo es un microorganismo patógeno.  The method according to claim 1, characterized in that the microorganism is a pathogenic microorganism.
El método de conformidad con la reivindicación 2, caracterizado porque el microorganismo patógeno es un virus.  The method according to claim 2, characterized in that the pathogenic microorganism is a virus.
El método de conformidad con la reivindicación 3, caracterizado porque el virus se selecciona del grupo que comprende Papaya leaf crumple virus (PaLCrV), Papaya leaf curl virus (PaLCuV), Papaya mosaic virus (PapMV), Papaya ringspot virus (PRSV), Tomato ringspot virus (ToRSV), Papaya meleira virus (PMeV), Tomato spotted wilt virus (TSWV), Papaya lethal yellowing virus (PLYV), Papaya leaf-distortion mosaic virus (PLDMV), Papaya droopy necrosis virus (PDNV), Papaya apical necrosis virus (PANV), Moroccan watermelon mosaic virus (MWMV), Crotón yellow vein mosaic virus (CYVMV), Tobacco ringspot virus (TobRV), Cucumber mosaic virus (CMV), Maize chlorotic mosaic virus (MCMV) y Sugarcane mosaic virus (SCMV).  The method according to claim 3, characterized in that the virus is selected from the group comprising Papaya leaf crumple virus (PaLCrV), Papaya leaf curl virus (PaLCuV), Papaya mosaic virus (PapMV), Papaya ringspot virus (PRSV), Tomato ringspot virus (ToRSV), Papaya meleira virus (PMeV), Tomato spotted wilt virus (TSWV), Papaya lethal yellowing virus (PLYV), Papaya leaf-distortion mosaic virus (PLDMV), Papaya droopy necrosis virus (PDNV), Papaya apical necrosis virus (PANV), Moroccan watermelon mosaic virus (MWMV), Croton yellow vein mosaic virus (CYVMV), Tobacco ringspot virus (TobRV), Cucumber mosaic virus (CMV), Maize chlorotic mosaic virus (MCMV) and Sugarcane mosaic virus (SCMV) .
El método de conformidad con la reivindicación 4, caracterizado porque el virus es Papaya mosaic virus (PapMV) o Papaya ringspot virus (PRSV).  The method according to claim 4, characterized in that the virus is Papaya mosaic virus (PapMV) or Papaya ringspot virus (PRSV).
El método de conformidad con la reivindicación 4, caracterizado porque el virus es Maize chlorotic mosaic virus (MCMV) o Sugarcane mosaic virus (SCMV).  The method according to claim 4, characterized in that the virus is Maize chlorotic mosaic virus (MCMV) or Sugarcane mosaic virus (SCMV).
El método de conformidad con la reivindicación 1 , caracterizado porque en la etapa a), la extracción de RNA se realiza macerando la muestra de tejido vegetal en presencia de una solución amortiguadora que comprende 20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01 % Igpal, 50% Glicerol v/v y 100 μΙ de KOH a una concentración de 0.2 M a 0.5 M, para finalmente dejar reposar la mezcla por 10 minutos. The method according to claim 1, characterized in that in step a), RNA extraction is performed by macerating the sample of plant tissue in the presence of a buffer solution comprising 20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01% Igpal, 50% Glycerol v / v and 100 μΙ KOH at a concentration of 0.2 M at 0.5 M, to finally let the mixture stand for 10 minutes.
8. El método de conformidad con la reivindicación 1 , caracterizado porque en la etapa b), la obtención de dsDNA se obtiene mezclando el extracto crudo de RNA obtenido en la etapa a) con una mezcla de reacción de amplificación que comprende 1 .5 μΙ de DTT 0.1 M, 2.5 μΙ de dNTP's 2 mM, 1 μΙ de cada uno de los oligonucleótidos específicos para el microorganismo de interés a una concentración 10 μΜ, 0.25 μΙ de albúmina sérica bovina (BSA) al 0.1 % y 200 U de la enzima M-MLV (Moloney Murine Leukemia Virus Reverse Transcriptase), para finalmente incubar 1 hora. 8. The method according to claim 1, characterized in that in step b), obtaining dsDNA is obtained by mixing the crude RNA extract obtained in step a) with an amplification reaction mixture comprising 1.5 µΙ DTT 0.1 M, 2.5 μΙ dNTP 's 2 mM, 1 μΙ of each of the oligonucleotides specific for the organism of interest at a concentration 10 μΜ, 0.25 μΙ bovine serum albumin (BSA) at 0.1% and 200 U the enzyme M-MLV (Moloney Murine Leukemia Virus Reverse Transcriptase), to finally incubate 1 hour.
9. El método de conformidad con la reivindicación 1 , caracterizado porque en la etapa c), la solución colorimétrica comprende un colorante seleccionado del grupo que comprende el colorante SYBR GREEN, y una mezcla del colorante Victoria Puré Blue Bo con el colorante 9. The method according to claim 1, characterized in that in step c), the colorimetric solution comprises a dye selected from the group comprising SYBR GREEN dye, and a mixture of Victoria Puré Blue Bo dye with the dye
Rojo Congo. Congo red.
10. El método de conformidad con la reivindicación 9, caracterizado porque el colorante es una mezcla del colorante Victoria Puré Blue Bo con el colorante Rojo Congo, la cual comprende: 10. The method according to claim 9, characterized in that the dye is a mixture of the Victoria Puré Blue Bo dye with the Congo Red dye, which comprises:
- Una solución del colorante Victoria Puré Blue Bo al 0.0096% p/v que comprende MgCI2 TE (Tris 1 mM pH 8, EDTA 0.1 mM) pH 6.0, y - A solution of the Victoria Puré Blue Bo dye at 0.0096% w / v comprising MgCI 2 TE (1 mM Tris pH 8, 0.1 mM EDTA) pH 6.0, and
- Una solución del colorante Rojo Congo al 0.03% p/v,  - A solution of the Congo Red dye at 0.03% w / v,
en una proporción v/v de 0.5:1 a 1 :0.5 de la solución del colorante Victoria Puré Blue Bo y de la solución del colorante Rojo Congo correspondientemente.  in a v / v ratio of 0.5: 1 to 1: 0.5 of the Victoria Puree Blue Bo dye solution and the Congo Red dye solution accordingly.
1 1. El método de conformidad con la reivindicación 10, caracterizado porque en la etapa c), la solución colorimétrica cambia de color verde a rojo cuando el virus PapMV se encuentra presente en la muestra de tejido vegetal.  The method according to claim 10, characterized in that in step c), the colorimetric solution changes from green to red when the PapMV virus is present in the plant tissue sample.
12. El método de conformidad con la reivindicación 10, caracterizado porque en la etapa c), la solución colorimétrica cambia de color verde a naranja cuando el virus PRSV se encuentra presente en la muestra de tejido vegetal.  12. The method according to claim 10, characterized in that in step c), the colorimetric solution changes from green to orange when the PRSV virus is present in the plant tissue sample.
13. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Cucumber mosaic virus (CMV), se seleccionan del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 5, SEQ.ID.No. 6, SEQ.ID.No. 7 y SEQ.ID.No. 8. 13. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Cucumber mosaic virus (CMV) are selected from the group comprising the oligonucleotides with SEQ.ID.No. 5, SEQ.ID.No. 6, SEQ.ID.No. 7 and SEQ.ID.No. 8.
14. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Crotón yellow vein mosaic virus (CYVMV), son los oligonucleótidos con la SEQ.ID.No. 9 y SEQ.ID.No. 10.  14. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Croton yellow vein mosaic virus (CYVMV) are the oligonucleotides with SEQ.ID.No. 9 and SEQ.ID.No. 10.
15. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Moroccan watermelon mosaic virus (MWMV), son los oligonucleótidos con la SEQ.ID.No. 13 y SEQ.ID.No. 14.  15. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Moroccan watermelon mosaic virus (MWMV) are the oligonucleotides with SEQ.ID.No. 13 and SEQ.ID.No. 14.
16. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Papaya leaf crumple virus (PaLCrV), se seleccionan del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 15, SEQ.ID.No. 16 y SEQ.ID.No. 17. 16. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Papaya leaf crumple virus (PaLCrV) are selected from the group comprising the oligonucleotides with SEQ.ID.No . 15, SEQ.ID.No. 16 and SEQ.ID.No. 17.
17. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Papaya leaf curl virus (PaLCuV), se seleccionan del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 18, SEQ.ID.No. 19, SEQ.ID.No. 20 y SEQ.ID.No. 21 . 17. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Papaya leaf curl virus (PaLCuV) are selected from the group comprising the oligonucleotides with SEQ.ID.No . 18, SEQ.ID.No. 19, SEQ.ID.No. 20 and SEQ.ID.No. twenty-one .
18. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Papaya mosaic virus (PapMV), se seleccionan del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 1 , SEQ.ID.No. 2, SEQ.ID.No. 22 y SEQ.ID.No. 23. 18. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Papaya mosaic virus (PapMV) are selected from the group comprising the oligonucleotides with SEQ.ID.No. 1, SEQ.ID.No. 2, SEQ.ID.No. 22 and SEQ.ID.No. 2. 3.
19. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Papaya leaf-distortion mosaic virus (PLDMV), se seleccionan del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 24, SEQ.ID.No. 25, SEQ.ID.No. 26 y SEQ.ID.No. 27.  19. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Papaya leaf-distortion mosaic virus (PLDMV) are selected from the group comprising the oligonucleotides with SEQ.ID .Do not. 24, SEQ.ID.No. 25, SEQ.ID.No. 26 and SEQ.ID.No. 27.
20. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Papaya lethal yellowing virus (PLYV), son los oligonucleótidos con la SEQ.ID.No. 28 y SEQ.ID.No. 29.  20. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Papaya lethal yellowing virus (PLYV) are the oligonucleotides with SEQ.ID.No. 28 and SEQ.ID.No. 29.
21. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Papaya meleira virus (PMeV), son los oligonucleótidos con la SEQ.ID.No. 30 y SEQ.ID.No. 31 .  21. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Papaya meleira virus (PMeV) are the oligonucleotides with SEQ.ID.No. 30 and SEQ.ID.No. 31.
22. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Papaya ringspot virus 22. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Papaya ringspot virus
(PRSV), se seleccionan del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 2, SEQ.ID.No. 3, SEQ.ID.No. 32 y SEQ.ID.No. 33. (PRSV), are selected from the group comprising the oligonucleotides with SEQ.ID.No. 2, SEQ.ID.No. 3, SEQ.ID.No. 32 and SEQ.ID.No. 33.
23. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Tomato ringspot virus (ToRSV), son los oligonucleótidos con la SEQ.ID.No. 34 y SEQ.ID.No. 35.  23. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Tomato ringspot virus (ToRSV) are the oligonucleotides with SEQ.ID.No. 34 and SEQ.ID.No. 35
24. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Tomato spotted wilt virus (TSWV), son los oligonucleótidos con la SEQ.ID.No. 36 y SEQ.ID.No. 37.  24. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Tomato spotted wilt virus (TSWV), are the oligonucleotides with SEQ.ID.No. 36 and SEQ.ID.No. 37.
25. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Sugarcane mosaic virus 25. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double stranded cDNA (dsDNA) of the Sugarcane mosaic virus
(SCMV), son los oligonucleótidos con la SEQ.ID.No. 38 y SEQ.ID.No. 39. (SCMV), are the oligonucleotides with SEQ.ID.No. 38 and SEQ.ID.No. 39.
26. El método de conformidad con la reivindicación 4, caracterizado porque los oligonucleótidos específicos para amplificar cDNA de doble cadena (dsDNA) del virus Maize chiorotic mosaic virus (MCMV), son los oligonucleótidos con la SEQ.ID.No. 40 y SEQ.ID.No. 41.  26. The method according to claim 4, characterized in that the specific oligonucleotides for amplifying double-stranded cDNA (dsDNA) of the Maize chiorotic mosaic virus (MCMV) are the oligonucleotides with SEQ.ID.No. 40 and SEQ.ID.No. 41.
27. El método de conformidad con la reivindicaciones 5, 1 1 a 22 y 24, caracterizado porque el tejido vegetal es de la planta de papaya. 27. The method according to claims 5, 1 1 to 22 and 24, characterized in that the plant tissue is from the papaya plant.
28. El método de conformidad con la reivindicaciones 25 y 26, caracterizado porque el tejido vegetal es de la planta de maíz. 28. The method according to claims 25 and 26, characterized in that the plant tissue is from the corn plant.
29. El método de conformidad con la reivindicaciones 1 a 28, caracterizado porque el tejido vegetal es foliar. 29. The method according to claims 1 to 28, characterized in that the plant tissue is foliar.
30. Un kit para detectar a temperatura ambiente la presencia de un microorganismo de interés en células vegetales mediante el método de la reivindicación 1 a 29, caracterizado porque comprende:  30. A kit for detecting, at room temperature, the presence of a microorganism of interest in plant cells by the method of claim 1 to 29, characterized in that it comprises:
a) Un primer recipiente para extraer RNA, adaptado para recibir una muestra de tejido vegetal que contiene una solución de extracción de RNA y que permite su mezclado con dicha solución de extracción para obtener una solución de RNA, y  a) A first container for extracting RNA, adapted to receive a sample of plant tissue that contains an RNA extraction solution and which allows mixing with said extraction solution to obtain an RNA solution, and
b) Un segundo recipiente para amplificar cDNA de doble cadena (dsDNA) a partir de RNA y detectar su presencia, adaptado para recibir una muestra de extracción de RNA, y que contiene una solución enzimática que comprende:  b) A second vessel for amplifying double-stranded cDNA (dsDNA) from RNA and detecting its presence, adapted to receive an RNA extraction sample, and containing an enzymatic solution comprising:
- Oligonucleótidos específicos correspondientes al microorganismo de interés a detectar, - Specific oligonucleotides corresponding to the microorganism of interest to be detected,
- Una enzima transcriptasa inversa con actividad polimerasa, - A reverse transcriptase enzyme with polymerase activity,
- Nucleótidos libres en cantidades suficientes para permitir la amplificación del cDNA de cada microorganismo de interés al entrar en contacto con la solución de RNA, y  - Free nucleotides in sufficient quantities to allow amplification of the cDNA of each microorganism of interest upon contact with the RNA solution, and
- Una solución colorimétrica que contiene al menos un colorante capaz de cambiar de color a simple vista cuando el cDNA del microorganismo fue amplificado en la etapa de tratamiento enzimático, donde el colorante presente en la solución colorimétrica se une al dsDNA generado del microorganismo y consecuentemente se observa desarrollo de color o cambio de color, indicando la presencia del microorganismo.  - A colorimetric solution containing at least one dye capable of changing color to the naked eye when the microorganism cDNA was amplified at the stage of enzymatic treatment, where the dye present in the colorimetric solution binds to the generated dsDNA of the microorganism and consequently Observe color development or color change, indicating the presence of the microorganism.
31. Un kit para detectar a temperatura ambiente la presencia de un microorganismo de interés en células vegetales mediante el método de la reivindicación 1 a 29, caracterizado porque comprende:  31. A kit for detecting, at room temperature, the presence of a microorganism of interest in plant cells by the method of claim 1 to 29, characterized in that it comprises:
a) Un primer recipiente para extraer RNA, adaptado para recibir una muestra de tejido vegetal que contiene una solución de extracción de RNA y que permite su mezclado con dicha solución de extracción para obtener una solución de RNA,  a) A first container for extracting RNA, adapted to receive a sample of plant tissue that contains an RNA extraction solution and which allows mixing with said extraction solution to obtain an RNA solution,
b) Un segundo recipiente para amplificar cDNA de doble cadena (dsDNA) a partir de RNA, adaptado para recibir una muestra de extracción de RNA, y que contiene una solución enzimática que comprende:  b) A second vessel for amplifying double stranded cDNA (dsDNA) from RNA, adapted to receive an RNA extraction sample, and containing an enzymatic solution comprising:
- Oligonucleótidos específicos correspondientes al microorganismo de interés a detectar, - Specific oligonucleotides corresponding to the microorganism of interest to be detected,
- Una enzima transcriptasa inversa con actividad polimerasa, y - A reverse transcriptase enzyme with polymerase activity, and
- Nucleótidos libres en cantidades suficientes para permitir la amplificación del cDNA de cada microorganismo de interés al entrar en contacto con la solución de RNA, y c) Un tercer recipiente para detectar la presencia de dsDNA amplificado, adaptado para recibir una muestra de la amplificación de cDNA de doble cadena (dsDNA) a partir de - Free nucleotides in sufficient quantities to allow the amplification of the cDNA of each microorganism of interest upon contact with the RNA solution, and c) A third vessel to detect the presence of amplified dsDNA, adapted to receive a sample of the cDNA amplification double chain (dsDNA) from
RNA, que contiene una solución colorimétrica que contiene al menos un colorante capaz de cambiar de color a simple vista cuando el cDNA del microorganismo fue amplificado en la etapa de tratamiento enzimático, donde el colorante presente en la solución colorimétrica se une al dsDNA generado del microorganismo y consecuentemente se observa desarrollo de color o cambio de color, indicando la presencia del microorganismo.RNA, which contains a colorimetric solution that contains at least one dye capable of changing color to the naked eye when the microorganism cDNA was amplified at the stage of enzymatic treatment, where the dye present in the solution Colorimetric binds to the generated dsDNA of the microorganism and consequently color development or color change is observed, indicating the presence of the microorganism.
32. El kit de la reivindicación 30 y 31 , caracterizado porque la solución de extracción de RNA es una solución amortiguadora que comprende 20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01 % Igpal, 50% Glicerol v/v y 100 μΙ de KOH a una concentración de 0.232. The kit of claim 30 and 31, characterized in that the RNA extraction solution is a buffer solution comprising 20 mM Tris HCI pH 7.5, 100 mM NaCI, 0.1 mM EDTA, 1 mM DTT, 0.01% Igpal, 50% Glycerol v / v and 100 μΙ of KOH at a concentration of 0.2
M a 0.5 M. M to 0.5 M.
33. El kit de la reivindicación 30 y 31 , caracterizado porque la solución enzimática comprende 1 .5 μΙ de DTT 0.1 M, 2.5 μΙ de dNTP's 2 mM, 1 μΙ de cada uno de los oligonucleótidos específicos para el microorganismo de interés a una concentración 10 μΜ, 0.25 μΙ de albúmina sérica bovina (BSA) al 0.1 % y 200 U de la enzima M-MLV (Moloney Murine Leukemia Virus Reverse33. The kit of claim 30 and 31, wherein the enzyme solution contains 1 μΙ 0.5 M DTT 0.1, 2.5 μΙ dNTP 's 2 mM, 1 μΙ of each of the oligonucleotides specific for the microorganism of interest to a concentration of 10 μΜ, 0.25 μΙ of 0.1% bovine serum albumin (BSA) and 200 U of the enzyme M-MLV (Moloney Murine Leukemia Virus Reverse
Transcriptase). Transcribe)
34. El kit de la reivindicación 30 y 31 , caracterizado porque la solución colorimétrica comprende un colorante seleccionado del grupo que comprende el colorante SYBR GREEN, y una mezcla del colorante Victoria Puré Blue Bo con el colorante Rojo Congo.  34. The kit of claim 30 and 31, characterized in that the colorimetric solution comprises a dye selected from the group comprising SYBR GREEN dye, and a mixture of Victoria Puré Blue Bo dye with Congo Red dye.
35. El kit de la reivindicación 34, caracterizado porque el colorante es una mezcla del colorante Victoria Puré Blue Bo con el colorante Rojo Congo, la cual comprende: 35. The kit of claim 34, characterized in that the dye is a mixture of the Victoria Puré Blue Bo dye with the Congo Red dye, which comprises:
- Una solución del colorante Victoria Puré Blue Bo al 0.0096% p/v que comprende MgCI2 TE (Tris 1 mM pH 8, EDTA 0.1 mM) pH 6.0, y - A solution of the Victoria Puré Blue Bo dye at 0.0096% w / v comprising MgCI 2 TE (1 mM Tris pH 8, 0.1 mM EDTA) pH 6.0, and
- Una solución del colorante Rojo Congo al 0.03% p/v,  - A solution of the Congo Red dye at 0.03% w / v,
en una proporción v/v de 0.5:1 a 1 :0.5 de la solución del colorante Victoria Puré Blue Bo y de la solución del colorante Rojo Congo correspondientemente.  in a v / v ratio of 0.5: 1 to 1: 0.5 of the Victoria Puree Blue Bo dye solution and the Congo Red dye solution accordingly.
36. Un oligonucleótido útil para detectar la presencia de un virus patógeno en un tejido vegetal de papaya mediante el método de la reivindicación 1 , caracterizado porque se selecciona del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 5, SEQ.ID.No. 6, SEQ.ID.No. 7 y SEQ.ID.No. 8 para el Cucumber mosaic virus (CMV), los oligonucleótidos con la SEQ.ID.No. 9 y SEQ.ID.No. 10 para el Crotón yellow vein mosaic virus (CYVMV), los oligonucleótidos con la SEQ.ID.No. 13 y SEQ.ID.No. 14 para el Moroccan watermelon mosaic virus (MWMV), los oligonucleótidos con la SEQ.ID.No. 15, SEQ.ID.No. 16 y SEQ.ID.No. 17 para el Papaya leaf crumple virus (PaLCrV), los oligonucleótidos con la SEQ.ID.No. 18, SEQ.ID.No. 19, SEQ.ID.No. 20 y SEQ.ID.No. 21 para el Papaya leaf curl virus (PaLCuV), los oligonucleótidos con la36. An oligonucleotide useful for detecting the presence of a pathogenic virus in a papaya plant tissue by the method of claim 1, characterized in that it is selected from the group comprising the oligonucleotides with SEQ.ID.No. 5, SEQ.ID.No. 6, SEQ.ID.No. 7 and SEQ.ID.No. 8 for the Cucumber mosaic virus (CMV), oligonucleotides with SEQ.ID.No. 9 and SEQ.ID.No. 10 for the Croton yellow vein mosaic virus (CYVMV), oligonucleotides with SEQ.ID.No. 13 and SEQ.ID.No. 14 for the Moroccan watermelon mosaic virus (MWMV), oligonucleotides with SEQ.ID.No. 15, SEQ.ID.No. 16 and SEQ.ID.No. 17 for Papaya leaf crumple virus (PaLCrV), oligonucleotides with SEQ.ID.No. 18, SEQ.ID.No. 19, SEQ.ID.No. 20 and SEQ.ID.No. 21 for the Papaya leaf curl virus (PaLCuV), the oligonucleotides with the
SEQ.ID.No. 1 , SEQ.ID.No. 2, SEQ.ID.No. 22 y SEQ.ID.No. 23 para el Papaya mosaic virus (PapMV), los oligonucleótidos con la SEQ.ID.No. 24, SEQ.ID.No. 25, SEQ.ID.No. 26 y SEQ.ID.No. 27 para el Papaya leaf-distortion mosaic virus (PLDMV), los oligonucleótidos con la SEQ.ID.No. 28 y SEQ.ID.No. 29 para el Papaya lethal yellowing virus (PLYV), los oligonucleótidos con la SEQ.ID.No. 30 y SEQ.ID.No. 31 para el Papaya meleira virus (PMeV), los oligonucleótidos con la SEQ.ID.No. 2, SEQ.ID.No. 3, SEQ.ID.No. 32 y SEQ.ID.No. 33 para el Papaya ringspot virus (PRSV), y los oligonucleótidos con la SEQ.ID.No. 36 y SEQ.ID.No. 37 para el Tomato spotted wilt virus (TSWV). SEQ.ID.No. 1, SEQ.ID.No. 2, SEQ.ID.No. 22 and SEQ.ID.No. 23 for the Papaya mosaic virus (PapMV), oligonucleotides with SEQ.ID.No. 24, SEQ.ID.No. 25, SEQ.ID.No. 26 and SEQ.ID.No. 27 for Papaya leaf-distortion mosaic virus (PLDMV), oligonucleotides with SEQ.ID.No. 28 and SEQ.ID.No. 29 for Papaya lethal yellowing virus (PLYV), oligonucleotides with SEQ.ID.No. 30 and SEQ.ID.No. 31 for Papaya meleira virus (PMeV), oligonucleotides with SEQ.ID.No. 2, SEQ.ID.No. 3, SEQ.ID.No. 32 and SEQ.ID.No. 33 for Papaya ringspot virus (PRSV), and oligonucleotides with SEQ.ID.No. 36 and SEQ.ID.No. 37 for Tomato spotted wilt virus (TSWV).
37. Un oligonucleótido útil para detectar la presencia de un virus patógeno en un tejido vegetal de tomate mediante el método de la reivindicación 1 , caracterizado porque se selecciona del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 34 y SEQ.ID.No. 35 para el Tomato ringspot virus (ToRSV), y los oligonucleótidos con la SEQ.ID.No. 36 y SEQ.ID.No. 37 para el Tomato spotted wilt virus (TSWV). 37. An oligonucleotide useful for detecting the presence of a pathogenic virus in a tomato plant tissue by the method of claim 1, characterized in that it is selected from the group comprising the oligonucleotides with SEQ.ID.No. 34 and SEQ.ID.No. 35 for Tomato ringspot virus (ToRSV), and oligonucleotides with SEQ.ID.No. 36 and SEQ.ID.No. 37 for Tomato spotted wilt virus (TSWV).
38. Un oligonucleótido útil para detectar la presencia de un virus patógeno en un tejido vegetal de maíz mediante el método de la reivindicación 1 , caracterizado porque se selecciona del grupo que comprende los oligonucleótidos con la SEQ.ID.No. 38 y SEQ.ID.No. 39 para Sugarcane mosaic virus (SCMV), y los oligonucleótidos con la SEQ.ID.No. 40 y SEQ.ID.No. 41 para el Maize chlorotic mosaic virus (MCMV).  38. An oligonucleotide useful for detecting the presence of a pathogenic virus in a corn plant tissue by the method of claim 1, characterized in that it is selected from the group comprising the oligonucleotides with SEQ.ID.No. 38 and SEQ.ID.No. 39 for Sugarcane mosaic virus (SCMV), and oligonucleotides with SEQ.ID.No. 40 and SEQ.ID.No. 41 for the Maize chlorotic mosaic virus (MCMV).
PCT/IB2016/057313 2016-12-02 2016-12-02 Method and diagnostic kit for detecting phytopathogenic viruses WO2018100420A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/IB2016/057313 WO2018100420A1 (en) 2016-12-02 2016-12-02 Method and diagnostic kit for detecting phytopathogenic viruses

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2016/057313 WO2018100420A1 (en) 2016-12-02 2016-12-02 Method and diagnostic kit for detecting phytopathogenic viruses

Publications (1)

Publication Number Publication Date
WO2018100420A1 true WO2018100420A1 (en) 2018-06-07

Family

ID=62242423

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2016/057313 WO2018100420A1 (en) 2016-12-02 2016-12-02 Method and diagnostic kit for detecting phytopathogenic viruses

Country Status (1)

Country Link
WO (1) WO2018100420A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110117677A (en) * 2019-06-05 2019-08-13 三明市农业科学研究院 A kind of PCR primer combination and detection method of passion fruit cucumber mosaic virus
WO2020047949A1 (en) * 2018-09-03 2020-03-12 河南省农业科学院植物保护研究所 Method for predicting symptom appearance rate and severity of sweet potato viral disease in nursery stage
CN110951923A (en) * 2020-01-02 2020-04-03 云南省农业科学院甘蔗研究所 Multiplex PCR method for simultaneously detecting four sugarcane seed-borne viruses, primers and kit thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101875982A (en) * 2010-07-21 2010-11-03 陕西省烟草研究所 Method for synchronously detecting multiple tobacco viruses
CN102559926A (en) * 2011-12-01 2012-07-11 山东省花生研究所 Method for detecting peanut stripe virus and cucumber mosaic virus by using double reverse transcription-polymerase chain reaction (RT-PCR)
CN102703605A (en) * 2012-05-17 2012-10-03 中国热带农业科学院环境与植物保护研究所 Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit
MX2012000081A (en) * 2011-12-16 2013-06-18 Ct De Investigacion Cientifica De Yucatan A C Partial sequence and diagnostic method by rt-pcr of the papaya meleira virus.
CN105779652A (en) * 2016-04-14 2016-07-20 新疆农业大学 Multiple RT-PCR method for fast detecting four kinds of pepper viruses

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101875982A (en) * 2010-07-21 2010-11-03 陕西省烟草研究所 Method for synchronously detecting multiple tobacco viruses
CN102559926A (en) * 2011-12-01 2012-07-11 山东省花生研究所 Method for detecting peanut stripe virus and cucumber mosaic virus by using double reverse transcription-polymerase chain reaction (RT-PCR)
MX2012000081A (en) * 2011-12-16 2013-06-18 Ct De Investigacion Cientifica De Yucatan A C Partial sequence and diagnostic method by rt-pcr of the papaya meleira virus.
CN102703605A (en) * 2012-05-17 2012-10-03 中国热带农业科学院环境与植物保护研究所 Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit
CN105779652A (en) * 2016-04-14 2016-07-20 新疆农业大学 Multiple RT-PCR method for fast detecting four kinds of pepper viruses

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020047949A1 (en) * 2018-09-03 2020-03-12 河南省农业科学院植物保护研究所 Method for predicting symptom appearance rate and severity of sweet potato viral disease in nursery stage
CN110117677A (en) * 2019-06-05 2019-08-13 三明市农业科学研究院 A kind of PCR primer combination and detection method of passion fruit cucumber mosaic virus
CN110951923A (en) * 2020-01-02 2020-04-03 云南省农业科学院甘蔗研究所 Multiplex PCR method for simultaneously detecting four sugarcane seed-borne viruses, primers and kit thereof

Similar Documents

Publication Publication Date Title
US10907222B2 (en) Primers for detecting influenza by using lamp, and use thereof
CN109055502B (en) Detection method, detection kit and application of invasive fungal infection
ES2664335T3 (en) Method to detect Helicobacter pylori DNA in a stool sample
JP6286419B2 (en) Primer and probe sets used for genetic polymorphism discrimination and their use
Chi et al. Evaluation of recombinase polymerase amplification assay for detecting Meloidogyne javanica
ES2854049T3 (en) Compositions and procedures for the detection of Mycoplasma genitalium
KR20230033920A (en) Rapid-molecular diagnostic method using venom gland-specific gene of Red imported fire ant, Solenopsis invicta 11977
WO2018100420A1 (en) Method and diagnostic kit for detecting phytopathogenic viruses
Zhao et al. Rapid detection of tobacco viruses by reverse transcription loop-mediated isothermal amplification
ES2301170T3 (en) EXTRACTION, AMPLIFICATION AND SEQUENTIAL HYBRIDIZATION OF MICOTIC DNA and METHODS TO DETECT MICOTIC CELLS IN CLINICAL MATERIAL.
KR101892085B1 (en) Primers for loop-mediated isothermal amplification to detect Nilaparvata lugens and detection method for Nilaparvata lugens by using the same
CN108779500A (en) Composition for detecting zika virus and method
CN108796127A (en) A kind of kit and its detection method of specific detection lily mottle virus
CN103952497B (en) A kind of hepatitis B virus detecting method based on DNAzyme probes
Buddhachat et al. One-step colorimetric LAMP (cLAMP) assay for visual detection of Xanthomonas oryzae pv. oryzae in rice
Huang et al. Rapid, sensitive, and visual detection of Clonorchis sinensis with an RPA-CRISPR/Cas12a-based dual readout portable platform
KR20190041237A (en) Oligonucleotide set for detection of dengue virus and uses thereof
CN105218536B (en) Label-free fluorescent probe and application thereof in detecting diploid G-quadruplex structure
CN104946760B (en) A kind of method and dedicated kit for detecting Pythium inflatum
ES2652500T3 (en) Procedure for diagnosis or prognosis, in vitro, of ovarian cancer
KR20220117235A (en) Sequential detection method for nucleic acids
ES2784654T3 (en) Compositions and procedures for the detection of drug-resistant Mycobacterium tuberculosis
CN107815490A (en) A kind of tobacco root-knot pathogeny detecting reagent box and its application method based on loop-mediated isothermal amplification technique
Wang et al. Development of a loop-mediated isothermal amplification for rapid diagnosis of Aphelenchoides ritzemabosi
CN107641664B (en) Primer group for detecting fish nervous necrosis virus and application thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16922888

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16922888

Country of ref document: EP

Kind code of ref document: A1