KR101892085B1 - Primers for loop-mediated isothermal amplification to detect Nilaparvata lugens and detection method for Nilaparvata lugens by using the same - Google Patents

Abstract

The present invention relates to a loop-mediated isothermal amplification primer set for detection of Nilaparvata lugens and a detection method for Nilaparvata lugens using same. The primer set of the present invention can detect Nilaparvata lugens specifically and more rapidly than a PCR method, and can quickly grasp Nilaparvata lugens by a fluorescence reaction without electrophoresis, thereby being used for determining the pest control time. The primer set comprises: (a) a primer combination comprising a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 2, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4; (b) a primer combination comprising a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 5, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4; and (c) a primer combination comprising a primer having the nucleotide sequence of SEQ ID NO: 6, a primer having the nucleotide sequence of SEQ ID NO: 7, a primer having the nucleotide sequence of SEQ ID NO: 8, and a primer having the nucleotide sequence of SEQ ID NO: 9.

Description

[0001] The present invention relates to primer sets for ring-mediated isothermal amplification for detecting brown planthopper, and a method for detecting Nilaparvata lugens using the same.

The present invention relates to a primer set for ring-mediated isothermal amplification for detecting a brownfly, and a method for detecting a brownfly using the same.

Rice ( Oryza sativa L.) is one of the most important crops in the world and is cultivated in more than 100 countries in tropical and subtropical regions of almost all of Asia, South and Central America and Central and Eastern Africa. World annual rice production amounts to 650 million tons, more than 90% of which is produced in Asian countries. Therefore, stable rice production in Asia is important as the world population continues to grow. Accordingly, the pests occurring in the above crops can be connected to a large scale of death, which causes a decrease in income due to a drastic decrease in yield in the cultivation farmers, while causing a sudden rise in the supply price due to imbalance in demand and supply. .

The major pest insect pests in Korea are Nilaparvata lugens , Sogatella furcifera and Laodelphax striatellus , which are infected directly by feeding juice to rice and infected with viral diseases. Because these rice plants can not survive in Korea and travel every year through long-distance flies, they are regularly observed in rice paddy fields through infant, air bombardment, and visual inspection methods. The timing of the control is determined. The level of urinary control in rice seedlings of rice plants ranged from 20 to 100 per day (whitefly) and 20 to 100 per day (late summer) in late July to early August. And 400 (white lanterns) are different for every pest, season. However, in the outdoor pavement, these young nymphs are difficult to distinguish morphologically by the naked eye. In addition, even in the case of the young bull larvae collected from infant and other public worms, It is not easy to do. Therefore, it is necessary to accurately identify and identify the brown planthoppers, white lanterns, lycopods and other planthoppers in an auxiliary method other than the form in order to collect data accurately and to establish an effective control strategy.

1. Publication No. 10-2015-0026633 (published on April 11, 2015) 2. China registered patent CN102168150B (registered on April 10, 2013) 3. China registered patent CN102168151B (registered on March 1, 2013)

The present invention provides a primer set for ring-mediated isothermal amplification for detecting a brownfly, and a method for detecting the brownfly using the same.

(A) a primer having a nucleotide sequence of SEQ ID NO: 1, a primer having a nucleotide sequence of SEQ ID NO: 2, a primer having a nucleotide sequence of SEQ ID NO: 3, and a nucleotide sequence of SEQ ID NO: ≪ RTI ID = 0.0 > a < / RTI > (b) a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 5, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4; And (c) a primer having the nucleotide sequence of SEQ ID NO: 6, a primer having the nucleotide sequence of SEQ ID NO: 7, a primer having the nucleotide sequence of SEQ ID NO: 8, and a primer having the nucleotide sequence of SEQ ID NO: ( Nilaparvata lugens ) detection primer set comprising at least one primer combination selected from SEQ ID NOs .

According to one aspect of the present invention, there is provided a composition for detecting Nilaparvata lugens comprising the aforementioned set of primers for ring-mediated isothermal amplification.

According to one aspect of the present invention, there is provided a kit for detecting Nilaparvata lugens comprising the aforementioned set of primers for ring-mediated isothermal amplification.

According to one aspect of the present invention, there is provided a method for detecting Nilaparvata lugens DNA comprising amplifying a specific region in DNA of a brownfly using the above-mentioned set of primers for ring-mediated isothermal amplification.

(A) a primer having a nucleotide sequence of SEQ ID NO: 1; a primer having a nucleotide sequence of SEQ ID NO: 2; a nucleotide sequence of SEQ ID NO: 3 And a primer having the nucleotide sequence of SEQ ID NO: 4; (b) a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 5, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4; And (c) a primer having the nucleotide sequence of SEQ ID NO: 6, a primer having the nucleotide sequence of SEQ ID NO: 7, a primer having the nucleotide sequence of SEQ ID NO: 8, and a primer having the nucleotide sequence of SEQ ID NO: And performing a ring-mediated isothermal amplification method using a primer set comprising at least one primer combination selected from the group consisting of SEQ ID NO : 1 and SEQ ID NO : 2.

The primer set of the present invention can detect the Nilaparvata lugens more rapidly than the PCR method, and can quickly grasp the fluorescence reaction without electrophoresis and utilize it for determination of the control time.

Figure 1 is a molecular schematic of the Nilaparvata lugens inferred from the ITS2 DNA sequence.
Fig. 2 shows the amplification effect of isothermal amplification reaction of the primer set of the present invention. C: Primer set a, 38-1: Primer set b, 207: Primer set c, 38-c: Negative control of primer set a, 38-1-c: Negative control of primer set b, 207-c: Set c negative control, PC positive control)
3 shows the result of confirming the specificity of the primer set of the present invention in the isothermal amplification reaction (BPH: Brownfly, SBPH: Leucocephaly, WBPH: White lily)
Fig. 4 shows the result of isothermal amplification reaction of the primer set c of the present invention according to the DNA amount of the butterfly mold.
Fig. 5 shows the result of detection and confirmation using the fluorescent reagent of the primer set c of the present invention.

In order to achieve the above-mentioned object, the present invention provides a set of primers for ring-mediated isothermal amplification for detecting Nilaparvata lugens . BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the drawings.

BPH (Nilaparvata lugens) detecting ring-mediated isothermal amplification primer set of the present invention is (a) having the nucleotide sequence of SEQ ID NO: 1 primer, a primer having the nucleotide sequence of SEQ ID NO: 2, a primer having the nucleotide sequence of SEQ ID NO: 3 And a primer having a nucleotide sequence of SEQ ID NO: 4; (b) a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 5, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4; And (c) a primer having the nucleotide sequence of SEQ ID NO: 6, a primer having the nucleotide sequence of SEQ ID NO: 7, a primer having the nucleotide sequence of SEQ ID NO: 8, and a primer having the nucleotide sequence of SEQ ID NO: ≪ / RTI >

The Nilaparvata lugens of the present invention is an insect species of the family Anthracnidae and is distributed in Korea, China, Japan, India, Asia and Australia, and inhabits in rice. In Korea, Southwest winds occur mainly in June and July, causing damage to southwestern coastal areas due to the presence of brown planthoppers in southern China. The rice grassy stunt virus (RGSV) and the rice ragged stunt virus (RRSV), which infect the juice of the lower part of the rice straw, Infectious. In Korea, only concentrated damage has been reported so far. In Southeast Asia such as Vietnam, however, damage to the virus has been severe along with the damage to the central examination. The disease caused by the virus can be seriously harmed because of disease and disease caused by the bryophytes.

The RGSV virus is a marsupial plant virus in tenuivirus, the length of which is 950 to 1350 nm. The genome of the virus is a linear ssRNA, the entire genome size is 15.46 kb, and the genome is divided into four parts. The host range is the paddy field crop, which is transmitted by fungus.

RRSV is a spherical plant virus in oryzavirus with a particle diameter of about 65 nm. The genome of the virus consists of 10 segmented genomes of dsRNA, and the total genome size is 26.66 kb. The host range is the paddy crop, which is transmitted by persistent viruses.

The "yellow syndrome", a viral disease caused by the combined infection of rice viruses including RGSV and RRSV, is mediated by the brown planthopper, the main symptom is the yellow mosaic and atrophic symptoms, do. When the insect pests of rice hogs are infested with rice, the growth inhibition, sulphation and damage caused within 20 days are known to be serious diseases, and they are becoming the biggest problem in the Mekong Delta region of Vietnam. It is also known that the symptoms of rice yellow syndrome continue to spread to Southeast Asia such as Vietnam and Cambodia.

As used herein, the term " primer " refers to a nucleic acid sequence having a short free 3 'hydroxyl group, which can form a base pair with a complementary template and is a starting point for template strand copying Short nucleic acid sequence " Primers can initiate DNA synthesis in the presence of reagents (DNA polymerase or reverse transcriptase) for polymerisation and four different dNTPs (deoxynucleoside triphosphate) at appropriate buffer solutions and temperatures. Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

In the present invention, an oligonucleotide used as a primer may comprise a nucleotide analogue such as phosphorothioate, alkylphosphorothioate or peptide nucleic acid, And may include an intercalating agent.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

In addition, the primer nucleic acid sequences of the present invention may, if necessary, comprise markers detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of labels include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules, chemical groups (e.g., biotin), etc. .

As used herein, the term "a pair of primers" refers to a base sequence for amplifying a gene to be diagnosed using a ring-mediated isothermal amplification method, in which a forward primer and a reverse primer are set To synthesize the product.

As used herein, the term " detection " means distinguishing the Nilaparvata lugens from the sample.

Primer combinations of the above-described present invention can be specifically bound to BPH (Nilaparvata lugens) to detect BPH (Nilaparvata lugens). Preferably the combination of the primers of the present invention does not bind to other insectivorous insects such as Leucopoda and White beetle, so that only Nilaparvata lugens can be specifically detected.

The primer set of the present invention composed of four primer combinations can be used only in a loop-mediated isothermal amplification (LAMP) reaction method capable of amplifying DNA. Only two of the four primers (F3-forward outer primer, B3-backward outer primer) forming each primer set can be used for general PCR.

The primer set of the present invention is a primer set prepared by analyzing the ITS2 region of Nilaparvata lugens . Using the above primer set, it was confirmed that only Nilaparvata lugens could be specifically detected in various insecticidal insects. In the case of confirming the electrophoresis, 360 ng template DNA, SYBR Green I fluorescence reaction, The presence of Nilaparvata lugens could be detected, and only high specificity Nilaparvata lugens could be diagnosed quickly and accurately.

In the present invention, the ring-mediated isothermal amplification is advantageous in that it can denature, bond and stretch at a constant temperature unlike the conventional PCR, which requires a change in temperature in three stages of denaturation, annealing and extension. . In ring-mediated isothermal amplification, especially Bst. DNA polymerase is used, and this Bst . The DNA polymerase can be obtained from Taq . Unlike the DNA polymerase, it has the characteristic of helicase, so that the double helix structure of the DNA can be modified, joined and stretched at a junction temperature close to the Tm value without being subjected to heat denaturation.

According to one aspect of the present invention, there is provided a composition for detecting Nilaparvata lugens comprising the aforementioned set of primers for ring-mediated isothermal amplification.

According to one aspect of the present invention, there is provided a kit for detecting Nilaparvata lugens comprising the aforementioned set of primers for ring-mediated isothermal amplification.

The kit for detecting Nilaparvata lugens of the present invention may include a kit component for detecting Nilaparvata lugens and a conventional component contained in the kit for detection. Typical components included in the detection kit may be reaction buffer, Bst DNA polymerase, dNTP, MgCl ₂ , and the like.

According to one aspect of the present invention, there is provided a method for detecting Nilaparvata lugens DNA comprising amplifying a specific region in DNA of a brownfly using the above-mentioned set of primers for ring-mediated isothermal amplification.

(A) a primer having a nucleotide sequence of SEQ ID NO: 1; a primer having a nucleotide sequence of SEQ ID NO: 2; a nucleotide sequence of SEQ ID NO: 3 And a primer having the nucleotide sequence of SEQ ID NO: 4; (b) a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 5, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4; And (c) a primer having the nucleotide sequence of SEQ ID NO: 6, a primer having the nucleotide sequence of SEQ ID NO: 7, a primer having the nucleotide sequence of SEQ ID NO: 8, and a primer having the nucleotide sequence of SEQ ID NO: And performing a ring-mediated isothermal amplification method using a primer set comprising at least one primer combination selected from the group consisting of SEQ ID NO : 1 and SEQ ID NO : 2.

The first step of the Nilaparvata lugens detection method of the present invention is a step of isolating DNA from a sample. At this time, a method known in the art can be used as a method of isolating DNA, but not limited thereto. The sample may be a Nilaparvata lugens itself or a suspected individual as a brown planthopper , and may be an enemy predating the brown planthopper .

Next, a step of performing amplification of the target sequence by performing the isothermal amplification reaction using the DNA isolated from the above as a template and using the primer set of the present invention described above is performed. The isothermal amplification reaction is preferably performed at 50 to 70 ° C. The amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, Cy-5 or Cy-3 is labeled at the 5'-end of the primer and the target sequence can be labeled with a detectable fluorescent labeling substance. When radioactive isotopes such as ³² P or ³⁵ S are added to the amplification reaction solution, amplification products may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive.

And then performing the step of detecting the amplification product obtained above. The amplification product can be detected using a method known in the art such as DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. The gel electrophoresis can be performed by agarose gel electrophoresis or acrylamide gel electrophoresis according to the size of the amplification product. In the fluorescence measurement method, when Cy-5 or Cy-3 is labeled at the 5'-end of the primer and amplification is carried out, the target sequence is labeled with a fluorescent label capable of detecting the target, and the labeled fluorescence is measured using a fluorescence analyzer Method. In the above radioactive measurement method, a radioactive isotope such as ³² P or ³⁵ S is added to an amplification reaction solution to mark the amplification product, and then a radioactive measurement instrument, for example, a Geiger counter or a liquid scintillation counter the radioactivity can be measured using a liquid scintillation counter. The detection of the amplified product can be performed using fluorescent dye materials commonly used in the art, but preferably SYBR Green I, GeneFinder and phenol red can be used, and more preferably, SYBR Green I and GeneFinder can be used . The fluorescent dye material is added in order to make it possible to read out the result without requiring additional experiment using the property of binding to DNA double strand. In particular, the SYBR Green I or GeneFinder is a material that is inserted into a double strand of DNA and expresses green fluorescence upon irradiation with ultraviolet light. Therefore, when a gene of a brownfly is amplified by the LAMP method according to the present invention, SYBR Green I or GeneFinder is added to the amplified LAMP product, and then the ultraviolet light is irradiated, green fluorescence appears. That is, the present invention refers to the presence of brownflies when green fluorescence is expressed by SYBR Green I or GeneFinder staining after LAMP amplification experiment without any additional experiment such as electrophoresis, and when green fluorescence is not present, Can be visually confirmed with high sensitivity and promptness.

 In the case of detecting the brown planthopper using the above method, the specificity of detecting the brown planthopper is excellent, and it can be performed directly at the site where the brown planthopper is generated because the expensive equipment is not required, and thus it can be effectively used for detecting the brown planthopper.

If it is determined by the detection method according to the present invention that the brown planthopper is present at a level higher than the level of the urine control, it is possible to prevent the damage caused by direct feeding by carrying out the control. In addition, since there is no way to treat the currently known rice viral infectious strains, it is possible to quickly and accurately identify and control the brown planthopper, thereby preventing future viral disease mediation.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these are only for the purpose of illustrating the present invention in more detail, but the scope of the present invention is not limited thereto.

[Example 1] Production of a primer set for isothermal amplification reaction for detecting brown planthopper

BPH as compared to the ITS2 region of DNA information BPH similar insects on the basis of ITS2 gene (KC417466) of (Nilaparvata lugens) were prepared for an isothermal amplification reaction primers for detection BPH. The candidates were PrimerExplorer V5, a design software for isothermal amplification reaction primers.

The specific primer combination contents of the prepared primer set are shown in the following table.

set division order mer order
number a
(38) F3
(Outside the forward direction) CAATCGAGTCTTCATATTGTGT 22 One B3
(Reverse external) CAACAGCTTGCAGGGATG 18 2 FIP
(Forward direction inside) ATGACAAGCCAATGCTGAGCTGATTGGATTCCACTTTGC 39 3 BIP
(Reverse inside) TGCAGTTGTGTGTTTAAATGTCTTTCAAACAACATTGAATGTAGAGC 47 4 b
(38-1) F3
(Outside the forward direction) CAATCGAGTCTTCATATTGTGT 22 One B3
(Reverse external) CATGGAAAGGTGTATTCATCG 21 5 FIP
(Forward direction inside) ATGACAAGCCAATGCTGAGCTGATTGGATTCCACTTTGC 39 3 BIP
(Reverse inside) TGCAGTTGTGTGTTTAAATGTCTTTCAAACAACATTGAATGTAGAGC 47 4 c
(207) F3
(Outside the forward direction) TGATTGGATTCCACTTTGC 19 6 B3
(Reverse external) TGTATTCATCGACCAGCATG 20 7 FIP
(Forward direction inside) GGCATGTGCATGTCAGAGTCGACATTTGTGGGGCTCAG 38 8 BIP
(Reverse inside) AGTTGAAGCCATGTTATTGTGAGTCAACAGCTTGCAGGGATG 42 9

[Example 2] Comparison of amplification effect in isothermal amplification reaction of primer set of the present invention

When the isothermal amplification reaction using the primer set prepared in Example 1 was carried out, the degree of amplification of each primer set was compared.

According to the recommended method of Loopamp DNA Amplification Kit (Eiken Chemical Co., Ltd.), 12.5 占 퐇 of 2x Reaction Mix, 2.5 占 퐇 of primer set (each a, b or c), 1.0 占 퐇 Bst DNA polymerase, Distilled water and 2 μl of DNA sample were mixed well to make a total of 25 μl of mixture. The PCR product was amplified by heating at 65 ° C for 60 minutes and then heated at 80 ° C for 5 minutes to inactivate the polymerase function and stored at 4 ° C until the LAMP result was confirmed. For each primer set, negative control samples (eg, 38-c, 38-1-c, and 207-c) were loaded with sterile third distilled water instead of DNA samples. Positive controls were Loopamp DNA Amplification Kit (Eiken Chemical Co.). PC DNA (Positive Control DNA) and PM DNA (PrimerMix, LAMP results were confirmed by electrophoresis after loading on 1% agarose gel (RedSafe ^™ Nucleic Acid Staining Solution (20,000x), iNtRON Biotechnology, Inc.).

As shown in Fig. 2, it was confirmed that the amplification effect of c set in the primer set of the present invention is superior to that of the other two sets a and b.

[Example 3] Confirmation of specificity of isothermal amplification reaction of the primer set of the present invention

In order to confirm the specificity of the isothermal amplification reaction using the primer set of the present invention prepared in Example 1, a comparative experiment using an insecticidal insect, Leptospira, was conducted.

According to the recommended method of Loopamp DNA Amplification Kit (Eiken Chemical Co., Ltd.), 12.5 占 퐇 of 2x Reaction Mix, 2.5 占 퐇 of primer set (each a, b or c), 1.0 占 퐇 Bst DNA polymerase, Distilled water and 2 μl of DNA sample (brownfly or leek or white lanceolate) were mixed well to make a total of 25 μl. The PCR product was amplified by heating at 65 ° C for 60 minutes and then heated at 80 ° C for 5 minutes to inactivate the polymerase function and stored at 4 ° C until the LAMP result was confirmed. The negative control was placed in the same amount of sterilized tertiary distilled water instead of the DNA sample. LAMP results were confirmed by electrophoresis after loading on 1% agarose gel (RedSafe ^™ Nucleic Acid Staining Solution (20,000x), iNtRON Biotechnology, Inc.).

As shown in FIG. 3, it was confirmed that all the primer sets a, b, and c of the present invention were amplified in BPH (brownfly), but not in SBPH (female) and WBPH (white lantern). In addition, it was confirmed that the DNA amplification effect of the primer set c of the present invention was superior.

[Example 4] Confirmation of sensitivity of the primer set of the present invention during isothermal amplification reaction

When the isothermal amplification reaction was carried out using the primer set c of the present invention, experiments were conducted by varying the dilution amount of the substrate in order to measure the detection limit.

100 ng / μl, 10 ng / μl, 1 ng / μl, and 0.1 ng / μl of a DNA sample of the brown planthopper were respectively prepared by diluting 180 ng / According to the recommended method of Loopamp DNA Amplification Kit (Eiken Chemical Co., Ltd.), 12.5 占 퐇 of 2x Reaction Mix, 2.5 占 퐇 of primer set c, 1.0 占 퐇 of Bst DNA polymerase, 7.0 占 퐇 of sterilized distilled water, 180 ng / μl or 100 ng / μl or 10 ng / μl or 1 ng / μl or 0.1 ng / μl of DNA of the brown planthopper) were mixed well to make a total of 25 μl. The PCR product was amplified by heating at 65 ° C for 60 minutes and then heated at 80 ° C for 5 minutes to inactivate the polymerase function and stored at 4 ° C until the LAMP result was confirmed. LAMP results were confirmed by electrophoresis after loading on 1% agarose gel (RedSafe ^™ Nucleic Acid Staining Solution (20,000x), iNtRON Biotechnology, Inc.).

4, obtained by performing the isothermal amplification reaction using the primer set of the present invention 1% agarose gel in the BPH of 360ng ^{(RedSafe TM Nucleic Acid Staining Solution (} 20,000x), iNtRON Biotechnology, Inc.) DNA It is confirmed that it can be detected sensitively at both levels.

[Example 5] Detection confirmation using a fluorescent reagent in the primer set of the present invention

To confirm the applicability of the isothermal amplification reaction using the primer set c of the present invention, 10 μl of TOPreal ™ qPCR 2X PreMIX (SYBR Green with low ROX) (enzynomics) was added to 10 μl of amplification product after performing isothermal amplification reaction And fluorescence detection was performed under blue light and ultraviolet light conditions. The results are shown in Fig.

As shown in FIG. 4, it was confirmed that 360 ng of blue light illuminator (470 nm) was stably amplified, and 200 ng of green light was more visible than the control group (negative control group).

While the present invention has been described in connection with what is presently considered to be practical exemplary embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, Should be interpreted as belonging to the scope.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION)          Industry Academic Cooperation Foundation, Hallym University <120> Primers for loop-mediated isothermal amplification to detect          Nilaparvata lugens and detection method for Nilaparvata lugens by          using the same <160> 9 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 1 caatcgagtc ttcatattgt gt 22 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 2 caacagcttg cagggatg 18 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 3 atgacaagcc aatgctgagc tgattggatt ccactttgc 39 <210> 4 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 4 tgcagttgtg tgtttaaatg tctttcaaac aacattgaat gtagagc 47 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 5 catggaaagg tgtattcatc g 21 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 6 tgattggatt ccactttgc 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 7 tgtattcatc gaccagcatg 20 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 8 ggcatgtgca tgtcagagtc gacatttgtg gggctcag 38 <210> 9 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Primer for LAMP detection of Nilaparvata lugens <400> 9 agttgaagcc atgttattgt gagtcaacag cttgcaggga tg 42

Claims (5)

A set of primer sets for ring-mediated isothermal amplification for detection of Nilaparvata lugens comprising at least one primer combination selected from the following group:
(a) a primer having a nucleotide sequence of SEQ ID NO: 1, a primer having a nucleotide sequence of SEQ ID NO: 2, a primer having a nucleotide sequence of SEQ ID NO: 3, and a primer having a nucleotide sequence of SEQ ID NO: 4;
(b) a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 5, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4;
(c) a primer having the nucleotide sequence of SEQ ID NO: 6, a primer having the nucleotide sequence of SEQ ID NO: 7, a primer having the nucleotide sequence of SEQ ID NO: 8, and a primer having the nucleotide sequence of SEQ ID NO:
A composition for detecting Nilaparvata lugens comprising the set of primers for ring-mediated isothermal amplification of claim 1 .
A kit for detecting Nilaparvata lugens comprising the set of primers for ring-mediated isothermal amplification of claim 1 .
A method for detecting Nilaparvata lugens DNA comprising amplifying a specific region in DNA of a brownfly using the loop-mediated isothermal amplification primer set of claim 1.
( Nilaparvata lugens ) detection method comprising the step of extracting DNA from a sample and performing a ring-mediated isothermal amplification method using a primer set including at least one primer combination selected from the group consisting of DNA obtained from the sample as a template Way;
(a) a primer having a nucleotide sequence of SEQ ID NO: 1, a primer having a nucleotide sequence of SEQ ID NO: 2, a primer having a nucleotide sequence of SEQ ID NO: 3, and a primer having a nucleotide sequence of SEQ ID NO: 4;
(b) a primer having the nucleotide sequence of SEQ ID NO: 1, a primer having the nucleotide sequence of SEQ ID NO: 5, a primer having the nucleotide sequence of SEQ ID NO: 3, and a primer having the nucleotide sequence of SEQ ID NO: 4;
(c) a primer having the nucleotide sequence of SEQ ID NO: 6, a primer having the nucleotide sequence of SEQ ID NO: 7, a primer having the nucleotide sequence of SEQ ID NO: 8, and a primer having the nucleotide sequence of SEQ ID NO:

Images