KR101823348B1 - Primer set for determination of Cordyceps bassiana, and use thereof - Google Patents

Abstract

The present invention relates to a primer set for determining C. bassiana and uses thereof and, more specifically, to a primer set capable of precisely detecting C. bassiana in a short time by detecting bassianolide biosynthetase gene included in C. bassiana, and uses thereof.

Description

≪ Desc / Clms Page number 2 > Primer Set for Discrimination of Yellow Crowley Cordyceps,

More particularly, the present invention relates to a primer set for the identification of a yellow-leafy caterpillar, and more particularly, to a method for detecting a bassianolide biosynthetase gene contained in a yellow-leafy caterpillar fungus, A primer set which can be detected and its use.

It is known that about 100 genus and 750 species of insect pathogenic fungi including Cordyceps are distributed throughout the world. Entomopathogenic fungi belonging to Ascomycetes include the genus Cordyceps, Ophiocordyceps, Elaphocordyceps, Shimizuomyces, Torrubiella, ).

Among these, Cordyceps bassiana = Beauveria bassiana has been widely recognized as an agricultural pest control and environmentally friendly biologic agent due to its wide range of host range and excellent insecticidal ability. Recently, the efficacy of anti-inflammatory and anticancer effects of extracts of Cordyceps sinensis var. .

On the other hand, it is identified and identified according to the shape, size and color of breeding organism, breeding organism or host insect, but the size is very small and the classification system is not clearly established. There is a problem that it is not easy. Therefore, it is necessary to develop a technique for quickly, accurately, and easily discriminating the discrimination of yellow-leafy caterpillars.

Therefore, the present inventors have sought to find out a method for more easily discriminating the yellow-crowned caterpillars. As a result, since the amplified product obtained by amplifying a specific part of the cassianolide biosynthesis gene of the yellow mulberry Cordyceps is distinguished from the other phylogenetically related mulberry leaves, the yellow mulberry caterpillar fungus is identified using the PCR method .

Accordingly, it is an object of the present invention to provide a primer set for identifying a yellow-rooted caterpillar fringes comprising the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

Still another object of the present invention is to provide a method for isolating a genomic DNA comprising: a) separating genomic DNA from a strain; b) carrying out PCR using the genomic DNA as a template, using the primer set for discriminating yellow-leaf cryptomeriae according to any one of claims 1 to 3; And c) analyzing the PCR product generated by the PCR.

It is still another object of the present invention to provide a composition for PCR (PCR) for discriminating yellow-leafy caterpillars comprising the primer set of the present invention.

It is still another object of the present invention to provide a kit for detecting yellow copepods comprising a primer set of the present invention.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

Accordingly, the present invention provides a primer set for discriminating yellow-rooted caterpillar folliculi comprising the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

According to a preferred embodiment of the present invention, the identification of the yellow-leafy caterpillar fasciola may be performed by detecting a bassianolide biosynthatase gene contained in the yellow-leafy caterpillar fungus.

According to another preferred embodiment of the present invention, the primer set for discriminating the yellow-leafy caterpillar follies comprises a second adenylation domain of the bassianolide biosynthetase gene contained in the yellow-leafy caterpillar fungus, And then amplifying it.

Also, the present invention provides a method for producing a recombinant DNA comprising: (a) isolating a genomic DNA from a strain; (b) carrying out PCR using the genomic DNA as a template, using the primer set for discriminating yellow bundles of the present invention according to any one of claims 1 to 3; And (c) analyzing the PCR product generated by the PCR.

According to a preferred embodiment of the present invention, the PCR product analysis of step (c) may be performed by analyzing the size of the PCR product.

According to another preferred embodiment of the present invention, the size of the PCR product may be analyzed by analyzing the size of the PCR product obtained using the primer set.

In addition, the present invention provides a composition for polymerase chain reaction (PCR) for discriminating yellow-leafy caterpillars comprising the primer set of the present invention.

According to a preferred embodiment of the present invention, the PCR may be real time polymerase chain reaction (PCR).

In addition, the present invention provides a kit for detecting a yellow bundle cordyceps comprising a primer set of the present invention.

DISCLOSURE OF THE INVENTION The present invention has been made to solve the above problems, and it is an object of the present invention to provide a discrimination method capable of promptly, accurately and simply discriminating phylogenetically related caterpillar fungus other than yellowtail caterpillars and a primer set ≪ / RTI >

In addition, it is intended to provide a quality control of a biological control agent using a yellow mulberry caterpillar fungus ultimately by discriminating yellow mulberry caterpillars and to provide an effect that the efficiency of biological quarantine can be increased at the time of entering and leaving the mushrooms of Chinese caterpillar fungus.

Fig. 1 shows the position of the primer set designed in Example 2. Fig.
FIG. 2 shows the result of confirming the PCR amplification product performed in Example 3. FIG.

Hereinafter, the present invention will be described in more detail.

As described above, studies on the molecular biologic methods for distinguishing the Chinese phylloxera from other phylogenetically different species have been insufficient, and there is a need for molecular biologic means capable of easily and accurately distinguishing them from each other due to different use ranges Respectively.

Accordingly, the present inventors sought to solve the above-described problem by providing a primer set for discriminating yellow-leafy caterpillar follicles comprising SEQ ID NO: 1 and SEQ ID NO: 2. This makes it possible to distinguish phylogenetically related Cordyceps quicker, more accurately and simply by molecular biology.

The term "Yellow- billed Cordyceps," as used herein, bassiana "," Cordyceps bassiana ", and" C. bassiana ", and it is referred to herein as" C. bassiana ".

The primer set for discriminating yellow rooted caterpillar fungus of the present invention is not particularly limited as long as it comprises SEQ ID NO: 1 and SEQ ID NO: 2, and addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 is also included can do.

The suitable length of the primer is determined by the characteristics of the primer to be used, but it may be usually 20 to 40 bp. The primer need not be exactly complementary to the sequence of the template but can be complementary enough to form a hybridcomplex with the template.

The primer of the present invention is not particularly limited as long as it is obtained from a library that can be constructed so as to select a primer. Preferably, the primer is obtained from a nucleotide sequence library constructed using DNA of C. bassiana , And more preferably from a nucleotide sequence library constructed using the Bassianolide biosynthetase gene (BbBAS) of C. bassiana .

The primer set has an effect of discriminating phylogenetically related Cordyceps, which is different from that of yellow-leafy caterpillars, and the above-mentioned discrimination can be performed to detect a bassianolide biosynthetase gene contained in yellow-leafy caterpillars have. In addition, the primer set for discriminating the yellow-leafy caterpillar follicles may specifically amplify the second adenylation domain of the bassianolide biosynthetase gene contained in the yellow-leafy cordyceps.

The term " bassianolide biosynthetase gene "is a gene that is specifically present in the genus of the yellow-tailed caterpillar fungus. The yellow-tailed caterpillar fungus is an insect pathogenic fungus such as beauvericin and valerianolide bassianolide), and the ability to synthesize vauverine in various species belonging to Cordycipitaceae is already known, but the synthesis of bassianolide is known to be unique in the yellow-rooted caterpillar fungus have.

The cyanolide is synthesized by NRPS (Non-ribosomal peptide synthetases) gene as well as vervariin, and the second metabolite is CATCA-NM-TTC (Condensation-Adenylation-Thiolation-Condensation-Adenylation-N-Methyltransferase- Thiolation-Thiolation-Condensation). The substrate to which each second adenylation domain is specifically activated is phenylalanine in the case of the viewergic biosynthesis gene but is different from leucine in the case of the biosynolide biosynthesis gene , Which is reflected in differences in the sequence of some of the nucleotides in the corresponding part.

In one embodiment of the present invention, primer 1 and primer 2 capable of specifically amplifying and detecting the second adenylation domain of the BbBAS gene ( Beauveria bassiana bassianolide biosynthetase gene) present in the yellow copycat genomic DNA were prepared PCR was carried out on the genomic DNA of various closely related species of Cordyceps spp., And it was confirmed that a specific amplification band was detected in the yellow copycycline (Fig. 2).

The present invention also relates to a method of screening for a virus, comprising the steps of (a) isolating genomic DNA from a strain, (b) using the genomic DNA as a template and using a primer set for discriminating yellow- And performing a polymerase chain reaction (PCR). And (c) analyzing the PCR product generated by the PCR.

In step (a), the strain may be used as long as it is necessary to determine whether or not it is a yellow-billed cucumber. Typically, it is preferable to use a strain sold and / or propagated, but the present invention is not limited thereto.

The genomic DNA isolation is not particularly limited as long as it is a method used for isolating DNA from fungi, and the strain is pulverized using liquid nitrogen and then the pulverized strain is treated with a solution of CTAB buffer (Doyle and Doyle, 1987) DNA can then be isolated by treatment with the CTAB Rapid Genomic DNA Isolation method.

The term "polymerase chain reaction (PCR)" refers to amplification of a nucleic acid molecule, particularly a method of selectively amplifying a specific DNA region by a chain reaction of a nucleic acid polymerase.

In the step (b), the PCR is performed in three steps in sequence. After the denaturation for separating two strands of DNA using heat, the temperature is lowered and a primer Annealing at the ends and slightly elevating the heat again to cause polymerization or extension of DNA synthesis.

The PCR is a method of amplifying a target sequence from a primer set that specifically binds to a target sequence using a polymerase. The PCR method is well known in the art, and a commercially available kit can be used.

In addition, the target sequence amplified by the PCR may be labeled with a detectable labeling substance. The labeling substance is not particularly limited as long as it is ordinarily used as a primer-labeled substance. For example, fluorescent, phosphorescent or radioactive materials can be used, and ethidium bromide or Hoechst 3258 dyes can be preferably used. When the radioactive isotope such as ³² P or ³⁵ S is added to the reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive.

Further, the primer set used for amplifying the target sequence may be one comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2.

The term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming base pairs with a complementary template and having a starting point for template strand copy Refers to a short nucleic acid sequence that serves to initiate DNA synthesis in the presence of a reagent for polymerization (i. E., DNA polymerase or reverse transcriptase) and a different four nucleoside triphosphate at a suitable buffer solution and temperature . For the purpose of the present invention, the primers include a BbBAS biosynthetic gene ( Beauveria Bassiana bassianolide biosynthetase gene) as long as it is used for the purpose of identifying the above-mentioned yellow adventitious stridum by amplifying and detecting the second adenylation domain of the bassiana bassianolide biosynthetase gene, preferably, it is composed of SEQ ID NO: 1 and SEQ ID NO: 2 Lt; RTI ID = 0.0 > polynucleotide < / RTI >

In addition, the primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides with one or more homologues, and modifications between nucleotides such as uncharged linkers (e.g., methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

The PCR conditions are not particularly limited as long as they are usually used for the amplification of fungus DNA. Preferably, the annealing temperature may be 45 to 70 ° C, more preferably 50 to 70 ° C Lt; / RTI > If the binding temperature is less than 45 ° C, there may arise a problem that the primer set binds to a site other than the target sequence to amplify undesired DNA. When the binding temperature exceeds 70 ° C, There is a problem that the amount of amplified DNA product is too small.

In addition, the size of the PCR product produced by the above PCR, that is, the size of the amplified DNA is not particularly limited, but it may be 400 to 800 base pairs (bp), more preferably 450 to 650 Base pair, and most preferably 500 base pairs.

The step (c) is a step of analyzing the PCR product generated by the PCR. The PCR product is usually detected by a method such as capillary electrophoresis, DNA chip, Gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

The capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity of the amplification product can be measured using a liquid scintillation counter.

The size analysis of the PCR product may be performed by analyzing the size of the PCR product obtained using the primer set. The term "size analysis of the PCR product" means that the size of the PCR product obtained using the primer set And analyzing the size of the product. For example, when the size of the PCR product obtained using the primer 1 and the primer 2 is 500 bp, it can be said that the product corresponds to the yellow herbal caterpillar fungus.

In addition, the present invention provides a composition for polymerase chain reaction (PCR) for discriminating yellow-leafy caterpillars comprising the primer set of the present invention.

The above polymerase chain reaction (PCR) composition is a composition for quantitatively analyzing the amount of the yellow heron cordworm shrimp contained in a sample. In addition to the primer designed in the present invention, the composition includes a probe, a reverse transcription reaction and a polymerization reaction DNA polymerase, reverse transcriptase, dNTP, and reaction buffer well known in the art. Furthermore, it may contain DNase, RNase inhibitor, DEPC-water, sterilized water and the like if necessary.

The PCR generally refers to a series of reactions using PCR to quantify the amount of template DNA at the start of the amplification reaction. The PCR includes an internal standard method using a reference standard as a reference, May be included. In order to accurately and easily determine the number of molecules of each sequence, a PCR method using a template DNA sequence as a standard called a standard sample is used, and the progress of the reaction, that is, the degree of amplification is checked at any time during the reaction . Thus, in the present invention, 'PCR' means a PCR for quantifying the amount of template DNA at the start of amplification reaction, and means a PCR which can confirm the amplification of a molecule to be amplified at any time during the reaction. For quantification, such a PCR is generally combined with a calibration curve that correlates the number of template DNA molecules at the start of the reaction with a signal that is an index of the amplification. This calibration curve can be prepared using standard samples with a known number of molecules.

Further, the PCR is not particularly limited as long as it is usually used to quantify the amount of the template DNA contained in the sample, but may be a real time PCR.

Also, the present invention provides a kit for detecting a yellow bundle cordyceps, comprising a primer set for discriminating yellow bundles of the present invention.

By the term "kit " is meant a tool that allows absolute quantitation of a target strain by confirming the number of copies of a gene representative of the yellow-leafy Cordyceps mosquitoes to be detected or quantified in the sample by RT-PCR. The kit for detecting a yellow bundle cordyceps according to the present invention is characterized by comprising an artificial base sequence comprising at least one primer and / or a probe region specific to a gene representing a strain to be detected or quantified as a standard sample for the check- As well as one or more other component compositions, solutions or devices suitable for analytical methods.

The kit for detecting yellow heron cordworm herbaceousum is not particularly limited as long as it comprises the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and may include addition, deletion or substitution of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 .

The primers contained in the kit for the detection of yellow herring cordyceps of the present invention are labeled with a labeling substance so that PCR products can be detected more easily.

The term "labeling substance" refers to a substance that assists in visually confirming the presence or absence of a PCR product amplified using the primer. Generally, an enzyme, a minerals, a ligand, a luminescent material, a microparticle, Redox molecules, radioisotopes, and the like, but are not particularly limited thereto. For example, enzymes that can be used include? -Glucuronidase,? -D-glucosidase,? -D-galactosidase, urease, peroxidase or alkaline phosphatase, acetylcholinesterase, Glucosoxidase, hexokinase, GDPase, RNase, glucose oxidase and luciferase, phosphofructokinase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphoenolpyruvate decarboxylase, beta -lactamase, and the like, and examples of the usable minerals include fluorescein, isothiocyanate, rhodamine, picoeriterine, picocyanin, allophycocyanin, o-phthaldehyde, And examples of ligands that can be used include biotin derivatives and the like, and available luminescent materials include acridinium ester, luciferin, luciferase, etc., and available microparticles Colloidal gold, colored latex, etc. The available redox molecules include ferrocene, ruthenium complex, viologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, hydroquinone and the like number, and a radioactive isotope available will include ^{3 H, 14 C, 32 P} , 35 S, 36 Cl, 51 Cr, 57 Co, 58 Co, 59 Fe, 90 Y, 125 I, 131 I, 186 Re But is not limited thereto.

The yellow bundle cordyceps, which is a target to be detected by the kit, is not particularly limited, but may be preferably Cordyceps bassiana , more preferably Cordyceps bassiana ) C101, ASI356, and ASI 828, and the like.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to further illustrate the present invention, and the scope of the present invention is not limited to these examples.

[Example]

Example  1. DNA extraction

As a result, the strain C101, ASI 356 and ASI 828 ( codename : Cordyceps bassiana = Beauveria bassiana ), which were purchased from the National Institute of Horticultural Science, were used.

After isolating the spores from infected host insects using flame disinfected fungi, the monospore was isolated using a microscope Zeiss dissecting microscope Stemi SV11 (Zeiss, West Germany). The seedlings were allowed to stagnate for 72 hours in Sabayud-dextrose-yeast extract (SDAY) medium under the dark condition to proliferate. The mycelia obtained by the above proliferation were quenched with liquid nitrogen, ground in a mortar to obtain a powder state, treated with a solution of CTAB Buffer (Doyle and Doyle, 1987), and then subjected to CTAB Rapid Genomic DNA Isolation Respectively.

As described above, the extracted DNA was measured using Nanodrop (manufactured by Thermo Fisher Scientific, USA) concentration, and the final concentration of each DNA was adjusted to 100 ng / μl using sterilized distilled water Respectively.

Example  2. primer  Set design

Analysis of the nucleotide sequence of the yellow herring cordyceps gene showed that the most suitable primer for use in the present invention was selected and the gene encoding the cassanolide biosynthetic gene ( Beauveria bassiana bassianolide biosynthetase gene; A primer set capable of specifically amplifying BbBAS was prepared. The primer set base sequence region is shown in Fig.

A preferred primer set of the present invention is designated as BbBAS_A2_P4, and is represented by SEQ ID NO: 1 and SEQ ID NO: 2, and is shown in Table 1 below.

name Sequence (5 '- > 3') BbBAS_A2_P4  CTCGGGTGGTGATAGATTC SEQ ID NO: 1  GACGGCAGCATTACGCACAG SEQ ID NO: 2

Comparative Example 1

DNA was extracted in the same manner as in Example 1 except that KACC 47484 ( Beauveria pseudobassiana ), which was distributed at the Korean Agricultural Microbiology Resource Center, was used.

Comparative Example  2.

The KACC 47481 ( Beauveria The DNA was extracted in the same manner as in Example 1 except that the E. coli strain ( sungii ) was used.

Comparative Example  3.

KACC 43316, which was sold by Korea Agricultural Microbiology Resource Center ( Cordyceps militaris fungus, and pupa fungus) was used as a starting material, DNA was extracted in the same manner as in Example 1.

Comparative Example  4.

KACC 44470, which was sold by Korea Agricultural Microbiology Resource Center ( Cordyceps pruinosa bacterium, red bollworm Cordyceps) was used as a starting material . DNA was extracted in the same manner as in Example 1.

Comparative Example  5.

DNA was extracted in the same manner as in Example 1, except that KACC 47485 ( Isaria tenuipes , Blastocyst ) was purchased from the Korean Agricultural Microbiology Resource Center.

Comparative Example  6.

KACC 47486 ( Isaria), which was sold by the Korean Agricultural Microbiology Resource Center farinosa bacteria, powdered flower caterpillar fungus) was used as the yeast extract.

Example  3. Polymerase chain reaction ( PCR ) Perform

Polymerase chain reaction (PCR) was performed from the DNA extracted in Example 1 and Comparative Examples 1 to 6 using an Eppendorf thermal cycler (manufactured by Eppendorf).

The total volume of the PCR reaction solution was 20 μl, and 10 μl of DNA of Example 1 and Comparative Examples 1 to 6 and 8 μl of distilled water (DW) were mixed.

In addition, the PCR reaction was carried out by pre-denaturation at 95 ° C for 5 minutes, amplification at 95 ° C for 30 seconds, 62 ° C for 30 seconds, and 72 ° C for 60 seconds for 35 times And the final amplification (final extension) was carried out at 72 ° C for 5 minutes.

The DNA product amplified by the PCR reaction was electrophoresed on 2% agarose gel at 180 V, stained with EtBr (EthBr), and the band was observed on a UV-illuminator The phenomenon was recorded as a photograph. A photograph of the DNA product band obtained by the PCR reaction is shown in Fig.

2, M is a size marker (Bioneer, product name: D-1050, 0.6 μl / ml), lane 1 to lane 3 are Cordyceps bassiana (= Beauveria bassiana , lane 1 is C101, lane 2 is ASI 356, and lane 3 is ASI 828. Lanes 4 to 9 are strains of Comparative Examples 1 to 6, lane 4 is Beauveria pseudobassia na of Comparative Example 1, lane 5 is Beauveria of Comparative Example 2, sungii , lane 6 was the Cordyceps of Comparative Example 3 militaris , and lane 7 was the Cordyceps pruinosa And lane 8 was the Isaria of Comparative Example 5 tenuipes , lane 9 represents Isaria farinosa of Comparative Example 6, NC represents sterilized distilled water (3DW).

As can be seen in FIG. 2, the BbBAS_p3 primer set was able to clearly distinguish the yellow-bug cucurbitacea from the DNA fragments of 500 bp in lanes 1 to 3, which are Cordyceps bassiana . In addition, the primer set did not amplify the phylogenetically related caterpillar fungus other than the yellow-tailed caterpillar fungus, and thus it was confirmed that the primer set was specific to the yellow caterpillar fungus. As a result, the primer set of the present invention has an effect of specifically discriminating the yellow-leafy caterpillars from yellow-leafy caterpillars and other phylogenetically close caterpillars.

Claims (9)

Characterized in that it specifically amplifies the second adenylation domain of the bassianolide biosynthase gene contained in the yellow copalia cordata including the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 A primer set for the identification of yellow bug cucumber ( C. bassiana ) from phylogenetically related caterpillar fungus.
The method according to claim 1,
The yellow stamens are identified by the detection of the bassianolide biosynthase gene contained in the yellow stamens.
A set of primers for the identification of yellow-leafy caterpillar fungus from phylogenetically related caterpillar fungus.
The method according to claim 1,
Yellow bivalves were identified as C. bassiana C101, C. bassiana , ASI356 or C. bassiana ASI828.
A set of primers for the identification of yellow-leafy caterpillar fungus from phylogenetically related caterpillar fungus.
(a) isolating genomic DNA from the strain;
(b) carrying out PCR using the genomic DNA as a template, using the primer set for discriminating yellow bundles of the present invention according to any one of claims 1 to 3; And
(c) analyzing the size of the PCR product generated by the PCR, and determining that the size of the amplified product is 500 bp; From a phylogenetically related caterpillar fungus.
delete delete A composition for polymerase chain reaction (PCR) for the identification of yellow-leafy caterpillars from a phylogenetically related caterpillar fungus comprising the primer set of any one of claims 1 to 3.
8. The method of claim 7,
The PCR is a real time polymerase chain reaction (PCR)
Composition for PCR for the identification of yellow - stem Chinese caterpillar fungus from phylogenetically related.
A kit for the detection of yellow heron cordworms from phylogenetically related caterpillar fungus comprising the primer set of any one of claims 1 to 3.

Images