CN102703605A - Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit - Google Patents

Abstract

The invention relates to a kit for rapidly detecting a banana streak virus (BSV) by isothermal gene amplification. Reagents of the kit include a primer mixed solution, a Bst DNA (deoxyribonucleic acid) polymerase with the concentration of 8U/Mu l, a 8U reverse transcriptase, an RNA extract, a reaction buffer solution, a nucleic acid dye, a positive control reagent and a negative control reagent, wherein the primer mixed solution consists of two pairs of primers; the RNA extract contains 100mM of Tris-HCL (pH 7.4), 1M of KCl, 10mM of EDTA and 2% (w/v) of PVPP; the reaction buffer solution contains 10mM of dNTP, a 10*ThermoPol reaction buffer solution, 150mM of MgSO4 and 5mM of betaine which are at a ratio of 8:5:2:10; the positive control reagent is a cDNA containing BSV coat protein; and the negative control reagent is 100mM of Tris-HCL (pH 8.0) and 50mM of EDTA. The invention also relates to a use method of the kit. By extraction of nucleic acid of the BSV from a sample and isothermal gene amplification with the kit, the color of the reaction solution is finally judged through naked eyes, so that the high-specificity, rapid, high-sensitivity, simple and convenient molecular detection on the BSV is achieved.

Description

A kind of banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit and method of use thereof

Technical field

The present invention relates to the microorganism detection field, specifically, the present invention relates to a kind of banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit and method of use thereof.

Background technology

Banana is the Musaceae banana, is important cash crop of tropical and subtropical zone and food crop.In recent years; Bananas such as China Guangdong, Yunnan, Hainan are mainly planted the area and banana floral leaf heart rot virus (Banana streak virus successively occurred; BSV) situation of eruption and prevalence, this disease early symptom shows as a meter granulous chlorisis, along with the appearance of development blade interrupted or the successive chlorisis streak and the fusiformis streak of symptom; And can develop into downright bad black streak gradually, false stem, petiole and fruit ear also the striped symptom can occur sometimes.Banana is mainly produced through asexual tissue culture batch production; The banana floral leaf heart rot virus can be along with the breeding of banana differentiation bud in the group training; The form that is integrated into banana genome through free virus form or viral genome was transmitted by generation; If seedling (or any of several broadleaf plants head) carries the banana floral leaf heart rot virus again without the strictness quarantine, its cause of disease just possibly propagated with tissue cultured seedling at faster speed, becomes an important primary source of infection of transmitted virus.Therefore, set up a cover BSV fast, the stable detection method is the important assurance that nontoxic seedling is produced.

In recent years; Have a large amount of reports to confirm that the method for PCR-based successfully has been used to detect the banana floral leaf heart rot virus, PCR method improves a lot than ordinary method on the running time and aspect specificity that detects and the sensitivity, still; PCR method must have accurate temperature cycle device; And its detection time also still long (2～3 hours), and reaction process is easy to the influence of contaminated thing, thus make this method can not satisfy the needs of actual detected.Therefore, need a kind of highly sensitive and willing method of exploitation, can replace the detection method of PCR to a certain extent.Therefore, the newest fruits of biotech development is applied to the banana floral leaf heart rot virus detects, significant.

(loop-mediated isothermal amplification of DNA LAMP) overcomes the deficiency of gene amplification method in the past, can specificity under isothermal condition, carry out the amplification of nucleic acid efficiently, apace for dna circle mediated constant temperature nucleic acid amplification technology; Has a lot of meliority; See document Notomi T, Okayama H, Masubuchi H; Yonekawa T; Watanabe K, Amino N, Hase T.Loop-mediated isothermal amplification of DNA.Nucleic Acids Res.2000Jun 15; 28 (12): E63..This method is normally carried out as follows: step 1, seized sample is carried out pre-treatment, the DNA of the seized sample of rapid extraction or RNA; The preparation of step 2, Auele Specific Primer: after confirming the target gene of sample to be measured, obtain 2 pairs of Auele Specific Primers, each is a pair of for inner primer and outer primer; Step 3, carry out loop-mediated isothermal amplification technique (LAMP) reaction: will mix with the Bst archaeal dna polymerase through sample, primer, the reaction buffer of pre-treatment, be incubated 0.5 to 1.5 hour at 63～65 ℃ and carry out the endless chain replacement(metathesis)reaction; Step 4, analysis and judgement reaction product result.

Summary of the invention

The objective of the invention is to overcome above-mentioned technological deficiency, a kind of banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit is provided.

The present invention also aims to provide the method for use of this banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit.

In order to realize the object of the invention, the present invention provides a kind of banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit, and its reagent comprises:

The primer mixed solution that constitutes by two pairs of primers; Said two pairs of primers are: outer primer 1-CMV-F3; Its nucleotide sequence shown in SEQ ID NO:l (AATTCGATTCTACCGTGTGG), outer primer 2-CMV-B3, its nucleotide sequence is shown in SEQ ID NO:2 (GACATGAAGTACTAGCTCGTC); Inner primer 1-CMV-FIP; Its nucleotide sequence shown in SEQ ID NO:3 (ACCAGTACCGGTGAGGCTTGCCTCCTCGGACTTATC), inner primer 2-CMV-BIP, its nucleotide sequence is shown in SEQ ID NO:4 (TCTGGAGTCCAAGCCAACAACTACGCATGTCACCAATATCAG); The concentration of said inner primer 1-CMV-FIP and said inner primer 2-CMV-BIP is 40pmol/ μ l, and the concentration of said outer primer 1-CMV-F3 and said outer primer 2-CMV-B3 is respectively 5pmol/ μ l;

Concentration is the Bst archaeal dna polymerase of 8U/ μ l;

The ThermoScript II of 8U;

The RNA extracting solution, said RNA extracting solution comprises: 100mM Tris-HCl (pH7.4), 1MKC1,10mM EDTA and 2% (w/v) PVPP;

Reaction buffer, said reaction buffer comprises: 10mM dNTP, 10 * ThermoPol reaction buffer, 150mM MgSO ₄, 5mM trimethyl-glycine=8: 5: 2: 10;

Nucleic acid dye;

Positive control: the cDNA that contains banana floral leaf heart rot virus coat protein;

Negative control: 100mM Tris-HCl (pH 8.0) and 50mM EDTA.

Preferably, said nucleic acid dye is 1000 * SYBR Green I.

Use like this paper, in reaction buffer, " reaction buffer comprises: 10mM dNTP, 10 * ThermoPol reaction buffer, 150mM MgSO ₄, 5mM trimethyl-glycine=8: 5: 2: 10 " be meant 10mM dNTP in the reaction buffer, 10 * ThermoPol reaction buffer, 150mM MgSO ₄The volume ratio of the aqueous solution of the aqueous solution, 5mM trimethyl-glycine be 8: 5: 2: 10.

The present invention also provides a kind of method of use of banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit, and this method comprises the following steps:

1) the RNA nucleic acid extraction of test sample: in the 0.5mg detected sample, add 30 μ lRNA extracting solutions, grind to form pasty state after, at 95 ℃ of 10min, under the 10000rpm centrifugal 2 minutes, get supernatant as detecting template ribonucleic acid;

2) loop-mediated isothermal amplification:

In 25 μ l PCR pipe, dispose reaction soln: the outer primer 1-CMV-F3 of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:1; The outer primer 2-CMV-B3 of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:2; The inner primer 1-CMV-FIP of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:3; The inner primer 2-CMV-BIP of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:4; 12.5 the reaction buffer of μ l; The BstDNA polysaccharase 1 μ l of 8U; The ThermoScript II 0.2 μ l of 8U, the template ribonucleic acid of 2 μ l;

Add water to 25 μ l then; When the positive control reaction is set; Replace 1 with the cDNA that contains banana floral leaf heart rot virus coat protein) in the detection template ribonucleic acid that obtains; When the negative control reaction is set; Replace 1 with 100mM Tris-HCl (pH 8.0) and 50mM EDTA) in the detection template ribonucleic acid that obtains, the PCR that will contain the reaction soln for preparing manages in 63 ℃ of isothermal reaction 90min;

3) adding the nucleic acid dye of 1 μ l analysis and judgement reaction product result: 2) in the products therefrom, is orange like the reaction solution color, and ecbatic is negative, is green like the reaction solution color, and ecbatic is positive.

Preferably, said nucleic acid dye is 1000 * SYBR Green I.

Banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit of the present invention has following beneficial effect:

1, high specific: the present invention according to banana floral leaf heart rot virus gene conserved regions design four Auele Specific Primers, primer sequence is SEQ ID NO:1, SEQ ID NO:2, SEQ IDNO:3 and SEQ ID NO:4.Use above-mentioned four primers, whether the existence that just can judge target substance according to whether increasing, and positive rate is greater than 95%, and false positive rate is less than 3%;

2, need not the high purity template DNA: DNA extraction method does not simply fast need whizzer, liquid nitrogen, phenol, chloroform instrument and reagent;

3, realizing that sample is on-the-spot detects: in the open air or the field on-the-spot, directly the streak virus in the sample is carried out on-the-spot gene amplification and detects;

4, fast efficient amplification: amplification can be accomplished less than 1 hour, and productive rate is high;

5, highly sensitive: in complex system, can detect the target of individual cells, the lowest detection limit reaches 2pg DNA, and the recall rate of sample reaches more than 95%;

6, evaluation is easy: through visual inspection colour-change result of determination, need not other any analytical procedures such as electrophoresis.

Embodiment

Following examples are used to explain the present invention, but are not used for limiting scope of the present invention.

Embodiment 1

(Cucumber mosaic virus CMV) can receive wound available from Bei Jingbei and join Bioteknologisk Institut the banana floral leaf heart rot virus.Press following formulation banana floral leaf heart rot virus isothermal gene amplification fast detecting kit:

By the primer mixed solution that two pairs of primers constitute, said two pairs of primers are: outer primer 1-CMV-F3, and its nucleotide sequence is shown in SEQ ID NO:1; Outer primer 2-CMV-B3; Its nucleotide sequence shown in SEQ ID NO:2, inner primer 1-CMV-FIP, its nucleotide sequence is shown in SEQ ID NO:3; Inner primer 2-CMV-BIP; Its nucleotide sequence is shown in SEQ ID NO:4, and the concentration of said inner primer 1-CMV-FIP and said inner primer 2-CMV-BIP is 40pmol/ μ l, and the concentration of said outer primer 1-CMV-F3 and said outer primer 2-CMV-B3 is respectively 5pmol/ μ l;

Concentration is the Bst archaeal dna polymerase of 8U/ μ l;

The RNA extracting solution, said RNA extracting solution comprises: 100mM Tris-HCl (pH7.4), 1M KC1,10mM EDTA and 2%PVPP;

Reaction buffer, said reaction buffer comprises: 10mM dNTP (available from sigma), 10 * ThermoPol reaction buffer (available from sigma), 150mM MgSO ₄, 5mM trimethyl-glycine=8: 5: 2: 10;

Nucleic acid dye 1000 * SYBR Green I;

Positive control: the cDNA that contains banana floral leaf heart rot virus coat protein;

Negative control: 100mM Tris-HCl (pH 8.0) and 50mM EDTA.

Use the mentioned reagent box banana floral leaf heart rot virus to be detected by following method:

1) the DNA nucleic acid extraction of test sample: add 30 μ l RNA extracting solutions in the 0.5mg detected sample (plant is got middle arteries and veins, and seedling is got bulb), grind to form pasty state after, at 95 ℃ of 10 min, under the 10000rpm centrifugal 2 minutes, get supernatant as detecting template DNA;

2) loop-mediated isothermal amplification: in 25 μ l PCR pipe, dispose reaction soln: the outer primer 1-CMV-F3 of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:1; The outer primer 2-CMV-B3 of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:2; The inner primer 1-CMV-FIP of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:3; The inner primer 2-CMV-BIP of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:4; 12.5 the reaction buffer of μ l; The Bst archaeal dna polymerase of 1 μ l; The template DNA of 2 μ l; Add water to 25 μ l then; When the positive control reaction is set; Replace 1 with the cDNA that contains banana floral leaf heart rot virus coat protein) in the detection template DNA that obtains; When the negative control reaction is set; Replace 1 with 100mM Tris-HCl (pH 8.0) and 50mM EDTA) in the detection template DNA that obtains, the PCR that will contain the reaction soln for preparing manages in 63 ℃ of isothermal reaction 90min;

3) adding nucleic acid dye 1000 * SYBR Green I of 1 μ l analysis and judgement reaction product result: 2) in the products therefrom, is orange like the reaction solution color, and ecbatic is negative, is green like the reaction solution color, and ecbatic is positive.

Claims (4)

1. banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit is characterized in that its reagent comprises:

By the primer mixed solution that two pairs of primers constitute, said two pairs of primers are: outer primer 1-CMV-F3, and its nucleotide sequence is shown in SEQ ID NO:l; Outer primer 2-CMV-B3; Its nucleotide sequence shown in SEQ ID NO:2, inner primer 1-CMV-FIP, its nucleotide sequence is shown in SEQ ID NO:3; Inner primer 2-CMV-BIP; Its nucleotide sequence is shown in SEQID NO:4, and the concentration of said inner primer 1-CMV-FIP and said inner primer 2-CMV-BIP is 40pmol/ μ l, and the concentration of said outer primer 1-CMV-F3 and said outer primer 2-CMV-B3 is respectively 5pmol/ μ l;

Concentration is the Bst archaeal dna polymerase of 8U/ μ l;

The ThermoScript II of 8U;

The RNA extracting solution, said RNA extracting solution comprises: 100mM Tris-HCl (pH7.4), 1M KC1,10mM EDTA and 2% (w/v) PVPP;

Reaction buffer, said reaction buffer comprises: 10mM dNTP, 10 * ThermoPol reaction buffer, 150mM MgSO ₄, 5mM trimethyl-glycine=8:5:2:10;

Nucleic acid dye;

Positive control: the cDNA that contains banana floral leaf heart rot virus coat protein;

Negative control: 100mM Tris-HCl (pH 8.0) and 50mM EDTA.

2. banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit according to claim 1 is characterized in that, said nucleic acid dye is 1000 * SYBR Green I.

3. the method for use of a banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit, this method comprises the following steps:

1) the RNA nucleic acid extraction of test sample: in the 0.5mg detected sample, add 30 μ lRNA extracting solutions, grind to form pasty state after, at 95 ℃ of 10min, under the 10000rpm centrifugal 2 minutes, get supernatant as detecting template ribonucleic acid;

2) loop-mediated isothermal amplification:

In 25 μ l PCR pipe, dispose reaction soln: the outer primer 1-CMV-F3 of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:l; The outer primer 2-CMV-B3 of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:2; The inner primer 1-CMV-FIP of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:3; The inner primer 2-CMV-BIP of 1 μ l, its nucleotide sequence is shown in SEQ ID NO:4; 12.5 the reaction buffer of μ l; The Bst archaeal dna polymerase 1 μ l of 8U; The ThermoScript II 0.2 μ l of 8U, the template ribonucleic acid of 2 μ l;

Add water to 25 μ l then; When the positive control reaction is set; Replace 1 with the cDNA that contains banana floral leaf heart rot virus coat protein) in the detection template ribonucleic acid that obtains; When the negative control reaction is set; Replace 1 with 100mM Tris-HCl (pH 8.0) and 50mM EDTA) in the detection template ribonucleic acid that obtains, the PCR that will contain the reaction soln for preparing manages in 63 ℃ of isothermal reaction 90min;

3) adding the nucleic acid dye of 1 μ l analysis and judgement reaction product result: 2) in the products therefrom, is orange like the reaction solution color, and ecbatic is negative, is green like the reaction solution color, and ecbatic is positive.

4. the method for use of banana floral leaf heart rot virus constant temperature gene amplification fast detecting kit according to claim 3 is characterized in that, said nucleic acid dye is 1000 * SYBRGreenI.