CN102703605B - Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit - Google Patents
Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit Download PDFInfo
- Publication number
- CN102703605B CN102703605B CN201210151982.5A CN201210151982A CN102703605B CN 102703605 B CN102703605 B CN 102703605B CN 201210151982 A CN201210151982 A CN 201210151982A CN 102703605 B CN102703605 B CN 102703605B
- Authority
- CN
- China
- Prior art keywords
- cmv
- reaction
- nucleotide sequence
- kit
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a kit for rapidly detecting a cucumber mosaic virus (CMV) by isothermal gene amplification. Reagents of the kit include a primer mixed solution, a Bst DNA (deoxyribonucleic acid) polymerase with the concentration of 8U/Mu l, a 8U reverse transcriptase, an RNA extract, a reaction buffer solution, a nucleic acid dye, a positive control reagent and a negative control reagent, wherein the primer mixed solution consists of two pairs of primers; the RNA extract contains 100mM of Tris-HCL (pH 7.4), 1M of KCl, 10mM of EDTA and 2% (w/v) of PVPP; the reaction buffer solution contains 10mM of dNTP, a 10*ThermoPol reaction buffer solution, 150mM of MgSO4 and 5mM of betaine which are at a ratio of 8:5:2:10; the positive control reagent is a cDNA containing BSV coat protein; and the negative control reagent is 100mM of Tris-HCL (pH 8.0) and 50mM of EDTA. The invention also relates to a use method of the kit. By extraction of nucleic acid of the BSV from a sample and isothermal gene amplification with the kit, the color of the reaction solution is finally judged through naked eyes, so that the high-specificity, rapid, high-sensitivity, simple and convenient molecular detection on the BSV is achieved.
Description
Technical field
The present invention relates to microorganism detection field, specifically, the present invention relates to a kind of Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit and using method thereof.
Background technology
Banana is Musaceae banana, is the important cash crop of tropical and subtropical zone and food crop.In recent years, the bananas such as China Guangdong, Yunnan, Hainan are mainly planted area and have successively been occurred Banana Mosaic Disease poison (Cucumber mosaic virus, CMV) situation of eruption and prevalence, this sick early symptom shows as the chlorisis of grain of rice shape, there is interrupted or continuous print chlorisis streak and fusiformis streak in the development blade along with symptom, and downright bad black streak can be developed into gradually, false stem, petiole and fruit ear also there will be striped symptom sometimes.Banana cultivates factorial praluction mainly through Vegetative tissue, Banana Mosaic Disease poison can along with the breeding of differentiated banana shoots in group training, offer incense in a temple the genomic form of any of several broadleaf plants by generation transmission by free virus form or virus genomic integration, if seedling (or any of several broadleaf plants head) carries Banana Mosaic Disease poison again without strict quarantine, its cause of disease just may be propagated with tissue cultured seedling at faster speed, becomes the primary source of infection that of transmitted virus is important.Therefore, the important guarantee that quick, the stable detection method of a set of CMV is nontoxic seeling industry is set up.
In recent years, the method of PCR-based has been used successfully to detection Banana Mosaic Disease poison to have a large amount of reports to confirm, PCR method on the operating time and detect specificity and sensitivity in comparatively ordinary method improve a lot, but, PCR method must have accurate temperature cycling device, and its detection time also still long (2 ~ 3 hours), and reaction process is easy to the impact of contaminated thing, thus makes this method can not meet the needs of actual detection.Therefore, need exploitation one highly sensitive and willing method, the detection method of PCR can be replaced to a certain extent.Therefore, the newest fruits of biotech development is applied to Banana Mosaic Disease poison and detects, significant.
DNA circle mediated constant temperature nucleic acid amplification technology (loop-mediated isothermalamplification of DNA; LAMP) deficiency of gene amplification method is in the past overcome; under isothermal conditions can specificity, efficiently, carry out the amplification of nucleic acid rapidly; there is a lot of superiority; see document Notomi T; Okayama H; Masubuchi H; Yonekawa T; Watanabe K; Amino N, Hase T.Loop-mediated isothermal amplificationof DNA.Nucleic Acids Res.2000Jun15; 28 (12): E63..The method is normally carried out as follows: step one, carry out pre-treatment to tested sample, DNA or RNA of the tested sample of rapid extraction; The preparation of step 2, Auele Specific Primer: after determining the target gene of sample to be measured, obtains Auele Specific Primer 2 right, inner primer and each a pair of outer primer; Step 3, carry out loop-mediated isothermal amplification technique (LAMP) reaction: mix through the sample of pre-treatment, primer, reaction buffer with Bst archaeal dna polymerase, within 0.5 to 1.5 hour, carry out endless chain replacement(metathesis)reaction 63 ~ 65 DEG C of insulations; Step 4, analysis judge reaction product result.
Summary of the invention
The object of the invention is to overcome above-mentioned technological deficiency, a kind of Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit is provided.
The present invention also aims to the using method that this Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit is provided.
In order to realize object of the present invention, the invention provides a kind of Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit, its reagent comprises:
The primer mixed solution be made up of two pairs of primers, described two pairs of primers are: outer primer 1-CMV-F3, its nucleotide sequence is as SEQ ID NO:l(AATTCGATTCTACCGTGTGG) shown in, outer primer 2-CMV-B3, its nucleotide sequence is as SEQ ID NO:2(GACATGAAGTACTAGCTCGTC) shown in, inner primer 1-CMV-FIP, its nucleotide sequence is as SEQ ID NO:3(ACCAGTACCGGTGAGGCTTGCCTCCTCGGACTTATC) shown in, inner primer 2-CMV-BIP, its nucleotide sequence is as SEQ ID NO:4(TCTGGAGTCCAAGCCAACAACTACGCATGTCACCAATATCAG) shown in, the concentration of described inner primer 1-CMV-FIP and described inner primer 2-CMV-BIP is 40pmol/ μ l, the concentration of described outer primer 1-CMV-F3 and described outer primer 2-CMV-B3 is respectively 5pmol/ μ l,
Concentration is the Bst archaeal dna polymerase of 8U/ μ l;
The ThermoScript II of 8U;
RNA extracting solution, described RNA extracting solution comprises: 100mM Tris-HCl(pH7.4), 1M KC1,10mM EDTA and 2% (w/v) PVPP;
Reaction buffer, described reaction buffer comprises: 10mM dNTP, 10 × ThermoPol reaction buffer, 150mM MgSO
4, 5mM trimethyl-glycine=8:5:2:10;
Nucleic acid dye;
Positive control: the cDNA containing Banana Mosaic Disease poison coat protein;
Negative control: 100mM Tris-HCl(pH8.0) and 50mM EDTA.
Preferably, described nucleic acid dye is 1000 × SYBR Green I.
As used herein, in reaction buffer, " reaction buffer comprises: 10mMdNTP, 10 × ThermoPol reaction buffer, 150mM MgSO
4, 5mM trimethyl-glycine=8:5:2:10 " refer to 10mM dNTP in reaction buffer, 10 × ThermoPol reaction buffer, 150mM MgSO
4the aqueous solution, 5mM trimethyl-glycine the volume ratio of the aqueous solution be 8:5:2:10.
The present invention also provides the using method of a kind of Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit, and the method comprises the following steps:
1) the RNA nucleic acid extraction of test sample: add 30 μ lRNA extracting solutions in 0.5mg detected sample, after grinding to form pasty state, under 95 DEG C of 10min, 10000rpm centrifugal 2 minutes, gets supernatant as detection template RNA;
2) loop-mediated isothermal amplification:
In 25 μ l PCR pipe, configure reaction soln: the outer primer 1-CMV-F3 of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:l; The outer primer 2-CMV-B3 of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:2; The inner primer 1-CMV-FIP of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:3; The inner primer 2-CMV-BIP of 1 μ l, its nucleotide sequence is as shown in SEQID NO:4; The reaction buffer of 12.5 μ l; The Bst archaeal dna polymerase 1 μ l of 8U; The ThermoScript II 0.2 μ l of 8U, the template ribonucleic acid of 2 μ l;
Then 25 μ l are added water to; When positive control reaction is set, replace 1 with the cDNA containing Banana Mosaic Disease poison coat protein) in the detection template RNA that obtains, when negative control reaction is set, use 100mM Tris-HCl(pH8.0) and 50mM EDTA replace 1) in the detection template RNA that obtains, by the PCR pipe containing the reaction soln prepared in 63 DEG C of isothermal reaction 90min;
3) analyze and judge reaction product result: 2) in add the nucleic acid dye of 1 μ l in products therefrom, if reaction solution color is orange, represent that result be negative, if reaction solution color be green, expression result is the positive.
Preferably, described nucleic acid dye is 1000 × SYBR Green I.
Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit of the present invention has following beneficial effect:
1, high specific: the present invention is four Auele Specific Primers according to Banana Mosaic Disease virus gene conserved regions design, and primer sequence is SEQ ID NO:l, SEQ ID NO:2, SEQ IDNO:3 and SEQ ID NO:4.Apply above-mentioned four primers, whether the existence that just can judge target substance according to whether increasing, and positive rate is greater than 95%, and false positive rate is less than 3%;
2, without the need to high purity template DNA: simple and quick DNA extraction method, whizzer, liquid nitrogen, phenol, chloroform instrument and reagent is not needed;
3, realize sample site to detect: in the wild or field on-the-spot, directly on-the-spot gene amplification detection is carried out to the streak virus in sample;
4, fast, efficient amplification: increase and can complete less than 1 hour, and productive rate is high;
5, highly sensitive: the target that individual cells can be detected in complex system, the lowest detection limit reaches 2pg DNA, and the recall rate of sample reaches more than 95%;
6, identify easy: change result of determination by visual color, without the need to other any analytical procedures such as electrophoresis.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
Embodiment 1
Banana Mosaic Disease poison (Cucumber mosaic virus, CMV) can purchased from Beijing North Na Chuanlian Bioteknologisk Institut.Banana Mosaic Disease poison isothermic gene amplification quick detection kit is prepared by following formula:
The primer mixed solution be made up of two pairs of primers, described two pairs of primers are: outer primer 1-CMV-F3, its nucleotide sequence is as shown in SEQ ID NO:l, outer primer 2-CMV-B3, its nucleotide sequence is as shown in SEQ ID NO:2, inner primer 1-CMV-FIP, its nucleotide sequence is as shown in SEQ ID NO:3, inner primer 2-CMV-BIP, its nucleotide sequence is as shown in SEQ IDNO:4, the concentration of described inner primer 1-CMV-FIP and described inner primer 2-CMV-BIP is 40pmol/ μ l, the concentration of described outer primer 1-CMV-F3 and described outer primer 2-CMV-B3 is respectively 5pmol/ μ l,
Concentration is the Bst archaeal dna polymerase of 8U/ μ l;
RNA extracting solution, described RNA extracting solution comprises: 100mM Tris-HCl(pH7.4), 1M KC1,10mM EDTA and 2%PVPP;
Reaction buffer, described reaction buffer comprises: 10mM dNTP(is purchased from sigma), 10 × ThermoPol reaction buffer (purchased from sigma), 150mM MgSO
4, 5mM trimethyl-glycine=8:5:2:10;
Nucleic acid dye 1000 × SYBR Green I;
Positive control: the cDNA containing Banana Mosaic Disease poison coat protein;
Negative control: 100mM Tris-HCl(pH8.0) and 50mM EDTA.
Mentioned reagent box is used to detect Banana Mosaic Disease poison by the following method:
1) the DNA nucleic acid extraction of test sample: add 30 μ l RNA extracting solutions in 0.5mg detected sample (plant gets middle arteries and veins, and seedling gets bulb), after grinding to form pasty state, under 95 DEG C of 10min, 10000rpm centrifugal 2 minutes, gets supernatant as detection template DNA;
2) loop-mediated isothermal amplification: configure reaction soln in 25 μ l PCR pipe: the outer primer 1-CMV-F3 of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:l; The outer primer 2-CMV-B3 of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:2; The inner primer 1-CMV-FIP of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:3; The inner primer 2-CMV-BIP of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:4; The reaction buffer of 12.5 μ l; The Bst archaeal dna polymerase of 1 μ l; The template DNA of 2 μ l; Then 25 μ l are added water to; When positive control reaction is set, replace 1 with the cDNA containing Banana Mosaic Disease poison coat protein) in the detection template DNA that obtains, when negative control reaction is set, use 100mM Tris-HCl(pH8.0) and 50mM EDTA replace 1) in the detection template DNA that obtains, by the PCR pipe containing the reaction soln prepared in 63 DEG C of isothermal reaction 90min;
3) analyze and judge reaction product result: 2) in add nucleic acid dye 1000 × SYBR Green I of 1 μ l in products therefrom, if reaction solution color is orange, represent that result be negative, if reaction solution color be green, expression result is the positive.
Claims (2)
1. a Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit, it is characterized in that, its reagent comprises:
The primer mixed solution be made up of two pairs of primers, described two pairs of primers are: outer primer 1-CMV-F3, its nucleotide sequence is as shown in SEQ ID NO:1, outer primer 2-CMV-B3, its nucleotide sequence is as shown in SEQ ID NO:2, inner primer 1-CMV-FIP, its nucleotide sequence is as shown in SEQ ID NO:3, inner primer 2-CMV-BIP, its nucleotide sequence is as shown in SEQID NO:4, the concentration of described inner primer 1-CMV-FIP and described inner primer 2-CMV-BIP is 40pmol/ μ l, the concentration of described outer primer 1-CMV-F3 and described outer primer 2-CMV-B3 is respectively 5pmol/ μ l,
Concentration is the Bst archaeal dna polymerase of 8U/ μ l;
The ThermoScript II of 8U;
RNA extracting solution, described RNA extracting solution comprises: Tris-HCl, 1M KCl, 10mM EDTA and 2% (w/v) PVPP of 100mM pH7.4;
Reaction buffer, described reaction buffer comprises: 10mM dNTP, 10 × ThermoPol reaction buffer, 150mM MgSO
4, 5mM trimethyl-glycine=8: 5: 2: 10;
Nucleic acid dye;
Positive control: the cDNA containing Banana Mosaic Disease poison coat protein;
Tris-HCl and the 50mM EDTA of negative control: 100mM pH 8.0;
Described nucleic acid dye is 1000 × SYBR Green I.
2. a using method for Banana Mosaic Disease poison constant temperature gene amplification fast detecting kit, the method comprises the following steps:
1) the RNA nucleic acid extraction of test sample: add 30 μ lRNA extracting solutions in 0.5mg detected sample, after grinding to form pasty state, under 95 DEG C of 10min, 10000rpm centrifugal 2 minutes, gets supernatant as detection template RNA;
2) loop-mediated isothermal amplification:
In 25 μ l PCR pipe, configure reaction soln: the outer primer 1-CMV-F3 of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:1; The outer primer 2-CMV-B3 of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:2; The inner primer 1-CMV-FIP of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:3; The inner primer 2-CMV-BIP of 1 μ l, its nucleotide sequence is as shown in SEQ ID NO:4; The reaction buffer of 12.5 μ l; The Bst archaeal dna polymerase 1 μ l of 8U; The ThermoScript II 0.2 μ l of 8U, the template ribonucleic acid of 2 μ l;
Then 25 μ l are added water to; When positive control reaction is set, replace 1 with the cDNA containing Banana Mosaic Disease poison coat protein) in the detection template RNA that obtains, when negative control reaction is set, replace 1 with Tris-HCl and the 50mM EDTA of 100mM pH 8.0) in the detection template RNA that obtains, by the PCR pipe containing the reaction soln prepared in 63 DEG C of isothermal reaction 90min;
3) analyze and judge reaction product result: 2) in add the nucleic acid dye of 1 μ l in products therefrom, if reaction solution color is orange, represent that result be negative, if reaction solution color be green, expression result is the positive;
Described nucleic acid dye is 1000 × SYBR Green I.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210151982.5A CN102703605B (en) | 2012-05-17 | 2012-05-17 | Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210151982.5A CN102703605B (en) | 2012-05-17 | 2012-05-17 | Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102703605A CN102703605A (en) | 2012-10-03 |
| CN102703605B true CN102703605B (en) | 2015-03-11 |
Family
ID=46896651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210151982.5A Expired - Fee Related CN102703605B (en) | 2012-05-17 | 2012-05-17 | Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102703605B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805221B (en) * | 2015-05-15 | 2017-08-25 | 广东省农业科学院植物保护研究所 | For with the primer and method of RT LAMP method quick detections banana virus |
| WO2018100420A1 (en) * | 2016-12-02 | 2018-06-07 | Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional | Method and diagnostic kit for detecting phytopathogenic viruses |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007135526A (en) * | 2005-11-22 | 2007-06-07 | Aichi Prefecture | Method for diagnosing cucumber mosaic virus |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101487060A (en) * | 2008-12-25 | 2009-07-22 | 中山出入境检验检疫局检验检疫技术中心 | PCR primer for heart rot mosaic virus detection method and detection kit thereof |
| CN102154476B (en) * | 2011-01-31 | 2014-06-25 | 中国农业科学院植物保护研究所 | Loop-mediated isothermal amplification (LAMP) detection method for specificity of radopholus similis and application thereof |
-
2012
- 2012-05-17 CN CN201210151982.5A patent/CN102703605B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007135526A (en) * | 2005-11-22 | 2007-06-07 | Aichi Prefecture | Method for diagnosing cucumber mosaic virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102703605A (en) | 2012-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2016054870A1 (en) | Method and use of nucleic acid isothermal amplification via polymerase spiral reaction | |
| CN104561358B (en) | A kind of Herba Dendrobii Phytophthora nicotianae Breda LAMP detection kit and detection method | |
| CN102559928A (en) | Specific primer group, kit comprising the primer group, use method and detection method | |
| CN102703604B (en) | Kit for rapidly detecting banana bunchy top virus by isothermal gene amplification and use method of kit | |
| CN102051416B (en) | LAMP (loop-mediated isothermal amplification) primer group for detecting transgenic corn strain MIR604 at normal temperature | |
| CN110592268A (en) | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) | |
| CN107868849A (en) | Detect primer sets and its application of prawn IHHNV viruses | |
| Das et al. | Optimization of DNA isolation and PCR protocol for RAPD analysis of banana/plantain (Musa spp.) | |
| Li et al. | Morphology and molecular identification of the Eimeria spp. in domestic rabbits | |
| CN102703605B (en) | Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit | |
| CN103773867A (en) | LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method | |
| CN106520937A (en) | Shellfish vibrio parahemolyticus LAMP detection kit and application thereof | |
| CN107849566A (en) | For detecting the method and kit of powdery mildew | |
| CN104419761A (en) | Detection kit for buckwheat allergen ingredients by employing loop-mediated isothermal amplification and application method of kit | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN102168150A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper | |
| CN102676659B (en) | LAMP detection reagent and kit of oil palm damping-off fungi | |
| CN106480231B (en) | Multiple RT-PCR method for simultaneously detecting citrus yellow vein clearing virus and tristeza virus and application thereof | |
| CN106011265A (en) | Molecular biology distinguishing method of larvae of Cnaphalocrocis medinalis and Marsamia patnalis | |
| KR101750837B1 (en) | Primer set for multiple detection MNSV, SqMV, WMV, and CABYV and method for detecting said viruses using the same | |
| CN107419031A (en) | Primer sets, kit and method based on intelligent constant-temperature amplification technique detection salmonella | |
| CN104498633A (en) | NASBA primer, kit and method for detecting peach latent mosaic viroid | |
| CN105936947A (en) | Potato X virus RT-LAMP detection kit and detection method | |
| CN105886619A (en) | Kit and method for detecting claviceps purpurea |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150311 Termination date: 20160517 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |