WO2018093226A1 - Composition pour améliorer une affection cutanée peau comprenant du plasma de sang de cordon ombilical - Google Patents

Composition pour améliorer une affection cutanée peau comprenant du plasma de sang de cordon ombilical Download PDF

Info

Publication number
WO2018093226A1
WO2018093226A1 PCT/KR2017/013219 KR2017013219W WO2018093226A1 WO 2018093226 A1 WO2018093226 A1 WO 2018093226A1 KR 2017013219 W KR2017013219 W KR 2017013219W WO 2018093226 A1 WO2018093226 A1 WO 2018093226A1
Authority
WO
WIPO (PCT)
Prior art keywords
skin
plasma
wound
pharmaceutical composition
present
Prior art date
Application number
PCT/KR2017/013219
Other languages
English (en)
Korean (ko)
Inventor
조성국
김정미
박대휘
황유경
Original Assignee
주식회사 녹십자랩셀
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 녹십자랩셀 filed Critical 주식회사 녹십자랩셀
Publication of WO2018093226A1 publication Critical patent/WO2018093226A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/16—Blood plasma; Blood serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/51—Umbilical cord; Umbilical cord blood; Umbilical stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/98—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/98—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin
    • A61K8/981—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin of mammals or bird
    • A61K8/983—Blood, e.g. plasma
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A61K9/0021—Intradermal administration, e.g. through microneedle arrays, needleless injectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating skin diseases including umbilical cord blood-derived plasma or serum and a cosmetic composition for improving skin condition.
  • Th2 lymphocytes produce IL-4, IL-5, IL-13, and these cytokines produce granular cells such as eosinophils, basophils, and mast cells. Gather to the site of inflammation. Granular cells collected at the site of inflammation are activated either alone or by IgE to release large amounts of inflammatory granules, causing allergic or atopic symptoms.
  • IL-4 and IL-13 produced in Th2 lymphocytes increase antibody production of B lymphocytes.
  • IgE production is increased by inducing isotype switching to IgE, which greatly activates granule cells.
  • Cytokines produced by Th1 and Th2 lymphocytes inhibit the differentiation of the other side.
  • the differentiation and proliferation of Th2 lymphocytes is inhibited by Th1 cytokines.
  • IFN- ⁇ and IL-12 which promote the Th1 response, inhibit the expression of the Th2 cytokine, IL-4, thereby producing antibody and IgE in B lymphocytes.
  • Autoimmune skin disease is a disease accompanied by inflammation caused by the patient's immune system attacking the patient's own normal cells. Due to problems such as environmental pollution, the number of patients has recently increased rapidly, and there is no fundamental treatment method. It is a necessary disease. Accordingly, it is very important to develop a therapeutic agent that does not cause side effects even after long-term use.
  • Collagen a major component of the extracellular matrix, is known to play an important role in healing wounds and maintaining skin elasticity.
  • Collagen is the major substrate protein produced in the fibroblasts of the skin. It is also an important protein, accounting for about 30% of the total weight of biological proteins, and has a solid triple helix structure.
  • Collagen forms most of the organic matter in the skin, tendons, bones and teeth, especially in bones and skin (dermis). Most other body structures exist as fibrous inclusions.
  • the main functions of collagen are known as mechanical firmness of skin, resistance of connective and connective tissues, support of cell adhesion, induction of cell division and differentiation (in organic growth or wound healing). This collagen is reduced by age and photoaging by ultraviolet irradiation, which is known to be closely associated with wrinkle formation of the skin.
  • wound healing begins immediately after being damaged.Wound healing is caused by the peeling of the epidermis and the epidermis damaged by the epidermis and the exposed nerve endings, resulting in a painful and moist wound surface. Will have In the wound where the epidermis is missing while the basement membrane is exposed, the wound surface is bright red.
  • the major components in the repair of skin damage consist of the initial inflammatory response, the proliferation and migration of epithelial cells, and the restoration of the epidermal layer where normal cell donation has been restored. In the case of wounds with missing dermis, epithelial cell recovery and concomitant tissue repair also occur.
  • autoimmune skin disease treatment agents and wound healing accelerators such as atopic dermatitis
  • atopic dermatitis Most of the autoimmune skin disease treatment agents and wound healing accelerators, such as atopic dermatitis, developed up to now, include a large amount of artificially manufactured compounds (steroids, hormones, etc.), which cause skin irritation, resulting in restrictions on long-term use.
  • the most widely used conventional steroid preparations are effective for anti-inflammatory action, immunosuppressive function, allergic disease, etc., but also cause side effects such as pox marks, skin wrinkles, folliculitis, and are not effective for bacterial diseases such as athlete's foot.
  • Ointments containing antibiotics may be resistant and may cause various side effects when used in soft skin wounds such as children. Since the side effects of these steroidal formulations are high in frequency or length of use, the frequency and severity of the steroid preparations are severe, and thus, the treatment of autoimmune skin diseases requiring long-term treatment is restricted.
  • the present inventors have completed the present invention by developing a pharmaceutical composition and a cosmetic composition including plasma or serum derived from umbilical cord blood, which have no side effects even in long-term use, and are excellent in treating autoimmune skin diseases such as atopic dermatitis and promoting wound healing. .
  • An object of the present invention is to provide a pharmaceutical composition excellent in treating autoimmune skin diseases such as atopic dermatitis.
  • Another object of the present invention is to provide a pharmaceutical composition excellent in treating skin diseases such as acne.
  • Another object of the present invention is to provide a pharmaceutical composition excellent in treating skin diseases such as wounds, burns and frostbite.
  • Another object of the present invention is to provide a cosmetic composition excellent in improving skin conditions such as inhibiting skin aging, improving skin wrinkles, alleviating skin inflammation, alleviating acne and promoting regeneration of damaged skin tissue.
  • composition for preventing or treating skin diseases including umbilical cord blood-derived plasma or serum.
  • the skin disease is any one selected from the group consisting of autoimmune skin disease, acne, wound (burn) and frostbite, pharmaceutical composition.
  • the autoimmune skin disease is atopic dermatitis, psoriasis, scleroderma, multiple sclerosis, dermatomyositis, lupus (systemic lupus erythematosus) , Vitiligo, epidermolysis bullosa, bullous pemphigoid, alopecia areata, Behcet's disease and Crohn's disease Either one, the pharmaceutical composition.
  • wound of 3 above wherein the wound is abrasion, incision wound, laceration, avulsion, puncture wound, penetration wound, gunshot wound, Consisting of crushing injury, ulcers, blisters, keloids, keratosis, osteonecrosis, pressure ulcers, and wound caused by infection Any one selected from the group, pharmaceutical composition.
  • the burn is any one selected from the group consisting of thermal burn (chemical burn), chemical burn (chemical burn), electrical burn (radiation burn) and radiation burn (radiation burn).
  • a method for preventing or treating skin diseases comprising administering to the subject a composition of any one of 1 to 10 above.
  • Cosmetic composition for improving skin condition comprising umbilical cord blood-derived plasma or serum.
  • the skin condition improvement is any one selected from the group consisting of skin aging inhibition, skin wrinkle improvement, skin inflammation relief, acne relief and promoting the regeneration of damaged skin tissue, cosmetic composition.
  • a method for improving skin condition comprising applying the composition of any one of 12 to 16 to a subject.
  • composition according to the present invention can effectively treat skin diseases with inflammation.
  • composition according to the present invention can effectively treat skin diseases caused by trauma such as wounds, burns and frostbite.
  • composition according to the invention can be used for a long time without side effects.
  • composition according to the present invention exhibits an effect of relieving inflammation and promoting wound healing due to collagen formation, it is possible to prevent a vicious cycle in which the patient scratches the lesion due to the itch caused by the inflammation of the lesion, thereby causing further inflammation and wounds. .
  • Figure 2 shows the effect of promoting collagen formation in the dermal layer of the composition according to the present invention.
  • Figure 3 shows the effect of reducing the skin inflammation in the atopic dermatitis model and the immune cells (eosinophilic and mast cells) in the dermal layer upon subcutaneous injection of the composition according to the present invention.
  • Figure 4 shows the effect of reducing skin inflammation in the atopic dermatitis model and immune cells (eosinophils and mast cells) in the dermal layer when applying the composition of the present invention.
  • Figure 5 shows the effect of reducing skin inflammation and reducing immune cells (eosinophils and mast cells) in the dermal layer in atopic dermatitis model upon skin application or subcutaneous injection of the composition according to the invention.
  • Figure 6 confirms the effective concentration showing the efficacy in the atopic dermatitis model when applying the skin of the composition according to the present invention.
  • Figure 7 confirms the potency factor indicating the efficacy in the atopic dermatitis model upon skin application of the composition according to the present invention.
  • Figure 8 confirms the effect of reducing the keratinogenesis and the epidermal layer increase in the psoriasis model when applying the skin of the composition according to the invention.
  • the present invention relates to a composition for improving skin condition comprising umbilical cord blood-derived plasma or serum.
  • the present invention relates to a pharmaceutical composition having excellent preventive and therapeutic effects on skin diseases and a cosmetic composition with excellent skin condition improvement effect by including umbilical cord blood-derived plasma or serum. will be.
  • the composition of the present invention is excellent in anti-inflammatory and wound healing promoting effect, there is no side effect even in long-term use, the production method is simple and easy to mass production.
  • the pharmaceutical composition for preventing or treating skin diseases of the present invention includes umbilical cord blood-derived plasma or serum.
  • Cord blood of the present invention means blood obtained from the umbilical cord of the fetus.
  • Plasma of the present invention refers to a pale yellow liquid from which tangible components in the blood have been removed.
  • plasma may be one in which red blood cells and white blood cells are removed from the blood, and further, for example, platelets may be further removed.
  • the serum of the present invention may be one in which red blood cells, white blood cells, platelets and fibrinogen have been removed.
  • the removal means using the centrifugation and the filter to remove the removal target to significantly reduce the residual amount, and does not mean that only 100% removal target is removed.
  • Umbilical cord blood-derived plasma or serum of the present invention may be prepared from umbilical cords discarded during childbirth or stillbirth of the fetus, or may be prepared from umbilical cord plasma or inadequate umbilical cord plasma discarded after umbilical cord storage. Since cord blood plasma or serum generated as a by-product after separation of cord blood is generally discarded, it is easy to supply and inexpensive, which may be advantageous for mass production.
  • Sources of umbilical cord plasma include all species of mammals, including humans and non-human primates, and may include, for example, livestock, including sheep, goats, pigs, horses, dogs, cattle, and other primates, rodents, and the like. .
  • Umbilical cord blood can be collected from the umbilical vein by inserting a needle connected to a blood bag. This blood collection takes place at room temperature, with a maximum of 100 cc per umbilical cord. All of this can be done in a clean room free of contamination.
  • Umbilical cord blood-derived plasma of the present invention may be one that has not been subjected to physical and chemical treatments to increase the amount or activity of platelets after red blood cells and white blood cells are removed.
  • Umbilical cord blood-derived plasma or serum of the present invention may not be subjected to additional treatment with chemicals or the like for platelet activation.
  • Prior art using autologous blood plasma from a patient is complicated by methods of preparation, including processes for activating platelets (e.g., activating platelets with calcium chloride solution), and concerns about side effects due to added chemicals.
  • the cord blood or plasma of the present invention is prepared without such a process, the method of preparing the composition may be simple and advantageous for mass production, and does not cause side effects even when administered for a long time.
  • Skin disease of the present invention means that the skin is damaged by various external or internal factors.
  • the skin disease may be autoimmune skin disease, inflammatory skin disease, acne, wound, burn or frostbite.
  • the autoimmune skin disease of the present invention may be a disease caused by the patient's own immune system attacking normal tissues.
  • autoimmune skin diseases include atopic dermatitis, psoriasis, scleroderma, multiple sclerosis, dermatomyositis, systemic lupus erythematosus, vitiligo, vitiligo, It may be, but is not limited to, epidermolysis bullosa, bullous pemphigoid, alopecia areata, Behcet's disease, or Crohn's disease.
  • Inflammatory skin disease of the present invention means that the skin is inflamed by infection or external stimulation.
  • an inflammatory skin disease may be acne, but is not limited thereto.
  • the wound of the present invention refers to a trauma caused by damage or necrosis of the skin due to a sharp object, a rough surface, heat, repeated compression, blood circulation disorder, diabetes complications, and the like.
  • the wound may be abrasion, incision wound, laceration, avulsion, puncture wound, penetration wound, gunshot wound, crushing injury, It may be, but is not limited to, ulcers, blisters, keloids, keratosis, osteonecrosis, pressure ulcers, or wound caused by infection. .
  • the burn of the present invention means that the skin is damaged by heat, chemicals, electricity, radiation, or the like.
  • the image may be a thermal burn, a chemical burn, an electrical burn, or a radiation burn, but is not limited thereto.
  • the frostbite of the present invention means that the skin is damaged by exposure to low temperatures.
  • the pharmaceutical composition of the present invention may comprise cord blood-derived plasma or serum in an amount of 0.1% to 99.9% by weight based on the total weight of the composition.
  • the pharmaceutical composition of the present invention may be one containing only 100% of umbilical cord plasma or serum without being combined with an excipient, carrier or diluent.
  • the pharmaceutical composition of the present invention may be appropriately adjusted in consideration of the patient's state of health and the degree of skin damage. According to one embodiment, usually for adults, it may be applied or injected into the affected area at a dose of about 0.0001 to about 5 mg / cm 2 once.
  • the pharmaceutical composition of the present invention can be used to adjust the concentration of untreated umbilical cord plasma or serum in the composition, to increase preservation, to prevent oxidation, to prevent precipitation, to buffer pH changes, to facilitate application to affected areas, and the like.
  • Various excipients and carriers such as stabilizers, wetting agents, emollients, fragrances or coloring agents, etc. may be further added to achieve the purpose (for example, to be suitable for use as an injection, or to make the ointment viscous to increase convenience). It may include.
  • excipients and carriers include viscosity modifiers such as beeswax, glyceryl tribehenate, glyceryl trimyristate; Buffers such as potassium metaphosphate, potassium phosphate, monovalent sodium acetate, sodium citrate anhydride; Surfactants such as fatty acid alkali metals, dimethyl dialkyl ammonium halides, alkyl pyridinium halides, alkyl sulfonates, fatty amine oxides, 2-alkylimidazoline quaternary ammonium salts; Thickening agents such as paraffin, silicon dioxide, cetosteryl alcohol, waxes; Diluents such as mannitol, sorbitol, starch, kaolin, sucrose; Preservatives such as parabens; Alkalizing agents such as ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium carbonate, sodium bicarbonate, sodium hydroxide; Acidifying agents such as hydro
  • the pharmaceutical composition of the present invention may be sterilized by various methods known in the art as needed.
  • the pharmaceutical composition of the present invention may be formulated in various forms.
  • the pharmaceutical composition may be formulated as an external preparation or injection.
  • the pharmaceutical compositions of the present invention may be formulated in various forms of external preparations. For example, it may be formulated as a spray or non-spray.
  • the pharmaceutical compositions of the present invention may be formulated into semi-solid, semi-liquid or liquid formulations such as, but not limited to, suspensions, emulsions, creams, ointments, liniments, pastes, gels and the like.
  • the pharmaceutical composition of the present invention may be formulated as an ointment, in which case carriers of higher fatty acids, waxes, lipids, glycerol, higher alcohols or synthetic lipids may be included, but the carriers that can be used are limited thereto. It doesn't happen.
  • the pharmaceutical composition of the present invention may be formulated in the form of patches, dressings, sponges and the like.
  • it may be formulated as a bandage, plaster patch (with or without adhesive), but is not limited thereto.
  • the pharmaceutical composition of the present invention may be formulated in the form of a subcutaneous injection.
  • Excipients used to formulate subcutaneous injections may include, but are not limited to, saline, buffers, preservatives, and the like.
  • compositions of the present invention can be applied to the affected areas of humans or various animals or administered by intradermal or subcutaneous injection.
  • the present invention provides a method for treating autoimmune skin disease, comprising at least one of applying a pharmaceutical composition according to the present invention to an affected part of an animal including a human, intradermal injection, and subcutaneous injection.
  • the animal may be a vertebrate.
  • the animal may be a mammal, such as but not limited to humans, mice, rabbits, guinea pigs, hamsters, dogs, cats, and apes.
  • the cosmetic composition for improving the skin condition of the present invention includes umbilical cord blood-derived plasma or serum.
  • the characteristics of the cord blood-derived plasma or serum included in the cosmetic composition of the present invention are as described for the cord blood-derived plasma or serum included in the pharmaceutical composition of the present invention.
  • the skin condition improvement may be any one selected from the group consisting of skin aging inhibition, skin wrinkle improvement, skin inflammation relief, acne relief and accelerated regeneration of damaged skin tissue.
  • the cosmetic composition of the present invention may be formulated into any one selected from the group consisting of liquids, creams, gels, particles, powders, sheets, pads, pastes, patches, dressings and sponges, but is not limited thereto. It doesn't happen.
  • the cosmetic composition of the present invention by adjusting the concentration of untreated umbilical cord plasma or serum in the composition, increase the shelf life, prevent oxidation, prevent precipitation, buffer the pH change, ointment, gel Or various excipients and carriers such as stabilizers, wetting agents, emollients, fragrances or coloring agents, etc., for achieving the purpose of increasing the convenience by having a viscosity in the form of cream or the like.
  • various excipients and carriers described above in the pharmaceutical composition of the present invention may be used, but are not limited thereto, and various excipients and carriers acceptable as cosmetic compositions may be used.
  • the cosmetic composition of the present invention may include cord blood-derived plasma or serum in an amount of 0.1 wt% to 99.9 wt% based on the total weight of the composition.
  • the cosmetic composition of the present invention may be one containing only 100% of umbilical cord plasma or serum without being combined with an excipient, carrier or diluent.
  • the dosage amount of the cosmetic composition of the present invention may be appropriately adjusted in consideration of the health condition of the patient and the degree of skin damage. According to one embodiment, it can be applied to the skin (eg, face, hands, arms, legs, feet or whole body) at a dose of about 0.0001 to about 5 mg / cm 2 once, usually for adults.
  • the present invention provides a method for preventing or treating skin diseases comprising the step of administering to the subject a pharmaceutical composition for preventing or treating skin diseases.
  • the subject may be a vertebrate.
  • the animal may be a mammal, such as but not limited to humans, mice, rabbits, guinea pigs, hamsters, dogs, cats, and apes.
  • the skin disease may be the skin disease described above.
  • the administration method of the said pharmaceutical composition is not specifically limited, For example, the method of apply
  • the present invention provides a method for improving skin condition comprising applying the pharmaceutical composition for preventing or treating skin disease or a cosmetic composition for improving skin condition to a subject.
  • the subject may be a vertebrate.
  • the animal may be a mammal, such as but not limited to humans, mice, rabbits, guinea pigs, hamsters, dogs, cats, and apes.
  • Skin condition improvement may be the skin condition improvement described above.
  • mice received 6-week-old female Balb / c mice from Orient (Korea). Experimental animals were fed with solid feed and water at the Green Cross R & D Center Laboratory Animal Center, where temperature (24 ⁇ 2), humidity (40-60%) and daylight cycle (12 hours) were maintained. Animal experiments were divided into five animals per cage after one week of environmental adaptation.
  • Egg white albumin, sodium dodecyl sulfate (SDS), hematoxylin-eosin solution, Masson-trichrome stain kit, toluidine blue, Giemsa solution and xylene Ethanol were purchased from Sigma-Aldrich (St Louis, MO, USA).
  • Adjuvant for inducing an immune response was purchased from imject ® Alum (Thermo Scientific, Fremont, CA, USA).
  • Imiquimod for psoriasis induction was used to purchase Aldara cream (Dong-A Pharmaceutical, Korea).
  • Tegaderm TM (3M, USA) was purchased and used to fix gauze after egg white albumin and alda cream and plasma application.
  • Cord blood plasma was supplied from cord blood plasma (Yongin, korea) and cord blood plasma and inadequate cord blood plasma discarded after storage of cord blood.
  • mice were treated in the normal group (No treat), PBS treated group (PBS), untreated umbilical cord plasma spread group (CB plasma spread) of the present invention, Treatment was divided into four groups, including umbilical cord plasma dermal injection group (CB plasma Dermal injection).
  • PBS PBS treated group
  • CB plasma spread untreated umbilical cord plasma spread group
  • the wound was covered with a 1 ⁇ 1 cm 2 gauze over the induced circular wound and the tegaderm covered thereon.
  • the cord blood plasma application group was immersed in 100 l of gauze plasma plasma (CB plasma) every 3 to 4 days and placed on the wound and fixed with tegaderm.
  • CB plasma gauze plasma plasma
  • Untreated umbilical cord plasma dermal injection group of the present invention was injected into the skin around the wound by 25 ⁇ l each by using a 0.3cc syringe at intervals of 3 to 4 days, and then covered with gauze and fixed with tegaderm. Two weeks later, tissues were collected by euthanasia of the experimental animals using the cervical dislocation method for tissue analysis. The wound regeneration rate in the wound treatment mouse model was compared by counting the number of pixels in the wound-induced area image using photosensitive and calculating the wound opening rate.
  • the wound was closed about 30% in the control group compared to about 75% of the untreated umbilical cord plasma application of the present invention and close to about 60% of the injection on the 8th day.
  • the dorsal skin tissue of the mouse was separated and fixed with 4% PFA for 4 to 24 hours, and then paraffin-embedded sections having a thickness of 4 ⁇ m were prepared (Genia, korea).
  • the prepared paraffin fragment was deparaffinized with xylene and then treated with progressively diluted alcohol to proceed with the functionalization process.
  • Skin tissue was stained using a staining reagent such as hematoxylin-eosin solution, Masson-trichrome stain kit, toluidine blue, and Giemsa solution.
  • a staining reagent such as hematoxylin-eosin solution, Masson-trichrome stain kit, toluidine blue, and Giemsa solution.
  • imject ® Alum containing 20 ⁇ g of egg white albumin were injected intraperitoneally for three weeks.
  • the SDS was wiped off using distilled water.
  • 100 ⁇ l of egg white albumin of 1 ⁇ g / ⁇ l in total 4 times at intervals of 3 to 4 days for 2 weeks after 1 day was covered with gauze and fixed on the back of the mouse and fixed with tegaderm.
  • the coated SDS solution was dried, the SDS was wiped off using distilled water. 1 ⁇ g / ⁇ l of egg white albumin 100 ⁇ l was applied to the back of the mouse, and fixed with tegaderm.
  • mast cells were respectively reduced to 57% and 62% at the time of subcutaneous injection compared to the PBS-treated group, respectively, eosinophils.
  • eosinophils was decreased to 50% at subcutaneous injection and 57% at application.
  • mast cells were reduced to 57% and 70% at subcutaneous injection compared to PBS group, and eosinophils were 45% at subcutaneous injection and 68% at application.
  • the protein contained in each plasma was 23.4 mg / ml for untreated cord plasma and 54.1 mg / ml for adult plasma. It was confirmed that the untreated umbilical cord plasma of the present invention had the same or higher potency as the adult plasma even with a smaller amount of protein.
  • the Balb / c mice in the normal group (PBS), atopy-induced group (OVA), atopy-induced group in the total protein concentration of 0.4, 0.8, 1.2, 1.6, 2.0 mg / ml in the present invention The study was divided into twelve groups, five groups of untreated umbilical cord plasma and five groups of adult plasma.
  • the SDS was wiped off using distilled water. After 1 day, 100 ⁇ l of egg white albumin of 1 ⁇ g / ⁇ l in a total of 4 times at intervals of 3 to 4 days for 2 weeks was covered with gauze and fixed on the back of the mouse and fixed with tegaderm.
  • PBS or untreated cord blood plasma and untreated adult plasma of the present invention were diluted to a total protein concentration of 0.4, 0.8, 1.2, 1.6, and 2.0 mg / ml. It was moistened and covered with the back of the mouse and fixed with tegaderm.
  • FIG. 6b shows that when untreated umbilical cord plasma (left) and adult plasma (right) of the present invention are applied according to concentrations, in the case of mast cells, adult plasma (right) is treated at a concentration of 0.8 mg / ml or more.
  • the treatment of the untreated umbilical cord plasma (left) of the present invention was similar to that of 0.4 mg / ml.
  • the treatment of adult plasma (right) at a concentration of 1.2 mg / ml was performed. Similar effect was obtained with treatment of cord blood plasma (left) at 0.4 mg / ml.
  • the untreated umbilical cord plasma of the present invention exhibits about 2-3 times the effect at the same concentration as the adult plasma, and compared to the atopy-induced group, mast cells and eosinophils of the present invention.
  • Treatment with only 0.4 mg / ml of untreated umbilical cord plasma reduced more than 50%, and treatment with 1.2 mg / ml was found to be reduced by more than 75%.
  • Example 7 in atopy induction model No treatment Cord Blood Plasma Potency Factor Assessment
  • atopy-induced model was carried out in the Balb / c mice each of the normal group (PBS), atopy-induced group (OVA), atopy-induced group 0.4, 0.8, 1.2, 1.6, 2.0 mg / ml total protein concentration of the present invention
  • PBS normal group
  • OVA atopy-induced group
  • atopy-induced group 0.4, 0.8, 1.2, 1.6, 2.0 mg / ml total protein concentration of the present invention Five groups of untreated umbilical cord plasma and five groups of adult plasma were divided into 12 groups.
  • the SDS was wiped off using distilled water. 1 ⁇ g / ⁇ l of egg white albumin 100 ⁇ l was applied to the back of the mouse and fixed with tegaderm four times at intervals of 3-4 days for 2 weeks after 1 day.
  • untreated cord blood plasma and untreated adult plasma of PBS or the present invention were diluted to a total protein concentration of 0.4, 0.8, 1.2, 1.6, 2.0 mg / ml, and 100 ⁇ l was added to the gauze. It was moistened and covered with the back of the mouse and fixed with tegaderm.
  • atopy-induced skin tissue was collected by euthanasia of the experimental animals using the cervical dislocation method for tissue analysis.
  • the collected tissues were subjected to RT-PCR to determine the expression level of atopic inflammation regulators IL-4, IL-6, IL-8, IL-13, and INF- ⁇ .
  • Each skin tissue obtained above was dissolved with 0.3 g trizol reagent (Invitrogen). Transfer the dissolved sample to a 1.5 ml tube, add 200 ⁇ l of chloroform, and centrifuge at 12,000 g for 20 minutes. Mix the supernatant and isopropanol 1: 1 at 12,000 g for 20 minutes.
  • RNA was completely precipitated, washed three times with ethanol and dissolved in 30 ⁇ l of DEPC-water to obtain total RNA.
  • PCR polymerase chain reaction
  • the primers used were IL-4 forward AAGAACACCACAGAGAGTGAG CTC (SEQ ID NO: 1), IL-4 reverse TTTCAGTGTGGACTTCCACTC (SEQ ID NO: 2), IL-6 forward AACCTTCC AAAGATGGCTGA A (SEQ ID NO: 3), IL-6 reverse CAGGAACTGGATCAGGACTTT (SEQ ID NO: 4) , IL-8 forward TCAGTGCATAAAGACATACTCC (SEQ ID NO: 5), IL-8 reverse TGGCATCTTCACTGATTCTTG (SEQ ID NO: 6), IL-13 forward AGCATGGTATGGAGTGTGGACCTG (SEQ ID NO: 7), IL-13 reverse CAGT TGCTTTGTGTAGCTGAGCAG (SEQ ID NO: 8), INF- ⁇ forward GTCAACAACCCACAGGTCCA (SEQ ID NO: 9), INF- ⁇ reverse ACTCCTTTTCCGCTTCCTGA (SEQ ID NO: 10), GAPDH forward GAGGGGC CATCCACAGTCTTC (
  • the cytokines IL-4, IL-6, IL-8, and IL-13 which induce an atopic inflammatory response upon induction of atopy by OVA treatment, increase and inhibit atopic inflammation. It was confirmed that the IFN- ⁇ decreased (Green box).
  • the treatment of untreated umbilical cord plasma of the present invention was found to decrease with increasing concentrations of inflammatory-induced cytokines IL-4, IL-6, IL-8, IL-13 untreated umbilical cord plasma, and adults.
  • IL-4, IL-6 was found to significantly reduce the expression of the untreated umbilical cord plasma of the present invention at a concentration of 2.0 mg / ml of total protein (Red box).
  • the treatment of untreated umbilical cord plasma of the present invention was confirmed to increase with increasing treatment concentration, but in the case of adult plasma, the amount of increase of IFN- ⁇ was insignificant.
  • the untreated umbilical cord plasma of the present invention inhibits the expression of atopy-induced cytokines IL-4, IL-6, IL-8, IL-13, and in particular, the expression of IL-4, IL-6 in adult plasma. It was confirmed that the present invention effectively inhibits atopic dermatitis symptoms by effectively inhibiting and increasing the expression of the atopic inhibitory cytokine IFN- ⁇ .
  • Example 8 psoriasis Evaluation of Therapeutic Efficacy of Umbilical Cord Blood Plasma in a Model
  • mice Experiments using the psoriasis induction model divided into four groups of five Balb / c mice, including a normal group (No treat), a Vaseline skin application group, a psoriasis-induced PBS application group, and a psoriasis-free untreated umbilical cord plasma application group. Proceeded.
  • Aldara cream (Dong-A Pharm) was applied to 62.5mg and so on at 2 days intervals. At this time, vaceline was applied to the back in the same amount as a control.
  • 100 ⁇ l of untreated cord blood plasma, untreated adult plasma, and PBS of the present invention were soaked in gauze, and covered with tegaderm.
  • Example 1 to Example 8 the pharmaceutical composition according to the present invention is excellent in the autoimmune skin disease treatment effect and wound healing promoting effect.
  • autoimmune skin diseases and wounds are often accompanied by itching, so that the patient's scratching of the affected area destroys the tissues of the epidermis, worsens inflammation, worsens itching, and increases the risk of secondary infection.
  • the symptoms continue to worsen through a vicious cycle, and the composition according to the present invention exhibits both an anti-inflammatory effect and an effect of promoting wound healing due to collagen formation, which is very effective in treating such autoimmune skin diseases and promoting wound healing. effective.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • Dermatology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Reproductive Health (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Birds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne une composition pour améliorer une affection cutanée comprenant du plasma ou du sérum dérivé de sang du cordon ombilical et, plus particulièrement, une composition pharmaceutique ayant un excellent effet de prévention et de traitement de maladies de la peau et une composition cosmétique ayant un excellent effet d'amélioration de l'état de la peau par le fait qu'elle comprend du plasma ou du sérum dérivé de sang de cordon ombilical. La composition de la présente invention présente d'excellents effets anti-inflammatoires et favorisant la cicatrisation des plaies, n'a pas d'effets secondaires même lors d'une utilisation à long terme, est facile à fabriquer, et peut être facilement produite en masse.
PCT/KR2017/013219 2016-11-21 2017-11-21 Composition pour améliorer une affection cutanée peau comprenant du plasma de sang de cordon ombilical WO2018093226A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160154689A KR20180056853A (ko) 2016-11-21 2016-11-21 제대혈 혈장을 포함하는 피부상태 개선용 조성물
KR10-2016-0154689 2016-11-21

Publications (1)

Publication Number Publication Date
WO2018093226A1 true WO2018093226A1 (fr) 2018-05-24

Family

ID=62145585

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/013219 WO2018093226A1 (fr) 2016-11-21 2017-11-21 Composition pour améliorer une affection cutanée peau comprenant du plasma de sang de cordon ombilical

Country Status (2)

Country Link
KR (1) KR20180056853A (fr)
WO (1) WO2018093226A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150050331A1 (en) * 2013-04-25 2015-02-19 Novo Solutions Md, Llc Method for making a topical composition comprising growth factors derived from human umbilical cord blood platelets
WO2016042041A1 (fr) * 2014-09-16 2016-03-24 Fundacion Publica Andaluza Progreso Y Salud Utilisation de sang de cordon pour traiter les maladies médiées par les cellules nk et les maladies médiées par l'ifn-γ
WO2016109655A1 (fr) * 2014-12-31 2016-07-07 Anthrogenesis Corporation Procédés d'isolement de plaquettes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150050331A1 (en) * 2013-04-25 2015-02-19 Novo Solutions Md, Llc Method for making a topical composition comprising growth factors derived from human umbilical cord blood platelets
WO2016042041A1 (fr) * 2014-09-16 2016-03-24 Fundacion Publica Andaluza Progreso Y Salud Utilisation de sang de cordon pour traiter les maladies médiées par les cellules nk et les maladies médiées par l'ifn-γ
WO2016109655A1 (fr) * 2014-12-31 2016-07-07 Anthrogenesis Corporation Procédés d'isolement de plaquettes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HASHEMI, S.S. ET AL.: "The in Vitro Effect of Different Cord Blood Platelet Rich Plasma Concentrations on Proliferation of Dermal Fibroblasts", BIOSCIENCES BIOTECHNOLOGY RESEARCH ASIA, vol. 1 3, no. 3, September 2016 (2016-09-01), pages 1709 - 1713 *
KIM, DAE HUN ET AL.: "Can Platelet-rich Plasma Be Used for Skin Rejuvenation? Evaluation of Effects of Platelet-rich Plasma on Human Dermal Fibroblast", ANNALS OF DERMATOLOGY, vol. 23, no. 4, 2011, pages 424 - 431, XP055209835 *

Also Published As

Publication number Publication date
KR20180056853A (ko) 2018-05-30

Similar Documents

Publication Publication Date Title
JP3706615B2 (ja) 肌のしわ予防及び低減のための組成物
KR20180094915A (ko) 건선, 아토피성 피부염, 만성 두드러기, 항히스타민-내성 가려움증 및 노인성 가려움증의 치료를 위한 암보라 추출물 및 녹차 추출물을 포함하는 조성물
JP2013060455A (ja) ハチ毒を有効成分とする組成物
WO2012020989A2 (fr) Composition pharmaceutique ou cosmétique contenant de l'acide nicotinique adénine dinucléotide phosphate ou un dérivé de celui-ci
RU2583137C2 (ru) Способ лечения кожных нарушений
WO2011096688A2 (fr) Composition pour améliorer la santé du cuir chevelu et des cheveux comprenant un dérivé de dibenzo-p-dioxine
WO2018093226A1 (fr) Composition pour améliorer une affection cutanée peau comprenant du plasma de sang de cordon ombilical
WO2018143692A1 (fr) Composition pharmaceutique comprenant comme principe actif de la poudre d'écorce primaire d'orme ou de racine d'ulmus davidiana afin de traiter des plaies et de régénérer la peau
WO2017119756A1 (fr) Nouveau peptide fonctionnel anti-inflammatoire, blanchissant la peau, anti-âge et atténuant les rides, et composition contenant le peptide
WO2019143145A1 (fr) Composition pour le traitement d'une inflammation cutanée, comprenant de la résolvine d2 en tant que principe actif
WO2017146341A1 (fr) Composition pour le traitement des plaies, contenant de la daphnine, et son utilisation
WO2016148324A1 (fr) Méthode de sélection de matériau fonctionnel de protection contre la lumière du soleil et méthode d'évaluation d'effet de protection contre la lumière du soleil
WO2020222552A1 (fr) Composition pharmaceutique, comprenant de la 6-diazo-5-oxo-l-norleucine, pour le traitement d'une maladie cutanée inflammatoire
EP4061355A1 (fr) Composés anti-inflammatoires destinés à être utilisés dans le traitement d'affections de la peau
EP4070798A1 (fr) Composition de cicatrisation de plaies chroniques et son application
WO2007133641A1 (fr) Protection améliorée contre des lésions cutanées chez des humains
Sakthibalan et al. Evaluation of wound healing effect of colostrum and curcumin cream in rat excision wound model
CN113929750B (zh) 一种具有修复皮肤屏障功能的多肽及其应用
WO2023090781A1 (fr) Composition destinée à prévenir et améliorer la rosacée cutanée comprenant de l'acide isochlorogénique ou un sel de celui-ci en tant que principe actif
WO2013070018A1 (fr) Composition comprenant de l'acide carnosique ou un dérivé de celui-ci
WO2024043715A1 (fr) Composition comprenant des exosomes dérivés de cellules souches pluripotentes induites et du collagène en tant que principes actifs, et leurs utilisations
JPWO2019069354A1 (ja) 頭皮若しくは皮膚の改質、創傷治癒、または毛髪の改質に用いられるための医薬組成物
WO2023140406A1 (fr) COMPOSITION PHARMACEUTIQUE COMPRENANT DU β-SITOSTÉROL POUR PRÉVENIR OU TRAITER LA SARCOPÉNIE
KR20220059777A (ko) 뱀독 첨가에 의한 숙성된 밍크오일을 유효성분으로 하는 상처 또는 화상 치료용 조성물
WO2016163751A9 (fr) Composition pour la prévention ou le traitement de la dermatite atopique comprenant une structure d'adn en forme de x comme ingrédient actif

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17871332

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17871332

Country of ref document: EP

Kind code of ref document: A1