WO2018093226A1 - Composition for improving skin condition including umbilical cord blood plasma - Google Patents

Abstract

The present invention relates to a composition for improving skin condition comprising plasma or serum derived from umbilical cord blood and, more particularly, to a pharmaceutical composition having an excellent effect of preventing and treating skin diseases and a cosmetic composition having an excellent effect of improving skin condition by comprising plasma or serum derived from umbilical cord blood. The composition of the present invention has excellent anti-inflammatory and wound healing promoting effects, has no side effects even in long-term use, is easy to manufacture, and can be mass-produced easily.

Description

Composition for improving skin condition comprising cord blood plasma

The present invention relates to a pharmaceutical composition for preventing or treating skin diseases including umbilical cord blood-derived plasma or serum and a cosmetic composition for improving skin condition.

Autoimmune responses originate from abnormalities in the immune system, and Th2 responses are known to play a central role. Activated Th2 lymphocytes produce IL-4, IL-5, IL-13, and these cytokines produce granular cells such as eosinophils, basophils, and mast cells. Gather to the site of inflammation. Granular cells collected at the site of inflammation are activated either alone or by IgE to release large amounts of inflammatory granules, causing allergic or atopic symptoms. In addition, IL-4 and IL-13 produced in Th2 lymphocytes increase antibody production of B lymphocytes. In particular, IgE production is increased by inducing isotype switching to IgE, which greatly activates granule cells. Cytokines produced by Th1 and Th2 lymphocytes, respectively, inhibit the differentiation of the other side. In other words, the differentiation and proliferation of Th2 lymphocytes is inhibited by Th1 cytokines. In particular, IFN-γ and IL-12, which promote the Th1 response, inhibit the expression of the Th2 cytokine, IL-4, thereby producing antibody and IgE in B lymphocytes. Reduce isotype switching to the furnace. Therefore, research is ongoing to reduce allergic and atopic responses through Th1 and Th2 balance control.

Autoimmune skin disease is a disease accompanied by inflammation caused by the patient's immune system attacking the patient's own normal cells. Due to problems such as environmental pollution, the number of patients has recently increased rapidly, and there is no fundamental treatment method. It is a necessary disease. Accordingly, it is very important to develop a therapeutic agent that does not cause side effects even after long-term use.

Collagen, a major component of the extracellular matrix, is known to play an important role in healing wounds and maintaining skin elasticity. Collagen is the major substrate protein produced in the fibroblasts of the skin. It is also an important protein, accounting for about 30% of the total weight of biological proteins, and has a solid triple helix structure. Collagen forms most of the organic matter in the skin, tendons, bones and teeth, especially in bones and skin (dermis). Most other body structures exist as fibrous inclusions. The main functions of collagen are known as mechanical firmness of skin, resistance of connective and connective tissues, support of cell adhesion, induction of cell division and differentiation (in organic growth or wound healing). This collagen is reduced by age and photoaging by ultraviolet irradiation, which is known to be closely associated with wrinkle formation of the skin.

In case of external skin damage, wound healing begins immediately after being damaged.Wound healing is caused by the peeling of the epidermis and the epidermis damaged by the epidermis and the exposed nerve endings, resulting in a painful and moist wound surface. Will have In the wound where the epidermis is missing while the basement membrane is exposed, the wound surface is bright red. The major components in the repair of skin damage consist of the initial inflammatory response, the proliferation and migration of epithelial cells, and the restoration of the epidermal layer where normal cell donation has been restored. In the case of wounds with missing dermis, epithelial cell recovery and concomitant tissue repair also occur.

Most of the autoimmune skin disease treatment agents and wound healing accelerators, such as atopic dermatitis, developed up to now, include a large amount of artificially manufactured compounds (steroids, hormones, etc.), which cause skin irritation, resulting in restrictions on long-term use.

In particular, the most widely used conventional steroid preparations are effective for anti-inflammatory action, immunosuppressive function, allergic disease, etc., but also cause side effects such as pox marks, skin wrinkles, folliculitis, and are not effective for bacterial diseases such as athlete's foot. Ointments containing antibiotics may be resistant and may cause various side effects when used in soft skin wounds such as children. Since the side effects of these steroidal formulations are high in frequency or length of use, the frequency and severity of the steroid preparations are severe, and thus, the treatment of autoimmune skin diseases requiring long-term treatment is restricted.

Various studies have been conducted to reduce the side effects of hormones or compound preparations used in the prior art, but therapeutic agents for autoimmune skin diseases such as atopic dermatitis and wound healing accelerators have limited therapeutic effects or risk of serious side effects in long-term use. There is a disadvantage such as not free, the development of a therapeutic agent that can replace this situation is urgently needed.

Accordingly, the present inventors have completed the present invention by developing a pharmaceutical composition and a cosmetic composition including plasma or serum derived from umbilical cord blood, which have no side effects even in long-term use, and are excellent in treating autoimmune skin diseases such as atopic dermatitis and promoting wound healing. .

An object of the present invention is to provide a pharmaceutical composition excellent in treating autoimmune skin diseases such as atopic dermatitis.

Another object of the present invention is to provide a pharmaceutical composition excellent in treating skin diseases such as acne.

Another object of the present invention is to provide a pharmaceutical composition excellent in treating skin diseases such as wounds, burns and frostbite.

Another object of the present invention is to provide a cosmetic composition excellent in improving skin conditions such as inhibiting skin aging, improving skin wrinkles, alleviating skin inflammation, alleviating acne and promoting regeneration of damaged skin tissue.

1. Pharmaceutical composition for preventing or treating skin diseases, including umbilical cord blood-derived plasma or serum.

2. The pharmaceutical composition of 1 above, wherein the plasma is not treated to increase the amount or activity of platelets.

3. In the above 1, wherein the skin disease is any one selected from the group consisting of autoimmune skin disease, acne, wound (burn) and frostbite, pharmaceutical composition.

4. In the above 3, the autoimmune skin disease is atopic dermatitis, psoriasis, scleroderma, multiple sclerosis, dermatomyositis, lupus (systemic lupus erythematosus) , Vitiligo, epidermolysis bullosa, bullous pemphigoid, alopecia areata, Behcet's disease and Crohn's disease Either one, the pharmaceutical composition.

5. The wound of 3 above, wherein the wound is abrasion, incision wound, laceration, avulsion, puncture wound, penetration wound, gunshot wound, Consisting of crushing injury, ulcers, blisters, keloids, keratosis, osteonecrosis, pressure ulcers, and wound caused by infection Any one selected from the group, pharmaceutical composition.

6. In the above 3, wherein the burn is any one selected from the group consisting of thermal burn (chemical burn), chemical burn (chemical burn), electrical burn (radiation burn) and radiation burn (radiation burn).

7. The pharmaceutical composition of 1 above, which is formulated as an injection or external preparation.

8. The pharmaceutical composition of claim 7, wherein the injection is intradermal injection or subcutaneous injection.

9. The pharmaceutical composition of 1 above, which increases collagen formation in the dermal layer.

10. The pharmaceutical composition according to the above 1, which reduces eosinophils and mast cells in the dermal layer.

11. A method for preventing or treating skin diseases comprising administering to the subject a composition of any one of 1 to 10 above.

12. Cosmetic composition for improving skin condition comprising umbilical cord blood-derived plasma or serum.

13. In the above 12, wherein the plasma is not treated to increase the amount or activity of platelets, cosmetic composition.

14. According to the above 12, wherein the skin condition improvement is any one selected from the group consisting of skin aging inhibition, skin wrinkle improvement, skin inflammation relief, acne relief and promoting the regeneration of damaged skin tissue, cosmetic composition.

15. The cosmetic composition according to the above 12, which increases collagen formation in the dermal layer.

16. The cosmetic composition according to the above 12, which reduces eosinophils and mast cells in the dermal layer.

17. A method for improving skin condition comprising applying the composition of any one of 12 to 16 to a subject.

The composition according to the present invention can effectively treat skin diseases with inflammation.

The composition according to the present invention can effectively treat skin diseases caused by trauma such as wounds, burns and frostbite.

The composition according to the invention can be used for a long time without side effects.

Since the composition according to the present invention exhibits an effect of relieving inflammation and promoting wound healing due to collagen formation, it is possible to prevent a vicious cycle in which the patient scratches the lesion due to the itch caused by the inflammation of the lesion, thereby causing further inflammation and wounds. .

1 shows the effect of promoting wound healing of the composition according to the present invention.

Figure 2 shows the effect of promoting collagen formation in the dermal layer of the composition according to the present invention.

Figure 3 shows the effect of reducing the skin inflammation in the atopic dermatitis model and the immune cells (eosinophilic and mast cells) in the dermal layer upon subcutaneous injection of the composition according to the present invention.

Figure 4 shows the effect of reducing skin inflammation in the atopic dermatitis model and immune cells (eosinophils and mast cells) in the dermal layer when applying the composition of the present invention.

Figure 5 shows the effect of reducing skin inflammation and reducing immune cells (eosinophils and mast cells) in the dermal layer in atopic dermatitis model upon skin application or subcutaneous injection of the composition according to the invention.

Figure 6 confirms the effective concentration showing the efficacy in the atopic dermatitis model when applying the skin of the composition according to the present invention.

Figure 7 confirms the potency factor indicating the efficacy in the atopic dermatitis model upon skin application of the composition according to the present invention.

Figure 8 confirms the effect of reducing the keratinogenesis and the epidermal layer increase in the psoriasis model when applying the skin of the composition according to the invention.

The present invention relates to a composition for improving skin condition comprising umbilical cord blood-derived plasma or serum. The present invention relates to a pharmaceutical composition having excellent preventive and therapeutic effects on skin diseases and a cosmetic composition with excellent skin condition improvement effect by including umbilical cord blood-derived plasma or serum. will be. The composition of the present invention is excellent in anti-inflammatory and wound healing promoting effect, there is no side effect even in long-term use, the production method is simple and easy to mass production.

Hereinafter, the present invention will be described in detail.

The pharmaceutical composition for preventing or treating skin diseases of the present invention includes umbilical cord blood-derived plasma or serum.

Cord blood of the present invention means blood obtained from the umbilical cord of the fetus.

Plasma of the present invention refers to a pale yellow liquid from which tangible components in the blood have been removed. For example, plasma may be one in which red blood cells and white blood cells are removed from the blood, and further, for example, platelets may be further removed. The serum of the present invention may be one in which red blood cells, white blood cells, platelets and fibrinogen have been removed. In this case, the removal means using the centrifugation and the filter to remove the removal target to significantly reduce the residual amount, and does not mean that only 100% removal target is removed.

Umbilical cord blood-derived plasma or serum of the present invention may be prepared from umbilical cords discarded during childbirth or stillbirth of the fetus, or may be prepared from umbilical cord plasma or inadequate umbilical cord plasma discarded after umbilical cord storage. Since cord blood plasma or serum generated as a by-product after separation of cord blood is generally discarded, it is easy to supply and inexpensive, which may be advantageous for mass production.

Sources of umbilical cord plasma include all species of mammals, including humans and non-human primates, and may include, for example, livestock, including sheep, goats, pigs, horses, dogs, cattle, and other primates, rodents, and the like. .

Umbilical cord blood can be collected from the umbilical vein by inserting a needle connected to a blood bag. This blood collection takes place at room temperature, with a maximum of 100 cc per umbilical cord. All of this can be done in a clean room free of contamination.

Umbilical cord blood-derived plasma of the present invention may be one that has not been subjected to physical and chemical treatments to increase the amount or activity of platelets after red blood cells and white blood cells are removed. Umbilical cord blood-derived plasma or serum of the present invention may not be subjected to additional treatment with chemicals or the like for platelet activation. Prior art using autologous blood plasma from a patient is complicated by methods of preparation, including processes for activating platelets (e.g., activating platelets with calcium chloride solution), and concerns about side effects due to added chemicals. However, since the cord blood or plasma of the present invention is prepared without such a process, the method of preparing the composition may be simple and advantageous for mass production, and does not cause side effects even when administered for a long time.

Skin disease of the present invention means that the skin is damaged by various external or internal factors. According to one embodiment, the skin disease may be autoimmune skin disease, inflammatory skin disease, acne, wound, burn or frostbite.

The autoimmune skin disease of the present invention may be a disease caused by the patient's own immune system attacking normal tissues. For example, autoimmune skin diseases include atopic dermatitis, psoriasis, scleroderma, multiple sclerosis, dermatomyositis, systemic lupus erythematosus, vitiligo, vitiligo, It may be, but is not limited to, epidermolysis bullosa, bullous pemphigoid, alopecia areata, Behcet's disease, or Crohn's disease.

Inflammatory skin disease of the present invention means that the skin is inflamed by infection or external stimulation. For example, an inflammatory skin disease may be acne, but is not limited thereto.

The wound of the present invention refers to a trauma caused by damage or necrosis of the skin due to a sharp object, a rough surface, heat, repeated compression, blood circulation disorder, diabetes complications, and the like. For example, the wound may be abrasion, incision wound, laceration, avulsion, puncture wound, penetration wound, gunshot wound, crushing injury, It may be, but is not limited to, ulcers, blisters, keloids, keratosis, osteonecrosis, pressure ulcers, or wound caused by infection. .

The burn of the present invention means that the skin is damaged by heat, chemicals, electricity, radiation, or the like. For example, the image may be a thermal burn, a chemical burn, an electrical burn, or a radiation burn, but is not limited thereto.

The frostbite of the present invention means that the skin is damaged by exposure to low temperatures.

The pharmaceutical composition of the present invention may comprise cord blood-derived plasma or serum in an amount of 0.1% to 99.9% by weight based on the total weight of the composition. In addition, the pharmaceutical composition of the present invention may be one containing only 100% of umbilical cord plasma or serum without being combined with an excipient, carrier or diluent.

The pharmaceutical composition of the present invention may be appropriately adjusted in consideration of the patient's state of health and the degree of skin damage. According to one embodiment, usually for adults, it may be applied or injected into the affected area at a dose of about 0.0001 to about 5 mg / cm ² once.

The pharmaceutical composition of the present invention can be used to adjust the concentration of untreated umbilical cord plasma or serum in the composition, to increase preservation, to prevent oxidation, to prevent precipitation, to buffer pH changes, to facilitate application to affected areas, and the like. Various excipients and carriers such as stabilizers, wetting agents, emollients, fragrances or coloring agents, etc. may be further added to achieve the purpose (for example, to be suitable for use as an injection, or to make the ointment viscous to increase convenience). It may include.

For example, such excipients and carriers include viscosity modifiers such as beeswax, glyceryl tribehenate, glyceryl trimyristate; Buffers such as potassium metaphosphate, potassium phosphate, monovalent sodium acetate, sodium citrate anhydride; Surfactants such as fatty acid alkali metals, dimethyl dialkyl ammonium halides, alkyl pyridinium halides, alkyl sulfonates, fatty amine oxides, 2-alkylimidazoline quaternary ammonium salts; Thickening agents such as paraffin, silicon dioxide, cetosteryl alcohol, waxes; Diluents such as mannitol, sorbitol, starch, kaolin, sucrose; Preservatives such as parabens; Alkalizing agents such as ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium carbonate, sodium bicarbonate, sodium hydroxide; Acidifying agents such as hydrochloric acid, nitric acid, acetic acid, amino acids, citric acid, fumaric acid; Antioxidants such as ascorbic acid, sodium ascorbate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, sodium formaldehyde sulfoxylate; Emulsifying or suspending agents such as PVP, gelatin, natural sugars, acacia, guar gum, agar, bentonite, carboxymethylcellulose sodium, polyethylene glycol; stabilizator; At least one selected from the group consisting of colorants such as iron oxide, titanium dioxide or aluminum lake, and the like, but is not limited thereto, and various pharmaceutically acceptable excipients and carriers may be used.

The pharmaceutical composition of the present invention may be sterilized by various methods known in the art as needed.

The pharmaceutical composition of the present invention may be formulated in various forms. For example, the pharmaceutical composition may be formulated as an external preparation or injection.

According to one embodiment, the pharmaceutical compositions of the present invention may be formulated in various forms of external preparations. For example, it may be formulated as a spray or non-spray. In addition, for example, the pharmaceutical compositions of the present invention may be formulated into semi-solid, semi-liquid or liquid formulations such as, but not limited to, suspensions, emulsions, creams, ointments, liniments, pastes, gels and the like.

According to another embodiment, the pharmaceutical composition of the present invention may be formulated as an ointment, in which case carriers of higher fatty acids, waxes, lipids, glycerol, higher alcohols or synthetic lipids may be included, but the carriers that can be used are limited thereto. It doesn't happen.

According to another embodiment, the pharmaceutical composition of the present invention may be formulated in the form of patches, dressings, sponges and the like. For example, it may be formulated as a bandage, plaster patch (with or without adhesive), but is not limited thereto.

According to another embodiment, the pharmaceutical composition of the present invention may be formulated in the form of a subcutaneous injection. Excipients used to formulate subcutaneous injections may include, but are not limited to, saline, buffers, preservatives, and the like.

The pharmaceutical compositions of the present invention can be applied to the affected areas of humans or various animals or administered by intradermal or subcutaneous injection.

The present invention provides a method for treating autoimmune skin disease, comprising at least one of applying a pharmaceutical composition according to the present invention to an affected part of an animal including a human, intradermal injection, and subcutaneous injection.

According to one embodiment, the animal may be a vertebrate. For example, the animal may be a mammal, such as but not limited to humans, mice, rabbits, guinea pigs, hamsters, dogs, cats, and apes.

The cosmetic composition for improving the skin condition of the present invention includes umbilical cord blood-derived plasma or serum.

The characteristics of the cord blood-derived plasma or serum included in the cosmetic composition of the present invention are as described for the cord blood-derived plasma or serum included in the pharmaceutical composition of the present invention.

According to one embodiment, the skin condition improvement may be any one selected from the group consisting of skin aging inhibition, skin wrinkle improvement, skin inflammation relief, acne relief and accelerated regeneration of damaged skin tissue.

According to one embodiment, the cosmetic composition of the present invention may be formulated into any one selected from the group consisting of liquids, creams, gels, particles, powders, sheets, pads, pastes, patches, dressings and sponges, but is not limited thereto. It doesn't happen.

According to one embodiment, the cosmetic composition of the present invention, by adjusting the concentration of untreated umbilical cord plasma or serum in the composition, increase the shelf life, prevent oxidation, prevent precipitation, buffer the pH change, ointment, gel Or various excipients and carriers such as stabilizers, wetting agents, emollients, fragrances or coloring agents, etc., for achieving the purpose of increasing the convenience by having a viscosity in the form of cream or the like. As such excipients and carriers, various excipients and carriers described above in the pharmaceutical composition of the present invention may be used, but are not limited thereto, and various excipients and carriers acceptable as cosmetic compositions may be used.

The cosmetic composition of the present invention may include cord blood-derived plasma or serum in an amount of 0.1 wt% to 99.9 wt% based on the total weight of the composition. In addition, the cosmetic composition of the present invention may be one containing only 100% of umbilical cord plasma or serum without being combined with an excipient, carrier or diluent.

The dosage amount of the cosmetic composition of the present invention may be appropriately adjusted in consideration of the health condition of the patient and the degree of skin damage. According to one embodiment, it can be applied to the skin (eg, face, hands, arms, legs, feet or whole body) at a dose of about 0.0001 to about 5 mg / cm ² once, usually for adults.

In another aspect, the present invention provides a method for preventing or treating skin diseases comprising the step of administering to the subject a pharmaceutical composition for preventing or treating skin diseases.

The subject may be a vertebrate. For example, the animal may be a mammal, such as but not limited to humans, mice, rabbits, guinea pigs, hamsters, dogs, cats, and apes.

The skin disease may be the skin disease described above.

The administration method of the said pharmaceutical composition is not specifically limited, For example, the method of apply | coating to skin, intradermal injection, subcutaneous injection, etc. are mentioned.

In addition, the present invention provides a method for improving skin condition comprising applying the pharmaceutical composition for preventing or treating skin disease or a cosmetic composition for improving skin condition to a subject.

The subject may be a vertebrate. For example, the animal may be a mammal, such as but not limited to humans, mice, rabbits, guinea pigs, hamsters, dogs, cats, and apes.

Skin condition improvement may be the skin condition improvement described above.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in detail, but the scope of the present invention is not limited to those illustrated in these examples.

Example 1: Laboratory Animals and Reagents

Laboratory animals

Experimental animals received 6-week-old female Balb / c mice from Orient (Korea). Experimental animals were fed with solid feed and water at the Green Cross R & D Center Laboratory Animal Center, where temperature (24 ± 2), humidity (40-60%) and daylight cycle (12 hours) were maintained. Animal experiments were divided into five animals per cage after one week of environmental adaptation.

reagent

Egg white albumin, sodium dodecyl sulfate (SDS), hematoxylin-eosin solution, Masson-trichrome stain kit, toluidine blue, Giemsa solution and xylene Ethanol were purchased from Sigma-Aldrich (St Louis, MO, USA). Adjuvant for inducing an immune response was purchased from imject ^® Alum (Thermo Scientific, Fremont, CA, USA). Imiquimod for psoriasis induction was used to purchase Aldara cream (Dong-A Pharmaceutical, Korea). Tegaderm ^TM (3M, USA) was purchased and used to fix gauze after egg white albumin and alda cream and plasma application. Cord blood plasma was supplied from cord blood plasma (Yongin, korea) and cord blood plasma and inadequate cord blood plasma discarded after storage of cord blood.

Example 2: Wound Closure Efficacy Evaluation

In the case of experiments using the wound healing mouse model, five Balb / c mice were treated in the normal group (No treat), PBS treated group (PBS), untreated umbilical cord plasma spread group (CB plasma spread) of the present invention, Treatment was divided into four groups, including umbilical cord plasma dermal injection group (CB plasma Dermal injection).

After a week of adaptation to the breeding environment, the hair of the back of the mouse was shaved using a hair clipper, and the hair removal treatment was performed. After depilation, inhalation anesthesia was performed with Isoflurane (JW pharma, korea), and circular wounds were generated on the skin of mice and the like using an 8mm skin punch.

The wound was covered with a 1 × 1 cm ² gauze over the induced circular wound and the tegaderm covered thereon. One day after wound induction, the cord blood plasma application group was immersed in 100 l of gauze plasma plasma (CB plasma) every 3 to 4 days and placed on the wound and fixed with tegaderm.

Untreated umbilical cord plasma dermal injection group of the present invention was injected into the skin around the wound by 25 μl each by using a 0.3cc syringe at intervals of 3 to 4 days, and then covered with gauze and fixed with tegaderm. Two weeks later, tissues were collected by euthanasia of the experimental animals using the cervical dislocation method for tissue analysis. The wound regeneration rate in the wound treatment mouse model was compared by counting the number of pixels in the wound-induced area image using photosensitive and calculating the wound opening rate.

As a result, as shown in FIG. 1A, 100 μl of the untreated umbilical cord plasma of the present invention or the dermal injection group promoted the wound regeneration as compared to the No treat group and the PBS group. In the Wound opening size graph, it was confirmed that the wound regeneration rate was increased by both untreated cord blood plasma application and cord blood dermal injection of the present invention.

In particular, it was confirmed that the wound was closed about 30% in the control group compared to about 75% of the untreated umbilical cord plasma application of the present invention and close to about 60% of the injection on the 8th day.

Example 3: Evaluation of Collagen Formation Efficacy

The dorsal skin tissue of the mouse was separated and fixed with 4% PFA for 4 to 24 hours, and then paraffin-embedded sections having a thickness of 4 μm were prepared (Genia, korea). The prepared paraffin fragment was deparaffinized with xylene and then treated with progressively diluted alcohol to proceed with the functionalization process.

Skin tissue was stained using a staining reagent such as hematoxylin-eosin solution, Masson-trichrome stain kit, toluidine blue, and Giemsa solution.

After staining and dehydration, skin slides were prepared using permount (VECTASHIELD, USA) and observed under a microscope.

As a result, as shown in Figure 2, when treated with untreated umbilical cord plasma of the present invention (Dermal injection or plasma spread) increased the formation of the epidermal layer was confirmed to be thicker than the control group, and also wound regeneration in the skin layer The formation of the initially appearing collagen blue layer was further increased and found to be significantly thicker than the control.

Example 4 Evaluation of Atopic Therapy Efficacy

Experiments using the atopy-induced model, Balb / c mice by five normal group (No treat), PBS control group (PBS), atopy-induced control group, untreated umbilical cord plasma spread group (CB plasma spread) of the present invention, of the present invention CB plasma Dermal injection was divided into five groups.

After a week of adaptation, 100 μl of imject ^® Alum containing 20 μg of egg white albumin were injected intraperitoneally for three weeks.

For the PBS control group, 100 μl of PBS was intraperitoneally injected. Three weeks later, 200 μl of a 4% SDS solution was applied to the back by applying the above-mentioned depilation.

After the coated SDS solution was dried, the SDS was wiped off using distilled water. 100 μl of egg white albumin of 1 μg / μl in total 4 times at intervals of 3 to 4 days for 2 weeks after 1 day was covered with gauze and fixed on the back of the mouse and fixed with tegaderm.

Two weeks later, 100 µl of untreated umbilical cord plasma of the present invention was divided into 25 µl portions of four atopy-induced sites and skin-injected. Three weeks later, tissues were collected by euthanasia of the experimental animals by cervical dislocation method for tissue analysis.

As a result, as shown in Figure 3, in the atopic induction group (PBS injection / ova spread; highlighted in red box) by application of egg white albumin (ova) compared to No treat and PBS control group (PBS injection, PBS spread) Compared to the increase in mast cells and eosinophils and the increase of skin inflammation and keratin, subcutaneous injection of untreated umbilical cord plasma of the present invention not only reduced the inflammation and keratin of the skin but also the effect of Eosinophil and Mast cells. Reductions in recruitment were observed (plasma injection / ova spread; highlighted in green box).

In addition, as shown in Figure 4, in the atopic dermatitis-induced group (PBS spread / ova spread; highlighted in red box) by egg white albumin application, the skin inflammation and keratin of the skin after 6 weeks only by the application of untreated umbilical cord plasma of the present invention markedly Decrease (plasma spread / ova spread; highlighted in green box). In addition, the recruitment of eosinophils and mast cells was reduced compared to the PBS spread control group (PBS spread / ova spread; highlighted in red box) (plasma spread / ova spread; highlighted in green box).

Example  5: Comparison of Umbilical Cord Blood Plasma versus Adult Plasma in Atopic Induction Model

Experiments using the atopy-induced model consisted of five Balb / c mice, no treat, PBS spread, PBS dermal injection, and untreated adult plasma skin spray (AB plasma). Spread), the untreated adult plasma dermal injection group (AB plasma Dermal injection), the untreated umbilical cord plasma plasma group of the present invention, the untreated umbilical cord plasma dermal injection group (CB plasma Dermal injection) of the present invention It was divided into seven groups.

After a week of adaptation, 100 μl of imject ^® Alum containing 20 μg of egg white albumin were injected intraperitoneally for three weeks. Three weeks later, 200 μl of a 4% SDS solution was applied to the back by applying the above-mentioned depilation.

After the coated SDS solution was dried, the SDS was wiped off using distilled water. 1 μg / μl of egg white albumin 100 μl was applied to the back of the mouse, and fixed with tegaderm.

Two weeks later, 100 µl of untreated umbilical cord plasma, untreated adult plasma, and PBS of the present invention were divided into 25 acres of four atopic dermatitis sites for skin injection, or 100 µl of gauze was applied to mice and the like. Covered on site and fixed with tegaderm.

 Three weeks later, tissues were collected by euthanasia of the experimental animals by cervical dislocation method for tissue analysis.

As a result, as shown in Figure 5a, compared with the PBS application and injection group in the No treat group and atopic dermal induced by egg white albumin (ova) application, mast cells and eosinophils significantly increased and Compared to increased skin inflammation and keratin, subcutaneous injection of untreated umbilical cord plasma of the present invention not only reduced the inflammation and keratin of the skin but also reduced the infiltration of atopy-induced sites of eosinophils and mast cells. I could confirm that. This shows a similar level of inflammatory cells as treated with adult plasma.

5b, in the case of subcutaneous injection or application of untreated umbilical cord plasma of the present invention, mast cells were respectively reduced to 57% and 62% at the time of subcutaneous injection compared to the PBS-treated group, respectively, eosinophils. Was decreased to 50% at subcutaneous injection and 57% at application. In adult plasma, mast cells were reduced to 57% and 70% at subcutaneous injection compared to PBS group, and eosinophils were 45% at subcutaneous injection and 68% at application. Similar to treated cord blood plasma, but the protein contained in each plasma was 23.4 mg / ml for untreated cord plasma and 54.1 mg / ml for adult plasma. It was confirmed that the untreated umbilical cord plasma of the present invention had the same or higher potency as the adult plasma even with a smaller amount of protein.

Example  6: Evaluation of the Effective Concentration of Umbilical Cord Blood Plasma in Atopic Induction Model

Experiments using the atopy-induced model, the Balb / c mice in the normal group (PBS), atopy-induced group (OVA), atopy-induced group in the total protein concentration of 0.4, 0.8, 1.2, 1.6, 2.0 mg / ml in the present invention The study was divided into twelve groups, five groups of untreated umbilical cord plasma and five groups of adult plasma.

After a week of adaptation, 100 μl of imject ^® Alum containing 20 μg of egg white albumin were injected intraperitoneally for three weeks. After 3 weeks, 200 μl of a 4% SDS solution was applied to the back by applying the above-mentioned epilation.

After the coated SDS solution was dried, the SDS was wiped off using distilled water. After 1 day, 100 μl of egg white albumin of 1 μg / μl in a total of 4 times at intervals of 3 to 4 days for 2 weeks was covered with gauze and fixed on the back of the mouse and fixed with tegaderm.

After 2 weeks, egg white albumin was applied and at the same time, PBS or untreated cord blood plasma and untreated adult plasma of the present invention were diluted to a total protein concentration of 0.4, 0.8, 1.2, 1.6, and 2.0 mg / ml. It was moistened and covered with the back of the mouse and fixed with tegaderm.

Three weeks later, tissues were collected by euthanasia of the experimental animals by cervical dislocation method for tissue analysis.

As a result, as shown in Figure 6a, when compared with the PBS treatment group and the atopic induction group by egg white albumin (ova) application, mast cells and eosinophils increase, skin inflammation and keratin increase In contrast, when applied to the concentration of untreated umbilical cord plasma of the present invention, as the concentration of the treatment increased, not only the inflammation and keratin of the skin was reduced, but also the penetration of atopic dermatitis into the mast cells (eosinophil) and eosinophils (mast cells) decreased. I could confirm it. Inflammation and keratin of the skin decreased and mast cells and eosinophils decreased as the treatment concentration increased during the treatment of adult plasma, but the effect of the untreated umbilical cord plasma of the present invention was more effective at the same concentration. It was confirmed that excellent. In particular, the treatment of untreated umbilical cord plasma of the present invention at a concentration of 0.4 mg / ml and the treatment of adult plasma 1.2 mg / ml by about three times showed similar effects.

6b shows that when untreated umbilical cord plasma (left) and adult plasma (right) of the present invention are applied according to concentrations, in the case of mast cells, adult plasma (right) is treated at a concentration of 0.8 mg / ml or more. The treatment of the untreated umbilical cord plasma (left) of the present invention was similar to that of 0.4 mg / ml. In the case of eosinophils, the treatment of adult plasma (right) at a concentration of 1.2 mg / ml was performed. Similar effect was obtained with treatment of cord blood plasma (left) at 0.4 mg / ml. This suggests that the untreated umbilical cord plasma of the present invention exhibits about 2-3 times the effect at the same concentration as the adult plasma, and compared to the atopy-induced group, mast cells and eosinophils of the present invention. Treatment with only 0.4 mg / ml of untreated umbilical cord plasma reduced more than 50%, and treatment with 1.2 mg / ml was found to be reduced by more than 75%.

Example  7: in atopy induction model No treatment  Cord Blood Plasma Potency Factor Assessment

Experiments using the atopy-induced model was carried out in the Balb / c mice each of the normal group (PBS), atopy-induced group (OVA), atopy-induced group 0.4, 0.8, 1.2, 1.6, 2.0 mg / ml total protein concentration of the present invention Five groups of untreated umbilical cord plasma and five groups of adult plasma were divided into 12 groups.

After a week of adaptation, 100 μl of imject ^® Alum containing 20 μg of egg white albumin was injected every three weeks for three weeks. Three weeks later, 200 μl of a 4% SDS solution was applied to the back by gauze after the aforementioned hair removal.

After the coated SDS solution was dried, the SDS was wiped off using distilled water. 1 μg / μl of egg white albumin 100 μl was applied to the back of the mouse and fixed with tegaderm four times at intervals of 3-4 days for 2 weeks after 1 day.

After two weeks of application of egg white albumin, untreated cord blood plasma and untreated adult plasma of PBS or the present invention were diluted to a total protein concentration of 0.4, 0.8, 1.2, 1.6, 2.0 mg / ml, and 100 μl was added to the gauze. It was moistened and covered with the back of the mouse and fixed with tegaderm.

Three weeks later, the atopy-induced skin tissue was collected by euthanasia of the experimental animals using the cervical dislocation method for tissue analysis. The collected tissues were subjected to RT-PCR to determine the expression level of atopic inflammation regulators IL-4, IL-6, IL-8, IL-13, and INF-γ. Each skin tissue obtained above was dissolved with 0.3 g trizol reagent (Invitrogen). Transfer the dissolved sample to a 1.5 ml tube, add 200 μl of chloroform, and centrifuge at 12,000 g for 20 minutes. Mix the supernatant and isopropanol 1: 1 at 12,000 g for 20 minutes. After centrifugation, the RNA was completely precipitated, washed three times with ethanol and dissolved in 30 μl of DEPC-water to obtain total RNA. PCR (polymerase chain reaction) was 94 ° C for 30 seconds IL-4 and IL-6 at 56 ° C, IL-8 at 54 ° C, IL-13 and GAPDH at 61 ° C, INF-γ at 58 ° C for 1 minute, 72 ° C 30 seconds was repeated 30 times. The primers used were IL-4 forward AAGAACACCACAGAGAGTGAG CTC (SEQ ID NO: 1), IL-4 reverse TTTCAGTGTGGACTTCCACTC (SEQ ID NO: 2), IL-6 forward AACCTTCC AAAGATGGCTGA A (SEQ ID NO: 3), IL-6 reverse CAGGAACTGGATCAGGACTTT (SEQ ID NO: 4) , IL-8 forward TCAGTGCATAAAGACATACTCC (SEQ ID NO: 5), IL-8 reverse TGGCATCTTCACTGATTCTTG (SEQ ID NO: 6), IL-13 forward AGCATGGTATGGAGTGTGGACCTG (SEQ ID NO: 7), IL-13 reverse CAGT TGCTTTGTGTAGCTGAGCAG (SEQ ID NO: 8), INF-γ forward GTCAACAACCCACAGGTCCA (SEQ ID NO: 9), INF-γ reverse ACTCCTTTTCCGCTTCCTGA (SEQ ID NO: 10), GAPDH forward GAGGGGC CATCCACAGTCTTC (SEQ ID NO: 11), GAPDH reverse CATCACCATCTTCCAGGAGCG (SEQ ID NO: 12).

As a result, as shown in FIG. 7, the cytokines IL-4, IL-6, IL-8, and IL-13, which induce an atopic inflammatory response upon induction of atopy by OVA treatment, increase and inhibit atopic inflammation. It was confirmed that the IFN-γ decreased (Green box). In contrast, the treatment of untreated umbilical cord plasma of the present invention was found to decrease with increasing concentrations of inflammatory-induced cytokines IL-4, IL-6, IL-8, IL-13 untreated umbilical cord plasma, and adults. Compared to the plasma, IL-4, IL-6 was found to significantly reduce the expression of the untreated umbilical cord plasma of the present invention at a concentration of 2.0 mg / ml of total protein (Red box). In the case of IFN-γ, the treatment of untreated umbilical cord plasma of the present invention was confirmed to increase with increasing treatment concentration, but in the case of adult plasma, the amount of increase of IFN-γ was insignificant. In this way, the untreated umbilical cord plasma of the present invention inhibits the expression of atopy-induced cytokines IL-4, IL-6, IL-8, IL-13, and in particular, the expression of IL-4, IL-6 in adult plasma. It was confirmed that the present invention effectively inhibits atopic dermatitis symptoms by effectively inhibiting and increasing the expression of the atopic inhibitory cytokine IFN-γ.

Example  8: psoriasis  Evaluation of Therapeutic Efficacy of Umbilical Cord Blood Plasma in a Model

Experiments using the psoriasis induction model divided into four groups of five Balb / c mice, including a normal group (No treat), a Vaseline skin application group, a psoriasis-induced PBS application group, and a psoriasis-free untreated umbilical cord plasma application group. Proceeded.

After a week of adaptation to the breeding environment, Aldara cream (Dong-A Pharm) was applied to 62.5mg and so on at 2 days intervals. At this time, vaceline was applied to the back in the same amount as a control. In the case of the psoriasis model, while applying Aldara cream, 100 μl of untreated cord blood plasma, untreated adult plasma, and PBS of the present invention were soaked in gauze, and covered with tegaderm.

Two weeks later, tissues were collected by euthanasia of the experimental animals using the cervical dislocation method for tissue analysis.

As a result, as shown in Figure 8, compared to the No treat and Vaseline treatment control, after applying Aldala cream, the PBS treatment group was found to increase keratin and inflammation, and the stratum corneum was removed through Giemsa and HE staining. It was confirmed that the epidermal layer became thick. On the contrary, when the untreated umbilical cord plasma of the present invention was treated with a total protein concentration of 2.0 mg / ml, it was confirmed that the formation of keratin was reduced and the increase of the epidermal layer was suppressed. This indicates that untreated umbilical cord plasma of the present invention inhibits the increase in keratinocytes induced by imiquimod, a TLR 7 immunoactivator.

Looking at the results of the above Example 1 to Example 8, it can be seen that the pharmaceutical composition according to the present invention is excellent in the autoimmune skin disease treatment effect and wound healing promoting effect.

In general, autoimmune skin diseases and wounds are often accompanied by itching, so that the patient's scratching of the affected area destroys the tissues of the epidermis, worsens inflammation, worsens itching, and increases the risk of secondary infection. Eventually, the symptoms continue to worsen through a vicious cycle, and the composition according to the present invention exhibits both an anti-inflammatory effect and an effect of promoting wound healing due to collagen formation, which is very effective in treating such autoimmune skin diseases and promoting wound healing. effective.

Claims (17)

1. Pharmaceutical composition for preventing or treating skin diseases, including umbilical cord blood-derived plasma or serum.
2. The pharmaceutical composition of claim 1, wherein the plasma has not been treated to increase the amount or activity of platelets.
3. The pharmaceutical composition of claim 1, wherein the skin disease is any one selected from the group consisting of autoimmune skin diseases, acne, wounds, burns and frostbites.
4. The method of claim 3, wherein the autoimmune skin disease is atopic dermatitis, psoriasis, scleroderma, multiple sclerosis, dermatomyositis, systemic lupus erythematosus, vitiligo (vitiligo), bullous epidermolysis bullosa, bullous pemphigoid, alopecia areata, Behcet's disease and Crohn's disease Phosphorus, pharmaceutical composition.
5. 4. The wound of claim 3 wherein the wound is abrasion, incision wound, laceration, avulsion, puncture wound, penetration wound, gunshot wound, left wound. from a group consisting of crushing injury, ulcers, blisters, keloids, keratosis, osteonecrosis, pressure ulcers and wound caused by infection Any one selected.
6. The pharmaceutical composition of claim 3, wherein the burn is any one selected from the group consisting of a thermal burn, a chemical burn, an electrical burn, and a radiation burn.
7. The pharmaceutical composition of claim 1, which is formulated as an injection or external preparation.
8. The pharmaceutical composition of claim 7, wherein the injection is intradermal injection or subcutaneous injection.
9. The pharmaceutical composition of claim 1, which increases collagen formation in the dermal layer.
10. The pharmaceutical composition of claim 1, which reduces eosinophils and mast cells in the dermal layer.
11. A method for preventing or treating skin diseases comprising administering to the subject a composition of any one of claims 1 to 10.
12. Cosmetic composition for improving skin conditions comprising umbilical cord blood-derived plasma or serum.
13. The cosmetic composition according to claim 12, wherein the plasma is not treated to increase the amount or activity of platelets.
14. The cosmetic composition according to claim 12, wherein the skin condition improvement is any one selected from the group consisting of skin aging inhibition, skin wrinkle improvement, skin inflammation relief, acne relief and promotion of regeneration of damaged skin tissue.
15. The cosmetic composition according to claim 12, which increases collagen formation in the dermal layer.
16. The cosmetic composition according to claim 12, which reduces eosinophils and mast cells in the dermal layer.
17. A method for improving skin condition comprising applying the composition of claim 12 to a subject.

Images