WO2018088734A2 - Structure globulaire contenant un nouveau domaine de transduction de protéine - Google Patents

Structure globulaire contenant un nouveau domaine de transduction de protéine Download PDF

Info

Publication number
WO2018088734A2
WO2018088734A2 PCT/KR2017/011917 KR2017011917W WO2018088734A2 WO 2018088734 A2 WO2018088734 A2 WO 2018088734A2 KR 2017011917 W KR2017011917 W KR 2017011917W WO 2018088734 A2 WO2018088734 A2 WO 2018088734A2
Authority
WO
WIPO (PCT)
Prior art keywords
spherical structure
peptide
seq
amino acid
acid sequence
Prior art date
Application number
PCT/KR2017/011917
Other languages
English (en)
Korean (ko)
Other versions
WO2018088734A3 (fr
Inventor
장상호
이길환
황정순
김지안
박주희
이정옥
조현종
정재영
Original Assignee
주식회사 바이오셀트란
제이앤팜유한책임회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오셀트란, 제이앤팜유한책임회사 filed Critical 주식회사 바이오셀트란
Publication of WO2018088734A2 publication Critical patent/WO2018088734A2/fr
Publication of WO2018088734A3 publication Critical patent/WO2018088734A3/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/14—Esters of carboxylic acids, e.g. fatty acid monoglycerides, medium-chain triglycerides, parabens or PEG fatty acid esters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
    • A61K8/14—Liposomes; Vesicles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/55—Phosphorus compounds
    • A61K8/553—Phospholipids, e.g. lecithin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers with substantial amounts of non-phosphatidyl, i.e. non-acylglycerophosphate, surfactants as bilayer-forming substances, e.g. cationic lipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin

Definitions

  • the present invention relates to spherical structures capable of delivering active or useful components to cells or skin, and more particularly to spherical structures containing novel protein transduction domains.
  • PTDs Protein transduction domains
  • PTD in combination with a target material can enter the cell and / or cell nucleus by transposing the cell membrane in vitro or in vivo .
  • various biological molecules such as antigenic peptides, peptide nucleic acids, antisense oligonucleotides, full length proteins, nanoparticles, liposomes can be delivered via PTD.
  • the PTD has been applied by direct chemical bonding to simple mixtures or drugs in drug delivery to the skin.
  • the skin penetration time difference between the PTD and the drug may occur, and the poorly soluble drug may have a limitation in application and may cause a large deviation depending on the administration conditions.
  • chemical bonding also causes problems in the ease of binding of the active material and the peptide and whether or not the active material is active, the use thereof is very limited.
  • poorly soluble drugs contain hydrophobic sites in the structure, so that they are insoluble in water, the practical use is often limited due to poor solubility. For example, about 41% of drugs that are developed as new drugs are given up due to poor solubility, and about 8% of drugs listed in the US Pharmacopeia are classified as poorly soluble drugs.
  • poorly soluble drugs include caffeic acid, coenzyme Q10, ursodeoxycholic acid, ilaprazol, paclitaxel, and imatinib mesylate. These drugs have limited use due to their poor solubility despite their excellent efficacy.
  • the liposome and PTD when the liposome and PTD are combined, the vesicular skin penetration, the penetration enhancing effect, the penetration of liposomes through the transappendageal route,
  • the mechanism of increasing skin penetration by PTD-induced drug introduction into the skin cells and thereby concentration gradient forming action can be synergistically improved to improve the skin permeability of the drug.
  • the new PTD developed by the present inventors it is intended to develop and provide a spherical structure with further enhanced cell or skin permeability.
  • the present invention provides a spherical structure formed by self-aggregation of an amphiphilic molecule having a hydrophilic portion and a hydrophobic portion, wherein the spherical structure contains a peptide having an amino acid sequence as set forth in SEQ ID NO: 1. .
  • the present invention also provides a spherical structure formed by self-aggregation of amphiphilic molecules prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to a lipid.
  • the lipid may be, for example, phosphatidylcholine having functional groups such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl; Phosphatidylethanolamine; Phosphatidylglycerol; Phosphatidylserine; Phosphatidylinositol; Ceramides; Sphinginine; Phytosphingosine; Sphingosine; Dimethyl dioctadecyl ammonium; Dioleoyltrimethylammonium propane; And dioctadecenyltrimethylammonium propane; It may be any one selected from or derivatives thereof.
  • the spherical structure may be a spherical structure, characterized in that the hydrophobic molecules of the amphipathic molecules are oriented so as to be in contact with each other to form a double membrane-shaped circumference.
  • the spherical structure may be, for example, liposomes.
  • the peptide having the amino acid sequence of SEQ ID NO: 1 is preferably oriented in the outward direction of the spherical structure.
  • the spherical structure of the present invention preferably contains cholesterol in a hydrophobic site.
  • the spherical structure of the present invention may preferably contain a material to be collected therein.
  • the present invention provides a cosmetic composition comprising the spherical structure of the present invention.
  • the present invention also provides a pharmaceutical composition comprising the spherical structure of the present invention.
  • the present invention comprises the steps of dissolving an amphiphilic molecule, a peptide having the amino acid sequence of SEQ ID NO: 1 and the target material in a solvent (a); After step (a), evaporating the solvent to prepare a film; After the step (b), by adding purified water or buffer to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a method for producing a spherical structure comprising a.
  • the amphipathic molecule may be, for example, a phospholipid.
  • the present invention comprises the steps of (a) dissolving the amphiphilic molecule and the capture material prepared by binding the peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid; After step (a), evaporating the solvent to prepare a film; After the step (b), by adding purified water or buffer to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a method for producing a spherical structure comprising a.
  • the step (a) preferably in addition to the amphiphilic molecule prepared by binding the peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid, it is preferable to further dissolve by adding a separate amphiphilic molecule to the solvent.
  • the separate amphipathic molecules may be, for example, phospholipids.
  • the amphipathic molecule prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid, for example, having the amino acid sequence of SEQ ID NO: 1 in the lipid of the film form
  • a solution containing the peptide is added to induce a binding reaction between the lipid and the peptide having the amino acid sequence set forth in SEQ ID NO: 1, wherein the lipid in the form of a film is dissolved in a hydrophobic organic solvent and then volatilized the organic solvent.
  • the solution containing the peptide having the amino acid sequence described in SEQ ID NO: 1 was dissolved in distilled water together with ammonia carbonate in a peptide having the amino acid sequence described in SEQ ID NO: 1, and then the pH was 8-8. It may be prepared by adjusting to 10.
  • the lipid may be, for example, phosphatidylcholine having functional groups such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl; Phosphatidylethanolamine; Phosphatidylglycerol; Phosphatidylserine; Phosphatidylinositol; Ceramides; Sphinginine; Phytosphingosine; Sphingosine; Dimethyl dioctadecyl ammonium; Dioleoyltrimethylammonium propane; And dioctadecenyltrimethylammonium propane; It may be any one selected from or derivatives thereof.
  • phosphatidylcholine having functional groups such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl
  • Phosphatidylethanolamine Phosphatidylglycerol
  • the step (a), preferably dissolve cholesterol further in a solvent.
  • the solvent may be, for example, a mixture of chloroform and methanol.
  • spherical structures eg, liposomes
  • enhanced cell or skin permeability can be prepared.
  • spherical structure eg, liposome
  • spherical structure eg, liposome
  • a poorly water-soluble material skin functional material or pharmacologically effective material
  • 1 is a map of a typical GFP expression vector.
  • 2 is a map of a TAT-GFP expression vector.
  • 3 is a map of a PEP1-GFP expression vector.
  • FIG. 11 shows the results of particle image (TEM image) of self-assembled PTD-liposome- (caffeic acid) (left: liposome- (caffeic acid), right: self-assembled PTD-liposome- (caffeic acid)).
  • Figure 13 is a result of comparing the protective effect of caffeic acid in cell damage by oxidative stress.
  • the present inventors have tried to develop more efficient peptides and drug delivery systems using the same, which can deliver a target substance into cells, and as a result, the cell-penetrating peptides of SEQ ID NO: 1 and circular spheres containing the same (for example, Liposomes).
  • Peptides of the present invention having the amino acid sequence set forth in SEQ ID NO: 1 has an amphipathic property, it was confirmed through the experiments of the present invention that can be efficiently applied to the intracellular delivery of the target material.
  • the amino acid sequence of SEQ ID NO: 1 may be preferably encoded by the nucleic acid sequence described in SEQ ID NO: 2.
  • the present invention provides a spherical structure formed by self-aggregation of an amphiphilic molecule having a hydrophilic portion and a hydrophobic portion, wherein the spherical structure contains a peptide having an amino acid sequence as set forth in SEQ ID NO: 1. .
  • the present invention also provides a spherical structure formed by self-aggregation of amphiphilic molecules prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to a lipid.
  • the amphiphilic molecule having a hydrophilic portion and a hydrophobic portion in the molecule When the amphiphilic molecule having a hydrophilic portion and a hydrophobic portion in the molecule is dispersed, for example, in an aqueous solution, the hydrophobic portions self-aggregate (associate) to form a spherical structure in which the hydrophobic portions are collected at the center. This is called a 'micelle', and the spherical structure thus formed may be used as a means for transporting the fat-soluble material by mounting the fat-soluble material on the hydrophobic part.
  • the amphiphilic molecules may be oriented so that the hydrophobic molecules come into contact with each other when dispersed in an aqueous solution to form a double membrane type circumference. It is called).
  • the liposome is a structure in which a space of a hydrophilic part exists inside and a hydrophobic phospholipid bilayer is formed around the liposome.
  • Liposomes are widely used as a means for transporting the water-soluble material in the water-soluble material therein. In particular, it is widely used in the cosmetic or pharmaceutical field as a means for the delivery of various useful water-soluble substances in the human body.
  • the peptide having the amino acid sequence of SEQ ID NO: 1 of the present invention has an amphiphilic, when bound to the lipid, and acts as a partner that can impart amphiphilicity to the entire lipid.
  • Lipids having the amino acid sequence described in SEQ ID NO: 1 bound to the amphiphile are self-aggregated (or self-assembled) when dispersed in an aqueous solution to form a spherical structure of a single membrane (so-called 'micelle') or a spherical structure of a double membrane ( As a representative example, 'phospholipid' is formed.
  • the lipid may be, for example, phosphatidylcholine having functional groups such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl; Phosphatidylethanolamine; Phosphatidylglycerol; Phosphatidylserine; Phosphatidylinositol; Ceramides; Sphinginine; Phytosphingosine; Sphingosine; Dimethyl dioctadecyl ammonium; Dioleoyltrimethylammonium propane; And dioctadecenyltrimethylammonium propane; It may be any one selected from or derivatives thereof.
  • phosphatidylcholine having functional groups such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl
  • Phosphatidylethanolamine Phosphatidylglycerol
  • the peptide having the amino acid sequence set forth in SEQ ID NO: 1 is contained in the spherical structure may also serve to help the penetration of the spherical structure of the present invention into the cells or in the skin.
  • the 'peptide having the amino acid sequence set forth in SEQ ID NO: 1' of the present invention may be oriented in the outward direction of the spherical structure.
  • the peptide having the amino acid sequence of SEQ ID NO: 1 oriented in the outward direction of the spherical structure serves as a protein transduction domaim (PTD), and the spherical structure can be easily transported into cells or skin.
  • PTD protein transduction domaim
  • cholesterol may be contained in the hydrophobic site, thereby stabilizing the structure of the spherical structure.
  • the spherical structure may preferably contain a material to be collected therein.
  • the material to be collected may vary.
  • the hydrophobic material may be mounted therein
  • the bilayered spherical structure for example, liposome
  • the hydrophilic material may be mounted therein.
  • the material to be collected may include a physiological functional material, a skin functional material, a pharmaceutical material, and the like, and the form may include a compound, a peptide, a protein, and the like.
  • the present invention provides a cosmetic composition comprising the spherical structure of the present invention.
  • a cosmetic composition comprising the spherical structure of the present invention.
  • it contains the spherical structure of the present invention is not necessarily limited to a specific cosmetic formulation, it includes all formulations.
  • the present invention also provides a pharmaceutical composition comprising the spherical structure of the present invention.
  • the pharmaceutical composition is also not necessarily limited to a specific pharmaceutical formulation as long as it contains the spherical structure of the present invention, and includes all formulations.
  • the present invention comprises the steps of dissolving an amphiphilic molecule, a peptide having the amino acid sequence of SEQ ID NO: 1 and the target material in a solvent (a); After step (a), evaporating the solvent to prepare a film; After the step (b), by adding purified water or buffer to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a method for producing a spherical structure comprising a.
  • the amphipathic molecule may be, for example, a phospholipid.
  • the present invention comprises the steps of (a) dissolving the amphiphilic molecules prepared by binding a peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid in a solvent; After step (a), evaporating the solvent to prepare a film; After the step (b), by adding purified water or buffer to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a method for producing a spherical structure comprising a.
  • the step (a) preferably in addition to the amphiphilic molecule prepared by binding the peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid, it is preferable to further dissolve by adding a separate amphiphilic molecule to the solvent.
  • the separate amphipathic molecules may be, for example, phospholipids.
  • the step of reducing the particle size by applying the energy may be performed by applying ultrasonic waves.
  • the present invention can produce a spherical structure containing the target material through the above process, when using a phospholipid as an amphiphilic molecule, it can be prepared as liposomes.
  • a phospholipid as an amphiphilic molecule
  • cholesterol may be further dissolved in a solvent in step (a).
  • a solvent for example, a mixture of chloroform and methanol may be used.
  • the spherical structure manufacturing method of the present invention is characterized by using the 'peptide having the amino acid sequence described in SEQ ID NO: 1, a method for producing a spherical structure using amphiphilic molecules (for example, using a phospholipid Since it is well known in the art), the detailed description of each step for the production of the spherical structure will be omitted.
  • the amphiphilic molecule prepared by binding the peptide having the amino acid sequence of SEQ ID NO: 1 to the lipid for example, the amino acid of SEQ ID NO: 1 to the lipid in the form of a film
  • a solution containing a peptide having a sequence can be added to induce a binding reaction between the lipid and the peptide having the amino acid sequence set forth in SEQ ID NO: 1.
  • the lipid in the film form is prepared by dissolving the lipid in a hydrophobic organic solvent, and then evaporating the organic solvent in the form of a film, the solution containing the peptide having the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 1 Peptide having the amino acid sequence described in it may be prepared by dissolving in distilled water with ammonium carbonate, and then adjusted to pH 8-10.
  • the lipid may be, for example, phosphatidylcholine having functional groups such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl; Phosphatidylethanolamine; Phosphatidylglycerol; Phosphatidylserine; Phosphatidylinositol; Ceramides; Sphinginine; Phytosphingosine; Sphingosine; Dimethyl dioctadecyl ammonium; Dioleoyltrimethylammonium propane; And dioctadecenyltrimethylammonium propane; It may be any one selected from or derivatives thereof.
  • phosphatidylcholine having functional groups such as maleimide, N-hydroxysuccinimide, amine, carboxylic acid, or hydroxyl
  • Phosphatidylethanolamine Phosphatidylglycerol
  • the present invention shows further enhanced cell permeability or skin permeability through a peptide consisting of 27 amino acid sequences as set forth in SEQ ID NO: 1, and can be transported into cells or skin by mounting a target substance inside the structure.
  • recombinant protein expression vectors were prepared by fusing peptides having cellular and skin permeability and proteins to be delivered.
  • the target protein (cargo) to be delivered in order to easily analyze the delivery ability of how the fusion protein can be delivered to cells and skin, the target protein (cargo) to be delivered, called Green Fluorescence Protein (hereinafter referred to as "GFP") ) Is selected.
  • GFP Green Fluorescence Protein
  • TAT or PEP1 which is a well-known PTD, is fused to GFP to transfer STeP (peptide having an amino acid sequence of SEQ ID NO: 1, encoded with a nucleic acid sequence of SEQ ID NO: 2) and cell and skin newly developed in the present invention. We tried to compare the abilities.
  • a DNA fragment corresponding to the base sequence of GFP was subcloned into XhoI and BamHI sites of plasmid pET15b to prepare pGFP that expresses GFP protein. Since the pGFP expression vector has not been fused with cells and peptides having skin permeability, and GFP is a hydrophilic polymer protein of about 29 kDa, it can be said that the GFP expressed in this vector is incapable of delivering to cells and skin. Therefore, it was prepared as a control for comparing the cell and skin permeability.
  • DNA fragments corresponding to the nucleotide sequence of GFP were polymerized by Pfu DNA polymerase (PCR) using plasmid pEGFP-C2 (Clontech) to amplify the complete sequence of GFP.
  • the forward primer is 5'-CTCGAGGTGAGCAAGGGCGAGGAGCTG-3 'and the sequence of the reverse primer is 5'-GGATCCTTACTTGTACAGCTCGTCC ATGCCGAG-3'.
  • the PCR product was cut with Xho I-Bam HI and subcloned into the XhoI-BamHI site of pET15b (Invitrogen, Carlsbad, Calif.) To prepare pGFP that expressed a general GFP protein. 1 is a map of a typical GFP expression vector.
  • PTAT-GFP expressing GFP fused with HIV-1 TAT was constructed by the following method.
  • the sequences encoding the nine amino acids of the HIV-1 TAT are the upper chain 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3 'and the lower chain 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3'.
  • Double-chain oligonucleotides were directly subcloned into NdeI-XhoI of pGFP to produce pTAT-GFP expressing the TAT-GFP protein.
  • 2 is a map of a TAT-GFP expression vector.
  • PPEP1-GFP expressing GFP fused with PEP1 was constructed by the following method. First, two oligonucleotide top chains 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGAGCCAGCCGAAAAAAACGTAAAGTGC-3 'and the bottom chain 5'-TCGAGCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCACCAGGTsynthetic-synthesizedcodingPPC2-speptide-couplings were prepared.
  • Double-chain oligonucleotides were directly subcloned into NdeI-XhoI of pGFP to produce pPEP1-GFP expressing PEP1-GFP protein.
  • 3 is a map of a PEP1-GFP expression vector.
  • PSTeP-GFP expressing the STeP fused GFP of the present invention was produced by the following method. First, two oligonucleotide top chains 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3 'and the bottom chain 5'-TCGAGACGACGACGCTGACGACGTTGTTCCCCCTCGTGTTCTCCGTGTGT Double-chain oligonucleotides were directly subcloned into NdeI-XhoI of pGFP to produce pSTeP-GFP expressing STeP-GFP protein. 4 is a map of the STeP-GFP expression vector.
  • the protein was expressed from the recombinant vectors prepared in the above example.
  • Four types of expression vectors were each transformed into E. coli Rosetta-gami 2 (DE3) cells.
  • the transformed bacterial cells were cultured at 37 ° C. until the OD 600 value was 0.6 using 1,000 ml of LB medium containing empicillin, and further cultured for 24 hours by introducing 0.5 mM IPTG at 22 ° C. Expression of the protein was induced.
  • GFP protein was purified and purified using His tag affinity column. Purification methods of the four GFP proteins were purified using the same method as follows.
  • pET15-GFP, pTAT-GFP, pPEP1-GFP, pSTeP-GFP transformed cells were disrupted in 1X Native buffer (50 mM NaPO5, 0.5M NaCl) using an ultrasonic wave, and then centrifuged to separate the aggregate body and cytoplasm. (Supernatant).
  • HaCaT human keratinocyte cells were incubated for 24 hours on a culture slide. The culture medium was then removed, washed three times with HBSS and treated with GFP and cell permeable GFP proteins (PEP1-GFP, TAT-GFP, STeP-GFP). When the cells were treated, a stock was prepared so that the concentration of each protein was 10mM, diluted 1/10 in the medium, and treated to a final 10 ⁇ M, followed by incubation for 2 hours. After 2 hours, the medium was removed, the cells were washed with PBS, and the cells were fixed at ⁇ 20 ° C. for 10 minutes using cold methanol. Cells were sufficiently washed with PBS, and then stained with PBS diluted nuclear staining reagent (DAPI) for 10 minutes under light blocking. Washed sufficiently with PBS, mounted and analyzed using a confocal scanning laser microscope.
  • DAPI PBS diluted nuclear staining reagent
  • Pork skin (0.7 mm thick, Medikinetics) was mounted between the top and bottom of the cell, and treated with 300 ⁇ l of 50 ⁇ M GFP protein on the top. After 24 hours, the pig skin was removed and washed three times with PBS. After washing, the cryo molds were treated with an OCT embedding matrix (Cell Path Ltd., UK) to freeze tissues at -70 ° C. The frozen tissues were cross-sectioned to a thickness of 7 ⁇ m at ⁇ 20 ° C. using cryotome (HM520, Germany) to prepare section slides.
  • OCT embedding matrix Cell Path Ltd., UK
  • Tissue sections fixed on slide glass in order to stain the nuclei of skin cells were placed in PBS diluted with 1/5000 nuclear staining reagent (DAPI) and stained for 10 minutes under light blocking. Washed twice. After mounting it was analyzed using a confocal scanning laser microscope.
  • DAPI nuclear staining reagent
  • 'LUT Image' is an image in which contrast is improved by using a look up table (LUT).
  • 'self-assembly' is a peptide having the amino acid sequence of SEQ ID NO: 1 by forming a membrane of liposomes in a state in which the peptide having the amino acid sequence of SEQ ID NO: 1 is bound to phospholipids.
  • Self-assembled PTD-liposomes of the present embodiment is a combination of PTD to lipids, without the hassle of the synthetic process of connecting the PTD to the biologically active material, directly encapsulated various bioactive materials directly into the self-assembled PTD-liposomes, efficiently skin It allows me to pass it on.
  • lipid-PTD was prepared by the following method. First, DSPE-PEG3.4K-maleimide (lipid, 1 equiv,) was dissolved in dichloromethane, and then evaporated at 50 ° C. to remove the organic solvent to prepare DSPE-PEG3.4K-maleimide in the form of a film. Ready. In addition, PTD (STeP peptide: KETWWETWWTEWSQPYGRKKRRQRRRC, SEQ ID NO: 1) (3 equiv.) And ammonium carbonate (3 equiv.) Were dissolved in distilled water and adjusted to pH 9 with buffer (pH 9.6) to adjust the PTD solution. Prepared separately and prepared.
  • the PTD solution prepared above was placed in DSPE-PEG3.4K-maleimide prepared in the form of a film above, followed by a hydration and stirring process (4 hours) at 37 ° C., and the maleimide of DSPE-PEG3.4K-maleimide.
  • the maleimide-thiol reaction was induced between the 'C' amino acids of the STeP peptide. After the reaction was completed, lyophilization and separation and purification were performed.
  • 9 shows the chemical structure of the lipid (DSPE-PEG3.4K-maleimide) -PTD (STeP peptide) prepared in this example.
  • Liposomes are artificial membranes composed of phospholipids, which can be used as encapsulated structures that enclose a liquid internal material. The retention of substances trapped in liposomes can be influenced by the composition of the lipids. Two important types of lipids are phospholipids and cholesterol. Phospholipids play a role in constituting the membrane of liposomes, and cholesterol has a hydrophilic hydroxyl group and a hydrophobic ring. As a result, van der Waals bonds stabilize the chain of saturated fatty acids in the cell membrane, reducing fluidity and giving firmness to the cell membrane. In charge of the function.
  • the lipid-PTD and phospholipid, cholesterol, and caffeic acid produced by the above method was mixed to prepare self-assembled PTD-liposomes (self-assembled PTD-liposomes- (caffeic acid)) containing caffeic acid.
  • the specific method is as follows.
  • the physicochemical characteristics of the self-assembled PTD-liposomal-caffeic acid were analyzed by checking the particle size, particle size distribution, and inclusion rate of the prepared liposomes.
  • the caffeic acid (liposome-caffeic acid) encapsulated in a normal liposome was analyzed together.
  • Particle size, particle size distribution, surface charge was confirmed using electrophoretic light scattering (ELS), the results were as shown in FIG. According to the results of FIG. 10, it was confirmed that the self-assembled PTD-liposomal- (caffeic acid) had a liposome having a relatively uniform particle size distribution of about 250 nm in average diameter. 10 is a particle characteristic evaluation results of self-assembled PTD-liposome- (caffeic acid).
  • the peptide having the amino acid sequence set forth in SEQ ID NO: 1 of the present invention is an amphiphilic peptide, but is more hydrophilic than hydrophobic. In the case of such hydrophilic peptides, it is expected that the liposomes will be located in the external or internal hydrophilic environment.
  • the zeta potential analysis (change from-to +) of FIG. 10 shows that STeP is exposed to the external surface environment of the liposomes. And it was found.
  • FIG. 11 shows the results of particle image (TEM image) of self-assembled PTD-liposome- (caffeic acid) (left: liposome- (caffeic acid), right: self-assembled PTD-liposome- (caffeic acid)).
  • Self-assembly PTD- liposome-cafe acid is, cafes acid and liposome-increasing cafe intracellular transmission than acid to oxidative stress to confirm that the enhancement of antioxidant effectiveness (hydrogen peroxide, H 2 O 2) cells of a cafe acid from cell damage caused by The protective effect was compared and observed.
  • antioxidant effectiveness hydrogen peroxide, H 2 O 2
  • HaCaT cells cultured in DMEM medium containing 10% FBS were dispensed in 96-well plates by 2 ⁇ 10 4 and incubated for 16 hours, and washed twice with HBSS.
  • Caffeic acid and caffeic acid encapsulated in liposomes, self-assembled PTD liposome caffeic acid was treated to cells to a final concentration of 12.5 ⁇ M and incubated for 24 hours. After removing the supernatant, the solution was washed twice with HBSS, and then incubated with H 2 O 2 at a concentration of 0.75 mM for 2 hours 30 minutes. After incubation, the supernatant was removed and the WST solution was diluted 1: 9 in the medium and treated with the cells.
  • the absorbance value was measured at 450 nm to calculate cell viability to compare the antioxidant efficacy of the treatment of caffeic acid, caffeic acid encapsulated in liposomes, and self-assembled PTD liposome caffeic acid.
  • Pork skin (0.7 mm thick, Medikinetics) was mounted between the top and bottom of the cell, and treated with 300 ⁇ l of 4 mM caffeic acid, liposome- (caffeic acid), self-assembled PTD-liposome- (caffeic acid). Filled the buffer at the bottom. After 24 hours, the sample at the bottom was taken. The collected sample was quantified using HPLC. C18 (4.6 ⁇ 250 mm reversed phase) was used as an HPLC column, flowed at a flow rate of 0.7 ml / min, and was detected at a wavelength of 330 nm using a UV absorbance detector.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Birds (AREA)
  • Dispersion Chemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Dermatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
  • Cosmetics (AREA)

Abstract

La présente invention concerne une structure globulaire dans laquelle de nouveaux domaines de transduction de protéine sont auto-assemblés. En utilisant le peptide ayant la séquence d'acides aminés de SEQ ID NO : 1 de la présente invention, une structure globulaire (par exemple, des liposomes) présentant une perméabilité améliorée par rapport aux cellules ou à la peau peut être construite. De plus, la structure globulaire (par exemple, des liposomes) construite dans la présente invention peut être utilisée pour y charger dedans un matériau modérément soluble (substance fonctionnelle de la peau ou substance pharmacologiquement efficace) et pour transporter efficacement le matériau dans la peau ou les cellules.
PCT/KR2017/011917 2016-11-10 2017-10-26 Structure globulaire contenant un nouveau domaine de transduction de protéine WO2018088734A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160149622A KR101797168B1 (ko) 2016-11-10 2016-11-10 신규의 프로테인 트랜스덕션 도메인을 함유하는 구형 구조체
KR10-2016-0149622 2016-11-10

Publications (2)

Publication Number Publication Date
WO2018088734A2 true WO2018088734A2 (fr) 2018-05-17
WO2018088734A3 WO2018088734A3 (fr) 2018-08-09

Family

ID=60385914

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/011917 WO2018088734A2 (fr) 2016-11-10 2017-10-26 Structure globulaire contenant un nouveau domaine de transduction de protéine

Country Status (2)

Country Link
KR (1) KR101797168B1 (fr)
WO (1) WO2018088734A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020222315A1 (fr) * 2019-04-29 2020-11-05 주식회사 바이오셀트란 Composition pour améliorer ou traiter des rides cutanées ayant une excellente perméabilité cutanée ou cellulaire

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100449889B1 (ko) * 2001-08-30 2004-09-22 동국제약 주식회사 음이온 고분자와 인지질의 결합체가 함유된 인지질 리포좀및 그의 제조방법과 응용
KR100811745B1 (ko) * 2006-07-07 2008-03-11 조선대학교산학협력단 세포투과성 펩타이드 Ｐｅｐ １으로부터 설계된 신규한항균 펩타이드 Ｐｅｐ 1 Ｋ 및 그의 용도
KR20090122769A (ko) * 2008-05-26 2009-12-01 메디스커브 주식회사 세포내로 단백질을 전달하는 방법 및 이를 위한 펩타이드
US20100112042A1 (en) * 2008-10-16 2010-05-06 Mdrna, Inc. Processes and Compositions for Liposomal and Efficient Delivery of Gene Silencing Therapeutics
KR101130550B1 (ko) * 2009-10-29 2012-03-23 고려대학교 산학협력단 세포투과성 펩타이드 표면 결합 나노 리포좀 및 이를 포함하는 항-아토피 조성물

Also Published As

Publication number Publication date
KR101797168B1 (ko) 2017-11-13
WO2018088734A3 (fr) 2018-08-09

Similar Documents

Publication Publication Date Title
Vhora et al. Lipid-nucleic acid nanoparticles of novel ionizable lipids for systemic BMP-9 gene delivery to bone-marrow mesenchymal stem cells for osteoinduction
Kuo et al. Wheat germ agglutinin-conjugated liposomes incorporated with cardiolipin to improve neuronal survival in Alzheimer’s disease treatment
Re et al. Functionalization of liposomes with ApoE-derived peptides at different density affects cellular uptake and drug transport across a blood-brain barrier model
KR101340354B1 (ko) 안정한 펩티드 제제
Hayward et al. Membrane fusion activity of purified SipB, a Salmonella surface protein essential for mammalian cell invasion
WO2013180537A2 (fr) Peptide à perméation cutanée
US8883967B2 (en) Branched amphipathic oligo-peptides that self-assemble into vesicles
Sancini et al. Functionalization with TAT-peptide enhances blood-brain barrier crossing in vitro of nanoliposomes carrying a curcumin-derivative to bind amyloid-β peptide
Regberg et al. pH-responsive PepFect cell-penetrating peptides
RU2743431C2 (ru) Липосомы, содержащие проникающие в клетки пептиды и тетраэфирные липиды, для пероральной доставки макромолекул
WO2011142515A1 (fr) Liposomes asymétriques pour l'encapsulation hautement efficace d'acides nucléiques et composés anioniques hydrophiles, et leur procédé de préparation
Zhang et al. The use of low molecular weight protamine to enhance oral absorption of exenatide
JPH11506722A (ja) 細胞に核酸を送達するための核酸運搬体
CN106619515A (zh) 脂质体组合物及其用途
Moeller et al. Stability, liposome interaction, and in vivo pharmacology of ghrelin in liposomal suspensions
Zhou et al. From a pro-apoptotic peptide to a lytic peptide: One single residue mutation
Diedrichsen et al. Revealing the importance of carrier-cargo association in delivery of insulin and lipidated insulin
Huang et al. Efficient cytosolic delivery mediated by polymersomes facilely prepared from a degradable, amphiphilic, and amphoteric copolymer
Clemons et al. Examining efficacy of “tat-less” delivery of a peptide against the L-type calcium channel in cardiac ischemia–reperfusion injury
Alhakamy et al. Dynamic measurements of membrane insertion potential of synthetic cell penetrating peptides
Yamada et al. Efficient and high-speed transduction of an antibody into living cells using a multifunctional nanocarrier system to control intracellular trafficking
Santalices et al. A nanoemulsion/micelles mixed nanosystem for the oral administration of hydrophobically modified insulin
Song et al. Oral delivery system for low molecular weight protamine-dextran-poly (lactic-co-glycolic acid) carrying exenatide to overcome the mucus barrier and improve intestinal targeting efficiency
WO2016108634A2 (fr) Nanostructure multi-lamellaire de type hybride de facteur de croissance épidermique et liposome et procédé de fabrication associé
Serna et al. Recruiting potent membrane penetrability in tumor cell-targeted protein-only nanoparticles

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17870507

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17870507

Country of ref document: EP

Kind code of ref document: A2