WO2018080225A2 - 시식성 파리의 종 구별용 snp 마커 및 이의 용도 - Google Patents

시식성 파리의 종 구별용 snp 마커 및 이의 용도 Download PDF

Info

Publication number
WO2018080225A2
WO2018080225A2 PCT/KR2017/011980 KR2017011980W WO2018080225A2 WO 2018080225 A2 WO2018080225 A2 WO 2018080225A2 KR 2017011980 W KR2017011980 W KR 2017011980W WO 2018080225 A2 WO2018080225 A2 WO 2018080225A2
Authority
WO
WIPO (PCT)
Prior art keywords
base
polynucleotide
seq
flies
fly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/011980
Other languages
English (en)
French (fr)
Other versions
WO2018080225A3 (ko
Inventor
박성환
박지혜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea University Research and Business Foundation
Original Assignee
Korea University Research and Business Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea University Research and Business Foundation filed Critical Korea University Research and Business Foundation
Publication of WO2018080225A2 publication Critical patent/WO2018080225A2/ko
Publication of WO2018080225A3 publication Critical patent/WO2018080225A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the present invention relates to SNP markers for distinguishing species of tasting flies and their use, and more particularly, to methods for distinguishing SNP marker compositions, kits, microarrays and tasting flies for distinguishing species of tasting flies.
  • black tanks (Calliphoridae), jipparigwa (Muscidae), swiparigwa (Sarcophagidae), Cheese Thief tanks (Piophilidae), flea tanks flies species (necrophagous fly species) Tasting Castle belongs to (Phoridae) have come to the body within a few minutes after death Because spawning and hatching continue to grow after a certain period of time, the larvae of flies (ie maggots) growing in the body are considered the most accurate indicators of the body's post-elapsed time in the forensic field.
  • the growth rate which is the most important factor in estimating the post-elapsed time, is also found among morphologically similar and genetically closely related fly species.
  • the dormant response, and the ecological habits are so different that it is necessary to accurately identify the fly species.
  • only highly skilled specialists can distinguish flies by morphological features, and immature individuals with few morphological features, such as eggs, larva, and pupa, may be expert. It is very difficult to identify.
  • the present inventors made a intensive effort to develop a method for distinguishing species of fly flies in a short time by using a small amount of DNA. As a result, we selected specific SNP markers between species of fly flies. The present invention was completed by confirming that a primer set that can be detected by using the present invention can be easily distinguished from fly species belonging to a testimonial fly family.
  • One object of the present invention is the 90th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A or T, the 72nd base is A, C, T or G, the 168th base is A Or T, 261th base is A, C or T, 252nd base is A or G, 243th base is C or T, and includes 90, 72, 168, 261, 252 and 243th bases.
  • SNP marker composition for distinguishing species of tasting flies comprising a polynucleotide consisting of 5 to 300 consecutive bases or a polynucleotide complementary thereto.
  • Another object of the present invention is to provide a composition for distinguishing species of tasting flies, comprising an agent capable of detecting the SNP marker.
  • Still another object of the present invention is to provide a kit for distinguishing species of tasting flies comprising the composition for discriminating.
  • Another object of the present invention is the 90th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A or T, the 72nd base is A, C, T or G, the 168th base Is A or T, the 261th base is A, C or T, the 252nd base is A or G, the 243th base is C or T, and the 90, 72, 168, 261, 252 and 243 bases It is to provide a microarray for distinguishing species of tasting flies, comprising a polynucleotide consisting of 5 to 300 consecutive bases comprising or a polynucleotide complementary thereto.
  • COI Cytochrome C Oxidase Subunit I
  • Another object of the present invention is to amplify a polymorphic site comprising: (a) a polymorphic site comprising a polynucleotide of SEQ ID NO: 20 or a SNP of a polynucleotide complementary thereto from DNA of a sample isolated from a sample flies; And (b) determining the base of the amplified polymorphic site.
  • One object of the present invention is the 1491th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A, C or T, the 1488th base is A, T or G, the 1479th base is A Or T, wherein the 1485th base is A or G and comprises a polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases or a polynucleotide complementary thereto It is to provide a marker composition for distinguishing species of flies.
  • COI Cytochrome C Oxidase Subunit I
  • Another object of the present invention is to provide a composition for distinguishing species of tasting flies, comprising an agent capable of detecting the SNP marker.
  • Still another object of the present invention is to provide a kit for distinguishing species of tasting flies comprising the composition for discriminating.
  • Another object of the present invention is the 1491th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A, C or T, the 1488th base is A, T or G, the 1479th base Is A or T, the 1485th base is A or G, and comprises a polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a polynucleotide complementary thereto, It is to provide a microarray for distinguishing species of tasting flies.
  • COI Cytochrome C Oxidase Subunit I
  • Another object of the present invention is to amplify a polymorphic site comprising: (a) a polymorphic site comprising a polynucleotide of SEQ ID NO: 20 or a SNP of a polynucleotide complementary thereto from DNA of a sample isolated from a sample flies; And (b) determining the base of the amplified polymorphic site.
  • the SNP marker for distinguishing the tasting flies of the present invention and the composition for distinguishing them using the same can be used as a means for easily distinguishing the species of the tasting flies with high accuracy, and thus can be actively used for criminal investigations such as the estimation of death time. .
  • 1 is a SNaPshot result of detecting the SNP marker of Lucilia ampullaceae .
  • Figure 2 is a SNaPshot results of detecting the SNP markers of the gold fly ( Lucilia caesar ).
  • 3 is a SNaPshot result of detecting SNP markers of two-tailed flies ( Triceratopyga calliphoroides ).
  • 4 is a SNaPshot result of detecting SNP markers of Lucilia illustris .
  • FIG. 5 shows SNaPshot results of detecting SNP markers of large black flies ( Calliphora lata ).
  • 6 is a SNaPshot result of detecting the SNP marker of Chrysomya megacephala .
  • FIG. 8 shows SNaPshot results of detecting SNP markers of Phormia regina .
  • 10 is a SNaPshot result of detecting the SNP marker of Calliphora vicina .
  • FIG. 11 shows SNaPshot results of detecting SNP markers of Aldrichina grahami .
  • FIG. 13 shows SNaPshot results of detecting SNP markers of parasarcophaga albiceps .
  • 15 is a SNaPshot result of detecting SNP markers of Sarcophaga hemorrhoidalis .
  • FIG. 16 shows SNaPshot results of detecting SNP markers of Sarcophaga melanura .
  • 17 is a SNaPshot result of detecting SNP markers of Sarcophoga peregrina .
  • FIG. 18 is a SNaPshot result of detecting SNP markers of Sarcophaga similis .
  • 19 is a SNaPshot result of detecting SNP markers of Sarcophaga crassipalpis .
  • one embodiment of the present invention is the 90th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A or T, the 72nd base is A, C, T or G Base 168 is A or T, base 261 is A, C, or T, base 252 is A or G, base 243 is C or T, and is 90, 72, 168, 261, 252 And a polynucleotide consisting of 5 to 300 consecutive bases comprising the 243th base or a polynucleotide complementary thereto, to provide a SNP marker composition for distinguishing species of tasting flies.
  • COI Cytochrome C Oxidase Subunit I
  • a specific SNP marker was selected among the species of fly flies, and a primer set capable of specifically detecting only the SNP marker was developed. By using this, it is possible to easily distinguish fly species belonging to the species of flies. Confirmed. Through this, using a small amount of DNA corresponding to about 1 ng it was confirmed that the species can be distinguished faster and more accurately, and completed the present invention.
  • COI Cytochrome C Oxidase Subunit I gene
  • COI Cytochrome C Oxidase Subunit I gene
  • the COI gene may include a polynucleotide of SEQ ID NO: 20, but is not limited thereto.
  • tempered flies refers to flies found in the corpse, and is known as the first insect to arrive after the development of a corpse.
  • Tasting Castle Paris belongs like black tanks (Calliphoridae), swiparigwa (Sarcophagidae), jipparigwa (Muscidae), Cheese Thief tanks (Piophilidae), flea tanks (Phoridae).
  • the tasting flies are, for example, Lucilia ampullaceae , Lucilia caesar , Triceratopyga calliphoroides , Lucilia illustris , Calliphora lata , Black fly gold fly ( Chrysomya megacephala), a big black cheek geumpari (Chrysomya pinguis), black geumpari (Phormia regina), copper geumpari (Lucilia sericata) red cheeks blowfly (Calliphora vicina), hairy black fly (Aldrichina grahami), red calf big house in Paris (Muscina angustifrons ), White-necked fly ( Parasarcophaga albiceps ), Sarcophaga dux , brook-fly ( Sarcophaga hemorrhoidalis ), black- bolted fly ( Sarcophaga melanura ), drifting fly ( Sarcophoga peregrina ), curly haired fly ( Sar
  • differentiation refers to the classification, classification, discrimination, identification, or determination of different tasting flies.
  • SNP marker refers to a single nucleotide polymorphism (SNP) allele base pair on a DNA sequence used to identify an individual or species. Since SNPs are relatively frequent and stable, and genetic distribution of individuals occurs as they are distributed throughout the genome, SNP markers may serve as an indicator of genetic proximity between individuals. SNP markers generally include a change in phenotype associated with single base polymorphism, but in some cases may not.
  • the 'SNP marker' may be used interchangeably with 'SNP'.
  • the SNP marker may be all or part of a polynucleotide including the SNP region of the COI gene represented by SEQ ID NO: 20, more specifically, the 90th base at the translation start position of the COI gene represented by SEQ ID NO: 20 Is A or T, 72nd base is A, C, T or G, 168th base is A or T, 261th base is A, C or T, 252nd base is A or G, 243th A polynucleotide consisting of 5 to 300, specifically 25 to 280, even more specifically 45 to 260 consecutive bases, wherein the base is C or T and comprises said 90, 72, 168, 261, 252 and 243 bases It may be, but is not limited to, an SNP marker for distinguishing species of tasting flies, including nucleotides or polynucleotides complementary thereto.
  • the species mitochondrial sequence of the fly (COI; listed in the Korean J Leg Med., 2013; 37: 177-182) and GenBank (www.ncbi.nih.gov); Species specific SNPs capable of distinguishing species of tasting flies were selected by identifying species variations based on the Cytochrome C Oxidase Subunit I gene region (Table 1).
  • compositions for distinguishing species of tasting flies comprising an agent capable of detecting the SNP marker.
  • the term “agent capable of detecting SNP markers” refers to an agent capable of specifically binding to and recognizing SNP markers included in the SNP marker composition, or capable of detecting and amplifying the SNP markers.
  • a probe capable of specifically binding to a polymorphic site including the SNP marker, or a primer capable of specifically detecting and amplifying a polynucleotide comprising the SNP marker or its complementary polynucleotide. May be).
  • probe refers to a nucleic acid fragment that is labeled such as RNA or DNA, which may correspond to mRNA, which may be short to several bases in length. Probes may be prepared in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, and the like.
  • probes that bind to and recognize SNP markers include sequences complementary to polynucleotide sequences comprising SNPs, but may be in the form of DNA, RNA or DNA-RNA hybrids.
  • a fluorescent labeling factor, a radiolabeling factor, or the like may be additionally attached to the 5 'or 3' end of the probe for visual recognition.
  • primer refers to a base sequence having a short free 3 ′ hydroxyl group, which can form complementary templates and base pairs and is a starting point for copying template strands. By a short sequence that functions as a point.
  • primers used for the detection and amplification of SNP markers appropriate conditions (e.g., four other nucleoside triphosphates and polymerizers such as DNA, RNA polymerase or reverse transcriptase) and appropriate temperatures It can be a single-stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis under the appropriate length of the primer, depending on the intended use.
  • the primer sequence need not be completely complementary to the polynucleotide comprising the SNP marker or its complementary polynucleotide, and may be used if it is complementary enough to hybridize.
  • primers may be modified, for example, methylation, encapsulation, substitution of nucleotides or modifications between nucleotides, such as uncharged linkages (e.g. methyl phosphonate, phosphoester, phosphoramidate, Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.).
  • uncharged linkages e.g. methyl phosphonate, phosphoester, phosphoramidate, Carbamate, etc.
  • charged linkers eg, phosphorothioate, phosphorodithioate, etc.
  • sequence of the primer and its length can be appropriately selected by those skilled in the art.
  • the sequence of the primer can be modified to improve the specificity and binding capacity for the SNP marker, it is possible to use a plurality of primers having different base sequences for the same SNP marker.
  • the length of the primer can be modified to distinguish the SNP markers by having amplification products including the respective SNP markers different sizes, using the same length primers for the same SNP markers, and to different SNP markers
  • the primer length is not particularly limited. More specifically, the length of each primer can be adjusted by adding a repeating base at its terminus, and the type of the base may be A, T, G, C, or a combination thereof, but as long as the primer has a repeating sequence, There is no limit to the type of. More specifically, the primer terminal may include 1 to 100, specifically 1 to 80, more specifically 1 to 60 bases, but is not particularly limited thereto, the number of the base is It may be appropriately selected by those skilled in the art for the purpose.
  • the primer may be a polynucleotide consisting of a nucleotide sequence represented by SEQ ID NO: 1 and 2, 5 to 15, but is not limited thereto.
  • the base sequence used in the present invention is to be construed to include a sequence showing substantial identity with the sequence described in the sequence list, in consideration of the biologically equivalent variation.
  • the term 'substantial identity' means that if the alignment of the sequence of the present invention with any other sequence is maximally matched, the aligned sequence is analyzed using algorithms commonly used in the art. By 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.
  • a primer represented by SEQ ID NOS: 1 and 2 was prepared to detect a DNA fragment containing SNP (Table 3), in the DNA amplification products amplified by SEQ ID NOS: 1 and 2
  • a primer represented by SEQ ID NOS: 5 to 15 was prepared by adding a T base to the terminal (Table 4).
  • Another aspect provides a kit for distinguishing species of tasting flies comprising said discriminating composition.
  • the kit of the present invention can distinguish the species of the tasting flies by detecting and identifying the base of the SNP marker provided in the present invention using the distinguishing composition of the present invention.
  • the kit may be a PCR kit or a DNA chip kit, but is not limited thereto.
  • the kit may be a kit including essential elements necessary for performing PCR.
  • PCR kits may include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), didioxynucleotides (ddNTPs) in addition to the respective primers specific for the SNP markers.
  • Enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also include primer pairs specific for the gene used as a quantitative control.
  • the kit of the present invention may be a DNA chip kit for distinguishing species of a tasting fly that includes essential elements necessary for carrying out the DNA chip.
  • DNA chip of the present invention means one of the DNA microarray which can identify each base of hundreds of thousands of DNA at a time.
  • the DNA chip kit is a substrate in which a nucleic acid species is attached in a gridded array to a glass surface, which is generally not larger than a flat solid support plate, typically a microscope slide. Multiple hybridization reactions occur between nucleic acids on a chip and complementary nucleic acids contained in a solution treated on a chip surface, thereby enabling mass parallel analysis.
  • Another embodiment provides a microarray for species discrimination of an edible fly comprising an SNP marker composition for species discrimination of an edible fly.
  • the 90th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A or T
  • the 72nd base is A, C, T or G
  • the 168th base is A Or T
  • 261th base is A
  • C or T
  • 252nd base is A or G
  • 243th base is C or T
  • Polynucleotides consisting of 5 to 300 consecutive bases or polynucleotides complementary thereto.
  • the microarray may include DNA or RNA polynucleotides.
  • the microarray consists of conventional microarrays except that the polynucleotide of the present invention is included in the probe polynucleotide.
  • the probe polynucleotide refers to a polynucleotide capable of hybridization, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid.
  • the probe of the present invention is an allele specific probe in which polymorphic sites exist in nucleic acid fragments derived from two members of the same species, and hybridize to DNA fragments derived from one member, but not to fragments derived from other members. . In this case, hybridization conditions show significant differences in hybridization strength between alleles, and should be sufficiently stringent to hybridize to only one of the alleles.
  • the probe of the present invention may be used for detecting alleles and distinguishing species of a tasting fly.
  • the distinguishing method includes detection methods based on hybridization of nucleic acids such as Southern blot and the like, and may be provided in a form that is pre-bound to the substrate of the DNA chip in a method using a DNA chip.
  • the hybridization can be carried out under stringent conditions, for example salt concentrations of 1 M or less and temperatures of 25 ° C. or higher. For example, conditions of 5 ⁇ SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 ° C. may be suitable for allele specific probe hybridization.
  • the process of immobilizing probe polynucleotides on the substrate associated with the species distinction of the tasting flies of the present invention can also be readily performed using this prior art.
  • the hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art.
  • the detection is accomplished by labeling a nucleic acid sample with a labeling substance capable of generating a detectable signal comprising, for example, a fluorescent substance such as Cy3 and Cy5, and then hybridizing onto a microarray and generating from the labeling substance.
  • the hybridization result can be detected by detecting the signal.
  • Another embodiment comprises the steps of: (a) amplifying a polymorphic site comprising a polynucleotide of SEQ ID NO: 20 or a SNP of a polynucleotide complementary thereto from DNA of a sample isolated from a tasting fly; And (b) determining the base of the amplified polymorphic site.
  • the SNP marker composition for distinguishing species of tasting flies provided by the present invention is a polynucleotide of SEQ ID NO: 20 capable of distinguishing species of tasting flies, specifically COI (Cytochrome) represented by SEQ ID NO: 20.
  • COI Cytochrome
  • the method comprises (c) in the polynucleotide of SEQ ID NO: 20, the 90th base is A, the 72th base is C, the 168th base is T, the 261th base is C, the 252th base is G, If the 243th base is T, further comprising the step of judging by Lucilia ampullaceae ;
  • the method may further include determining a red-cheeked black fly ( Calliphora vicina ).
  • the method may further include determining a hairy fly ( Aldrichina grahami ).
  • the method may further include determining a hairy fly ( Aldrichina grahami ).
  • polymorphism refers to a case in which two or more alleles exist in one locus, and that only one base differs from one polymorphic site to another. Called polymorphism.
  • the polymorphic marker may have two or more alleles showing an incidence of 1% or more, more specifically 5% or 10% or more in the selected population, but is not limited thereto.
  • alleles refers to several types of genes that exist at the same locus of homologous chromosomes. Alleles are also used to indicate polymorphism, for example, SNPs have two kinds of bialleles.
  • the step of amplifying the polymorphic site of the SNP marker from the DNA of step (a) can be used by any method known to those skilled in the art. Specific examples may include, but are not limited to, PCR, ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, nucleic acid based sequence amplification (NASBA), and the like.
  • LCR ligase chain reaction
  • NASBA nucleic acid based sequence amplification
  • step of determining the base of the amplified polymorphic site of step (b) may be any method known to those skilled in the art. Specific examples include sequencing, mini-sequencing, allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis (e.g., single base extension (SBE), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), Bio-Plex system (BioRad), etc., but are not limited thereto. no.
  • sequencing mini-sequencing, allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis (e.g., single base extension (SBE), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), Bio-Plex system
  • the sequencing or mini-sequencing analysis can use conventional methods for sequencing and can be performed using an automated genetic analyzer.
  • allele specific PCR may be performed by amplifying a DNA fragment in which the mutation is located with a primer set including a primer designed with a 3 'terminal as the base where the mutation site is located.
  • PCR extension assays are also performed after amplifying DNA fragments containing SNP markers with primer pairs and inactivating by dephosphorylation of all nucleotides added to the reaction, including specific extension primers, dNTP mixtures, didioxy
  • the extension primer is a 3 'end of the base immediately adjacent to the 5' direction of the base where the mutation site is located
  • the dNTP mixture excludes a nucleic acid having the same base as the didioxynucleotide
  • the didioxynucleotide is a mutation It is selected from one of the base types shown.
  • the primer is extended by DNA polymerase at the base where the substitution takes place and after several bases A
  • the primer extension is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, since the extension reaction is terminated at the position, it is possible to determine the base type showing the mutation by comparing the length of the extended primer.
  • the mutation may be detected by detecting fluorescence using a gene analyzer (for example, ASM PRISM 3500, 3700, etc.) used for the general nucleotide sequence determination.
  • a gene analyzer for example, ASM PRISM 3500, 3700, etc.
  • the genetic variation of the SNP can be detected by molecular weight measurement using a matrix assisted laser desorption ionization-time of flight (MALDI-TOF) technique.
  • MALDI-TOF matrix assisted laser desorption ionization-time of flight
  • the DNA fragment containing the SNP marker of the present invention was amplified by PCR using primers represented by SEQ ID NOs: 1 and 2 from the DNA of the extracted tasting flies, and then the amplified DNA product.
  • Single base extension (SBE) analysis was performed using primers represented by SEQ ID NOs: 5 to 14, fluorescently labeled ddNTP, and the like (Examples 2-2 and 2-3).
  • SBE Single base extension
  • one embodiment of the present invention is the 1491th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A, C or T, the 1488th base is A, T or G , A 1479 base is A or T, a 1485 base is A or G, and a polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases or a poly complementary thereto Provided are marker compositions for distinguishing species of tasting flies, including nucleotides.
  • COI Cytochrome C Oxidase Subunit I
  • a specific SNP marker was selected among the species of fly flies, and a primer set capable of specifically detecting only the SNP marker was developed. By using this, it is possible to easily distinguish fly species belonging to the species of flies. Confirmed. Through this, using a small amount of DNA corresponding to about 1 ng it was confirmed that the species can be distinguished faster and more accurately, and completed the present invention.
  • COI Cytochrome C Oxidase Subunit I gene
  • COI Cytochrome C Oxidase Subunit I gene
  • the COI gene may include a polynucleotide of SEQ ID NO: 20, but is not limited thereto.
  • tempered flies refers to flies found in the corpse, and is known as the first insect to arrive after the development of a corpse.
  • Tasting Castle Paris belongs like black tanks (Calliphoridae), swiparigwa (Sarcophagidae), jipparigwa (Muscidae), Cheese Thief tanks (piophilidae), flea tanks (phoridae).
  • the tasting flies are, for example, Lucilia ampullaceae , Lucilia caesar , Triceratopyga calliphoroides , Lucilia illustris , Calliphora lata , Black fly gold fly ( Chrysomya megacephala), a big black cheek geumpari (Chrysomya pinguis), black geumpari (Phormia regina), copper geumpari (Lucilia sericata) red cheeks blowfly (Calliphora vicina), hairy black fly (Aldrichina grahami), red calf big house in Paris (Muscina angustifrons ), White-necked fly ( Parasarcophaga albiceps ), Sarcophaga dux , brook-fly ( Sarcophaga hemorrhoidalis ), black- bolted fly ( Sarcophaga melanura ), drifting fly ( Sarcophoga peregrina ), curly haired fly ( Sar
  • the term “differentiation” refers to classifying, classifying, discriminating, identifying, or judging different species belonging to a visual fly.
  • SNP marker refers to a single nucleotide polymorphism (SNP) allele base pair on a DNA sequence used to identify an individual or species. Since SNPs are relatively frequent and stable, and genetic distribution of individuals occurs as they are distributed throughout the genome, SNP markers may serve as an indicator of genetic proximity between individuals. SNP markers generally include a change in phenotype associated with single base polymorphism, but in some cases may not.
  • the 'SNP marker' may be used interchangeably with 'SNP'.
  • the SNP marker may be all or part of a polynucleotide including the SNP region of the COI gene represented by SEQ ID NO: 20, more specifically, the 1491th base at the translation start position of the COI gene represented by SEQ ID NO: 20 Is A, C or T, the 1488th base is A, T or G, the 1479th base is A or T, the 1485th base is A or G, and includes the 1491, 1488, 1479 and 1485 bases May be a SNP marker for distinguishing species of tasting flies, including polynucleotides consisting of 5 to 300, specifically 25 to 280, even more specifically 45 to 260 consecutive bases or complementary polynucleotides thereof.
  • the present invention is not limited thereto.
  • the species mitochondrial sequence of the fly (COI; listed in the Korean J Leg Med., 2013; 37: 177-182) and GenBank (www.ncbi.nih.gov); Species specific SNPs capable of distinguishing species of tasting flies were selected by identifying species variations based on the Cytochrome C Oxidase Subunit I gene region (Table 2).
  • compositions for distinguishing species of tasting flies comprising an agent capable of detecting the SNP marker.
  • the term "agent capable of detecting SNP markers” refers to an agent capable of specifically binding to and recognizing SNP markers included in the SNP marker composition, or an agent capable of detecting and amplifying the SNP.
  • a probe capable of specifically binding to the polymorphic site including the SNP marker, or a primer capable of specifically detecting and amplifying a polynucleotide comprising the SNP marker or a complementary polynucleotide thereof. can be.
  • probe refers to a nucleic acid fragment that is labeled such as RNA or DNA, which may correspond to mRNA, which may be short to several bases in length. Probes may be prepared in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, and the like.
  • probes that bind to and recognize SNP markers include sequences complementary to polynucleotide sequences comprising SNPs, but may be in the form of DNA, RNA or DNA-RNA hybrids.
  • a fluorescent labeling factor, a radiolabeling factor, or the like may be additionally attached to the 5 'or 3' end of the probe for visual recognition.
  • primer refers to a base sequence having a short free 3 ′ hydroxyl group, which can form complementary templates and base pairs and is a starting point for copying template strands. By a short sequence that functions as a point.
  • primers used for the detection and amplification of SNP markers appropriate conditions (e.g., four other nucleoside triphosphates and polymerizers such as DNA, RNA polymerase or reverse transcriptase) and appropriate temperatures It can be a single-stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis under the appropriate length of the primer, depending on the intended use.
  • the primer sequence need not be completely complementary to the polynucleotide comprising the SNP marker or its complementary polynucleotide, and may be used if it is complementary enough to hybridize.
  • primers may be modified, for example, methylation, encapsulation, substitution of nucleotides or modifications between nucleotides, such as uncharged linkages (e.g. methyl phosphonate, phosphoester, phosphoramidate, Carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.).
  • uncharged linkages e.g. methyl phosphonate, phosphoester, phosphoramidate, Carbamate, etc.
  • charged linkers eg, phosphorothioate, phosphorodithioate, etc.
  • sequence of the primer and its length can be appropriately selected by those skilled in the art.
  • the sequence of the primer can be modified to improve the specificity and binding capacity for the SNP marker, it is possible to use a plurality of primers having different base sequences for the same SNP marker.
  • the length of the primer can be modified to distinguish the SNP markers by having amplification products including the respective SNP markers different sizes, using the same length primers for the same SNP markers, and to different SNP markers
  • the primer length is not particularly limited. More specifically, the length of each primer can be adjusted by adding a repeating base at its terminus, and the type of the base may be A, T, G, C, or a combination thereof, but as long as the primer has a repeating sequence, There is no limit to the type of. More specifically, the primer terminal may include 1 to 100, specifically 1 to 80, more specifically 1 to 60 bases, but is not particularly limited thereto, the number of the base is It may be appropriately selected by those skilled in the art for the purpose.
  • the primer may be a polynucleotide consisting of the nucleotide sequences represented by SEQ ID NOs: 3 and 4, and 16 to 19, but is not limited thereto.
  • the base sequence used in the present invention is to be construed to include a sequence showing substantial identity with the sequence described in the sequence list, in consideration of the biologically equivalent variation.
  • the term 'substantial identity' means that if the alignment of the sequence of the present invention with any other sequence is maximally matched, the aligned sequence is analyzed using algorithms commonly used in the art. By 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.
  • a primer represented by SEQ ID NOS: 3 and 4 was prepared to detect a DNA fragment containing SNP (Table 3), and in the DNA amplification products amplified by SEQ ID NOs: 3 and 4 In order to detect only SNP, a primer represented by SEQ ID NOS: 16 to 19 having a length adjusted by adding a T base at the end was prepared (Table 4).
  • Another aspect provides a kit for distinguishing species of tasting flies comprising said discriminating composition.
  • the kit of the present invention can distinguish the species of the tasting flies by detecting and identifying the base of the SNP marker provided in the present invention using the distinguishing composition of the present invention.
  • the kit may be a PCR kit or a DNA chip kit, but is not limited thereto.
  • the kit may be a kit including essential elements necessary for performing PCR.
  • PCR kits may include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), didioxynucleotides (ddNTPs) in addition to the respective primers specific for the SNP markers.
  • Enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also include primer pairs specific for the gene used as a quantitative control.
  • the kit of the present invention may be a DNA chip kit for distinguishing species of a tasting fly that includes essential elements necessary for carrying out the DNA chip.
  • DNA chip of the present invention means one of the DNA microarray which can identify each base of hundreds of thousands of DNA at a time.
  • the DNA chip kit is a substrate in which a nucleic acid species is attached in a gridded array to a glass surface, which is generally not larger than a flat solid support plate, typically a microscope slide. Multiple hybridization reactions occur between nucleic acids on a chip and complementary nucleic acids contained in a solution treated on a chip surface, thereby enabling mass parallel analysis.
  • Another embodiment provides a microarray for species discrimination of an edible fly comprising an SNP marker composition for species discrimination of an edible fly.
  • the 1491th base of the Cytochrome C Oxidase Subunit I (COI) gene represented by SEQ ID NO: 20 is A, C, or T
  • the 1488th base is A, T, or G
  • the 1479th base is A.
  • the 1485th base is A or G
  • a polynucleotide consisting of 5 to 300 consecutive bases comprising the 1491, 1488, 1479 and 1485 bases, or a polynucleotide complementary thereto.
  • the microarray may include DNA or RNA polynucleotides.
  • the microarray consists of conventional microarrays except that the polynucleotide of the present invention is included in the probe polynucleotide.
  • the probe polynucleotide refers to a polynucleotide capable of hybridization, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid.
  • the probe of the present invention is an allele specific probe in which polymorphic sites exist in nucleic acid fragments derived from two members of the same species, and hybridize to DNA fragments derived from one member, but not to fragments derived from other members. . In this case, hybridization conditions show significant differences in hybridization strength between alleles, and should be sufficiently stringent to hybridize to only one of the alleles.
  • the probe of the present invention may be used for detecting alleles and distinguishing species of a tasting fly.
  • the distinguishing method includes detection methods based on hybridization of nucleic acids such as Southern blot and the like, and may be provided in a form that is pre-bound to the substrate of the DNA chip in a method using a DNA chip.
  • the hybridization can be carried out under stringent conditions, for example salt concentrations of 1 M or less and temperatures of 25 ° C. or higher. For example, conditions of 5 ⁇ SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 ° C. may be suitable for allele specific probe hybridization.
  • the process of immobilizing probe polynucleotides on the substrate associated with the species distinction of the tasting flies of the present invention can also be readily performed using this prior art.
  • the hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art.
  • the detection is accomplished by labeling a nucleic acid sample with a labeling substance capable of generating a detectable signal comprising, for example, a fluorescent substance such as Cy3 and Cy5, and then hybridizing onto a microarray and generating from the labeling substance.
  • the hybridization result can be detected by detecting the signal.
  • Another embodiment comprises the steps of: (a) amplifying a polymorphic site comprising a polynucleotide of SEQ ID NO: 20 or a SNP of a polynucleotide complementary thereto from DNA of a sample isolated from a tasting fly; And (b) determining the base of the amplified polymorphic site.
  • the SNP marker composition for distinguishing species of tasting flies provided by the present invention is a polynucleotide of SEQ ID NO: 20 capable of distinguishing species of tasting flies, specifically COI (Cytochrome) represented by SEQ ID NO: 20.
  • COI Cytochrome
  • the method comprises: (c) Parasarcophaga albiceps in the polynucleotide of SEQ ID NO: 20 when the 1491st base is T, the 1488th base is A, the 1479th base is T, and the 1485th base is A Judging by);
  • polymorphism refers to a case in which two or more alleles exist in one locus, and that only one base differs from one polymorphic site to another. Called polymorphism.
  • the polymorphic marker may have two or more alleles showing an incidence of 1% or more, more specifically 5% or 10% or more in the selected population, but is not limited thereto.
  • alleles refers to several types of genes that exist at the same locus of homologous chromosomes. Alleles are also used to indicate polymorphism, for example, SNPs have two kinds of bialleles.
  • the step of amplifying the polymorphic site of the SNP marker from the DNA of step (a) can be used by any method known to those skilled in the art. Specific examples may include, but are not limited to, PCR, ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, nucleic acid based sequence amplification (NASBA), and the like.
  • LCR ligase chain reaction
  • NASBA nucleic acid based sequence amplification
  • step of determining the base of the amplified polymorphic site of step (b) may be any method known to those skilled in the art. Specific examples include sequencing, mini-sequencing, allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis (e.g., single base extension (SBE), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), Bio-Plex system (BioRad), etc., but are not limited thereto. no.
  • sequencing mini-sequencing, allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis (e.g., single base extension (SBE), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), Bio-Plex system
  • the sequencing or mini-sequencing analysis can use conventional methods for sequencing and can be performed using an automated genetic analyzer.
  • allele specific PCR may be performed by amplifying a DNA fragment in which the mutation is located with a primer set including a primer designed with a 3 'terminal as the base where the mutation site is located.
  • PCR extension assays are also performed after amplifying DNA fragments containing SNP markers with primer pairs and inactivating by dephosphorylation of all nucleotides added to the reaction, including specific extension primers, dNTP mixtures, didioxy
  • the extension primer is a 3 'end of the base immediately adjacent to the 5' direction of the base where the mutation site is located
  • the dNTP mixture excludes a nucleic acid having the same base as the didioxynucleotide
  • the didioxynucleotide is a mutation It is selected from one of the base types shown.
  • the primer is extended by DNA polymerase at the base where the substitution takes place and after several bases A
  • the primer extension is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, since the extension reaction is terminated at the position, it is possible to determine the base type showing the mutation by comparing the length of the extended primer.
  • the mutation may be detected by detecting fluorescence using a gene analyzer (for example, ASM PRISM 3500, 3700, etc.) used for the general nucleotide sequence determination.
  • a gene analyzer for example, ASM PRISM 3500, 3700, etc.
  • the genetic variation of the SNP can be detected by molecular weight measurement using a matrix assisted laser desorption ionization-time of flight (MALDI-TOF) technique.
  • MALDI-TOF matrix assisted laser desorption ionization-time of flight
  • the DNA fragment containing the SNP marker of the present invention was amplified by PCR using primers represented by SEQ ID NOs: 3 and 4 from the DNA of the extracted tasting fly, and then the amplified DNA product.
  • Single base extension (SBE) analysis was performed using primers represented by SEQ ID NOS: 16-19, fluorescently labeled ddNTP, and the like (Examples 2-2 and 2-3).
  • SBE Single base extension
  • the seven flies belonging to the family of the Parisian family of tasting flies each have the SNP markers selected in the present invention, and thus the different species of the tasting flies. It was confirmed that all can be distinguished (Figs. 13 to 19). This suggests that the SNP markers identified in the present invention and the composition for distinguishing using the same may be used as a means for easily distinguishing the species of the fly with high accuracy.
  • Species specific SNP markers were selected to differentiate the species of tasting flies found in the corpse.
  • mitochondrial sequence of species of fly (CO I; Cytochrome C Oxidase Subunit I gene), which is listed in Korean J Leg Med., 2013; 37: 177-182 and GenBank (www.ncbi.nih.gov). After confirming the variation in species based on the region), a common base sequence was created to select SNPs for each species, so that their combinations could distinguish between species of flies.
  • species specific SNPs were selected to distinguish the species through the combination of the SNP markers of Table 1 and the fly family of Swipeaceae, which are a type of fly flies.
  • Al is a white-necked fly ( parasarcophaga albiceps )
  • Dux is a sarcophaga dux
  • Hm is a creek ( sarcophaga hemorrhoidalis )
  • Me is a Sarcophaga melanura
  • Pg is Sarcophoga peregrina
  • Si is Sarcophaga similis
  • And Cr refers to redcoil fly ( Sarcophaga crassipalpis ).
  • primers specific for the SNP were prepared by the method according to Examples 2-1 to 2-3, and the SNP was detected using the same. It was.
  • DNA was isolated from flies according to the method of close sample type provided by GeneAll Tissue SV Mini Kit (GeneAll, Seoul, Korea), and DNA was analyzed using a NanoDrop Spectrophotometer (model: ND-2000C, Thermo Scientific, Wilmington, USA). The concentration was measured. DNA solution was diluted to experimental concentration with distilled water and stored at 20 ° C. until use.
  • PCR primers were prepared as described in Table 3 below.
  • PCR was performed in the following manner.
  • the PCR product obtained was used as a template for sequencing. Purify the PCR product with ExoSAP-IT reagent (Affymetrix, Santa Clara, USA), perform sequencing with BigDye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA), and finally with ABI PRISM 3730 DNA sequencer. The sequence was determined by.
  • SNP specific primers were prepared as described in Table 4 below. Specifically, as the length of the primer increases, the size of the PCR product amplified using the primer also increases. Accordingly, in order to distinguish each amplified SNP marker, primers having different lengths were prepared for the markers, and the length of the primers was determined by adding a repeating base (T) to the tail thereof. Adjusted. In addition, for the same SNP markers, the number of bases added to the ends and the length of the primers are the same, but one to three primers having different sequences of the primers were prepared.
  • T repeating base

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)

Abstract

본 발명은 시식성 파리의 종 구별용 SNP 마커 및 이의 용도에 관한 것으로, 구체적으로 시식성 파리의 종 구별을 위한 SNP 마커 조성물, 키트, 마이크로어레이 및 시식성 파리의 구별 방법에 관한 것이다. 본 발명의 시식성 파리를 구별하기 위한 SNP 마커 및 이를 이용한 구별용 조성물은 시식성 파리의 종을 높은 정확도로 간편히 구분하는 수단으로 사용될 수 있으므로, 사망시간의 추정 등 범죄수사에 적극 활용될 수 있다.

Description

시식성 파리의 종 구별용 SNP 마커 및 이의 용도
본 발명은 시식성 파리의 종 구별용 SNP 마커 및 이의 용도에 관한 것으로, 구체적으로 시식성 파리의 종 구별을 위한 SNP 마커 조성물, 키트, 마이크로어레이 및 시식성 파리의 구별 방법에 관한 것이다.
살인사건 수사에서 사망시각이나 사후경과시간(postmortem interval; PMI)을 정확하게 판단하는 것은 매우 중요한 일이다. 인간을 포함한 모든 동물들이 사망한 후에 시작되는 부패는 장내세균(intestinal flora)과 시식성 절지동물의 개입으로 진행되는데, 부패의 정도에 따라 시체에 유입하는 시식성 곤충들(necrophagous insects)의 종(species)이 다르다. 특히, 검정파리과(Calliphoridae), 집파리과(Muscidae), 쉬파리과(Sarcophagidae), 치즈도둑파리과(Piophilidae), 벼룩파리과(Phoridae)에 속하는 시식성 파리 종(necrophagous fly species)들이 사망 후 몇 분 내에 시체를 찾아와 산란하고 일정 시간이 경과하면 부화하여 성장을 계속하기 때문에, 시체에서 성장하는 파리의 유충(즉, 구더기)은 법의학 분야에서 시체의 사후경과시간을 추정할 수 있는 가장 정확한 지표로 간주된다.
상술한 바와 같이, 파리의 유충 등과 같은 곤충 증거물을 이용하여 사후경과시간을 추정하기 위해서는, 형태학적으로 유사하고 유전적으로 밀접한 관계가 있는 파리 종들 간에도 사후경과시간 추정에 가장 중요한 요소인 성장률(growth rate), 휴면반응(diapause response), 생태적 습성(ecological habits) 등이 현저히 다르기 때문에 파리 종을 정확하게 동정할 필요가 있다. 그러나, 고도로 숙련된 전문가만이 형태학적 특징으로 파리 종을 구별할 수 있으며, 파리의 알(egg), 유충(larva), 번데기(pupa)와 같이 형태적 특징이 거의 없는 미성숙 개체들은 전문가라 하더라도 식별이 매우 어려운 단점이 있다.
또한, 살인사건 현장에서 수집되는 곤충 증거물은 파리 성충보다는 시체에서 성장하고 있는 미성숙 파리인 구더기나 번데기가 대부분이며, 이러한 미성숙 개체는 성충까지 발육시켜야만 파리 종의 식별이 가능하게 된다. 따라서, 실제로 사건에 적용하기에는 많은 시간과 노력이 필요하기 때문에 보다 정확하고 간편하며 신속하게 파리 종을 동정할 수 있는 방법의 개발이 요구되고 있다.
이와 관련하여, 분자유전학적으로 종을 동정하는 방법에 대하여 활발한 연구개발이 이루어지고 있다. mtDNA 유전표식자(genetic marker)로 시식성 파리 종을 식별할 수 있는 가능성이 보고되었으며(Sperling G. et al., In Early Vision and Beyond. Cambridge, MA: MIT Press, 1994. Pp. 133-142.), 이후, COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 서열 분석을 분석하여 비교함으로써 검정파리 또는 쉬파리과 내에 속하는 종을 구별하는 방법이 공지되었다(Seong Hwan Park et al., J Forensic Sci, September 2009, Vol. 54, No. 5; Yu-Hoon Kim et el., The Scientific World Journal, Volume 2014, Article ID 275085, 9 pages). 그러나, 이러한 염기서열 분석을 통한 동정 방법은 많은 양의 DNA가 필요하며, 시간이 오래 걸리는 단점이 있었다.
본 발명자들은 소량의 DNA를 이용하여 짧은 시간에 시식성 파리의 종을 구별하기 위한 방법을 개발하고자 예의 노력연구한 결과, 시식성 파리 종 간에 특이적인 SNP 마커를 선정하였으며, 상기 SNP 마커만을 특이적으로 검출할 수 있는 프라이머 세트를 개발하였고, 이를 이용하면 시식성 파리과에 속하는 파리 종을 간편히 구별할 수 있음을 확인함으로써 본 발명을 완성하였다.
본 발명의 하나의 목적은 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 90번째 염기가 A 또는 T이고, 72번째 염기가 A, C, T 또는 G이고, 168번째 염기가 A 또는 T이고, 261번째 염기가 A, C 또는 T이고, 252번째 염기가 A 또는 G이고, 243번째 염기가 C 또는 T이고, 상기 90, 72, 168, 261, 252 및 243번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종(species) 구별을 위한 SNP 마커 조성물을 제공하는 것이다.
본 발명의 다른 하나의 목적은 상기 SNP 마커를 검출할 수 있는 제제를 포함하는, 시식성 파리의 종 구별용 조성물을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 구별용 조성물을 포함하는 시식성 파리의 종 구별용 키트를 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 90번째 염기가 A 또는 T이고, 72번째 염기가 A, C, T 또는 G이고, 168번째 염기가 A 또는 T이고, 261번째 염기가 A, C 또는 T이고, 252번째 염기가 A 또는 G이고, 243번째 염기가 C 또는 T이고, 상기 90, 72, 168, 261, 252 및 243번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종 구별용 마이크로어레이를 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 (a) 시식성 파리로부터 분리된 시료의 DNA로부터 서열번호 20의 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위(polymorphic site)를 증폭시키는 단계; 및 (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 시식성 파리의 종 구별 방법을 제공하는 것이다.
본 발명의 하나의 목적은 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 1491번째 염기가 A, C 또는 T이고, 1488번째 염기가 A, T 또는 G이고, 1479번째 염기가 A 또는 T이고, 1485번째 염기가 A 또는 G이고, 상기 1491, 1488, 1479 및 1485번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종(species) 구별을 위한 마커 조성물을 제공하는 것이다.
본 발명의 다른 하나의 목적은 상기 SNP 마커를 검출할 수 있는 제제를 포함하는, 시식성 파리의 종 구별용 조성물을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 구별용 조성물을 포함하는 시식성 파리의 종 구별용 키트를 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 1491번째 염기가 A, C 또는 T이고, 1488번째 염기가 A, T 또는 G이고, 1479번째 염기가 A 또는 T이고, 1485번째 염기가 A 또는 G이고, 상기 1491, 1488, 1479 및 1485번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종 구별용 마이크로어레이를 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 (a) 시식성 파리로부터 분리된 시료의 DNA로부터 서열번호 20의 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위(polymorphic site)를 증폭시키는 단계; 및 (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 시식성 파리의 종 구별 방법을 제공하는 것이다.
본 발명의 시식성 파리를 구별하기 위한 SNP 마커 및 이를 이용한 구별용 조성물은 시식성 파리의 종을 높은 정확도로 간편히 구분하는 수단으로 사용될 수 있으므로, 사망시간의 추정 등 범죄수사에 적극 활용될 수 있다.
도 1은 푸른등금파리(Lucilia ampullaceae)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 2는 금파리(Lucilia caesar)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 3은 두꼬리금파리(Triceratopyga calliphoroides)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 4는 연두금파리(Lucilia illustris)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 5는 큰검정파리(Calliphora lata)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 6은 검정빰금파리(Chrysomya megacephala)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 7은 큰검정뺨금파리(Chrysomya pinguis)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 8은 검정금파리(Phormia regina)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 9는 구리금파리(Lucilia sericata)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 10은 붉은뺨검정파리(Calliphora vicina)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 11은 털검정파리(Aldrichina grahami)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 12는 붉은종아리큰집파리(Muscina angustifrons)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 13은 흰목덜미쉬파리(Parasarcophaga albiceps)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 14는 왕초쉬파리(Sarcophaga dux)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 15는 개울쉬파리(Sarcophaga hemorrhoidalis)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 16은 검정볼기쉬파리(Sarcophaga melanura)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 17은 떠돌이쉬파리(Sarcophoga peregrina)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 18은 곱슬털쉬파리(Sarcophaga similis)의 SNP 마커를 탐지한 SNaPshot 결과이다.
도 19는 붉은볼기쉬파리(Sarcophaga crassipalpis)의 SNP 마커를 탐지한 SNaPshot 결과이다.
상기 목적을 달성하기 위하여, 본 발명의 하나의 양태는 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 90번째 염기가 A 또는 T이고, 72번째 염기가 A, C, T 또는 G이고, 168번째 염기가 A 또는 T이고, 261번째 염기가 A, C 또는 T이고, 252번째 염기가 A 또는 G이고, 243번째 염기가 C 또는 T이고, 상기 90, 72, 168, 261, 252 및 243번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종(species) 구별을 위한 SNP 마커 조성물을 제공한다.
본 발명에서는 시식성 파리 종 간에 특이적인 SNP 마커를 선정하였으며, 상기 SNP 마커만을 특이적으로 검출할 수 있는 프라이머 세트를 개발하였고, 이를 이용하면 시식성 파리에 속하는 파리 종을 간편히 구별할 수 있음을 확인하였다. 이를 통해, 약 1 ng에 해당하는 소량의 DNA를 이용하여 보다 빠르고 정확하게 시식성 파리의 종을 구별할 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 용어, "COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자"는 박테리아와 진핵생물의 미토콘드리아에 존재하는 막 단백질로서, 종의 구분을 위해 사용되는 DNA 표지자를 의미하며, 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있다(Accession: ACL01376.1, AMH84773.1 등). 본 발명에서, 상기 COⅠ 유전자는 서열번호 20의 폴리뉴클레오티드를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 용어, "시식성 파리"는 시체에서 발견되는 파리를 의미하며, 사체 발생 후 가장 먼저 도착하는 곤충으로 알려져 있다. 시식성 파리에는 검정파리과(Calliphoridae), 쉬파리과(Sarcophagidae), 집파리과(Muscidae), 치즈도둑파리과(Piophilidae), 벼룩파리과(Phoridae) 등이 속해있다.
상기 시식성 파리는, 구체적인 예로, 푸른등금파리(Lucilia ampullaceae), 금파리(Lucilia caesar), 두꼬리금파리(Triceratopyga calliphoroides), 연두금파리(Lucilia illustris), 큰검정파리(Calliphora lata), 검정빰금파리(Chrysomya megacephala), 큰검정뺨금파리(Chrysomya pinguis), 검정금파리(Phormia regina), 구리금파리(Lucilia sericata) 붉은뺨검정파리(Calliphora vicina), 털검정파리(Aldrichina grahami), 붉은종아리큰집파리(Muscina angustifrons), 흰목덜미쉬파리(Parasarcophaga albiceps), 왕초쉬파리(Sarcophaga dux), 개울쉬파리(Sarcophaga hemorrhoidalis), 검정볼기쉬파리(Sarcophaga melanura), 떠돌이쉬파리(Sarcophoga peregrina), 곱슬털쉬파리(Sarcophaga similis) 또는 붉은볼기쉬파리(Sarcophaga crassipalpis)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 용어, "구별"은 서로 다른 시식성 파리 종을 분류, 구분, 판별, 식별 또는 판단하는 것을 의미한다.
본 발명의 용어, "SNP 마커"는 개체 또는 종을 식별하기 위해 이용되는 DNA 서열 상의 단일 염기 다형성(single nucleotide polymorphism; SNP) 대립인자 염기쌍을 의미한다. SNP는 비교적 그 빈도가 높고 안정하며, 유전체 전체에 분포되어 있음에 따라 개체의 유전적 다양성이 발생하므로, SNP 마커는 개체 간의 유전적 근접성을 알려주는 지표의 역할을 할 수 있다. SNP 마커는 일반적으로 단일 염기 다형성에 수반되는 표현형의 변화를 포함하지만 경우에 따라 그렇지 않을 수도 있다.
본 명세서에서, 상기 'SNP 마커'는 'SNP'와 혼용되어 명명될 수 있다.
본 발명에서, 상기 SNP 마커는 서열번호 20으로 표시되는 COⅠ 유전자의 SNP 부위를 포함하는 전체 또는 일부 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 20으로 표시되는 COⅠ 유전자의 번역시작 위치에서 90번째 염기가 A 또는 T이고, 72번째 염기가 A, C, T 또는 G이고, 168번째 염기가 A 또는 T이고, 261번째 염기가 A, C 또는 T이고, 252번째 염기가 A 또는 G이고, 243번째 염기가 C 또는 T이고, 상기 90, 72, 168, 261, 252 및 243번째 염기를 포함하는 5 내지 300개, 구체적으로 25 내지 280개, 더더욱 구체적으로 45 내지 260개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종 구별을 위한 SNP 마커일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 구체적인 일 실시예에서는, 기존 문헌(Korean J Leg Med., 2013;37:177-182) 및 GenBank(www.ncbi.nih.gov)에 등재되어 있는 파리의 종별 미토콘드리아 염기서열(COⅠ; Cytochrome C Oxidase Subunit Ⅰ 유전자 영역)에 근거하여 종 내 변이를 확인함으로써, 시식성 파리의 종을 구별할 수 있는 종 특이적인 SNP를 선정하였다(표 1).
다른 하나의 양태는 상기 SNP 마커를 검출할 수 있는 제제를 포함하는, 시식성 파리의 종 구별용 조성물을 제공한다.
본 발명의 용어, "SNP 마커를 검출할 수 있는 제제"는 상기 SNP 마커 조성물에 포함된 SNP 마커에 특이적으로 결합하여 인식할 수 있도록 하거나 상기 SNP 마커를 검출하여 증폭시킬 수 있는 제제로서, 구체적인 예로, 상기 SNP 마커가 포함된 다형성 부위에 특이적으로 결합할 수 있는 프로브(probe) 또는 상기 SNP 마커를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 검출하여 증폭할 수 있는 프라이머(primer)일 수 있다.
본 발명의 용어 "프로브"란 mRNA와 특이적 결합을 이룰 수 있는, 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 라벨링(labeling) 되어 있는 핵산 단편을 의미한다. 프로브는 올리고 뉴클레오타이드(oligonucleotide) 프로브, 단일 사슬 DNA(single stranded DNA) 프로브, 이중 사슬 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다.
본 발명에서, SNP 마커에 결합 및 인식하는 프로브는 SNP를 포함하는 폴리뉴클레오티드 서열에 대해 상보적인 서열을 포함하며, 이에 제한되지 않으나 DNA, RNA 또는 DNA-RNA 잡종(hybrid) 형태일 수 있다. 또한, 육안으로 인식가능하도록 하기 위해 프로브의 5' 또는 3' 말단에 형광 표지인자, 방사선 표지 인자 등을 추가로 부착할 수 있다.
본 발명의 용어 "프라이머"란, 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 염기서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 서열을 의미한다. 본 발명에서, SNP 마커의 검출 및 증폭에 사용되는 프라이머, 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드가 될 수 있는데, 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있다. 상기 프라이머 서열은 상기 SNP 마커를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드와 완전하게 상보적일 필요는 없으며, 혼성화할 정도로 충분히 상보적이면 사용가능하다.
또한, 프라이머는 변형시킬 수 있는데, 구체적인 예로, 메틸화, 캡화, 뉴클레오타이드의 치환 또는 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있을 수 있다.
본 발명의 목적상, 상기 프라이머의 서열 및 이의 길이는 당업자에 의하여 적절히 선택될 수 있다.
구체적인 예로, 상기 프라이머의 서열은 SNP 마커에 대한 특이성 및 결합력이 향상될 수 있도록 변형 가능하며, 동일한 SNP 마커에 대하여 서로 다른 염기 서열을 갖는 복수 개의 프라이머를 사용할 수 있다.
또한, 상기 프라이머의 길이는 각 SNP 마커를 포함하는 증폭 산물이 서로 다른 크기를 갖게 함으로써 SNP 마커를 구분할 수 있도록 변형 가능하며, 동일한 SNP 마커에 대하여 동일한 길이의 프라이머를 사용하고, 서로 다른 SNP 마커에 대하여 다른 길이의 프라이머를 사용하는 한, 프라이머 길이는 특별히 제한되지 않는다. 더욱 구체적인 예로, 각 프라이머의 길이는 이의 말단에 반복되는 염기를 첨가하여 조절할 수 있으며, 그 염기의 종류는 A, T, G, C 또는 이들의 조합일 수 있으나, 반복되는 서열을 갖는 한, 염기의 종류는 제한이 없다. 더욱 구체적인 예로, 상기 프라이머의 말단에는 1 내지 100개, 구체적으로 1 내지 80개, 더욱 구체적으로 1 내지 60개의 염기가 추가로 포함될 수 있으나, 특별히 이에 제한되는 것은 아니며, 상기 염기의 수는 발명의 목적에 맞게 당업자에 의해 적절히 선택될 수 있다.
본 발명에서, 상기 프라이머는 서열번호 1 및 2, 5 내지 15로 표시되는 염기서열로 이루어진 폴리뉴클레오티드인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 이용되는 염기서열은, 생물학적으로 균등 활성을 갖는 변이를 고려한다면, 서열목록에 기재된 서열과 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기 용어, '실질적인 동일성'은 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인(align)하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 60%의 상동성, 더욱 구체적으로 70%의 상동성, 더더욱 구체적으로 80%의 상동성, 가장 구체적으로 90%의 상동성을 나타내는 서열을 의미한다.
따라서, 상기 서열번호 1 및 2, 및 5 내지 15로 표시되는 염기서열과 높은 상동성을 갖는 염기서열, 예를 들면 그 상동성이 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로 90%이상의 높은 상동성을 갖는 염기서열도 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
본 발명의 구체적인 일 실시예에서, SNP를 포함하는 DNA 단편을 검출하기 위하여 서열번호 1 및 2로 표시되는 프라이머를 제작하였으며(표 3), 상기 서열번호 1 및 2에 의해 증폭된 DNA 증폭 산물에서 SNP만을 검출하기 위하여 말단에 T 염기를 추가하여 길이를 조절한 서열번호 5 내지 15로 표시되는 프라이머를 제작하였다(표 4).
또 다른 하나의 양태는 상기 구별용 조성물을 포함하는 시식성 파리의 종 구별용 키트를 제공한다.
본 발명의 키트는 본 발명의 구별용 조성물을 이용하여 본 발명에서 제공하는 SNP 마커의 염기를 검출하여 확인함으로써 시식성 파리의 종을 구별할 수 있다. 구체적으로, 상기 키트는 PCR 키트 또는 DNA 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.
구체적인 예로, 상기 키트는 PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 예를 들어, PCR 키트는, 상기 SNP 마커에 대한 특이적인 각각의 프라이머 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 디옥시뉴클레오타이드(dNTPs), 디디옥시뉴클레오타이드(ddNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
또 다른 예로, 본 발명의 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 시식성 파리의 종 구별용 DNA 칩 키트일 수 있다.
본 발명의 용어 "DNA 칩"이란, 수십만 개의 DNA의 각 염기를 한 번에 확인할 수 있는 DNA 마이크로어레이의 하나를 의미한다. 상기 DNA 칩 키트는, 일반적으로 편평한 고체 지지판, 전형적으로는 현미경용 슬라이드보다 크지 않은 유리 표면에 핵산 종을 격자형 배열(gridded array)로 부착한 것으로, 칩 표면에 핵산이 일정하게 배열되어, DNA 칩 상의 핵산과 칩 표면에 처리된 용액 내에 포함된 상보적인 핵산 간에 다중 혼성화(hybridization) 반응이 일어나 대량 병렬 분석이 가능하도록 하는 도구이다.
또 다른 하나의 양태는 시식성 파리의 종 구별을 위한 SNP 마커 조성물을 포함하는 시식성 파리의 종 구별용 마이크로어레이를 제공한다.
구체적으로, 상기 마이크로어레이는 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 90번째 염기가 A 또는 T이고, 72번째 염기가 A, C, T 또는 G이고, 168번째 염기가 A 또는 T이고, 261번째 염기가 A, C 또는 T이고, 252번째 염기가 A 또는 G이고, 243번째 염기가 C 또는 T이고, 상기 90, 72, 168, 261, 252 및 243번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.
상기 마이크로어레이는 DNA 또는 RNA 폴리뉴클레오티드를 포함하는 것일 수 있다. 상기 마이크로어레이는 프로브 폴리뉴클레오티드에 본 발명의 폴리뉴클레오티드를 포함하는 것을 제외하고는 통상적인 마이크로어레이로 이루어진다.
프로브 폴리뉴클레오티드를 기판상에 고정화하여 마이크로어레이를 제조하는 방법은 당업계에 잘 알려져 있다. 상기 프로브 폴리뉴클레오티드는 혼성화할 수 있는 폴리뉴클레오티드를 의미하는 것으로, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 본 발명의 프로브는 대립유전자 특이적 프로브로서, 같은 종의 두 구성원으로부터 유래한 핵산 단편 중에 다형성 부위가 존재하여, 한 구성원으로부터 유래한 DNA 단편에는 혼성화하나, 다른 구성원으로부터 유래한 단편에는 혼성화하지 않는다. 이 경우 혼성화 조건은 대립유전자간의 혼성화 강도에 있어서 유의한 차이를 보여, 대립유전자 중 하나에만 혼성화 하도록 충분히 엄격해야 한다. 이렇게 함으로써 다른 대립유전자 형태 간에 좋은 혼성화 차이를 유발할 수 있다. 본 발명의 상기 프로브는 대립유전자를 검출하여 시식성 파리의 종 구별 방법 등에 사용될 수 있다. 상기 구별 방법에는 서던 블롯트 등과 같은 핵산의 혼성화에 근거한 검출방법들이 포함되며, DNA 칩을 이용한 방법에서 DNA 칩의 기판에 미리 결합된 형태로 제공될 수도 있다. 상기 혼성화란 엄격한 조건, 예를 들면 1 M 이하의 염 농도 및 25℃ 이상의 온도하에서 수행될 수 있다. 예를 들면, 5x SSPE(750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) 및 25-30℃의 조건이 대립유전자 특이적 프로브 혼성화에 적합할 수 있다.
본 발명의 시식성 파리의 종 구별과 연관된 프로브 폴리뉴클레오티드를 기판상에 고정화하는 과정도 또한 이러한 종래 기술을 사용하여 용이하게 수행할 수 있다. 또한, 마이크로어레이 상에서의 핵산의 혼성화 및 혼성화 결과의 검출은 당업계에 잘 알려져 있다. 상기 검출은 예를 들면, 핵산 시료를 형광 물질 예를 들면 Cy3 및 Cy5와 같은 물질을 포함하는 검출가능한 신호를 발생시킬 수 있는 표지 물질로 표지한 다음, 마이크로어레이 상에 혼성화하고 상기 표지 물질로부터 발생하는 신호를 검출함으로써 혼성화 결과를 검출할 수 있다.
또 다른 하나의 양태는 (a) 시식성 파리로부터 분리된 시료의 DNA로부터 서열번호 20의 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위(polymorphic site)를 증폭시키는 단계; 및 (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 시식성 파리의 종 구별 방법을 제공한다.
상술한 바와 같이, 본 발명에서 제공하는 시식성 파리의 종 구별을 위한 SNP 마커 조성물은 시식성 파리의 종을 구별할 수 있는 서열번호 20의 폴리뉴클레오티드, 구체적으로 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 폴리뉴클레오티드에 포함된 각각의 SNP 마커를 포함하므로,
상기 방법은, (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 C이고, 252번째 염기가 G이고, 243번째 염기가 T인 경우, 푸른등금파리(Lucilia ampullaceae)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 C이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 금파리(Lucilia caesar)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 A이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 C인 경우, 두꼬리금파리(Triceratopyga calliphoroides)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 연두금파리(Lucilia illustris)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 A이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 큰검정파리(Calliphora lata)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 A이고, 261번째 염기가 T이고, 252번째 염기가 G이고, 243번째 염기가 T인 경우, 검정빰금파리(Chrysomya megacephala)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 A이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 큰검정뺨금파리(Chrysomya pinguis)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 T이고, 168번째 염기가 A이고, 261번째 염기가 A이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 검정금파리(Phormia regina)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 T이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 구리금파리(Lucilia sericata)로 판단하는 단계를 추가로 포함하고; 및
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 G이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 C인 경우, 붉은뺨검정파리(Calliphora vicina)로 판단하는 단계를 추가로 포함할 수 있다.
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 T이고, 72번째 염기가 A이고, 168번째 염기가 C이고, 261번째 염기가 C이고, 252번째 염기가 A이고, 243번째 염기가 C인 경우, 털검정파리(Aldrichina grahami)로 판단하는 단계를 추가로 포함할 수 있다.
서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 C이고, 72번째 염기가 A이고, 168번째 염기가 A이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 털검정파리(Aldrichina grahami)로 판단하는 단계를 추가로 포함할 수 있다.
본 발명의 용어, "다형성"(polymorphism)은 하나의 유전자 좌위(locus)에 두 가지 이상의 대립유전자(allele)가 존재하는 경우를 의미하며, 다형성 부위 중에서 개체에 따라 단일 염기만이 다른 것을 단일 염기 다형성이라 한다. 구체적인 예로, 다형성 마커는 선택된 집단에서 1% 이상, 더욱 구체적으로 5% 또는 10% 이상의 발생빈도를 나타내는 두 가지 이상의 대립유전자를 가질 수 있으나, 이에 제한되는 것은 아니다.
상기 용어, '대립유전자(allele)'는 상동염색체의 동일한 유전자 좌위에 존재하는 한 유전자의 여러 타입을 의미한다. 대립유전자는 다형성을 나타내는데 사용되기도 하며, 예컨대, SNP는 두 종류의 대립인자(biallele)를 갖는다.
본 발명에서, 상기 (a) 단계의 DNA로부터 상기 SNP 마커의 다형성 부위를 증폭하는 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 구체적인 예로, PCR, 리가제 연쇄 반응(LCR), 전사증폭(transcription amplification), 자가유지 서열 복제, 핵산에 근거한 서열 증폭(NASBA) 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 (b) 단계의 증폭된 다형성 부위의 염기를 결정하는 단계도 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 구체적인 예로, 시퀀싱, 미니-시퀀싱, 대립유전자 특이적 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화(dynamic allele-specifichybridization; DASH), PCR 연장 분석(예로, 단일 염기 연장(single base extension; SBE), PCR-SSCP, PCR-RFLP 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예로, Sequenom의 MassARRAY 시스템), Bio-Plex 시스템(BioRad) 등을 이용하여 수행될 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 시퀀싱 또는 미니-시퀀싱 분석은 염기서열 결정을 위한 통상적인 방법을 사용할 수 있으며, 자동화된 유전자분석기를 이용하여 수행될 수 있다.
또한, 대립유전자 특이적 PCR은 변이 부위가 위치하는 염기를 3' 말단으로 하여 고안한 프라이머를 포함한 프라이머 세트로 상기 변이가 위치하는 DNA 단편을 증폭하여 수행될 수 있다.
또한, PCR 연장 분석은 SNP 마커를 포함하는 DNA 단편을 프라이머 쌍으로 증폭한 다음에 수행되며, 반응에 첨가된 모든 뉴클레오티드를 탈인산화시킴으로써 불활성화시키고, 여기에 특이적 연장 프라이머, dNTP 혼합물, 디디옥시뉴클레오티드, 반응 완충액 및 DNA 중합효소를 첨가하여 프라이머 연장반응을 수행함으로써 이루어질 수 있다. 이때, 연장 프라이머는 변이 부위가 위치하는 염기의 5' 방향의 바로 인접한 염기를 3' 말단으로 삼으며, dNTP 혼합물에는 디디옥시뉴클레오티드와 동일한 염기를 갖는 핵산이 제외되고, 상기 디디옥시뉴클레오티드는 변이를 나타내는 염기 종류 중 하나에서 선택된다. 예를 들어, A에서 G로의 치환이 있는 경우, dGTP, dCTP 및 TTP 혼합물과 ddATP를 반응에 첨가할 경우, 상기 치환이 일어난 염기에서 프라이머는 DNA 중합효소에 의하여 연장되고, 몇 염기가 지난 후 A 염기가 최초로 나타나는 위치에서 ddATP에 의하여 프라이머 연장반응이 종결된다. 만일 상기 치환이 일어나지 않았다면, 그 위치에서 연장반응이 종결되므로, 상기 연장된 프라이머의 길이를 비교함으로써 변이를 나타내는 염기 종류를 판별할 수 있게 된다.
이때, 검출방법으로는 연장 프라이머 또는 디디옥시뉴클레오티드를 형광 표지한 경우에는 일반적인 염기서열 결정에 사용되는 유전자 분석기(예를 들어, ABI사의 PRISM 3500, 3700 등)를 사용하여 형광을 검출함으로써 상기 변이를 검출할 수 있으며, 무-표지된 연장 프라이머 및 디디옥시뉴클레오티드를 사용할 경우에는 MALDI-TOF(matrix assisted laser desorption ionization-time of flight) 기법을 이용하여 분자량을 측정함으로써 상기 SNP의 유전적 변이를 검출할 수 있다.
본 발명의 구체적인 일 실시예에서는, 추출한 시식성 파리의 DNA로부터 서열번호 1 및 2로 표시되는 프라이머를 이용한 PCR을 통해 본 발명의 SNP 마커를 포함하는 DNA 단편을 증폭하였으며, 이후 상기 증폭된 DNA 산물로부터 서열번호 5 내지 14로 표시되는 프라이머, 형광이 표지된 ddNTP 등을 이용하여 단일 염기 연장(single base extension; SBE) 분석을 수행하였다(실시예 2-2 및 2-3). 이에 따라 증폭된 SNP 마커의 염기를 ABI PRISM 3500 DNA analyzer를 이용하여 확인한 결과, 검정파리과에 속하는 시식성 파리 11종 및 집파리과에 속하는 시식성 파리 1종은 각각 본 발명에서 선정한 SNP 마커를 가지며, 이에 따라 시식성 파리의 서로 다른 종을 모두 구별할 수 있음을 확인하였다(도 1 내지 12). 이는, 본 발명에서 규명한 SNP 마커 및 이를 이용한 구별용 조성물은 시식성 파리의 종을 높은 정확도로 간편히 구분하는 수단으로 사용될 수 있음을 시사하는 것이다.
상기 목적을 달성하기 위하여, 본 발명의 하나의 양태는 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 1491번째 염기가 A, C 또는 T이고, 1488번째 염기가 A, T 또는 G이고, 1479번째 염기가 A 또는 T이고, 1485번째 염기가 A 또는 G이고, 상기 1491, 1488, 1479 및 1485번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종(species) 구별을 위한 마커 조성물을 제공한다.
본 발명에서는 시식성 파리 종 간에 특이적인 SNP 마커를 선정하였으며, 상기 SNP 마커만을 특이적으로 검출할 수 있는 프라이머 세트를 개발하였고, 이를 이용하면 시식성 파리에 속하는 파리 종을 간편히 구별할 수 있음을 확인하였다. 이를 통해, 약 1 ng에 해당하는 소량의 DNA를 이용하여 보다 빠르고 정확하게 시식성 파리의 종을 구별할 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 용어, "COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자"는 박테리아와 진핵생물의 미토콘드리아에 존재하는 막 단백질로서, 종의 구분을 위해 사용되는 DNA 표지자를 의미하며, 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있다(Accession: ACL01376.1, AMH84773.1 등). 본 발명에서, 상기 COⅠ 유전자는 서열번호 20의 폴리뉴클레오티드를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 용어, "시식성 파리"는 시체에서 발견되는 파리를 의미하며, 사체 발생 후 가장 먼저 도착하는 곤충으로 알려져 있다. 시식성 파리에는 검정파리과(Calliphoridae), 쉬파리과(Sarcophagidae), 집파리과(Muscidae), 치즈도둑파리과(piophilidae), 벼룩파리과(phoridae) 등이 속해있다.
상기 시식성 파리는, 구체적인 예로, 푸른등금파리(Lucilia ampullaceae), 금파리(Lucilia caesar), 두꼬리금파리(Triceratopyga calliphoroides), 연두금파리(Lucilia illustris), 큰검정파리(Calliphora lata), 검정빰금파리(Chrysomya megacephala), 큰검정뺨금파리(Chrysomya pinguis), 검정금파리(Phormia regina), 구리금파리(Lucilia sericata) 붉은뺨검정파리(Calliphora vicina), 털검정파리(Aldrichina grahami), 붉은종아리큰집파리(Muscina angustifrons), 흰목덜미쉬파리(Parasarcophaga albiceps), 왕초쉬파리(Sarcophaga dux), 개울쉬파리(Sarcophaga hemorrhoidalis), 검정볼기쉬파리(Sarcophaga melanura), 떠돌이쉬파리(Sarcophoga peregrina), 곱슬털쉬파리(Sarcophaga similis) 또는 붉은볼기쉬파리(Sarcophaga crassipalpis)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 용어, "구별"은 시식성 파리에 속하는 서로 다른 종을 분류, 구분, 판별, 식별 또는 판단하는 것을 의미한다.
본 발명의 용어, "SNP 마커"는 개체 또는 종을 식별하기 위해 이용되는 DNA 서열 상의 단일 염기 다형성(single nucleotide polymorphism; SNP) 대립인자 염기쌍을 의미한다. SNP는 비교적 그 빈도가 높고 안정하며, 유전체 전체에 분포되어 있음에 따라 개체의 유전적 다양성이 발생하므로, SNP 마커는 개체 간의 유전적 근접성을 알려주는 지표의 역할을 할 수 있다. SNP 마커는 일반적으로 단일 염기 다형성에 수반되는 표현형의 변화를 포함하지만 경우에 따라 그렇지 않을 수도 있다.
본 명세서에서, 상기 'SNP 마커'는 'SNP'와 혼용되어 명명될 수 있다.
본 발명에서, 상기 SNP 마커는 서열번호 20으로 표시되는 COⅠ 유전자의 SNP 부위를 포함하는 전체 또는 일부 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 20으로 표시되는 COⅠ 유전자의 번역시작 위치에서 1491번째 염기가 A, C 또는 T이고, 1488번째 염기가 A, T 또는 G이고, 1479번째 염기가 A 또는 T이고, 1485번째 염기가 A 또는 G이고, 상기 1491, 1488, 1479 및 1485번째 염기를 포함하는 5 내지 300개, 구체적으로 25 내지 280개, 더더욱 구체적으로 45 내지 260개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종 구별을 위한 SNP 마커일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 구체적인 일 실시예에서는, 기존 문헌(Korean J Leg Med., 2013;37:177-182) 및 GenBank(www.ncbi.nih.gov)에 등재되어 있는 파리의 종별 미토콘드리아 염기서열(COⅠ; Cytochrome C Oxidase Subunit Ⅰ 유전자 영역)에 근거하여 종 내 변이를 확인함으로써, 시식성 파리의 종을 구별할 수 있는 종 특이적인 SNP를 선정하였다(표 2).
다른 하나의 양태는 상기 SNP 마커를 검출할 수 있는 제제를 포함하는, 시식성 파리의 종 구별용 조성물을 제공한다.
본 발명의 용어, "SNP 마커를 검출할 수 있는 제제"는 상기 SNP 마커 조성물에 포함된 SNP 마커에 특이적으로 결합하여 인식할 수 있도록 하거나 상기 SNP를 검출하여 증폭시킬 수 있는 제제로서, 구체적인 예로, 상기 SNP 마커가 포함된 다형성 부위에 특이적으로 결합할 수 있는 프로브(probe) 또는 상기 SNP 마커를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 검출하여 증폭할 수 있는 프라이머(primer)일 수 있다.
본 발명의 용어 "프로브"란 mRNA와 특이적 결합을 이룰 수 있는, 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 라벨링(labeling) 되어 있는 핵산 단편을 의미한다. 프로브는 올리고 뉴클레오타이드(oligonucleotide) 프로브, 단일 사슬 DNA(single stranded DNA) 프로브, 이중 사슬 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다.
본 발명에서, SNP 마커에 결합 및 인식하는 프로브는 SNP를 포함하는 폴리뉴클레오티드 서열에 대해 상보적인 서열을 포함하며, 이에 제한되지 않으나 DNA, RNA 또는 DNA-RNA 잡종(hybrid) 형태일 수 있다. 또한, 육안으로 인식가능하도록 하기 위해 프로브의 5' 또는 3' 말단에 형광 표지인자, 방사선 표지 인자 등을 추가로 부착할 수 있다.
본 발명의 용어 "프라이머"란, 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 염기서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 서열을 의미한다. 본 발명에서, SNP 마커의 검출 및 증폭에 사용되는 프라이머, 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드가 될 수 있는데, 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있다. 상기 프라이머 서열은 상기 SNP 마커를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드와 완전하게 상보적일 필요는 없으며, 혼성화할 정도로 충분히 상보적이면 사용가능하다.
또한, 프라이머는 변형시킬 수 있는데, 구체적인 예로, 메틸화, 캡화, 뉴클레오타이드의 치환 또는 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있을 수 있다.
본 발명의 목적상, 상기 프라이머의 서열 및 이의 길이는 당업자에 의하여 적절히 선택될 수 있다.
구체적인 예로, 상기 프라이머의 서열은 SNP 마커에 대한 특이성 및 결합력이 향상될 수 있도록 변형 가능하며, 동일한 SNP 마커에 대하여 서로 다른 염기 서열을 갖는 복수 개의 프라이머를 사용할 수 있다.
또한, 상기 프라이머의 길이는 각 SNP 마커를 포함하는 증폭 산물이 서로 다른 크기를 갖게 함으로써 SNP 마커를 구분할 수 있도록 변형 가능하며, 동일한 SNP 마커에 대하여 동일한 길이의 프라이머를 사용하고, 서로 다른 SNP 마커에 대하여 다른 길이의 프라이머를 사용하는 한, 프라이머 길이는 특별히 제한되지 않는다. 더욱 구체적인 예로, 각 프라이머의 길이는 이의 말단에 반복되는 염기를 첨가하여 조절할 수 있으며, 그 염기의 종류는 A, T, G, C 또는 이들의 조합일 수 있으나, 반복되는 서열을 갖는 한, 염기의 종류는 제한이 없다. 더욱 구체적인 예로, 상기 프라이머의 말단에는 1 내지 100개, 구체적으로 1 내지 80개, 더욱 구체적으로 1 내지 60개의 염기가 추가로 포함될 수 있으나, 특별히 이에 제한되는 것은 아니며, 상기 염기의 수는 발명의 목적에 맞게 당업자에 의해 적절히 선택될 수 있다.
본 발명에서, 상기 프라이머는 서열번호 3 및 4, 및 16 내지 19로 표시되는 염기서열로 이루어진 폴리뉴클레오티드인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 이용되는 염기서열은, 생물학적으로 균등 활성을 갖는 변이를 고려한다면, 서열목록에 기재된 서열과 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기 용어, '실질적인 동일성'은 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인(align)하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 60%의 상동성, 더욱 구체적으로 70%의 상동성, 더더욱 구체적으로 80%의 상동성, 가장 구체적으로 90%의 상동성을 나타내는 서열을 의미한다.
따라서, 상기 서열번호 3 및 4, 및 16 내지 19로 표시되는 염기서열과 높은 상동성을 갖는 염기서열, 예를 들면 그 상동성이 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로 90%이상의 높은 상동성을 갖는 염기서열도 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
본 발명의 구체적인 일 실시예에서, SNP를 포함하는 DNA 단편을 검출하기 위하여 서열번호 3 및 4로 표시되는 프라이머를 제작하였으며(표 3), 상기 서열번호 3 및 4에 의해 증폭된 DNA 증폭 산물에서 SNP만을 검출하기 위하여 말단에 T 염기를 추가하여 길이를 조절한 서열번호 16 내지 19로 표시되는 프라이머를 제작하였다(표 4).
또 다른 하나의 양태는 상기 구별용 조성물을 포함하는 시식성 파리의 종 구별용 키트를 제공한다.
본 발명의 키트는 본 발명의 구별용 조성물을 이용하여 본 발명에서 제공하는 SNP 마커의 염기를 검출하여 확인함으로써 시식성 파리의 종을 구별할 수 있다. 구체적으로, 상기 키트는 PCR 키트 또는 DNA 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.
구체적인 예로, 상기 키트는 PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 예를 들어, PCR 키트는, 상기 SNP 마커에 대한 특이적인 각각의 프라이머 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 디옥시뉴클레오타이드(dNTPs), 디디옥시뉴클레오타이드(ddNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
또 다른 예로, 본 발명의 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 시식성 파리의 종 구별용 DNA 칩 키트일 수 있다.
본 발명의 용어 "DNA 칩"이란, 수십만 개의 DNA의 각 염기를 한 번에 확인할 수 있는 DNA 마이크로어레이의 하나를 의미한다. 상기 DNA 칩 키트는, 일반적으로 편평한 고체 지지판, 전형적으로는 현미경용 슬라이드보다 크지않은 유리 표면에 핵산 종을 격자형 배열(gridded array)로 부착한 것으로, 칩 표면에 핵산이 일정하게 배열되어, DNA 칩 상의 핵산과 칩 표면에 처리된 용액 내에 포함된 상보적인 핵산 간에 다중 혼성화(hybridization) 반응이 일어나 대량 병렬 분석이 가능하도록 하는 도구이다.
또 다른 하나의 양태는 시식성 파리의 종 구별을 위한 SNP 마커 조성물을 포함하는 시식성 파리의 종 구별용 마이크로어레이를 제공한다.
구체적으로, 상기 마이크로어레이는 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 1491번째 염기가 A, C 또는 T이고, 1488번째 염기가 A, T 또는 G이고, 1479번째 염기가 A 또는 T이고, 1485번째 염기가 A 또는 G이고, 상기 1491, 1488, 1479 및 1485번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.
상기 마이크로어레이는 DNA 또는 RNA 폴리뉴클레오티드를 포함하는 것일 수 있다. 상기 마이크로어레이는 프로브 폴리뉴클레오티드에 본 발명의 폴리뉴클레오티드를 포함하는 것을 제외하고는 통상적인 마이크로어레이로 이루어진다.
프로브 폴리뉴클레오티드를 기판상에 고정화하여 마이크로어레이를 제조하는 방법은 당업계에 잘 알려져 있다. 상기 프로브 폴리뉴클레오티드는 혼성화할 수 있는 폴리뉴클레오티드를 의미하는 것으로, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 본 발명의 프로브는 대립유전자 특이적 프로브로서, 같은 종의 두 구성원으로부터 유래한 핵산 단편 중에 다형성 부위가 존재하여, 한 구성원으로부터 유래한 DNA 단편에는 혼성화하나, 다른 구성원으로부터 유래한 단편에는 혼성화하지 않는다. 이 경우 혼성화 조건은 대립유전자간의 혼성화 강도에 있어서 유의한 차이를 보여, 대립유전자 중 하나에만 혼성화 하도록 충분히 엄격해야 한다. 이렇게 함으로써 다른 대립유전자 형태 간에 좋은 혼성화 차이를 유발할 수 있다. 본 발명의 상기 프로브는 대립유전자를 검출하여 시식성 파리의 종 구별 방법 등에 사용될 수 있다. 상기 구별 방법에는 서던 블롯트 등과 같은 핵산의 혼성화에 근거한 검출방법들이 포함되며, DNA 칩을 이용한 방법에서 DNA 칩의 기판에 미리 결합된 형태로 제공될 수도 있다. 상기 혼성화란 엄격한 조건, 예를 들면 1 M 이하의 염 농도 및 25℃ 이상의 온도하에서 수행될 수 있다. 예를 들면, 5x SSPE(750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) 및 25-30℃의 조건이 대립유전자 특이적 프로브 혼성화에 적합할 수 있다.
본 발명의 시식성 파리의 종 구별과 연관된 프로브 폴리뉴클레오티드를 기판상에 고정화하는 과정도 또한 이러한 종래 기술을 사용하여 용이하게 수행할 수 있다. 또한, 마이크로어레이 상에서의 핵산의 혼성화 및 혼성화 결과의 검출은 당업계에 잘 알려져 있다. 상기 검출은 예를 들면, 핵산 시료를 형광 물질 예를 들면 Cy3 및 Cy5와 같은 물질을 포함하는 검출가능한 신호를 발생시킬 수 있는 표지 물질로 표지한 다음, 마이크로어레이 상에 혼성화하고 상기 표지 물질로부터 발생하는 신호를 검출함으로써 혼성화 결과를 검출할 수 있다.
또 다른 하나의 양태는 (a) 시식성 파리로부터 분리된 시료의 DNA로부터 서열번호 20의 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위(polymorphic site)를 증폭시키는 단계; 및 (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 시식성 파리의 종 구별 방법을 제공한다.
상술한 바와 같이, 본 발명에서 제공하는 시식성 파리의 종 구별을 위한 SNP 마커 조성물은 시식성 파리의 종을 구별할 수 있는 서열번호 20의 폴리뉴클레오티드, 구체적으로 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 폴리뉴클레오티드에 포함된 각각의 SNP 마커를 포함하므로,
상기 방법은, (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 A이고, 1479번째 염기가 T이고, 1485번째 염기가 A인 경우, 흰목덜미쉬파리(Parasarcophaga albiceps)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 A이고, 1488번째 염기가 G이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 왕초쉬파리(Sarcophaga dux)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 T이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 개울쉬파리(Sarcophaga hemorrhoidalis)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 C이고, 1488번째 염기가 A이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 검정볼기쉬파리(Sarcophaga melanura)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 G이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 떠돌이쉬파리(Sarcophoga peregrina)로 판단하는 단계를 추가로 포함하고;
서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 A이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 곱슬털쉬파리(Sarcophaga similis)로 판단하는 단계를 추가로 포함하고; 및
서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 C이고, 1488번째 염기가 A이고, 1479번째 염기가 A이고, 1485번째 염기가 G인 경우, 붉은볼기쉬파리(Sarcophaga crassipalpis)로 판단하는 단계를 추가로 포함할 수 있다.
본 발명의 용어, "다형성"(polymorphism)은 하나의 유전자 좌위(locus)에 두 가지 이상의 대립유전자(allele)가 존재하는 경우를 의미하며, 다형성 부위 중에서 개체에 따라 단일 염기만이 다른 것을 단일 염기 다형성이라 한다. 구체적인 예로, 다형성 마커는 선택된 집단에서 1% 이상, 더욱 구체적으로 5% 또는 10% 이상의 발생빈도를 나타내는 두 가지 이상의 대립유전자를 가질 수 있으나, 이에 제한되는 것은 아니다.
상기 용어, '대립유전자(allele)'는 상동염색체의 동일한 유전자 좌위에 존재하는 한 유전자의 여러 타입을 의미한다. 대립유전자는 다형성을 나타내는데 사용되기도 하며, 예컨대, SNP는 두 종류의 대립인자(biallele)를 갖는다.
본 발명에서, 상기 (a) 단계의 DNA로부터 상기 SNP 마커의 다형성 부위를 증폭하는 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 구체적인 예로, PCR, 리가제 연쇄 반응(LCR), 전사증폭(transcription amplification), 자가유지 서열 복제, 핵산에 근거한 서열 증폭(NASBA) 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 (b) 단계의 증폭된 다형성 부위의 염기를 결정하는 단계도 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 구체적인 예로, 시퀀싱, 미니-시퀀싱, 대립유전자 특이적 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화(dynamic allele-specifichybridization; DASH), PCR 연장 분석(예로, 단일 염기 연장(single base extension; SBE), PCR-SSCP, PCR-RFLP 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예로, Sequenom의 MassARRAY 시스템), Bio-Plex 시스템(BioRad) 등을 이용하여 수행될 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 시퀀싱 또는 미니-시퀀싱 분석은 염기서열 결정을 위한 통상적인 방법을 사용할 수 있으며, 자동화된 유전자분석기를 이용하여 수행될 수 있다.
또한, 대립유전자 특이적 PCR은 변이 부위가 위치하는 염기를 3' 말단으로 하여 고안한 프라이머를 포함한 프라이머 세트로 상기 변이가 위치하는 DNA 단편을 증폭하여 수행될 수 있다.
또한, PCR 연장 분석은 SNP 마커를 포함하는 DNA 단편을 프라이머 쌍으로 증폭한 다음에 수행되며, 반응에 첨가된 모든 뉴클레오티드를 탈인산화시킴으로써 불활성화시키고, 여기에 특이적 연장 프라이머, dNTP 혼합물, 디디옥시뉴클레오티드, 반응 완충액 및 DNA 중합효소를 첨가하여 프라이머 연장반응을 수행함으로써 이루어질 수 있다. 이때, 연장 프라이머는 변이 부위가 위치하는 염기의 5' 방향의 바로 인접한 염기를 3' 말단으로 삼으며, dNTP 혼합물에는 디디옥시뉴클레오티드와 동일한 염기를 갖는 핵산이 제외되고, 상기 디디옥시뉴클레오티드는 변이를 나타내는 염기 종류 중 하나에서 선택된다. 예를 들어, A에서 G로의 치환이 있는 경우, dGTP, dCTP 및 TTP 혼합물과 ddATP를 반응에 첨가할 경우, 상기 치환이 일어난 염기에서 프라이머는 DNA 중합효소에 의하여 연장되고, 몇 염기가 지난 후 A 염기가 최초로 나타나는 위치에서 ddATP에 의하여 프라이머 연장반응이 종결된다. 만일 상기 치환이 일어나지 않았다면, 그 위치에서 연장반응이 종결되므로, 상기 연장된 프라이머의 길이를 비교함으로써 변이를 나타내는 염기 종류를 판별할 수 있게 된다.
이때, 검출방법으로는 연장 프라이머 또는 디디옥시뉴클레오티드를 형광 표지한 경우에는 일반적인 염기서열 결정에 사용되는 유전자 분석기(예를 들어, ABI사의 PRISM 3500, 3700 등)를 사용하여 형광을 검출함으로써 상기 변이를 검출할 수 있으며, 무-표지된 연장 프라이머 및 디디옥시뉴클레오티드를 사용할 경우에는 MALDI-TOF(matrix assisted laser desorption ionization-time of flight) 기법을 이용하여 분자량을 측정함으로써 상기 SNP의 유전적 변이를 검출할 수 있다.
본 발명의 구체적인 일 실시예에서는, 추출한 시식성 파리의 DNA로부터 서열번호 3 및 4로 표시되는 프라이머를 이용한 PCR을 통해 본 발명의 SNP 마커를 포함하는 DNA 단편을 증폭하였으며, 이후 상기 증폭된 DNA 산물로부터 서열번호 16 내지 19로 표시되는 프라이머, 형광이 표지된 ddNTP 등을 이용하여 단일 염기 연장(single base extension; SBE) 분석을 수행하였다(실시예 2-2 및 2-3). 이에 따라 증폭된 SNP 마커의 염기를 ABI PRISM 3500 DNA analyzer를 이용하여 확인한 결과, 시식성 파리의 쉬파리과에 속하는 파리 7종은 각각 본 발명에서 선정한 SNP 마커를 가지며, 이에 따라 시식성 파리의 서로 다른 종을 모두 구별할 수 있음을 확인하였다(도 13 내지 19). 이는, 본 발명에서 규명한 SNP 마커 및 이를 이용한 구별용 조성물은 시식성 파리의 종을 높은 정확도로 간편히 구분하는 수단으로 사용될 수 있음을 시사하는 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
실시예 1. 파리 종 특이적 SNP 선정
사체에서 발견되는 시식성 파리의 종을 구분하기 위해, 종 특이적인 SNP 마커들을 선정하였다.
구체적으로, 기존 문헌(Korean J Leg Med., 2013;37:177-182) 및 GenBank(www.ncbi.nih.gov)에 등재되어 있는 파리의 종별 미토콘드리아 염기서열(COⅠ; Cytochrome C Oxidase Subunit Ⅰ 유전자 영역)에 근거하여 종 내 변이를 확인한 후, 공통염기서열을 만들어 종마다 가지는 SNP를 선정함으로써, 이들의 조합이 파리의 종을 구분할 수 있게 하였다.
결과적으로, 시식성 파리의 일종인 검정파리과의 파리는 하기 표 1, 쉬파리과의 파리는 하기 표 2의 SNP 마커의 조합을 통해 종을 구분할 수 있도록 종 특이적인 SNP를 선정하였다.
Figure PCTKR2017011980-appb-T000001
Figure PCTKR2017011980-appb-T000002
상기 표 2에서, Al은 흰목덜미쉬파리(Parasarcophaga albiceps), Dux는 왕초쉬파리(Sarcophaga dux), Hm은 개울쉬파리(Sarcophaga hemorrhoidalis); Me는 검정볼기쉬파리(Sarcophaga melanura); Pg는 떠돌이쉬파리(Sarcophoga peregrina), Si는 곱슬털쉬파리(Sarcophaga similis); 및 Cr은 붉은볼기쉬파리(Sarcophaga crassipalpis)를 의미한다.
실시예 2. 파리 종 특이적 SNP 검출
상기 실시예 1에서 선정한 SNP를 통해 파리의 종을 구분할 수 있는지 확인하고자, 하기 실시예 2-1 내지 2-3에 따른 방법으로 상기 SNP에 특이적인 프라이머를 제작하였고, 이를 이용하여 상기 SNP를 검출하였다.
실시예 2-1. 파리 DNA 추출
사체에서 발견된 파리 19종, 총 176개체의 파리 또는 구더기 샘플을 이용하였다. GeneAll Tissue SV Mini Kit (GeneAll, Seoul, Korea)에서 제공하는 근접한 샘플 유형의 방법에 따라 파리로부터 DNA를 분리하였으며, NanoDrop Spectrophotometer(모델: ND-2000C, Thermo Scientific, Wilmington, USA)를 이용하여 DNA의 농도를 측정하였다. 3차 증류수를 이용하여 DNA 용액을 실험 농도까지 희석하고 사용시까지 20℃에서 보관하였다.
실시예 2-2. SNP를 포함하는 DNA 단편의 증폭
상기 실시예 1에서 선정한 SNP의 특이적 프라이머를 제작하기 위해, 먼저 상기 SNP를 포함하는 DNA 단편의 서열을 분석하고자 하였다. 이를 위해, 하기 표 3에 기재된 바와 같은 PCR 프라이머를 제작하였다.
구분 PCR 프라이머 서열 (5'→3')
검정파리과(Calliphoridae) F:CAGTCTATTGCCTAAACTTCAG(서열번호 1)
R:GTTARTGCRGGRGGTAAAAGTCA(서열번호 2)
쉬파리과(Sarcophagidae) F:AAGTTTAGYATCHCAACGWCAAGT(서열번호 3)
R:TTAAACCCATTGCACTAATCTGCC(서열번호 4)
이후, 상기 SNP를 포함하는 DNA 단편을 증폭하기 위해, 하기와 같은 방법으로 PCR을 수행하였다.
구체적으로, 각 파리의 DNA 1ng, 상기 표 3에 기재된 전방향(F) 및 역방향(R) 프라이머 각각 0.8 μM 및 AmpliTaq Gold(5U/ul) (Promega, Madison, USA)을 혼합하여 반응 혼합물 20 ㎕을 제조하였다. 상기 혼합물을 95℃에서 11분 동안 변성한 다음, 94℃에서 20초; 50℃에서 30초(어닐링 단계); 및 72℃에서 7분으로 총 35사이클을 수행하였고, 최종 신장 72℃에서 15분(최종 신장 단계) 반응하였다.
수득한 상기 PCR 생성물을 서열 결정의 주형으로 사용하였다. PCR 생성물을 ExoSAP-IT reagent(Affymetrix, Santa Clara, USA)로 정제하고, BigDye terminator cycle sequencing kit(Applied Biosystems, Foster City, CA, USA)로 서열 분석 반응을 실시한 다음, ABI PRISM 3730 DNA sequencer로 최종적으로 서열을 결정하였다.
실시예 2-3. SNP의 검출
상기 실시예 1에서 선정한 SNP를 특이적으로 검출하기 위해, 상기 실시예 2-2를 통해 확인한 염기서열을 기준으로 IUPAC nucleotide code를 사용하여, 하기 표 4에 기재된 바와 같은 SNP 특이적 프라이머를 제작하였다. 구체적으로, 프라이머의 길이가 길어지면, 그 프라이머를 이용하여 증폭한 PCR 산물의 크기도 증가하게 된다. 이에 따라, 증폭된 각 SNP 마커를 구분하기 위하여 상기 마커에 대해 서로 다른 길이를 갖는 프라이머를 제작하였고, 이때, 프라이머의 길이는 이의 말단(tail)에 반복되는 염기(T)를 첨가함으로써 그 수를 조절하였다. 또한, 동일한 SNP 마커에 대해서는 말단에 첨가되는 염기의 개수 및 이에 따른 프라이머의 길이는 동일하되, 프라이머의 서열이 서로 다른 1 내지 3개의 프라이머를 제작하였다.
구분 SNP마커(포인트) 프라이머길이(bp) SNP 마커 특이적 프라이머 (3'→5')
검정파리과(Calliphoridae) CA90 25 CTTGATCNGGAATARTHGGAACTTC(서열번호 5)
25 CTTGATCCGGTATAATYGGAACTTC(서열번호 6)
25 CTTGATCAGGAATAATTGGTACTTC(서열번호 7)
CA72 35 TTTTTTACTTTATAYTTTATTTTTGGAGCTTGATC(서열번호 8)
35 TTTTTTACTTTATATTTYATTTTCGGAGCTTGATC(서열번호 9)
CA168 45 TTTTTTTTTTTTTTTTGGAGAYGAYCAAATTTATAATGTAATTGT(서열번호 10)
CA261 55 TTTTTTTTTTTTTTTTTTTTTTTTTTAATTGATTAGTTCCWTTAATACTAGGRGC(서열번호 11)
55 TTTTTTTTTTTTTTTTTTTTTTTTTTAATTGAYTAGTTCCTTTAATGTTAGGAGC(서열번호 12)
55 TTTTTTTTTTTTTTTTTTTTTTTTTTAATTGATTAGTYCCTTTAATATTAGGAGC(서열번호 13)
CA252 65 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAGGRTTTGGAAATTGAYTAGTYCCWTTAAT(서열번호 14)
CA243 75 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAGGRTTYGGWAATTGAYTAGT(서열번호 15)
쉬파리과(Sarcophagidae) SA1491 26 AATTCAGAATAACTATGTTCAGCTGG(서열번호 16)
SA1488 36 T TTT TTT TTT TTT GAATAACTATGTTCAGCTGGHGG(서열번호 17)
SA1479 46 TTTTTTTTTTTTTTTTTTAACTATGTTCAGCTGGHGGDGTRTTTTG(서열번호 18)
SA1485 56 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTATGTTCAGCTGGHGGDGT(서열번호 19)
이후, 하기와 같은 방법으로 SNaPshot 분석을 수행하였다.
구체적으로, 상기 실시예 2-2를 통해 증폭한 각 파리의 DNA 1ng, 상기 표 4에 기재된 프라이머 각각 0.8 pmol, Gold ST★R 10X Buffer(Promega, Madison, USA) 및 AmpliTaq Gold® DNA polymerase(Promega, Madison, USA) 5 유닛(units)을 혼합하여 반응 혼합물 20 ㎕을 제조하였다. 이후, SNaPshot Multiplex Kit(Catalog number: 4323159, AB by Life Technologies)를 이용하여 단일 염기 연장(single base extension; SBE)을 위한 ABI SNaPshot 분석을 수행하였으며, 상기 반응 혼합물에 염기마다 각각 다른 색의 형광물질로 표기된 4종류의 ddNTP(ddATP=녹색, ddCTP=흑색, ddGTP=청색, ddTTP=적색)를 첨가한 후, 상기 키트의 제조자의 지시에 따른 PCR을 수행하고, ABI PRISM 3500 DNA analyzer를 이용하여 SNP를 탐지하였다.
그 결과, 도 1 내지 12에서 볼 수 있듯이, 시식성 파리의 검정파리과에 속하는 파리 11종 및 집파리과에 속하는 1종은 서로 다른 SNP 마커를 가짐을 확인하였고, 이는 상기 실시예 1에서 선정한 6개의 SNP 마커 조합임을 확인하였다.
또한, 도 13 내지 19에서 볼 수 있듯이, 시식성 파리의 쉬파리과에 속하는 파리 7종은 서로 다른 SNP 마커를 가짐을 확인하였고, 이는 상기 실시예 1에서 선정한 4개의 SNP 마커 조합임을 확인하였다.
상기 결과를 통해, 본 발명에서 규명한 SNP 마커 및 이의 검출을 위한 프라이머를 이용하면, 시식성 파리의 종을 높은 정확도로 간편히 구분할 수 있음을 알 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (37)

  1. 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 90번째 염기가 A 또는 T이고, 72번째 염기가 A, C, T 또는 G이고, 168번째 염기가 A 또는 T이고, 261번째 염기가 A, C 또는 T이고, 252번째 염기가 A 또는 G이고, 243번째 염기가 C 또는 T이고, 상기 90, 72, 168, 261, 252 및 243번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종(species) 구별을 위한 SNP 마커 조성물.
  2. 제1항에 있어서, 상기 시식성 파리는 푸른등금파리(Lucilia ampullaceae), 금파리(Lucilia caesar), 두꼬리금파리(Triceratopyga calliphoroides), 연두금파리(Lucilia illustris), 큰검정파리(Calliphora lata), 검정빰금파리(Chrysomya megacephala), 큰검정뺨금파리(Chrysomya pinguis), 검정금파리(Phormia regina), 구리금파리(Lucilia sericata), 붉은뺨검정파리(Calliphora vicina), 털검정파리(Aldrichina grahami) 및 붉은종아리큰집파리(Muscina angustifrons)로 이루어진 군에서 선택되는 것인, 조성물.
  3. 제1항의 SNP 마커를 검출할 수 있는 제제를 포함하는, 시식성 파리의 종 구별용 조성물.
  4. 제3항에 있어서, 상기 제제는 프라이머 또는 프로브인 것인, 조성물.
  5. 제4항에 있어서, 상기 프라이머는 서열번호 5 내지 15로 표시되는 염기서열로 이루어진 폴리뉴클레오티드인 것인, 조성물.
  6. 제3항 내지 제5항 중 어느 한 항의 조성물을 포함하는, 시식성 파리의 종 구별용 키트.
  7. 제6항에 있어서, 상기 키트는 PCR 키트 또는 DNA 칩 키트인 것인, 키트.
  8. 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 90번째 염기가 A 또는 T이고, 72번째 염기가 A, C, T 또는 G이고, 168번째 염기가 A 또는 T이고, 261번째 염기가 A, C 또는 T이고, 252번째 염기가 A 또는 G이고, 243번째 염기가 C 또는 T이고, 상기 90, 72, 168, 261, 252 및 243번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종 구별용 마이크로어레이.
  9. (a) 시식성 파리로부터 분리된 시료의 DNA로부터 서열번호 20의 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위를 증폭시키는 단계; 및
    (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 시식성 파리의 종(species) 구별 방법.
  10. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 C이고, 252번째 염기가 G이고, 243번째 염기가 T인 경우, 푸른등금파리(Lucilia ampullaceae)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  11. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 C이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 금파리(Lucilia caesar)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  12. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 A이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 C인 경우, 두꼬리금파리(Triceratopyga calliphoroides)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  13. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 연두금파리(Lucilia illustris)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  14. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 A이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 큰검정파리(Calliphora lata)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  15. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 A이고, 261번째 염기가 T이고, 252번째 염기가 G이고, 243번째 염기가 T인 경우, 검정빰금파리(Chrysomya megacephala)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  16. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 C이고, 168번째 염기가 A이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 큰검정뺨금파리(Chrysomya pinguis)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  17. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 T이고, 168번째 염기가 A이고, 261번째 염기가 A이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 검정금파리(Phormia regina)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  18. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 T이고, 72번째 염기가 C이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 구리금파리(Lucilia sericata)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  19. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 A이고, 72번째 염기가 G이고, 168번째 염기가 T이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 C인 경우, 붉은뺨검정파리(Calliphora vicina)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  20. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 T이고, 72번째 염기가 A이고, 168번째 염기가 C이고, 261번째 염기가 C이고, 252번째 염기가 A이고, 243번째 염기가 C인 경우, 털검정파리(Aldrichina grahami)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  21. 제9항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 90번째 염기가 C이고, 72번째 염기가 A이고, 168번째 염기가 A이고, 261번째 염기가 T이고, 252번째 염기가 A이고, 243번째 염기가 T인 경우, 털검정파리(Aldrichina grahami)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  22. 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 1491번째 염기가 A, C 또는 T이고, 1488번째 염기가 A, T 또는 G이고, 1479번째 염기가 A 또는 T이고, 1485번째 염기가 A 또는 G이고, 상기 1491, 1488, 1479 및 1485번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종(species) 구별을 위한 SNP 마커 조성물.
  23. 제22항에 있어서, 상기 시식성 파리는 흰목덜미쉬파리(Parasarcophaga albiceps), 왕초쉬파리(Sarcophaga dux), 개울쉬파리(Sarcophaga hemorrhoidalis), 검정볼기쉬파리(Sarcophaga melanura), 떠돌이쉬파리(Sarcophoga peregrina), 곱슬털쉬파리(Sarcophaga similis) 및 붉은볼기쉬파리(Sarcophaga crassipalpis)로 이루어진 군에서 선택되는 것인, 조성물.
  24. 제22항의 SNP 마커를 검출할 수 있는 제제를 포함하는, 시식성 파리 종 구별용 조성물.
  25. 제24항에 있어서, 상기 제제는 프라이머 또는 프로브인 것인, 조성물.
  26. 제25항에 있어서, 상기 프라이머는 서열번호 16 내지 19로 표시되는 염기서열로 이루어진 폴리뉴클레오티드인 것인, 조성물.
  27. 제24항 내지 제26항 중 어느 한 항의 조성물을 포함하는, 시식성 파리의 종 구별용 키트.
  28. 제27항에 있어서, 상기 키트는 PCR 키트 또는 DNA 칩 키트인 것인, 키트.
  29. 서열번호 20으로 표시되는 COⅠ(Cytochrome C Oxidase Subunit Ⅰ) 유전자의 1491번째 염기가 A, C 또는 T이고, 1488번째 염기가 A, T 또는 G이고, 1479번째 염기가 A 또는 T이고, 1485번째 염기가 A 또는 G이고, 상기 1491, 1488, 1479 및 1485번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 시식성 파리의 종(species) 구별용 마이크로어레이.
  30. (a) 시식성 파리로부터 분리된 시료의 DNA로부터 서열번호 20의 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위를 증폭시키는 단계; 및
    (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 시식성 파리의 종(species) 구별 방법.
  31. 제30항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 A이고, 1479번째 염기가 T이고, 1485번째 염기가 A인 경우, 흰목덜미쉬파리(Parasarcophaga albiceps)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  32. 제30항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 A이고, 1488번째 염기가 G이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 왕초쉬파리(Sarcophaga dux)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  33. 제30항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 T이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 개울쉬파리(Sarcophaga hemorrhoidalis)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  34. 제30항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 C이고, 1488번째 염기가 A이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 검정볼기쉬파리(Sarcophaga melanura)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  35. 제30항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 G이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 떠돌이쉬파리(Sarcophoga peregrina)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  36. 제30항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 T이고, 1488번째 염기가 A이고, 1479번째 염기가 A이고, 1485번째 염기가 A인 경우, 곱슬털쉬파리(Sarcophaga similis)로 판단하는 단계를 추가로 포함하는 것인, 방법.
  37. 제30항에 있어서, 상기 방법은 (c) 서열번호 20의 폴리뉴클레오티드에서, 1491번째 염기가 C이고, 1488번째 염기가 A이고, 1479번째 염기가 A이고, 1485번째 염기가 G인 경우, 붉은볼기쉬파리(Sarcophaga crassipalpis)로 판단하는 단계를 추가로 포함하는 것인, 방법.
PCT/KR2017/011980 2016-10-27 2017-10-27 시식성 파리의 종 구별용 snp 마커 및 이의 용도 Ceased WO2018080225A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0141319 2016-10-27
KR1020160141319A KR101861930B1 (ko) 2016-10-27 2016-10-27 시식성 파리의 종 구별용 snp 마커 및 이의 용도

Publications (2)

Publication Number Publication Date
WO2018080225A2 true WO2018080225A2 (ko) 2018-05-03
WO2018080225A3 WO2018080225A3 (ko) 2018-08-09

Family

ID=62023811

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/011980 Ceased WO2018080225A2 (ko) 2016-10-27 2017-10-27 시식성 파리의 종 구별용 snp 마커 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101861930B1 (ko)
WO (1) WO2018080225A2 (ko)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102099457B1 (ko) * 2018-11-23 2020-04-10 고려대학교 산학협력단 다중 실시간 중합효소연쇄반응 및 용해곡선분석을 이용하는 시식성 파리의 동정 방법
KR102262568B1 (ko) * 2019-12-03 2021-06-07 고려대학교 산학협력단 시식성 파리의 발생 단계 판정을 통한 최소 사후경과시간 추정기술
CN111100934B (zh) * 2020-01-13 2021-08-31 中南大学 用于推算棕尾别麻蝇幼虫期发育时间的分子标记、引物组合物、试剂盒及应用
CN111100933B (zh) * 2020-01-13 2021-08-31 中南大学 用于推算棕尾别麻蝇幼虫期发育时间的分子标记、引物组合物、试剂盒及应用

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101040046B1 (ko) 2009-07-21 2011-06-09 주식회사 그래미 검정파리과 시식성 파리 12종의 식별을 위한 프라이머 세트 및 이를 이용한 식별방법
CN103937893B (zh) * 2014-04-22 2015-05-20 中南大学 基于8个麻蝇线粒体snp遗传标记的法医昆虫学检测试剂盒

Also Published As

Publication number Publication date
KR101861930B1 (ko) 2018-05-30
KR20180046438A (ko) 2018-05-09
WO2018080225A3 (ko) 2018-08-09

Similar Documents

Publication Publication Date Title
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
WO2018080225A2 (ko) 시식성 파리의 종 구별용 snp 마커 및 이의 용도
WO2015126078A1 (ko) 핵산과 신호 프로브의 비대칭 등온증폭을 이용한 핵산의 검출방법
WO2013133680A1 (ko) 핫스타트 역전사반응 또는 핫스타트 역전사 중합효소 연쇄반응용 조성물
WO2019107893A2 (ko) 표적핵산 증폭방법 및 표적핵산 증폭용 조성물
WO2017122897A1 (ko) 참돔 이리도바이러스병 원인바이러스의 검출용 유전자 마커, 및 이를 이용한 원인바이러스의 검출 방법
KR20140087785A (ko) 돼지의 흑모색 판단용 snp 마커 및 이의 용도
WO2010147372A2 (ko) 말라리아 원충 검출용 프라이머, 탐침 및 이를 이용한 검출방법
WO2021118288A1 (ko) 대립 유전자의 구분성을 높이는 pcr 방법 및 pcr 킷트
WO2020153764A1 (ko) 태그서열 snp를 이용한 단일 검출 프로브 기반 다중 표적 검출방법
WO2024096538A1 (ko) 간암 진단용 dna 메틸화 마커 및 이의 용도
US7993882B2 (en) CRH and POMC effects on animal growth
WO2013105801A1 (ko) 만성 골수성 백혈병 융합 유전자형 타이핑용 프로브, 프라이머 및 이의 이용방법
WO2011132989A2 (ko) 자궁경부암 진단용 메틸화 마커
WO2022163967A1 (ko) 라임병 진단용 조성물 및 이를 포함하는 키트
WO2022220527A1 (ko) 피부색 판단용 유전자 다형성 마커 및 이의 용도
WO2021172653A1 (ko) 단일 표적 유전자의 유전적 변이 실시간 검출용 단일핵산 및 이를 이용한 검출 방법
Parada et al. Cytogenetic and genetic study of a Y-linked microsatellite polymorphism in Polish Black-and-White cattle breed
KR102083675B1 (ko) 단일염기다형성 마커를 이용한 칡소 품종 식별 방법
WO2017146432A1 (ko) 프로히비틴 유전자 타깃 백혈병 진단용 키트 및 이를 이용한 진단 방법
Horng et al. Cloning of Taiwan water buffalo male-specific DNA sequence for sexing
WO2018016683A1 (ko) 다중 증폭 이중 시그널 증폭에 의한 타겟 핵산 서열의 검출 방법
WO2026005351A1 (ko) 내재 내부 대조군으로 corynebacterium spp. 또는 cutibacterium spp.를 이용하여 피부로부터 채취한 시료로부터 타겟 미생물의 핵산을 검출하는 방법
WO2026071759A1 (ko) 단편 분석을 이용한 snp 다중 검사용 키트 및 snp 다중검사 방법
WO2011078495A2 (ko) 항암제 감수성 예측용 snp

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17865478

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17865478

Country of ref document: EP

Kind code of ref document: A2