WO2018051110A1 - Cell death biomarker - Google Patents

Cell death biomarker Download PDF

Info

Publication number
WO2018051110A1
WO2018051110A1 PCT/GB2017/052733 GB2017052733W WO2018051110A1 WO 2018051110 A1 WO2018051110 A1 WO 2018051110A1 GB 2017052733 W GB2017052733 W GB 2017052733W WO 2018051110 A1 WO2018051110 A1 WO 2018051110A1
Authority
WO
WIPO (PCT)
Prior art keywords
bapi
protein
cancer
wild
type
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2017/052733
Other languages
English (en)
French (fr)
Inventor
Samuel JANES
Krishna KOLLURI
Ultan Mcdermott
Neelam KUMAR
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
UCL Business Ltd
Original Assignee
UCL Business Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by UCL Business Ltd filed Critical UCL Business Ltd
Priority to EP17771553.9A priority Critical patent/EP3513192B1/en
Priority to US16/333,590 priority patent/US11789012B2/en
Priority to DK17771553.9T priority patent/DK3513192T3/da
Priority to AU2017327994A priority patent/AU2017327994B2/en
Priority to ES17771553T priority patent/ES2863274T3/es
Priority to JP2019514263A priority patent/JP7211936B2/ja
Publication of WO2018051110A1 publication Critical patent/WO2018051110A1/en
Anticipated expiration legal-status Critical
Priority to US18/299,415 priority patent/US20240118266A1/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5014Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
    • G01N33/5017Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity for testing neoplastic activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2496/00Reference solutions for assays of biological material
    • G01N2496/05Reference solutions for assays of biological material containing blood cells or plasma
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/02Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2510/00Detection of programmed cell death, i.e. apoptosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to cell death of cancer cells, and in particular to biomarkers that maybe used to identify cancer cells that are sensitive to death receptor ligand (DRL)-induced cell death.
  • DRL death receptor ligand
  • the invention also extends to prognostic methods and kits for identifying cancer cells that are sensitive to DRL-induced cell death.
  • the invention further extends to novel compositions and therapeutic methods using such compositions for treating cancer.
  • Tumour necrosis factor (TNF)-related apoptosis-inducing ligand TRAIL/Apo2L
  • TNF Tumour necrosis factor
  • TRAIL/Apo2L Tumour necrosis factor-related apoptosis-inducing ligand
  • Numerous chemotherapeutic drugs have also been shown to sensitize tumour cells to TRAIL-mediated cell death. While some mesothelioma cells are sensitive to TRAIL induced cell death others are resistant to the induction of cell death in vitro and this disruption of core-cell death machinery has been implicated in the general resistance to conventional cytotoxic agents observed clinically (11).
  • a method of determining if an individual's cancer cell is sensitive to death receptor ligand (DRL)-induced cell death comprising detecting, in a biological sample taken from the individual, for:
  • BAPi is a tumour suppressor gene that is somatically mutated in a variety of cancer types including mesothelioma (7), uveal melanoma (8), renal cell carcinoma (9) and cholangiocarcinomas (10).
  • the inventors have discovered that the expression of BAPi mutants in cancer cells causes increased sensitivity to cell death induced by death receptor ligands, which exhibit fewer off-target effects.
  • Tumour necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) for example, induces cell death in tumour cells in vitro and in vivo but not in most normal cells.
  • the invention therefore increases the likelihood that an individual with a cancer, which is associated with expression of a mutant BAPi gene or synthesis of a mutant BAPi protein, or a reduced level of expression of a wild-type BAPi gene or a lower wild- type BAPi protein concentration, will exhibit a positive outcome when treated with death receptor ligand therapy. Accordingly, the method of the invention provides a prognosis. Thus, such individuals are less likely to be treated with non-specific therapies and suffer the associated undesirable side-effects.
  • BAPi is a deubiquitinating enzyme encoded by the BAPi gene. It is an 8o.4kDa protein, which comprises a nuclear-localising sequence and a ubiquitin carboxy- terminal hydrolase (UCH) domain, which provides BAPi with deubiquitinase activity.
  • the BAPi gene may be mutated in the germline or somatically in a variety of forms of cancer.
  • the nucleotide sequence encoding one embodiment of the human wild-type BAPi gene (BAPi Whole gene sequence ⁇ 1568815595x52410105-52401004 Homo sapiens chromosome 3) is provided herein as SEQ ID No.i, as follows:
  • the cDNA sequence encoding one embodiment of the human wild-type BAPi gene is provided herein as SEQ ID No.2, as follows:
  • SEQ ID No.2 The amino acid sequence of one embodiment of human wild-type BAPi is referred to herein as SEQ ID No. 3, as follows:
  • Tumours arise due to mutations in proto-oncogenes or tumour suppressor genes.
  • a gain-of-function mutation in a proto-oncogene converts it into an oncogene, which causes tumourigenesis.
  • Such gain-of-function mutations are usually missense mutations in the DNA bases, which confer a change in the amino acid sequence, or a gain of copy number of the gene.
  • a loss-of-function mutation in a tumour suppressor gene will also lead to tumourigenesis.
  • a loss-of-function mutation in a tumour suppressor however is not restricted to the change of a few amino acids. Any change in an amino acid which impairs the function of the protein, results in a loss-of- function mutation.
  • tumour suppressors unlike oncogenes, it is not always possible to identify a specific mutation which results in the loss of function of a tumour suppressor gene. Loss-of-function truncating mutations of tumour suppressors are therefore typically identified throughout the coding exons of a gene.
  • BAPi is a tumour suppressor gene.
  • a mutant BAPi gene is one that comprises a mutation.
  • the mutant BAPi gene is a gene that encodes a nonfunctional or enzymatically inactive BAPi protein, or a BAPi protein that exhibits reduced binding to an ASXL protein compared to the level of binding in a reference cell, which is resistant to DRL-induced cell death.
  • a mutant BAPi protein is one that is non-functional or enzymatically inactive or incapable of binding to an ASXL protein or exhibits reduced binding to an ASXL protein compared to the level of binding in a reference cell, which is resistant to DRL-induced cell death.
  • BAPi has surprisingly been shown to form a complex with ASXLi, ASXL2 or ASXL3. These proteins will be collectively referred to herein as an ASXL protein. BAPi-ASXL complexes have been shown to
  • the mutant BAPi protein may be a full-length protein with mutations at specific loci.
  • the mutant BAPi protein may be a partial or complete deletion or mutation of the wild-type BAPi protein. Partial deletion or mutation may occur in the nuclear localisation sequence (NLS), the active site of wild-type BAPi, the binding site of ASXL, or at any place in the gene that would result in the loss of function of BAPi. Mutation may include one or more point mutations. Point mutations maybe a substitution, an insertion, a deletion or a frameshift mutation.
  • a reduced level of expression of a wild-type BAPi gene compared to the level of expression in a reference cell may result in a lower wild-type BAPi protein
  • the reduced level of expression of the wild-type BAPi gene maybe at least a io%, 15%, 25%, 35%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or a 100% reduction compared to the reference cell.
  • the lower concentration of wild- type BAPi protein may be lower by at least 10%, 15%, 25%, 35%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% compared to the reference cell.
  • the skilled person would know how to detect the extent of the reduction in BAPi gene expression or lower BAPi protein expression.
  • non-functional BAPi protein can refer to but is not limited to a BAPi protein that does not exhibit deubiquitinase (enzyme) activity.
  • standard assays for measuring deubiquitinase activity include, but are not limited to, fluorescence assays using a fluorogenic substrate, such as ubiquitin- amidomethylcoumarin; and HPLC assays using ubiquitin ethyl ester or ubiquitin fusion peptides as model substrates to monitor deubiquitinating activity.
  • amino acid sequence of a mutant BAPi gene referred to herein as SEQ ID No. 4, as follows:
  • the amino acid sequence of the mutant BAPi protein may be encoded by SEQ ID NO. 4 or a fragment or variant thereof.
  • the nucleotide sequence of a mutant BAPi gene is referred to herein as SEQ ID No. 5, as follows: ATGAATAAGGGCTGGCTGGAGCTGGAGAGCGACCCAGGCCTCTTCACCCTGCTCGTGGAAGATTTCGGT GTCAAGGGGGTGCAAGTGGAGGAGATCTACGACCTTCAGAGCAAATGTCAGGGCCCTGTATATGGATTT ATCTTCCTGTTCAAATGGATCGAAGAGCGCCGGTCCCGGCAAAAGGTCTCTACCTTGGTGGATGATACG TCCGTGATTGATGATGATATTGTGAATAACATGTTCTTTGCCCACCAGCTGATACCCAACTCTTGTGCA ACTCATGCCTTGCTGAGCGTGCTCCTGAACTGCAGCAGCGTGGACCTGGGACCCACCCTGAGTCGCATG AAGGACTTCACCAAGGGTTTCAGCCCTGAGAGCAAAGGACTTCACC
  • nucleotide sequence of the mutant BAPi gene may be encoded by SEQ ID NO. 5 or a fragment or variant thereof.
  • Reduced or non-binding between an ASXL protein (ASXLi, ASXL2 or ASXL3) and a wild-type BAPi protein maybe at least a 10%, 15%, 25%, 35%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or a 100% reduction compared to a reference cell in which binding between a wild-type BAPi protein and an ASXL protein occurs.
  • the skilled person would know how to detect the extent of the reduction in wild-type BAPi protein binding to an ASXL protein.
  • Standard assays for measuring binding between a wild-type BAPi protein and an ASXL protein include but are not limited to protein complex immunoprecipitation or fluorescence resonance energy transfer (FRET).
  • DRL-induced cell death can refer to, but is not limited to, apoptosis and other types of cell death caused by a death receptor ligand (DRL), such as necroptosis and necrosis.
  • DRL death receptor ligand
  • the term “death receptor ligand” refers to any agent that binds to a cellular receptor and induces death of the cell on which the receptor is located.
  • cell death can refer to cellular apoptosis, necrosis and necroptosis. Preferably, it refers to cellular apoptosis.
  • Apoptosis refers to programmed cell death caused by activation of an apoptotic signal transduction pathway. This may be achieved through the binding of a DRL to a death receptor.
  • Death receptor ligands maybe TRAIL, TNFalpha, FAS ligand (FASL), recombinant TRAIL (dulanermin), antibodies to death receptors, especially antibodies to death receptors of the ligand TRAIL (such as mapatumuab, drozitumumab, conatumumab, lexatumumab, tigatuzumab, LBY-135), or a combination thereof.
  • the DRL maybe an agonist molecule such as Medi-3039 or any agent that activates an apoptotic signal transduction pathway.
  • An extrinsic apoptotic signal transduction pathway may be the FAS ligand pathway, the TNFalpha pathway or the TRAIL pathway.
  • express(ed) or expression can refer to a transcribed gene (i.e. DNA), or corresponding RNA that has been translated into a polypeptide or protein.
  • BAPi mutant gene or BAPi polypeptide may be detected in any compartment of the cell (e.g. in the nucleus, cytosol, the Endoplasmic Reticulum, the Golgi apparatus or the intracellular surface of the plasma membrane).
  • Detecting according to (i), (ii) or (iii) of the first aspect may comprise the use of any one of the following assays for detecting the presence of a gene or its corresponding protein in a sample: polymerase chain reaction (PCR); northern blotting;
  • PCR polymerase chain reaction
  • immunoassays such as enzyme-linked immunosorbent assays (ELISAs), an enzyme immunoassay (EIAs), radioimmunoassay (RIAs), Western Blots, immuno-precipitation or immunohistochemistry; immunofluorescence; chromogenic (enzyme activity) assays; fluorometric imaging plate reader (FLIPR) assay; high performance liquid
  • the biological sample is preferably a cancerous bodily sample taken from a test individual. Detection for the presence of a BAPi mutant gene or mutant BAPi protein in the sample is therefore preferably carried out in vitro.
  • the sample may comprise tissue, blood, plasma, serum, spinal fluid, urine, sweat, saliva, sputum, tears, breast aspirate, prostate fluid, seminal fluid, vaginal fluid, stool, cervical scraping, amniotic fluid, intraocular fluid, mucous, moisture in breath, animal tissue, cell lysates, tumour tissue, hair, skin, buccal scrapings, nails, bone marrow, cartilage, prions, bone powder, ear wax, or combinations thereof.
  • the sample may be a biopsy.
  • the sample may be contained within the test subject, which maybe an experimental animal (e.g. a mouse or rat) or a human, wherein the method is an in vivo based test.
  • the sample may be an ex vivo sample or an in vitro sample. Therefore, the cells being tested may be in a tissue sample (for ex vivo based tests) or the cells maybe grown in culture (an in vitro sample).
  • the biological sample is an ex vivo sample.
  • kits for determining if an individual's cancer cell is sensitive to DRL-induced cell death comprising detection means for detecting the expression of a mutant BAPi gene or mutant BAPi protein, or for detecting a reduced level of expression of a wild-type BAPi gene or a lower wild-type BAPi protein concentration compared to the level of expression or protein
  • the kit is used to provide a prognosis for an individual being treated with a death receptor ligand (DRL) or any agents activating the apoptotic pathways.
  • a death receptor ligand maybe TRAIL, TNFalpha, FAS ligand (FASL), recombinant TRAIL (dulanermin), death receptor antibodies (such as mapatumuab,
  • drozitumumab conatumumab, lexatumumab, tigatuzumab
  • death receptor agonists such as Medi-3038 or Medi-3039, or a combination thereof.
  • the kit comprises at least one control or reference sample.
  • the kit may comprise a negative control and/or a positive control.
  • a negative control may comprise a wild-type BAPi protein that is resistant to DRL-induced cell death.
  • a positive control may comprise a mutant BAPi mRNA, or mutant BAPi protein, or a blank sample. The skilled person will appreciate that the level of mRNA in a sample is indicative of the level of gene expression in a cell.
  • the detection means is preferably configured to detect the expression or the concentration of a mutant BAPi protein or mRNA, or wild-type BAPi mRNA or BAPi protein in the biological sample taken from the test individual.
  • the presence of the mutant BAPi mRNA or mutant BAPi protein, or reduced level of expression of wild- type BAPi mRNA or lower protein expression to the control, in the sample is indicative that the test sample is sensitive to DRL-induced cell death.
  • the level of expression of the wild-type BAPi mRNA or concentration of BAPi protein in the biological sample may be reduced or lower compared to the concentration or level of expression of the wild-type BAPi mRNA or protein in a negative control.
  • the reduction in expression may be at least a 10%, 15%, 25%, 35%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% reduction compared to the negative control.
  • concentration of the wild-type BAPi protein in the biological sample maybe lower by at least a 10%, 15%, 25%, 35%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.
  • the absence of a mutant BAPi gene or protein, or normal to high expression of the wild-type BAPi gene or protein, in the sample is indicative that the sample is insensitive to DRL-induced cell death.
  • Detection of a mutation in a BAPi gene or protein can be achieved using a number of sequencing approaches.
  • whole exome or targeted gene sequencing is undertaken with massively parallel sequencing of tumour DNA with target genes enriched using commercially available RNA baits.
  • a capillary sequencing approach is utilised with PCR primers designed to each of the exons in the BAPi gene footprint.
  • the detection means may be a primer.
  • nucleic acid sequence of a forward primer used to detect exon 12 (chr3:52438255-524388i7F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 6 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 8 (01 ⁇ 3:52440631-52441138?) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 7 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 1 (chr3:52443044-52444094F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 8 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 3 (chr3:52443356-52443839F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 9 as follows:
  • SEQ ID No. 9 the nucleic acid sequence of a forward primer used to detect exon 6 (chr3:52436404-52430905F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 10 as follows:
  • SEQ ID No. 10 the nucleic acid sequence of a forward primer used to detect exon 17 (chr3:52436i05-52436652F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 11 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 6 (0 ⁇ 3:52441201-52441691?) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 12 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 4 (0 ⁇ 3:52442276-52442837?) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 13 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 13a (chr3:524372i8-52437786F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 14 as follows:
  • SEQ ID No. 14 the nucleic acid sequence of a forward primer used to detect exon 13b (chr3:52437388-52437956F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 15 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 13c (chr3:52437558-52438i25F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 16 as follows:
  • SEQ ID No. 16 the nucleic acid sequence of a forward primer used to detect exon 14 (chr3:52430940-52437529F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 17 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 9 (chr3152440055-52440607?) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 18 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 5 (chr3:5244i76o-524423o8F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 19 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 2 (chr3:524435i6-52443974F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 20 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 7 (chr3:52440976-5244i547F) of wild-type BAPi mRNA is referred to herein SEQ ID No. 21 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 15 (chr3:5243058i-52437i02F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 22 as follows:
  • SEQ ID No. 22 the nucleic acid sequence of a forward primer used to detect exon 10 (0 ⁇ 3:52439567-52440143?) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 23 as follows:
  • nucleic acid sequence of a forward primer used to detect exon 11 (chr3:524389i2-52439525F) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 24 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 12 (chr3:52438255-524388i7R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 25 as follows:
  • SEQ ID No. 25 the nucleic acid sequence of a reverse primer used to detect exon 8 (chr3:5244063i-5244H38R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 26 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 1 (chr3:52443044-52444094R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 27 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 3 (chr3:52443356-52443839R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 28 as follows:
  • SEQ ID No. 28 the nucleic acid sequence of a reverse primer used to detect exon 16 ( ⁇ 3:52436404-5243690511) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 29 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 17 (chr3:52436i05-52436652R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 30 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 6 (chr3:5244i20i-5244i69iR) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 31 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 4 (chr3:52442276-52442837R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 32 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 13a (chr3:524372i8-52437786R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 33 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 13b (chr3:52437388-52437956R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 34 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 13c (chr3:52437558-52438i25R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 35 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 14 (chr3:52430940-52437529R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 36 as follows:
  • SEQ ID No. 36 the nucleic acid sequence of a reverse primer used to detect exon 9 (chr3:52440055-52440607R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 37 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 5 (chr3:5244i76o-524423o8R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 38 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 2 (chr3:524435i6-52443974R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 39 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 7 (chr3:52440976-5244i547R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 40 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 15 (chr3:5243058i-52437i02R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 41 as follows:
  • nucleic acid sequence of a reverse primer used to detect exon 10 (chr3:52439507-52440i43R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 42 as follows:
  • SEQ ID No. 42 the nucleic acid sequence of a reverse primer used to detect exon 11 (chr3:524389i2-52439525R) of wild-type BAPi mRNA is referred to herein as SEQ ID No. 43 as follows:
  • an ASXL protein to a wild- type BAPi protein may be achieved using a variety of techniques known in the art, which include protein complex immunoprecipitation, Bimolecular Fluorescence complementation, Affinity electrophoresis, Immunoelectrophoresis, chemical cross linking, Proximity ligation assay and FRET.
  • a mutant BAPi gene or a mutant BAPi protein or (ii) a cancer cell with a reduced level of expression of a wild-type BAPi gene or a lower wild-type BAPi protein concentration compared to the level of expression or protein concentration in a reference cell that is a BAPi wild-type cell, as a biomarker of sensitivity to DRL-induced cell death.
  • the inventors have developed a method of treating subjects suffering from cancer, and especially those suffering from a cancer that is completely or partially insensitive to death receptor ligand-induced cell death.
  • a method of treating an individual suffering from cancer comprising:
  • the death receptor ligand may be administered as a monotherapy or in combination with other agents that are capable of killing cancer cells.
  • the "subject” or “individual” may be a vertebrate, mammal, or domestic
  • medicaments according to the invention may be used to treat any mammal, for example livestock (e.g. a horse), pets, or may be used in other veterinary applications. Most preferably, the subject is a human being.
  • LAP anti-cell death proteins
  • the LAP family consist of 8 members (BIRC2, BIRC3, BIRC5, BIRC6, BIRC7, BIRC8, NAIP, XIAP).
  • the defining feature of an LAP protein is the presence of a ⁇ 70-amino acid baculovirus LAP repeat (BIR) domain that mediates protein-protein interactions (12).
  • LAP members act as endogenous inhibitors of caspases, the main executioners of cell death, and act through either direct caspase inhibition or ubiquitin-mediated regulation of caspase degradation (13).
  • the inventors have demonstrated that BAPi gene expression can be reduced in mesothelioma cell lines using a BAPi shRNA-expressing lentivirus and that this reduction of BAPi gene expression results in increased sensitivity to DLR-induced cell death in these cell lines. Accordingly, the inventors have determined that it is possible to sensitise to DRL-induced cell death, an individual suffering from a cancer that is normally insensitive to DRL-induced cell death, by administering a BAPi inhibitor.
  • the method comprising administering, to the individual, a BAPi inhibitor or an agent that mimics the effect of BAPi inhibition.
  • a BAPi inhibitor is any agent that targets the BAPi gene or protein directly, whereas an agent that mimics the effect of BAPi inhibition is a molecule that targets a signalling molecule downstream of the BAPi gene/protein signalling pathway.
  • a BAPi inhibitor may be any molecule that inactivates BAPi protein function, such as a deubiquitinase inhibitor or antagonist, or which silences or reduces BAPi gene or protein expression or function (such as a small molecule inhibitor of BAPi), or which prevents or reduces binding of a wild-type BAPi protein to an ASXL protein.
  • BAPi inhibitor or agent may also be any molecule that mutates a wild-type BAPi gene to create a mutant BAPi gene.
  • the BAPi inhibitor or agent may be an RNAi molecule, including shRNA, siRNA, miRNA, ribozymes and antisense molecules; a TALEN (Transcriptional Activator Like-Effector Nuclease); or a CRISPR/CAS9 nuclease.
  • shRNA shRNA
  • siRNA siRNA
  • miRNA miRNA
  • TALEN Transcriptional Activator Like-Effector Nuclease
  • CRISPR/CAS9 nuclease CRISPR/CAS9 nuclease.
  • an agent that mimics the effect of BAPi inhibition is an agent that targets signalling or effector molecules downstream of BAPi, such agents may be used to induce DLR resistance in cancer cell.
  • the BAPi inhibitor maybe an IAP inhibitor (a SMAC mimetic).
  • An LAP maybe BIRC2, BIRC3, BIRC5, BIRC6, BIRC7, BIRC8, NAIP, XIAP or a fragment thereof. The inventors have found that BAPi expression increases the expression of BIRC3 protein and that inhibition of BIRC3 protein with an LAP inhibitor, such as LCL161, results in sensitization to DRL induced cell death.
  • An LAP inhibitor is an agent that reduces expression or translation of an LAP, or renders an LAP functionally inactive.
  • the LAP inhibitor or agent may also be any molecule that mutates an LAP gene or protein to create a mutant LAP gene or protein.
  • the LAPi inhibitor or agent may be an RNAi molecule, including shRNA, siRNA, miRNA, ribozymes and antisense molecules; a TALEN (Transcriptional Activator Like-Effector Nuclease); or a
  • CRISPR/CAS9 nuclease An agent that mimics the effect of BAPi inhibition maybe an RNA helicase inhibitor, such as, YK-4279 or a tyrosine kinase inhibitor, such as sorafenib.
  • RNA helicase inhibitor such as, YK-4279
  • tyrosine kinase inhibitor such as sorafenib.
  • composition comprising (i) a BAPi inhibitor or an agent that mimics the effect of BAPi inhibition and (ii) a death receptor ligand.
  • composition comprising (i) a BAPi inhibitor or an agent that mimics the effect of BAPi inhibition and (ii) a death receptor ligand, for use in therapy or as a medicament.
  • composition comprising (i) a BAPi inhibitor or an agent that mimics the effect of BAPi inhibition and (ii) a death receptor ligand, for use in treating, preventing or ameliorating cancer.
  • a method of treating, preventing or ameliorating an individual suffering from a cancer comprising administering, to the individual, a therapeutically effective amount of the composition of the sixth aspect.
  • the BAPi inhibitor or agent that mimics the effect of BAPi inhibition and the death receptor ligand may be administered simultaneously, or the BAPi inhibitor may be administered prior to the death receptor ligand. It will be appreciated that administration of the BAPi inhibitor first sensitizes the subject to DRL-induced cell death. Then, administration of the death receptor ligand can be effectively used to induce cell death in cancerous cells.
  • the BAPi inhibitor is any molecule or approach which inactivates BAPi protein function, such as a deubiquitinase inhibitor or antagonist, or which silences or reduces BAPi gene transcription or BAPi protein expression, or which mutates a wild-type BAPi gene to create a BAPi mutant gene and protein.
  • the BAPi inhibitor may be WP1130, Usp9x, Usp5, Uspi4, Usp24, UCH37, b-APi5, CRISPR/CAS9 or a small molecule inhibitor of BAPi.
  • Preferred death receptor ligands maybe, but are not limited to TRAIL, TNFalpha, FAS ligand (FASL), recombinant TRAIL (dulanermin), death receptor antibodies (such as mapatumuab, drozitumumab, conatumumab, lexatumumab, tigatuzumab, LBY-135) or death receptor agonists such as Medi 3038 or Medi 3039, or a combination thereof.
  • Mesothelioma (or Malignant Pleural Mesothelioma) is a rare form of cancer that develops from cells of the mesothelium, the protective lining that covers many of the internal organs of the body.
  • the most common anatomical site for mesothelioma is the pleura (the outer lining of the lungs and internal chest wall), but it can also arise in the peritoneum (the lining of the abdominal cavity), the pericardium (the sac that surrounds the heart) or the tunica vaginalis (a sac that surrounds the testis).
  • the cancer which may be treated according to any aspect of the invention may be selected from mesothelioma, Malignant Pleural Mesothelioma, uveal melanoma, melanoma, non-melanoma skin cancer, renal cancers, cholangiocarcinomas, lung cancers, cancer of the pleura, abdominal cancer, peritoneal cancer, cancer of the pericardium, head and neck cancers, brain cancers, breast cancers, liver and biliary tract cancers, gastrointestinal cancers including upper and lower tracts, urothelial cancers, prostate cancers, testicular cancer, cancer of the tunica vaginalis, ovarian cancers, cervical cancers, sarcomas, lymphomas and leukaemia.
  • the cancer which is treated is mesothelioma.
  • the cancer which is treated is an asbestos-induced cancer.
  • the compositions according to the invention may have a number of different forms depending, in particular, on the manner in which the composition is to be used.
  • the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposome suspension or any other suitable form that may be administered to a person or animal in need of treatment.
  • the vehicle of medicaments according to the invention should be one which is well tolerated by the subject to whom it is given.
  • Compositions according to the invention may be used in a number of ways.
  • compositions comprising agents of the invention maybe administered by inhalation (e.g. intranasally).
  • Compositions may also be formulated for topical use. For instance, creams or ointments may be applied to the skin.
  • Agents or compositions according to the invention may also be incorporated within a slow- or delayed-release device.
  • Such devices may, for example, be inserted on or under the skin, and the medicament may be released over weeks or even months.
  • the device may be located at least adjacent to the treatment site.
  • Such devices may be particularly advantageous when long-term treatment with agents used according to the invention is required and which would normally require frequent administration (e.g. at least daily injection).
  • compositions and agents according to the invention maybe administered to a subject by injection into the blood stream or directly into a site requiring treatment.
  • the medicament may be injected at least adjacent to a sensitive cell, or within a tumour.
  • Injections maybe intravenous (bolus or infusion) or subcutaneous (bolus or infusion), or intradermal (bolus or infusion), or intrapleural.
  • the amount of the composition and agent that is required is determined by its biological activity and bioavailability, which in turn depends on the mode of administration, the physicochemical properties of the modulator and whether it is being used as a monotherapy or in a combined therapy.
  • the frequency of administration will also be influenced by the half-life of the BAPi inhibitors and DRLs within the subject being treated.
  • Optimal dosages to be administered may be determined by those skilled in the art, and will vary with the particular agent in use, the strength of the pharmaceutical composition, the mode of administration, and the advancement of the cancer. Additional factors depending on the particular subject being treated will result in a need to adjust dosages, including subject age, weight, gender, diet, and time of administration.
  • a daily dose of between o.o ⁇ g/kg of body weight and 500mg/kg of body weight of the agents (e.g. the inhibitor or the DRL) according to the invention may be used for treating, ameliorating, or preventing cancer, depending upon which agent is used. More preferably, the daily dose is between o.oimg/kg of body weight and 400mg/kg of body weight, more preferably between o.img/kg and 200mg/kg body weight, and most preferably between approximately lmg/kg and loomg/kg body weight.
  • composition or agent(s) may be administered before, during or after onset of the cancer.
  • Daily doses may be given as a single administration (e.g. a single daily injection).
  • the agent may require administration twice or more times during a day.
  • agents may be administered as two (or more depending upon the severity of the disease being treated) daily doses of between 25mg and 7000 mg (i.e. assuming a body weight of 70 kg).
  • a subject receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two dose regime) or at 3- or 4-hourly intervals thereafter.
  • a slow release device may be used to provide optimal doses of agents according to the invention to a patient without the need to administer repeated doses.
  • a pharmaceutical composition for treating cancer based on the use of a BAPi inhibitor to sensitise the subject to death receptor-induced cell death, and a death receptor ligand, which induces cell death of the cells that express death receptors and previously insensitive to death receptor-induced cell death.
  • a pharmaceutical composition comprising the composition according to the sixth aspect, and a pharmaceutically acceptable vehicle.
  • a method for preparing the pharmaceutical composition according to the tenth aspect comprising contacting a therapeutically effective amount of a BAPi inhibitor or agent that mimics the effect of BAPi inhibition and a death receptor ligand, and a pharmaceutically acceptable vehicle.
  • a “therapeutically effective amount” of BAPi inhibitor is any amount which, when administered to a subject, is the amount needed to sensitise an individual's cells to death receptor-induced cell death.
  • a “therapeutically effective amount” of death receptor ligand is any amount which, when administered to a subject, is the amount needed to treat the cancer, or produce the desired effect.
  • the therapeutically effective amount of active agent i.e. BAPi inhibitor and a death receptor ligand
  • the amount of agent is an amount from about o.i mg to about 250 mg, and most preferably from about 0.1 mg/ kg body weight to about 20 mg/ kg body weight.
  • a "pharmaceutically acceptable vehicle” as referred to herein, is any known compound or combination of known compounds that are known to those skilled in the art to be useful in formulating pharmaceutical compositions.
  • the pharmaceutically acceptable vehicle maybe a solid, and the composition may be in the form of a powder or tablet.
  • a solid
  • pharmaceutically acceptable vehicle may include one or more substances which may also act as flavouring agents, lubricants, solubilisers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, dyes, coatings, or tablet-disintegrating agents.
  • the vehicle may also be an encapsulating material.
  • the vehicle In powders, the vehicle is a finely divided solid that is in admixture with the finely divided active agents according to the invention.
  • the active agent e.g. the peptide, antibody, DRL or BAPi inhibitor
  • the active agent may be mixed with a vehicle having the necessary compression properties in suitable proportions and compacted in the shape and size desired.
  • the powders and tablets preferably contain up to 99% of the active agents.
  • suitable solid vehicles include, for example calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidone, low melting waxes and ion exchange resins.
  • the pharmaceutical vehicle may be a gel and the composition may be in the form of a cream or the like.
  • the pharmaceutical vehicle may be a liquid, and the pharmaceutical composition is in the form of a solution. Liquid vehicles are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions.
  • the active agent according to the invention may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats.
  • a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats.
  • the liquid vehicle can contain other suitable pharmaceutical additives such as solubilisers, emulsifiers, buffers, preservatives, sweeteners, flavouring agents, suspending agents, thickening agents, colours, viscosity regulators, stabilizers or osmo- regulators.
  • suitable examples of liquid vehicles for oral and parenteral administration include water (partially containing additives as above, e.g.
  • cellulose derivatives preferably sodium carboxymethyl cellulose solution
  • alcohols including monohydric alcohols and polyhydric alcohols, e.g. glycols) and their derivatives, and oils (e.g. fractionated coconut oil and arachis oil).
  • the vehicle can also be an oily ester such as ethyl oleate and isopropyl myristate.
  • Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration.
  • the liquid vehicle for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.
  • Liquid pharmaceutical compositions which are sterile solutions or suspensions, can be utilised by, for example, intramuscular, intrathecal, epidural,
  • composition or antibody may be prepared as a sterile solid composition that may be dissolved or suspended at the time of administration using sterile water, saline, or other appropriate sterile injectable medium.
  • the agents and compositions of the invention may be administered orally in the form of a sterile solution or suspension containing other solutes or suspending agents (for example, enough saline or glucose to make the solution isotonic), bile salts, acacia, gelatin, sorbitan monoleate, polysorbate 80 (oleate esters of sorbitol and its anhydrides copolymerized with ethylene oxide) and the like.
  • compositions and agents suitable for oral administration include solid forms, such as pills, capsules, granules, tablets, and powders, and liquid forms, such as solutions, syrups, elixirs, and suspensions.
  • forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.
  • nucleic acid or peptide or variant, derivative or analogue thereof which comprises substantially the amino acid or nucleic acid sequences of any of the sequences referred to herein, including variants or fragments thereof.
  • substantially the amino acid/nucleotide/peptide sequence can be a sequence that has at least 40% sequence identity with the amino acid/nucleotide/peptide sequences of any one of the sequences referred to herein, for example 40% identity with the polypeptide identified as SEQ ID Nos. 3 or 4, and so on.
  • amino acid/polynucleotide/polypeptide sequences with a sequence identity which is greater than 50%, more preferably greater than 65%, 70%, 75%, and still more preferably greater than 80% sequence identity to any of the sequences referred to are also envisaged.
  • sequence identity which is greater than 50%, more preferably greater than 65%, 70%, 75%, and still more preferably greater than 80% sequence identity to any of the sequences referred to are also envisaged.
  • amino acids referred to amino acids
  • acid/polynucleotide/polypeptide sequence has at least 85% identity with any of the sequences referred to, more preferably at least 90%, 92%, 95%, 97%, 98%, and most preferably at least 99% identity with any of the sequences referred to herein.
  • an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value.
  • the percentage identity for two sequences may take different values depending on:- (i) the method used to align the sequences, for example, ClustalW, BLAST, ASTA, Smiih-Waierman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local vs global alignment, the pair-score matrix used (e.g. BLOSUM62, PAM250, Gonnet etc.), and gap-penalty, e.g. functional form and constants.
  • the method used to align the sequences for example, ClustalW, BLAST, ASTA, Smiih-Waierman (implemented in different programs), or structural alignment from 3D comparison
  • the parameters used by the alignment method for example, local vs global alignment, the pair-score matrix used (e.g. BLOSUM62, PAM250, Gonnet etc.
  • percentage identity between the two sequences. For example, one may divide the number of identities by: (i) the length of shortest sequence; (ii) the length of alignment; (iii) the mean length of sequence; (iv) the number of non-gap positions; or (iv) the number of equivalenced positions excluding overhangs.
  • percentage identity is also strongly length dependent. Therefore, the shorter a pair of sequences is, the higher the sequence identity one may expect to occur by chance. Hence, it will be appreciated that the accurate alignment of protein or DNA sequences is a complex process.
  • ClustalW The popular multiple alignment program ClustalW (Thompson et al, 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al, 1997, Nucleic Acids Research, 24, 4876-4882) is a preferred way for generating multiple alignments of proteins or DNA in accordance with the invention.
  • calculation of percentage identities between two amino acid/polynucleotide/polypeptide sequences may then be calculated from such an alignment as (N/T)*ioo, where N is the number of positions at which the sequences share an identical residue, and T is the total number of positions compared including gaps but excluding overhangs.
  • a substantially similar nucleotide sequence will be encoded by a sequence which hybridizes to any sequences referred to herein or their complements under stringent conditions.
  • stringent conditions we mean the nucleotide hybridises to filter-bound DNA or RNA in 3x sodium
  • substantially similar polypeptide may differ by at least l, but less than 5, 10, 20, 50 or 100 amino acids from the sequences shown in SEQ ID Nos. 3 or 4.
  • nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent change.
  • Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change.
  • small non- polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine.
  • Non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine.
  • the polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine.
  • the positively charged (basic) amino acids include lysine, arginine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will know the nucleotide sequences encoding these amino acids.
  • Figure lA shows various types of mutations in different malignant pleural mesothelioma (MPM) cell lines.
  • Figure lB is an analysis of TCGA exomes for enrichment of BAPi loss of function mutations.
  • Figure lc is a schematic of BAPi gene exons with Mutations annotated from 5180 TCGA exomes.
  • Figure 2A is a volcano plot showing drug-genome interactions in MPM.
  • the volcano plot displays the mean delta AUC by genotype for 92 library compounds.
  • the Y-axis denotes adjusted p-Value
  • X-axis denotes effect size. Size of circle indicates number of mutant lines in cohort tested.
  • Met 5a is a mesothelial normal control line.
  • Figure 2C is a scatter plot showing AUC following 6 day viability assay in response to 40ng/ ml rTRAIL
  • BAPi mutation status significantly correlates with response to rTRAIL.
  • Two- tailed t-test, p o.oi5.
  • FIG 3A shows the results of a viability assay in which various MPM cells lines are treated with rTRAIL.
  • MPM cell lines were treated with a dose range from o.5ng/ml to loong/ ml and cell viability was measured using Syto-60 assay. Based on their cell viability, the cell lines were classified into resistant (red), partially sensitive (orange) and sensitive (green). Cell lines were western blotted to probe the expression of BAPi protein expression.
  • Figure 3B shows the results of a viability assay in which various MPM cells lines are treated with rTRAIL.
  • BAPi wild-type cell lines MPP-89, H2869 & H2818
  • BAPi mutant cell lines H2722, H2461, H28 and H2731
  • Figure 4 is a graph (and Western blot), which shows that knocking down BAPi in a BAPi wild-type mesothelioma cell line H2818 confers increased cell death response to rTRAIL.
  • Figure 5A is an immunoblot for BAPi protein in BAPi null mesothelioma lines following transfection with empty vector and BAPi expression vector.
  • Figure 5B is a dose-response curve for an Annexin V/DAPI cell death assay performed with rTRAIL on the BAPi null H226 parental line, a BAPi wt overexpressing stable line, and BAPi C91 hydrolase inactive stable cell line.
  • Figure 5C is a graph showing the effect of rTRAIL on cell viability of an untransduced H226 cell line, a BAPi (transduced) cell line, and a H226 cell line with the NLS deleted.
  • Figure 6A shows that cell death is significantly dysregulated with the loss of the BAPi catalytic ubiquitin hydrolation domain. Comparing GEX profile of C91 variant (catalytically inactive) BAPi transduced H226 with H226 BAPi wild-type transduced H226 Kegg pathway analysis on significantly dysregulated genes analysis with adj p ⁇ 0.05 and FDR ⁇ 20%.
  • Figure 6B is a graph showing RMA normalised gene centered mRNA expression of LAP genes BIRC2 and BIRC3 in C91 mutant BAPi vs wild-type BAPi expressing H226 cell line. The Western blot shows dysregulation of LAP family proteins in H226 cell line expressing catalytically inactivated C91 mutant BAPi.
  • Figure 7A is a volcano plot showing drug-genome interactions when rTRAIL was used as an anchor drug in combination with the library of 94 single agent
  • FIGS. 7B & 7C are graphs showing the effect of rTRAIL on cell viability of MPM cells in the presence of LCL161.
  • TRAIL resistant MPM cells were treated with either 0-1000 ng/ml of TRAIL alone or a combination of 5 ⁇ LCLi6i and 0-1000 ng/ml of TRAIL for 24 hours and cell death was quantified by Annexin V/DAPI assay.
  • Figure 7D is a graph showing the effect of rTRAIL on cell viability of cells in the presence of the LAP inhibitor, LCL161.
  • BAPi-transduced or BAPi C9iA-transduced H226 cells were treated either with 0-1000 ng/ml of TRAIL alone or combination of 5 ⁇ LCLi6i and 0-1000 ng/ml of TRAIL for 24 hours and cell death was quantified by Annexin V/DAPI assay.
  • Figure 8A is a graph showing the effect of rTRAIL on the viability of various cancer cell lines.
  • Bladder (RT4) and Breast (HCC1187) cancer cell lines with nonsense mutations in BAPi show sensitivity to rTRAIL while renal cell cancer cell lines (769P & RCC10RGB) with missense mutation and wild-type renal (BB65RCC) and bladder cancer (SW1710) cell lines are resistant to TRAIL.
  • Figure 8B shows that knockdown of BAPi in Breast cancer cell line MDA MB-231 increases sensitivity to rTRAIL.
  • Figure 9A is a protocol of an in vivo experiment.
  • Figure 9B is a box plot showing the weight of tumours extracted from mice injected with mutant or wild-type BAPi- expressing cells after treatment with rTRAIL. Tumour weights of mutated BAPi xenografts are significantly smaller than wild-type BAPi xenografts after TRAIL treatment.
  • Figure 9C is a graph showing that TRAIL treatment reduces the tumour burden (measured by bioluminescence) of mutated BAPi xenografts when compared to TRAIL treated wild-type BAPi xenografts or untreated BAPi mutated and BAPi wild-type xenografts.
  • Figure io is a graph, which shows that BAPi the that catalytic domain of BAPi also regulates the sensitivity of H226 cells to the cell death-inducing ligands, TRAIL, FASL and TNFa.
  • Untransduced BAPi-negative H226 cells, BAPi-expressing and catalytically dead BAPi-expressing H226 cells were treated with 100 ng/ml of FASL, TRAIL and TNF-alpha for 24 hours and cell death was quantified by Annexin V/DAPI assay.
  • * p ⁇ 0.05 indicating significant difference between untransduced H226 cells H226 BAPi expressing cells.
  • NS no significant difference between untransduced H226 cells and BAPi C91A transduced cells.
  • FIG. 11 is a graph, which shows that BAPi that catalytic domain of BAPi also regulates the sensitivity of H226 cells to the cell death inducing ligands, TRAIL, FASL and TNFa.
  • Untransduced BAPi-negative H226 cells, BAPi-expressing, ASXL binding site deleted BAPi-expressing H226 cells and catalytically dead BAPi-expressing H226 cells were treated with 100 ng/ml of FASL, TRAIL and TNF-alpha for 24 hours and cell death was quantified by Annexin V/DAPI assay.
  • the inventors have discovered that mutation of the BAPi tumour suppressor gene confers sensitivity to therapeutic modulation of the apoptotic pathway in human cancers. They have explored and validated this association in malignant pleural mesothelioma, bladder carcinoma and breast carcinoma and have evidence that it can be extended to between 1-36% human cancers, including renal cell carcinoma, and cervical cancer and uveal melanoma.
  • TRAIL a recombinant protein that activates the TRAIL pathway by binding to TRAIL receptor 1 (TRAIL-Ri, also known as death receptor 4; DR4) and TRAIL-R2 (also known as DR5)
  • TRAIL-Ri also known as death receptor 4
  • DR5 TRAIL receptor 2
  • BAPi is also found to modulate other pro-apoptotic pathways, such as the FAS ligand pathway or the TNF pathway or intrinsic apoptotic pathway (see Example 6).
  • Sequencing reads were aligned to the human genome (NCBI build GrCh 37) using the Burrows- Wheeler aligner (BWA) algorithm with default settings (17). Unmapped reads and PCR duplicates were excluded from the analysis. Average coverage of the cell line exomes at 20x or higher was 80%.
  • the CaVEMan algorithm was used to call single nucleotide substitutions [19].
  • the algorithm uses a na ' ive Bayesian classifier to estimate the posterior probability of each possible genotype (wild-type, germline or somatic mutation) at each base.
  • split read mapping was implemented as a modification of the Pindel Algorithm [19]. Pindel searches for one read anchored on the genome with the other read mapped in two portions, spanning a putative insertion/ deletion. For both algorithms, an identical putative normal from the CGP panel of tumours was nominated that has been used in all cell lines studied without available matched normal tissue.
  • Single agent high throughput 5 point viability screening was undertaken in 384 well formats [18] using robotic liquid handling with fixing with 4% paraformaldehyde and staining for viability with Syto6o nucleic acid dye (Invitrogen) (see below).
  • Single agent dose response curves were derived for each library of 85-95 drugs according to the experiment used, and log IC50 or area under the curve (AUC) metrics were derived for each library compound in each cell line according to a previously derived formula [18]. Using this data various 2-drug synergy was measured with a Delta AUC metric.
  • a binary event matrix was compiled for the cell lines in the mesothelioma screen by aggregating copy number and exome data and this was used as input classifiers for genomic correlation. Data from this therapeutic screen was then analysed using a Multivariate Analysis of Variance (MANOVA) [18] to annotate the sensitizing effect of genotype on dose response. The results are presented as a volcano plot
  • 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), nonessential amino acids, 50 U/mL penicillin, 50 g/mL streptomycin, and 1% sodium pyruvate.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • nonessential amino acids 50 U/mL penicillin
  • 50 g/mL streptomycin 50 g/mL
  • sodium pyruvate sodium pyruvate
  • Human mesothelioma cell lines were cultured in RPMI-1640 medium supplemented with 10% FBS, 1% penicillin-streptomycin and 1% sodium pyruvate (H2369, H2373, H2461, H2591, H2595, H2722, H2731, H2795, H2803, H2804, H2869, H290, H513, IST-MESi, MPP-89, MSTO-211H, NCI-H2052, NCI-H2452, NCI-H226, NCI-H28) or Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12) supplemented with 10% FBS, nonessential amino acids, 50 U/mL penicillin, 50 g/mL streptomycin, and 1% sodium pyruvate (H2818, H2810). Cells were maintained at 37°C at 5% C0 2 . Western blotting
  • Lysates were centrifuged at 14000 rpm for ten minutes and the supernatant aspirated. Protein concentration was calculated from a standard curve of bovine serum albumin using the BCA assay (Calbiotech) according to the manufacturer's instructions. Lysates were prepared to the appropriate concentration and 4x Laemelli buffer and ⁇ reducing agent added prior to the sample being heated at 70°C for ten minutes.
  • Lysates were subjected to SDS- PAGE on pre- cast 4-12% Bis-Tris gels (Invitrogen) at 200V for 1 hr. Protein was transferred onto a nitrocellulose membrane using an iBlot gel transfer device (Invitrogen) as per manufacturer's instructions. Membranes were blocked in 5% milk in tris-buffered saline with Tween 20 (TBS-T) before the addition of primary antibody (at 1:1000 in TBS-T unless otherwise stated) overnight at 4°C.
  • TBS-T tris-buffered saline with Tween 20
  • Antibodies used include BAPi (C-4; Santa Cruz sc-28383), alpha tubulin (Cell Signalling #2125), c-IAPi (Cell signaling #7065), cIAP2 (Cell signaling, #3130), Livin (Cell Signalling #5471), Survivin (Cell signaling, #2803), Alexa Fluor® 488 (Invitrogen A-21202). Immunoblots were imaged using an ImageQuantTM LAS 4000 biomolecular imager.
  • Adherent cell lines were seeded 24 hours before drugging. Cells were trypsinised and counted before seeding at the optimal density for the size of well (96 or 384) and duration of assay. 72hr after drug treatment cells were fixed with 4%
  • Adherent mesothelioma cell lines were plated in a 96 well plate at
  • Annexin V-647 antibody Invitrogen
  • DAPI was then added to each sample before flow cytometry analysis as below.
  • Annexin V-/DAPI- cells were judged to be viable, AnnexinV+/DAPI- cells were considered to be undergoing apoptosis (early apoptotic phase), and Annexin V+/DAPI+ cells were considered late apoptotic or necrotic, and recorded as dead.
  • the mRNA from catalytically inactive BAPi expressing H226 cells (H226 C91A) and WT BAPi expressing H226 cells (H226 BAPi) was extracted and run on an Illumina HT12 array.
  • the significantly differentially expressed genes identified from the mRNA microarray were analysed using KEGG pathway analysis.
  • the cDNA full-length clone of human BAPi was obtained in a pCMV6-AC backbone (Origene, SC117256), which was cloned into a PCCL.CMVlentiviral backbone for all further experiments.
  • BAPi mutant constructs were generated using site directed mutagenesis kits (NEB) and confirmed by full length DNA sequencing.
  • Short hairpin RNAs were obtained through UCL RNAi library in a GIPZ shRNAmir lentiviral vector (Dharmacon V2LHS41473).
  • the sequence (SEQ ID NO. 44) for the short hairpin is as follows:
  • Lentiviruses were generated by transfection of 293T cells with the lentivirus vector plasmids together with the packaging plasmid pCMVdR8.2 and envelope plasmid pMDG.2 using jetPEI (Polyplus Transfection) as the transfection reagent.
  • the 293T cells were incubated at 37°C and the medium containing the lentiviruses harvested at 24 and 48 hrs.
  • the lentivirus was concentrated by ultracentrifugation at i8ooorpm for 2hours at 4°C (SW28 rotor, Optima LE80K Ultracentrifuge, Beckman) and stored at -8o°C before use.
  • Lentivirus titration was performed by transducing 293T cells with serial dilutions of virus in the presence of 4 ⁇ g/ ml polybrene. After 4 days cells were analyzed for the percentage of BAPi positive cells using flow cytometry. Viral was calculated as follows:
  • Lentivirus encoding shRNA targeting BAPi was generated as per the lentivirus production protocol above.
  • MPM cells H2818
  • Puromycin was transduced and treated with puromycin until a pure population was achieved. Immunoblotting was performed to assess efficacy of the shRNA knockdown.
  • Animals All animal studies were approved by the University College London Biological Services Ethical Review Committee and licensed under the UK Home Office regulations and the Evidence for the Operation of Animals (Scientific Procedures) Act 1986 (Home Office, London, UK). Mice were purchased from Charles River, kept in individually ventilated cages under specific pathogen-free conditions and had access to sterile-irradiated food and autoclaved water ad libitum.
  • NOD SCID mice Groups of 8 week old NOD.CBi7-Prkdcscid/NcrCrl (NOD SCID) mice (Charles River) were injected on each flank with 1 million cells of luciferase transduced mesothelioma cell lines (H226 BAP and H226 C91A) in a 1:1 mixture of matrigel and media.
  • rVTS bioluminescent imaging
  • treatment was began with either vehicle or isoleucine zipper TRAIL (izTRAIL) [20]. Either vehicle or izTRAIL were given intraperitoneally once daily at a dose of 6oomcg for the duration of the experiment.
  • Tumour size was assessed at days o, 13, 19, 26 and 41 using bioluminescent imaging (rVTS). Mice were culled at 42 days and tumours removed and weighed. Six mice per group were treated. researchers were not blinded in these experiments. Statistical analyses
  • Example 1 - TRAIL targets BAPi mutant mesothelioma cells
  • the inventors carried out a combinatorial chemical screen in 15 mesothelioma cell lines (together with the Met5a mesothelial normal control line) using 94 small molecule inhibitors and chemotherapy agents (see Table 1) either alone or in combination with the ligand tumour necrosis factor (TNF)-related cell death inducing ligand (TRAIL).
  • TNF tumour necrosis factor
  • TRAIL ligand tumour necrosis factor-related cell death inducing ligand
  • mutant cell lines are generally
  • HDAC inhibitor Class I HDAC inhibitor Class I, Ila, chromain histone
  • Example 2 Modulation of BAPi expression determines TRAIL sensitivity through activation of cell death
  • TRAIL binds via two active transmembrane death receptors, DR4 and DR5, triggering a caspase cascade and subsequently cell death.
  • the viability effect of TRAIL observed in BAPi mutant cells was indeed associated with an increased fraction of cells stained with the apoptotic marker Annexin V (see Figure 3B).
  • the inventors therefore next examined whether modulation of BAPi expression in mesothelioma cells resulted in changes in TRAIL sensitivity.
  • the ablation of BAPi protein with the use of a lentiviral shRNA in the BAPi wild-type cell line H2818 promoted a shift towards increased sensitivity in the BAPi null compared to the BAPi competent parental line (see Figure 4).
  • Treatment of the null NCI-H226 cell line with a dose range of TRAIL resulted in increased cell death which was significantly reduced in the BAPi expressing H226 cell line (see Figure 5b).
  • the C91A variant however phenocopied the response of the BAPi null parental cell line indicating a functional Ubiquitin hydrolase catalytic domain is critical for sensitivity to TRAIL.
  • the nuclear localization signal also plays a key role in imparting TRAIL resistance as deletion of NLS results in significant reduction in BAPi induced TRAIL resistance (see Figure 5c).
  • Example - Loss of BAPi expression and function modulates components of the apoptotic machinery
  • the H226 mesothelioma cell line harbours a homozygous deletion of BAPi, resulting in complete loss of BAPi expression.
  • the inventors further examined the effect of this catalytically inactive BAPi on differential mRNA gene expression as well as carrying out a signalling pathway impact analysis (SPIA), as previously described (PMID 18990722).
  • SPIA signalling pathway impact analysis
  • Example 4 - Combination drug screen demonstrates synergy between SMAC mimetic LCL161 and rTRAIL in BAPi competent cell lines.
  • rTRAIL was used as an anchor drug in combination with the library of 94 single agent compounds described above. Synergy was described using delta AUC metric (ref Wessles et ⁇ ) and this was correlated with the previously described genomic subgroups. The inventors have shown that drugs such as SMAC mimetic LCL161, DNA helicase inhibitor YK-4279 and the tyrosine kinase inhibitor sorafenib to increase the efficacy of DRL - induced apoptosis in otherwise resistant cells.
  • TRAIL Treatment of these cell lines with TRAIL resulted in a marked viability effect compared to BAPi wild-type cell lines from the same cancer type (see Figure 8A).
  • the inventors also inactivated BAPi using a lentiviral shRNA in the breast cancer cell line, MDA-MB231, and observed an exaggerated apoptotic response to rTRAIL (see Figure 8B).
  • TRAIL therapy may be efficacious in other forms of cancer (in addition to mesothelioma), and that inhibition of BAPi or by targeting the pathway which BAPi induces TRAIL resistance it is possible to sensitise cancer cells to TRAIL.
  • Mutant and wild-type BAPi cells were injected subcutaneously into left and right flanks of mice.
  • the mice were treated with either rTRAIL or vehicle (see figure 9A).
  • the tumours were weighed at the end of the experiment and the weights of mutated BAPi tumours in mice that received TRAIL was significantly less than wild-type BAPi tumours with TRAIL treatment or mutant and wild-type tumours of mice with vehicle treatment (see figure 9B).
  • the tumour burden was tracked in real time over a period of 4 weeks.
  • tumour burden of mutated BAPi xenografts in mice that received TRAIL was significantly less than wild-type BAPi xenografts with TRAIL treatment or mutant and wild-type xenografts of mice with vehicle treatment (see figure 9C).
  • BAPi has been shown to form a complex with proteins ASXLi, ASXL2 or ASXL3. Mutation of the binding site for ASXL protein inhibits formation of BAPi-ASXL complexes.
  • the BAPi-ASXL complex has been shown to deubiquitinate Histone 2A, and other substrates, and both BAPi and ASXLi, ASXL2, or ASXL3 are required for this deubiquitination function. This complex is an important regulator of the Polycomb Respressor Complex and gene transcription.
  • the inventors have shown that the BAPi wild-type and ASXL3 mutant (truncating mutation) cell line H513 is TRAIL sensitive. Hence loss of function of ASXLi, ASXL2 or ASXL3 increases the sensitivity of cells to DRL induced cell death. Mutations of ASXLi, ASXL2 or ASXL3 also predict sensitivity to DLR and hence can be used as a biomarker for cell death independent of BAPi mutational status.
  • BAPi is an important regulator of whether a cell will undergo cell death in response to the activation of a death receptor by a death receptor ligand, such as TRAIL, TNF alpha (TNFa) and FAS ligand (FASL).
  • a death receptor ligand such as TRAIL, TNF alpha (TNFa) and FAS ligand (FASL).
  • non-functional or low expression of wild-type BAPi causes cells to become sensitive to death receptor ligand-induced cell death. Consequently, it has been discovered that a mutant BAPi gene or a mutant BAPi protein, or a cancer cell with low expression of a wild-type BAPi protein may be used as a biomarker of sensitivity to DRL-induced cell death.
  • the invention also encompasses an advantageous: method of determining if an individual's cancer cell is sensitive to death receptor ligand (DRL)-induced cell death;
  • DRL death receptor ligand
  • kit for determining if an individual's cancer cell is sensitive to DRL-induced cell death
  • composition comprising a BAPi inhibitor and a death receptor ligand; and a method of treating, preventing or ameliorating an individual suffering from a cancer, which is insensitive to DRL-induced cell death.
  • CDKN2A CDKN2A
  • CULi malignant pleural mesothelioma. Cancer research.
  • Narasimhan SR Yang L, Gerwin BI, Broaddus VC. Resistance of pleural mesothelioma cell lines to apoptosis: relation to expression of Bcl-2 and Bax.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Toxicology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Hospice & Palliative Care (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/GB2017/052733 2016-09-16 2017-09-15 Cell death biomarker Ceased WO2018051110A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP17771553.9A EP3513192B1 (en) 2016-09-16 2017-09-15 Cell death biomarker
US16/333,590 US11789012B2 (en) 2016-09-16 2017-09-15 Cell death biomarker
DK17771553.9T DK3513192T3 (da) 2016-09-16 2017-09-15 Celledødsbiomarkør
AU2017327994A AU2017327994B2 (en) 2016-09-16 2017-09-15 Cell death biomarker
ES17771553T ES2863274T3 (es) 2016-09-16 2017-09-15 Biomarcador de muerte celular
JP2019514263A JP7211936B2 (ja) 2016-09-16 2017-09-15 細胞死のバイオマーカー
US18/299,415 US20240118266A1 (en) 2016-09-16 2023-04-12 Cell death biomarker

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1615842.0A GB201615842D0 (en) 2016-09-16 2016-09-16 Cell death biomarker
GB1615842.0 2016-09-16

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/333,590 A-371-Of-International US11789012B2 (en) 2016-09-16 2017-09-15 Cell death biomarker
US18/299,415 Division US20240118266A1 (en) 2016-09-16 2023-04-12 Cell death biomarker

Publications (1)

Publication Number Publication Date
WO2018051110A1 true WO2018051110A1 (en) 2018-03-22

Family

ID=57288813

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2017/052733 Ceased WO2018051110A1 (en) 2016-09-16 2017-09-15 Cell death biomarker

Country Status (8)

Country Link
US (2) US11789012B2 (https=)
EP (1) EP3513192B1 (https=)
JP (1) JP7211936B2 (https=)
AU (1) AU2017327994B2 (https=)
DK (1) DK3513192T3 (https=)
ES (1) ES2863274T3 (https=)
GB (1) GB201615842D0 (https=)
WO (1) WO2018051110A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021130682A2 (en) 2019-12-23 2021-07-01 Otsuka Pharmaceutical Co., Ltd. Biomarkers for cancer therapy using mdm2 antagonists
CN114478797A (zh) * 2021-11-24 2022-05-13 中山大学附属第五医院 一种靶向ddx24蛋白的水解靶向嵌合体及其应用

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112961864A (zh) * 2021-02-26 2021-06-15 广州市妇女儿童医疗中心 突变的asxl3基因及应用
AU2024218399A1 (en) 2023-02-10 2025-01-30 1Inch Limited Dynamic multi-path transfers
CN117843657B (zh) * 2023-12-30 2025-08-05 新乡医学院 Brd4/nampt双靶向抑制剂及其作为抗肝癌药物的应用
US12608709B2 (en) 2024-03-15 2026-04-21 Degensoft Ltd. Decentralized systems and methods for response generation to API calls
US12574234B2 (en) 2024-04-18 2026-03-10 Degensoft Ltd Secure cross-chain atomic swaps

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020169123A1 (en) * 2001-02-27 2002-11-14 The Trustees Of The University Of Pennsylvania Regulating apoptosis in TRAIL-resistant cancer cells, while protecting normal, non-cancerous cells
EP2044434A2 (en) * 2006-06-20 2009-04-08 Genentech, Inc. Methods and materials for observing apoptosis by detecting fragments of clathrin-pathway components
WO2013106002A1 (en) * 2011-02-16 2013-07-18 Memorial Sloan-Kettering Cancer Center Bap1 mutational analysis in determining susceptibility to, prognosis of, and treatment of melanocytic neoplasia

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070037165A1 (en) 2000-09-08 2007-02-15 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
WO2012040614A1 (en) * 2010-09-23 2012-03-29 The Washington University Compositions and methods for detecting cancer metastasis
WO2014156527A1 (ja) 2013-03-28 2014-10-02 国立大学法人東北大学 食道癌の発症リスクを判定する方法及びキット
JP2016537316A (ja) 2013-10-10 2016-12-01 ザ リージェンツ オブ ザ ユニバーシティー オブ ミシガン デユビキチナーゼ阻害剤およびその使用方法
US20160101071A1 (en) * 2014-04-28 2016-04-14 Wisconsin Alumni Research Foundation Combination cancer treatment
EP3148971A4 (en) 2014-06-02 2017-10-25 Pharmakea, Inc. Deubiquitinase inhibitors
EP3158086B1 (en) 2014-06-19 2021-03-24 Memorial Sloan-Kettering Cancer Center Biomarkers for response to ezh2 inhibitors

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020169123A1 (en) * 2001-02-27 2002-11-14 The Trustees Of The University Of Pennsylvania Regulating apoptosis in TRAIL-resistant cancer cells, while protecting normal, non-cancerous cells
EP2044434A2 (en) * 2006-06-20 2009-04-08 Genentech, Inc. Methods and materials for observing apoptosis by detecting fragments of clathrin-pathway components
WO2013106002A1 (en) * 2011-02-16 2013-07-18 Memorial Sloan-Kettering Cancer Center Bap1 mutational analysis in determining susceptibility to, prognosis of, and treatment of melanocytic neoplasia

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
H. WALCZAK: "Death Receptor-Ligand Systems in Cancer, Cell Death, and Inflammation", COLD SPRING HARBOR PERSPECTIVES IN BIOLOGY, vol. 5, no. 5, 1 May 2013 (2013-05-01), pages a008698 - a008698, XP055418107, DOI: 10.1101/cshperspect.a008698 *
HAYES-JORDAN A ET AL: "474 POSTER Inhibition of PDGFR-beta increases sarcoma cell sensitivity to tumor necrosis factor related apoptosis inducing ligand, TRAIL and promotes inhibition of tumor growth in dual therapy using imantanib (Gleevac) and TRAIL", EUROPEAN JOURNAL OF CANCER. SUPPLEMENT, PERGAMON, OXFORD, GB, vol. 4, no. 12, 1 November 2006 (2006-11-01), pages 145, XP027888933, ISSN: 1359-6349, [retrieved on 20061101] *
M. LADANYI ET AL: "New Strategies in Pleural Mesothelioma: BAP1 and NF2 as Novel Targets for Therapeutic Development and Risk Assessment", CLINICAL CANCER RESEARCH, vol. 18, no. 17, 23 July 2012 (2012-07-23), US, pages 4485 - 4490, XP055418148, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-11-2375 *
PERSHANG FARSHI ET AL: "Deubiquitinases (DUBs) and DUB inhibitors: a patent review", EXPERT OPINION ON THERAPEUTIC PATENTS., vol. 25, no. 10, 16 June 2015 (2015-06-16), GB, pages 1191 - 1208, XP055406965, ISSN: 1354-3776, DOI: 10.1517/13543776.2015.1056737 *
R POLANSKI ET AL: "Caspase-8 activation by TRAIL monotherapy predicts responses to IAPi and TRAIL combination treatment in breast cancer cell lines", CELL DEATH AND DISEASE, vol. 6, no. 10, 1 October 2015 (2015-10-01), pages e1893, XP055418422, DOI: 10.1038/cddis.2015.234 *
YUAN ZHENGQIANG ET AL: "Cryopreservation of human mesenchymal stromal cells expressing TRAIL for human anti-cancer therapy", CYTOTHERAPY, vol. 18, no. 7, July 2016 (2016-07-01), pages 860 - 869, XP002774967 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021130682A2 (en) 2019-12-23 2021-07-01 Otsuka Pharmaceutical Co., Ltd. Biomarkers for cancer therapy using mdm2 antagonists
CN114478797A (zh) * 2021-11-24 2022-05-13 中山大学附属第五医院 一种靶向ddx24蛋白的水解靶向嵌合体及其应用
CN114478797B (zh) * 2021-11-24 2023-10-27 中山大学附属第五医院 一种靶向ddx24蛋白的水解靶向嵌合体及其应用

Also Published As

Publication number Publication date
JP2020500502A (ja) 2020-01-16
US20240118266A1 (en) 2024-04-11
AU2017327994A1 (en) 2019-04-04
ES2863274T3 (es) 2021-10-11
EP3513192B1 (en) 2020-12-23
EP3513192A1 (en) 2019-07-24
DK3513192T3 (da) 2021-03-29
US11789012B2 (en) 2023-10-17
AU2017327994B2 (en) 2023-09-14
US20190257818A1 (en) 2019-08-22
GB201615842D0 (en) 2016-11-02
JP7211936B2 (ja) 2023-01-24

Similar Documents

Publication Publication Date Title
US20240118266A1 (en) Cell death biomarker
Lu et al. Emerging pharmacotherapeutic strategies to overcome undruggable proteins in cancer
CN102124335B (zh) 基于肿瘤抑制因子的过度增生细胞对溶瘤病毒疗法的敏感性
Timme et al. Small-molecule dual PLK1 and BRD4 inhibitors are active against preclinical models of pediatric solid tumors
JP2025503385A (ja) メニン-mllエピジェネティック複合体を破壊することによる消化管間質腫瘍(gist)の治療的標的化
WO2020023768A1 (en) Methods and materials for identifying and treating bet inhibitor-resistant cancers
US20240398804A1 (en) Methods of treating cancer having an active wnt/beta-catenin pathway
Zhang et al. Intact regulation of G1/S transition renders esophageal squamous cell carcinoma sensitive to PI3Kα inhibitors
WO2020097324A1 (en) Targeting the transcription factor nf-kb with harmine
TW202202143A (zh) 使用cdk4/6及cdk2抑制劑共同治療以遏止腫瘤對cdk2抑制劑之適應性
Morales et al. GATOR2-dependent mTORC1 activity is a therapeutic vulnerability in FOXO1 fusion–positive rhabdomyosarcoma
US20240156800A1 (en) Ep300 degrader and uses thereof in neuroblastoma
US20230042367A1 (en) Methods and compositions for treating cancers having f-box and wd-repeat protein 7 (fbxw7) alterations and/or cyclin l1 (ccnl1) gain or amplification
US20250146080A1 (en) Methods for overcoming tazemetostat-resistance in cancer patients
US10398672B2 (en) Methods and compositions for targeting cancer stem cells
Fayzullina et al. Novel Targeted Therapeutic Strategies for Ewing Sarcoma. Cancers 2022, 14, 1988
Masanas Jimenez Prognostic and therapeutic significance of KIF11 in neuroblastoma
Liu Analysis of Pten-Null Primary Mouse Astrocytes Revealed Common Differentially Expressed Genes with Human Glioblastoma Transcriptomes
Gregg BSc (Hons.) Biomedical Science
Perl Leveraging Small Molecule Activators of Protein Phosphatase 2A (PP2A) to Elucidate PP2As Role in Regulating DNA Replication and Apoptosis
US20210401931A1 (en) Methods and materials for treating cancer
WO2023233148A1 (en) Cancer therapy
Kuang et al. Targeting Cyclin-Dependent Kinase 9 (CDK9) As a Novel Therapeutic Strategy for Clear Cell Renal Cell Carcinoma
Di Giandomenico Mode of Action of Trabectedin in Human Mixoid Liposarcoma Growing in Immunodeficient Mice: Evidence that the Drug Acts by Displacing FUS-CHOP Chimeric Protein From its Target Promoters
Shapiro CDK Inhibitors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17771553

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019514263

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017327994

Country of ref document: AU

Date of ref document: 20170915

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017771553

Country of ref document: EP

Effective date: 20190416