WO2018044124A1 - 신규한 줄기 세포 전달체 및 이의 제조 방법 - Google Patents

신규한 줄기 세포 전달체 및 이의 제조 방법 Download PDF

Info

Publication number
WO2018044124A1
WO2018044124A1 PCT/KR2017/009614 KR2017009614W WO2018044124A1 WO 2018044124 A1 WO2018044124 A1 WO 2018044124A1 KR 2017009614 W KR2017009614 W KR 2017009614W WO 2018044124 A1 WO2018044124 A1 WO 2018044124A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cell
stem cells
stem
cell
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/009614
Other languages
English (en)
French (fr)
Inventor
차형준
박태윤
김효정
최봉혁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
POSTECH Academy Industry Foundation
Original Assignee
POSTECH Academy Industry Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by POSTECH Academy Industry Foundation filed Critical POSTECH Academy Industry Foundation
Priority to US16/330,068 priority Critical patent/US20190307688A1/en
Priority claimed from KR1020170111812A external-priority patent/KR20180025831A/ko
Publication of WO2018044124A1 publication Critical patent/WO2018044124A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/14Macromolecular materials
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/36Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61LMETHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/40Composite materials, i.e. containing one material dispersed in a matrix of the same or different material

Definitions

  • the present invention relates to novel stem cell carriers and methods for their preparation.
  • stem cell utilization has been evaluated as a state-of-the-art medical technology that can bring about dramatic changes in drug and surgery-oriented clinical care.
  • the result may be that the injected cells may be scattered and difficult to settle and differentiate, with the problem that the delivery may not be accurately delivered to the target site. Turned out.
  • tissue engineering preparations incorporating tissue engineering techniques into stem cells have been actively studied.
  • the tissue engineering preparation refers to a method of introducing a delivery medium into stem cells, taking a material having excellent biocompatibility in a suitable form, and then culturing the stem cells and applying them to a site requiring a procedure.
  • tissue engineering preparations can be made in various forms depending on the disease site.
  • stem cells in order for stem cells to be used as a therapeutic agent to heal damaged tissues, it is essential to minimize the cell loss to the damaged tissues as well as to deliver them well, and to maintain stem cells continuously differentiation ability.
  • damaged tissue is necrotic, as well as blood vessels around the tissues are often damaged, so the inflow of blood is small. It is difficult for cells to survive because it lacks the oxygen needed for metabolism.
  • cell carriers for stem cell therapy should be able to be readily delivered to target damaged tissues as well as to biocompatibility, to minimize cell loss and to maintain the survival and differentiation of stem cells.
  • stem cells and cell carriers must be able to form vascular vasculature well around the cell carriers in order to be compatible with damaged tissue. As such, the development of cell carriers for the treatment of chronic diseases has been delayed because the various conditions mentioned above must be satisfied.
  • coacervate is a type of colloidal material formed when anionic polymer electrolyte and cationic polymer electrolyte are mixed under specific conditions.
  • the absorbance of the solution increases, and the round sphere on the solution forms an external solution and Exist in isolation.
  • the participant electrolyte separates from the solution, condenses and remains in a liquid phase, with changes in physical properties such as reduced surface tension and increased viscosity.
  • Coacervates can also occur through the mixing of proteins with polyelectrolytes with opposite properties (C.G. deKruif et al., 2004, Current Opinion in Colloid and Interface® Science 9, 340-349).
  • These mussel adhesive proteins are known as strong natural adhesives compared to currently known chemical synthetic adhesives, and most of them have flexibility that can bend while exhibiting tensile strengths that are about twice as high as epoxy resins.
  • Mussel adhesive proteins also have the ability to adhere to a variety of surfaces, including plastics, glass, metals, Teflon and biomaterials, and can adhere to wet surfaces in minutes.
  • adhesive proteins are known to not attack human cells or cause immune reactions, and thus have great potential for application in medical fields such as adhesion of living tissues and adhesion of broken teeth during surgery (J. Dove et al., 1986, Journal of American Dental Association). 112, 879).
  • the mussel adhesive protein can be used in the field of surface adhesion technology of the cell, the surface adhesion technology of the cell is one of the very important technology required for the field of cell culture and tissue engineering, cell culture for cells and tissue culture Technology that can effectively adhere to the surface is very important for promoting the transfer, capture, proliferation and differentiation of specific cells
  • stem cell transporters using coacervates based on cationic proteins, in particular mussel adhesive proteins may be a solution that can effectively heal biological tissues.
  • the present inventors prepared a cell transporter by inserting stem cells into coacervate formed by mixing a cationic mussel adhesive protein and hyaluronic acid in anionic polymer as a specific carrier, and when transplanting them into a living body, The present invention has been completed by confirming that the in vivo delivery and collection are excellently increased and at the same time an active substance is secreted from the stem cells to obtain a desired therapeutic effect.
  • one object of the present invention is to provide a method for producing a stem cell carrier comprising the step of contacting a stem cell to coacervate formed by mixing an anionic polymer to a mussel adhesive protein or a variant thereof.
  • Another object of the present invention is to provide a stem cell carrier prepared according to the above method.
  • Another object of the present invention to provide a stem cell therapy comprising the stem cell carrier.
  • Another object of the present invention to provide a pharmaceutical composition for vascular tissue regeneration or the treatment of vascular disorders associated with the stem cell carrier.
  • Another object of the present invention to provide a method for treating vascular tissue regeneration or treatment of vascular disorders comprising the step of administering a composition comprising the stem cell carrier to the subject.
  • the present invention provides a method for producing a stem cell carrier comprising the step of contacting the stem cells to coacervate (coacervate) formed by mixing an anionic polymer to a mussel adhesive protein or a variant thereof Provide stem cell carriers.
  • the mussel adhesive protein in the present invention is an adhesive protein derived from mussels, and preferably includes all mussel adhesive proteins described in WO2006 / 107183 or WO2005 / 092920.
  • the mussel adhesive protein or variant thereof is a protein consisting of an amino acid sequence selected from the group consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3; Or a fusion protein linked to one or more amino acid sequences selected from the group, more preferably a protein consisting of an amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, Most preferably, the protein consists of the amino acid sequence of SEQ ID NO: 1.
  • Mutants of the mussel adhesive protein in the present invention preferably include an additional sequence at the carboxyl or amino terminus of the mussel adhesive protein or some amino acids are substituted with other amino acids under the premise of maintaining the adhesion of the mussel adhesive protein. It may be. More preferably, the polypeptide consisting of 3 to 25 amino acids including RGD is linked to the carboxyl or amino terminus of the mussel adhesive protein or 1 to 100% of the total number of tyrosine residues forming the mussel adhesive protein. 5 to 100% may be substituted with 3,4-dihydroxyphenyl-L-alanine (DOPA).
  • DOPA 3,4-dihydroxyphenyl-L-alanine
  • 3 to 25 amino acids including the RGD include, but are not limited to, Arg Gly Asp (RGD), Arg Gly Asp Ser (RGDS), Arg Gly Asp Cys (RGDC), Arg Gly Asp Val (RGDV), and RGDSPASSKP.
  • Arg Gly Asp Ser Pro Ala Ser Ser Lys Pro GRGDS (Gly Arg Gly Asp Ser), GRGDTP (Gly Arg Gly Asp Thr Pro), GRGDSP (Gly Arg Gly Asp Ser Pro), GRGDSPC (Gly Arg Gly Asp Ser Pro) Cys) and YRGDS (Tyr Arg Gly Asp Ser) may be one or more selected from the group consisting of.
  • the variant of the mussel adhesive protein linked to the polypeptide consisting of 3 to 25 amino acids including RGD at the carboxyl or amino terminus of the mussel adhesive protein is not limited thereto but is preferably a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 Can be.
  • the mussel adhesive protein in the present invention is not limited thereto, but may be preferably inserted into a conventional vector designed to express an external gene so that it can be mass-produced by genetic engineering method.
  • the vector may be appropriately selected or newly produced according to the type and characteristics of the host cell for producing a protein.
  • the method for transforming the vector into a host cell and the method for producing a recombinant protein from the transformant can be easily carried out by conventional methods. Methods such as selection, production, transformation, and expression of recombinant proteins described above can be easily carried out by those skilled in the art, and some modifications are also included in the present invention.
  • the anionic polymer may be used without limitation as long as it is a polymer material capable of forming coacetate by combining with the cationic mussel adhesive protein, preferably, a polymer lower than the pI (Isoelectric point) of the cationic mussel adhesive protein, More preferably, the polymer may have a pI value of 2 to 6, even more preferably a polymer having a pI value of 2 to 4. Since coacervate is hardly formed when the pI value is above or below the pI value, it is preferable to use an anionic polymer within the pI range.
  • the anionic polymer may be, for example, hyaluronic acid, ferredoxin, polystyrene sulfonic acid, gum arabic, gelatin, albumin, Carbopol, high or low methoxyl pectin, sodium carboxymethyl guar gum, xanthan gum, whey protein, legamin bean legumin, carboxymethyl cellulose, alginate, carrageenan, sodium hexametaphosphate, sodium casinate, hemoglobin, heparin and heparin
  • External polysaccharide B40 (exopolysaccharide B40) may be one or more selected from the group consisting of, the average molecular weight of the anionic polymer is not limited thereto, but preferably a group consisting of 1kDa to 300kDa It may have a selected molecular weight and standing and more preferably from 10kDa to 100kD, more preferably from 17kDa to about 59kDa, and most preferably may
  • Stem cell transporter of the present invention may further comprise one or more bioactive substances that can achieve the desired effect.
  • the biologically active substance is a substance exhibiting a constant pharmacological activity when administered to a living body or applied to the skin surface, but is not limited thereto, and preferably may be at least one selected from the group consisting of drugs, enzymes, cells, and food additives.
  • anticancer agent antibiotic, anti-inflammatory agent, hormone, hormonal antagonist, interleukin, interferon, growth factor, tumor necrosis factor, endotoxin, lymphokoxy, urokinase, streptokinase, tissue plasminogen activator, protease inhibitor, alkylphosphocholine, radiation
  • isotopic labeling agents surfactants, cardiovascular drugs, gastrointestinal drugs, and nervous system drugs.
  • mussel adhesive protein and the anionic polymer of the cell carrier of the present invention may be formed by mixing in a weight ratio of 1: 0.01 to 100 at pH 2.0 to pH 10.0.
  • the mixing means a case where the anionic polymer and the stem cells are simultaneously mixed with the mussel adhesive protein or a variant thereof, or more preferably, the stem cells are mixed with a solution in which the mussel adhesive protein or the variant and the anionic polymer are dissolved. Then, it means a case of further mixing the mussel adhesive protein or a variant thereof and the other of the anionic polymer in order to induce coacetate formation.
  • the coacervate formed by the mussel adhesive protein and the anionic polymer forms a coating around the stem cells.
  • mussel adhesive proteins or variants thereof and anionic polymers may be mixed with 0.0001 to 50% by weight in a solvent that is preferably, but not limited to, an appropriate pH.
  • the stem cells at the time of mixing is not limited to this, but preferably mixed in an amount of 0.01 to 20% (v / v), more preferably 0.1 to 2% (v / v) by volume in a solvent set at an appropriate pH. desirable.
  • the type of solvent, proper pH, and proper temperature for preparing the stem cell carrier are the same as known conditions under which coacetate can be effectively formed.
  • stem cell refers to a cell having the ability to differentiate into two or more cells while having a self-replicating ability, totipotent stem cells, pluripotent stem cells It can be classified into multipotent stem cells.
  • Stem cells of the present invention may be selected without appropriate limitation depending on the purpose, and may be derived from adult cells, such as all known tissues, cells, etc. derived from mammals, including humans, preferably humans, for example, Bone marrow, umbilical cord blood, placenta (or placental tissue cells), fat (or adipose tissue cells) and the like.
  • the stem cells are restricted from bone marrow, adipose tissue, muscle tissue, ex vivo cultured autologous mesenchymal stem cells, allogeneic mesenchymal stem cells, umbilical cord blood, embryonic yolk sac, placenta, umbilical cord, periosteum, fetal and adolescent skin, and blood It may be a stem cell obtained without, and may be a stem cell derived from the fetus or shortly after birth or adult.
  • Stem cells of the present invention do not limit the type of stem cells as long as the desired effect can be achieved, but preferably the stem cells are Adipose Stem Cells (ASC), Mesenchymal Stem Cells , MSC), bone marrow stem cells, umbilical cord blood stem cells, neural stem cells, and induced pluripotent stem cells may be selected from the group consisting of stem cells (Adipose Stem Cell (ASC) or mesenchymal stem cells (ASC) Mesenchymal Stem Cell (MSC).
  • ASC Adipose Stem Cell
  • MSC Mesenchymal Stem Cell
  • MSC mesenchymal Stem Cell
  • the present inventors In order to induce cell culture in the form of three-dimensional cell aggregates, the present inventors have developed a method of maintaining a high cell density so that cell-cell and cell-substrate interactions can be made.
  • the cell carrier of the present invention achieves the desired therapeutic and / or regenerative effect by enhancing one or more stem cell abilities selected from the group consisting of stem cell viability, proliferative capacity, differentiation capacity and angiogenesis.
  • the present invention provides a stem cell therapeutic agent comprising the stem cell carrier or a pharmaceutical composition for vascular tissue regeneration or the treatment of vascular disorders related disease comprising the stem cell carrier.
  • cell therapeutic agent refers to the proliferation, selection, or other methods of viable autologous, allogenic, xenogenic cells in vitro to restore the function of cells and tissues. It refers to medicines used for the purpose of treatment, diagnosis, and prevention through a series of actions such as changing biological characteristics. In particular, it can be classified into “stem cell therapy” embryonic stem cell therapy and adult stem cell therapy.
  • the stem cell therapeutic agent may be administered to the human body through any general route as long as it can reach the target tissue.
  • Parenteral administration for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration may be, but is not limited thereto.
  • the stem cell therapy may also be administered by any device in which the active agent may migrate to the target cell. It may be administered together with a pharmaceutical carrier generally used for stem cell treatment, and the carrier may be physiological saline.
  • Stem cell therapeutic agents of the invention can be applied directly or indirectly to cell therapy of vascular dysfunction-related diseases (eg, angiogenesis-associated diseases).
  • vascular dysfunction-related diseases eg, angiogenesis-associated diseases.
  • the angiogenesis-associated disease may include diabetic ulcers; Necrotic; Wounds requiring angiogenesis for healing; Burgue's disease; High blood pressure; Ischemic diseases including cerebrovascular ischemia, renal ischemia, pulmonary ischemia, ground ischemia and ischemic myocardial infarction; Obstructive vascular disease; And cardiovascular disease.
  • composition of the present invention is not limited thereto, but may preferably be in the form of a pharmaceutical composition.
  • composition of the present invention comprises 0.0001 to 50% by weight of the coacervate relative to the total weight of the composition.
  • the composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions in addition to the active ingredients.
  • composition of the present invention can be prepared by including one pharmaceutically acceptable carrier in addition to the coacervates described above for administration.
  • Pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and one or more of these components, as needed.
  • other conventional additives such as buffers and bacteriostatic agents can be added.
  • diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable formulations, pills, capsules, granules, or tablets such as aqueous solutions, suspensions, emulsions, and the like, and may act specifically on target organs.
  • Target organ specific antibodies or other ligands may be used in combination with the carrier so as to be used.
  • it may be preferably formulated according to each disease or component by a suitable method in the art or using a method disclosed in Remington's Pharmaceutical Science (Recent Edition, Mack Publishing Company, Easton PA). have.
  • the composition is intravenous, intraperitoneal, intramuscular, subcutaneous, intradermal, nasal, mucosal, inhalation and oral. or by injecting such as oral). Dosage varies depending on the subject's weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion and severity of disease.
  • the daily dosage is about 0.1 to 100 mg / kg, preferably 0.5 to 10 mg / kg, and more preferably administered once to several times a day.
  • vascular tissue regeneration or treating a vascular disorder related disease comprising administering to the subject a composition comprising the stem cell carrier.
  • the method of the present invention uses the above-described composition, the overlapping content is omitted in order to avoid excessive complexity of the present specification.
  • the present invention relates to a new stem cell therapeutic platform for delivering cells in a captured state by forming an adherent cell carrier using cross-linked coacervate.
  • the cell carrier of the present invention maintains the biocompatibility as well as the differentiation ability of stem cells. It can survive without losing cell adhesion even under oxygen-deficient conditions.
  • metabolic reactions particularly neovascularization, induced in a hypoxic environment, it can be applied to biological tissues that are not easy to regenerate blood vessels to induce rapid regeneration.
  • 1 is a diagram showing the relationship between the concentration of cells that can be collected in coacervate and the collection efficiency.
  • Figure 2 is a diagram observing the shape of the stem cells collected in coacervate through a microscope. Scale bar is 50 ⁇ m.
  • FIG. 3 is a view showing an experimental photograph observed after a week after the survival of the stem cells collected in coacervate in various environments
  • Figure 4 is a diagram showing the numerical representation of the survival of the stem cells collected in the coacervate disclosed in FIG.
  • Figure 5 is a diagram showing the experimental photographs observed over time stem cell survival and death in low oxygen conditions.
  • FIG. 6 is a graph illustrating the result of FIG. 5.
  • FIG. 7 is a diagram confirming the maintenance of stem cell differentiation capacity.
  • FIG. 8 is a diagram confirming the expression of SOX2 and OCT4 genes related to stem cell differentiation ability.
  • FIG. 9 is a graph showing a comparative comparison of the expression level of Hypoxia inducible factor 1 ⁇ gene in cells collected in coacervate.
  • FIG. 10 is a graph comparing the expression levels of genes related to induction of neovascularization such as VEGF and FGF2 in cells collected in coacervate.
  • 11 is a diagram showing the degree of neovascularization by cutting the aorta of rats and treating each experimental group.
  • FIG. 12 is a diagram showing the distribution of cells for 2 weeks through the injection of stem cells into the subcutaneous mouse and animal luminescence imaging analyzer.
  • FIG. 13 is a diagram comparing the fluorescent stained stem cells injected per unit area by fragmenting the tissue site observed in FIG. 12.
  • FIG. 14 is a diagram illustrating the immune response and blood vessel formation through H & E staining by fragmenting the tissue region observed in FIG. 12.
  • FIG. 15 is a diagram illustrating the expression level of proteins related to the differentiation capacity of stem cells in tissues after 2 weeks by injection of stem cell carriers into the subcutaneous rat.
  • FIG. 15 is a diagram illustrating the expression level of proteins related to the differentiation capacity of stem cells in tissues after 2 weeks by injection of stem cell carriers into the subcutaneous rat.
  • Mussel adhesive protein fp-151 (SEQ ID NO: 1) used in the present invention is a decapeptide (decapeptide) consisting of 10 amino acids repeated about 80 times among the mussel adhesive protein fp-1 present in nature 6 to be expressed in E. coli Fp-1 variant consisting of two decapeptides and a Mgfp-5 gene (Genbank No. AAS00463 or AY521220) were inserted between two fp-1 variants and produced in Escherichia coli (DS Hwang et. Al., Biomaterials 28, 3560-3568, 2007).
  • decapeptide consisting of 10 amino acids repeated about 80 times among the mussel adhesive protein fp-1 present in nature 6 to be expressed in E. coli Fp-1 variant consisting of two decapeptides and a Mgfp-5 gene (Genbank No. AAS00463 or AY521220) were inserted between two fp-1 variants and produced in Escherichia coli (DS Hwang
  • fp-1 a fp-1 variant (hereinafter referred to as 6xAKPSYPPTYK) to which the peptide consisting of AKPSYPPTYK is repeated six times is prepared, and the N-terminus of Mgfp-5 is prepared above.
  • Fp-151 of SEQ ID NO: 1 was prepared by combining 6xAKPSYPPTYK and 6xAKPSYPPTYK at the C-terminus of Mgfp-5.
  • the specific preparation of the mussel adhesive protein is the same as that shown in WO2006 / 107183 or WO2005 / 092920, which is incorporated by reference in its entirety.
  • Fp-151-RGD of SEQ ID NO: 2 was prepared by adding the GRGDSP sequence selected from the fibronectin RGD group to the C-terminus of fp-151 of Example 1-1.
  • Mussel adhesive protein fp-131 is a gene of the mussel adhesive protein Mgfp-3A (Genbank No. BAB16314 or AB049579) that exists naturally between two fp-1 variants in the same manner as fp-151 of Example 1-1. After put in, it is produced in E. coli.
  • fp-1 a fp-1 variant (hereinafter referred to as 6xAKPSYPPTYK) to which the peptide consisting of AKPSYPPTYK is repeated six times is prepared, and the N-terminus of Mgfp-3 is prepared above.
  • Fp-131 of SEQ ID NO: 3 was prepared by combining 6xAKPSYPPTYK and 6xAKPSYPPTYK at the C-terminus of Mgfp-3.
  • Coacervate is a type of colloid produced by mixing anionic electrolyte polymer and cationic electrolyte polymer at a specific ratio under specific pH conditions. Since the absorbance of the solution increases when the coacetate is formed, the absorbance is mainly measured to determine whether coacetate is formed (V. Ducel et. Al., Colloids and Surfaces a-Physicochemical and Engineering Aspects, 232, 239-247). , 2004).
  • the present inventors confirmed the formation of coacetate by mixing the mussel adhesive protein fp-151 prepared in Example 1-1 with hyaluronic acid as a negative electrolyte polymer.
  • coacervate may be prepared by dissolving mussel adhesive protein and hyaluronic acid at the same 1 wt% in PBS solution (Hyclone) having a pH of 7.2 to 7.4, and then using a mussel adhesive protein and hyaluronic acid in a volume ratio of 7-3.
  • the non-condensed coacervate form can be suspended together with the stem cells to produce a condensed form, as well as by floating the stem cells with mussel adhesive protein solution and then mixing the hyaluronic acid solution in a volume ratio. It can also be produced by condensing the coacervate formed. Thereafter, the coacervate collected by cells was condensed by using a centrifuge at 150 g for 3 minutes to finally produce a stem cell carrier.
  • the present inventors observed the survival of stem cells (ASC and MSC) captured in the coacervate after one week in various environments.
  • Normal oxygen NOrmoxia
  • Hypoxia consists of 1% oxygen, 5% carbon dioxide, 84% controlled gas, and Anoikis.
  • Environment is 200 ⁇ M of hydrogen peroxide added to Normoxia.
  • Surviving cells were stained green and dead cells stained red.
  • Stem cell survival results are shown in Figure 3, Figure 4 is a graphical representation of the results.
  • Comparative Group 1 the stem cells not collected in coacervate did not adhere to the cells as a result of experiments on a low oxygen environment, the surface difficult to adhere to the cells, no cells were observed.
  • Comparative Group 2 stem cells that were not collected in coacervate were cultured on a surface with sufficient oxygen and easy cell attachment, and the cells survived well.
  • Experimental group 1 was confirmed that the cells survive well as a result of culturing the stem cells collected in coacervate on the surface with sufficient oxygen and easy cell attachment.
  • Experiment group 2 was able to confirm that the cells survive well even though the cells collected in coacervate were cultured on a surface that lacked oxygen and difficult to adhere to cells.
  • the present inventors confirmed the stem cell capacity of the mussel adhesive protein based coacetate-stem cell transporter of the present invention.
  • the present inventors confirmed the expression of SOX2 and OCT4, genes related to stem cell differentiation ability of the mussel adhesion protein-based coacervate-stem cell transporter of the present invention.
  • genes related to induction of neovascularization such as VEGF and FGF2 in cells collected in coacervate were compared.
  • the primer information used for gene amplification in the above experiments was as follows (GAPDH was used as the housekeeping gene):
  • Forward primer (SEQ ID NO: 4) 5'-GTTACCAGGGCTGCCTTCTC-3 'and reverse primer (SEQ ID NO: 5) 5'-GATGGTGATGGGTTTCCCGT-3';
  • rat hypoxia inducible factor-1 ⁇ (HIF-1 ⁇ ; accession number: NM_024359)
  • Forward primer (SEQ ID NO: 8) 5'-AGCAATTCTCCAAGCCCTCC-3 'and reverse primer (SEQ ID NO: 9) 5'-TTCATCAGTGGTGGCAGTTG-3';
  • VEGF vascular endothelial growth factor
  • Forward primer (SEQ ID NO: 10) 5'-GCAGCATAGCAGATGTGAA-3 'and reverse primer (SEQ ID NO: 11) 5'- TGAACGCTCCAGGATTTA -3';
  • FGF-2 rat fibroblast growth factor-2
  • rat octamer-binding transcription factor-4 (OCT-4; accession number: NM_001009178)
  • Forward primer (SEQ ID NO: 16) 5'- CAAGGGAATTGGGAGGGGTG -3 'and reverse primer (SEQ ID NO: 17) 5'- TTCATCGCCCGGAGTCTAGT -3'.
  • PCR amplified the gene by repeating denaturation (95 ° C., 10 sec), annealing (60 ° C., 15 sec), and extension (72 ° C., 20 sec) in total 40 times.
  • stem cells were injected into the subcutaneous rats, and the distribution of cells was confirmed for two weeks through an animal luminescence imaging analyzer. At this time, the stained stem cells were used for analysis.
  • tissue sites observed in FIG. 12 were sectioned and compared with the fluorescent stained stem cells injected per unit area.
  • the cell carrier according to the present invention can be usefully used as a cell therapeutic agent for damaged vascular tissue regeneration as well as a composite support for tissue engineering for vascular regeneration.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Transplantation (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Dispersion Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Inorganic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Composite Materials (AREA)
  • Materials Engineering (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 신규한 줄기 세포 전달체 및 이의 제조 방법에 관한 것으로, 홍합 접착 단백질 또는 이의 변이체에 음이온성 고분자가 혼합되어 형성된 코아세르베이트(coacervate)와 줄기 세포를 접촉시키는 단계를 포함하는 줄기 세포 전달체의 제조 방법을 제공한다. 본 발명은 가교된 코아세르베이트를 이용하여 접착성 있는 세포 전달체를 형성함으로써 세포를 포집된 상태로 전달하는 새로운 줄기세포 치료제 플랫폼에 관한 것으로, 본 발명의 세포 전달체는 생체적합성은 물론 줄기세포의 분화능을 유지할 수 있으며 산소가 부족한 조건에서도 세포 부착성을 잃어버리지 않고 생존할 수 있다. 뿐만 아니라, 저산소 환경에서 유발되는 물질대사적 반응, 특히 신생 혈관 형성을 유도하여, 혈관 재생이 용이하지 않은 생체조직에 적용하여 재생시킬 수 있는 효과가 우수하다.

Description

신규한 줄기 세포 전달체 및 이의 제조 방법
본 발명은 신규한 줄기 세포 전달체 및 이의 제조 방법에 관한 것이다.
줄기세포를 이용한 난치병 정복은 현세기 생명과학계의 중요한 과제로 심혈관계, 신경계, 혈액을 비롯한 대부분의 의학분야에서 주목 받고 있다. 특히, 치료가 불가능하다고 간주된 퇴행성 질환에도 줄기세포를 통한 치료요법을 적용함으로써, 많은 긍정적인 결과를 도출하고 있다. 이러한 결과로부터, 줄기세포 이용은 약물 및 수술 위주의 임상치료에 획기적인 변화를 가져 올 수 있는 첨단 의료기술로 평가되고 있다.
그러나, 줄기세포만을 단일적으로 사용하여 시행되는 시술법은 임상적 결과에 의해 다양한 문제점들이 지적되어 왔는데, 가장 크게 대두된 문제점으로는 타겟성과 효율성에 관한 것이다.
상세하게는 종래의 주입하는 형태의 치료제의 경우, 목표로 하고자 하는 부위에 정확히 전달이 안될 수도 있다는 문제점과 함께, 주입된 세포들이 흩어질 우려가 있어 자리잡고 분화하기까지 어려움이 있다는 결과가 연구에 의해 밝혀졌다.
이에 따라, 줄기세포 전달의 효율성 문제를 해결하기 위한 연구로서, 안정한 형태로 치료하고자 하는 부위에 정확히 전달할 수 있는 방법에 대한 연구가 각계 연구분야 협력을 통해 진행되고 있다.
이러한 노력의 일환으로서, 줄기세포에 조직공학적 기술을 접목한 하이브리드형의 조직공학제제가 활발히 연구되고 있다. 상기 조직공학제제란 줄기세포에 전달 매개체를 도입하는 방법으로 생체적합성이 우수한 물질을 적합한 형태로 취한 후, 줄기세포를 배양하여 시술이 필요한 부위에 적용하는 것을 말한다. 이러한 조직공학제제는 질환부위에 따라 다양한 형태로 제작될 수 있다.
또한, 줄기세포가 손상된 조직을 치유하는 치료제로 사용되기 위해서는 손상 조직까지 세포 유실을 최소화하여 잘 전달되어야 할 뿐만 아니라 줄기세포가 지속적으로 분화능을 유지하는 것이 필수적이다. 뿐만 아니라, 줄기세포 치료를 필요로 하는 만성 질환의 경우 손상된 조직이 괴사되어 있을 뿐만 아니라 조직 주변의 혈관 또한 손상된 경우가 많으므로 혈액의 유입이 적다. 이는 물질 대사를 위해 필요한 산소가 부족한 환경이기 때문에 세포가 생존하기 어렵다. 그리하여, 줄기세포 치료를 위한 세포전달체는 생체적합성은 물론, 표적 손상 조직까지 쉽게 전달될 수 있고, 세포 유실을 최소화하며 줄기세포의 생존과 분화능 유지를 할 수 있어야 한다. 뿐만 아니라 줄기세포와 세포 전달체는 손상 조직과 잘 융화되기 위해서는 세포 전달체 주변으로 혈관 맥관 구조를 잘 형성할 수 있어야 한다. 이처럼, 만성 질환을 치유하기 위한 세포 전달체를 개발하기 위해서는 앞서 언급한 다양한 조건들을 충족시켜야 하기 때문에 개발이 지연되고 있다
한편, 코아세르베이트는 음이온성 고분자 전해질과 양이온성 고분자 전해질이 특정 조건에서 혼합되었을 때 형성되는 콜로이드 물질의 일종으로, 코아세르베이트가 형성되었을 때 용액의 흡광도는 증가하게 되고, 용액 상에서 동그란 구 형태로 외부 용액과 분리되어 존재한다. 코아세르베이트 형성 시, 참여 전해질은 용액에서 분리되어 응축되고 여전히 액상을 띠게 되며, 이때 표면장력이 줄어들고 점성이 늘어나는 등, 물성도 변화한다. 코아세르베이트는 단백질과 그 반대 성질을 띠는 고분자 전해질과의 혼합을 통해서도 일어날 수 있다 (C.G. deKruif 등, 2004, Current Opinion in Colloid and Interface Science 9, 340-349). 코아세르베이트의 낮은 표면장력에 기인해 약물, 효소, 세포, 식품첨가물 등의 기능성 물질을 미세캡슐 안에 고정화 하는데 쓰이는 기술도 보고되어 있다. (Schmitt C. 등, 1998, Critical Review in Food Science and Nutrition 8, 689-753).
해양 생명체인 홍합(mussel)은 접착 단백질들(adhesive proteins)을 생산, 분비함으로써 홍합 자신을 바다 속의 바위와 같은 젖은 고체표면에 단단히 부착할 수 있어, 파도의 충격이나 바닷물의 부력 효과에 영향을 받지 않는다 (J.H. Waite 등, 1983, Biological Review 58, 209-231; H.J. Cha 등, 2008, Biotechnology Journal 3,631-638). 이러한 홍합 접착 단백질은 현재 알려진 화학 합성 접착제와 비교하였을 때 강력한 자연 접착제로 알려져 있으며, 대부분 에폭시 수지보다 약 두 배 정도의 높은 인장강도를 나타내면서도 휘어질 수 있는 유연성을 가지고 있다. 또한 홍합 접착 단백질은 플라스틱, 유리, 금속, 테플론 및 생체물질 등의 다양한 표면에 접착할 수 있는 능력을 가지고 있으며, 젖은 표면에 몇 분 안에 붙을 수 있다. 이러한 특성은 아직까지 화학접착제 분야에서는 미완의 과제로 남아있다. 또한, 접착 단백질은 인간세포를 공격하거나 면역반응을 일으키지 않는 것으로 알려져 수술시 생체조직의 접착이나 부러진 치아의 접착 등의 의료분야에 응용 가능성이 크다 (J. Dove 등, 1986, Journal of American Dental Association 112, 879). 특히, 상기 홍합 접착 단백질은 세포의 표면 접착 기술 분야에도 이용될 수 있는데, 세포의 표면 접착 기술은 세포 배양 및 조직 공학 분야에 필요한 매우 중요한 기술 중의 하나로서, 세포 및 조직 배양을 위해 세포를 세포배양 표면에 효율적으로 접착시킬 수 있는 기술이므로 특정 세포의 전달, 포집, 증식 및 분화를 촉진시키는 데 매우 중요하다
따라서, 양이온성 단백질, 특히, 홍합 접착 단백질 기반의 코아세르베이트를 이용한 줄기세포 전달체의 개발은 효율적으로 생체 조직을 치유할 수 있는 해결책이 될 수 있을 것이다.
이러한 상황 하에서, 본 발명자들은 효율적인 줄기 세포 전달체를 개발하고자 예의 노력하였다. 그 결과, 본 발명자들은 특정 담체로서 양이온성 홍합 접착 단백질과 음이온성 고분자 중 히알루론산과 혼합하여 형성시킨 코아세르베이트에 줄기세포를 삽입하여 세포 전달체를 제작하고, 이를 생체에 이식하였을 때, 상기 줄기세포의 생체 내 전달 및 포집성이 탁월하게 증가된 동시에 상기 줄기세포로부터 활성 물질이 분비되어 원하는 치료 효과를 얻을 수 있다는 것을 확인함으로써 본 발명을 완성하였다.
따라서, 본 발명의 일 목적은 홍합 접착 단백질 또는 이의 변이체에 음이온성 고분자가 혼합되어 형성된 코아세르베이트에 줄기 세포를 접촉시키는 단계를 포함하는 줄기 세포 전달체의 제작 방법을 제공하는 데 있다.
또한, 본 발명의 다른 목적은 상기 방법에 따라 제조된 줄기 세포 전달체를 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 상기 줄기 세포 전달체를 포함하는 줄기세포 치료제를 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 상기 줄기 세포 전달체를 포함하는 혈관조직 재생용 또는 또는 혈관 이상 관련 질환의 치료용 약학적 조성물을 제공하는 데 있다.
또한, 본 발명의 또 다른 목적은 상기 줄기 세포 전달체를 포함하는 조성물을 대상에게 투여하는 단계를 포함하는 혈관 조직 재생용 또는 혈관 이상관련 질환의 치료 방법을 제공하는 데 있다.
이하, 본 발명에 대하여 보다 상세히 설명한다.
이때, 여기서 사용되는 기술 용어 및 과학 용어에 있어서 다른 정의가 없다면, 이 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 통상적으로 이해하고 있는 의미를 가진다.
또한, 종래와 동일한 기술적 구성 및 작용에 대한 반복되는 설명은 생략하기로 한다.
본 발명의 일 양태에 따르면, 본 발명은 홍합 접착 단백질 또는 이의 변이체에 음이온성 고분자가 혼합되어 형성된 코아세르베이트(coacervate)에 줄기 세포를 접촉시키는 단계를 포함하는 줄기 세포 전달체의 제조 방법 및 이에 따라 제조된 줄기 세포 전달체를 제공한다.
본 발명의 바람직한 구현예에 따르면, 본 발명에 따른 줄기 세포 전달체는, 줄기 세포를 함유하는 세포치료용 세포 전달체로서, 줄기 세포를 코아세르베이트로 이루어진 담체의 내부에 삽입시켜 형성된, 즉, 코아세르베이트의 내부에 줄기세포가 봉입된 세포 전달체인 것을 특징으로 한다. 상기 세포 전달체는 목표 부위가 직접 접촉하지 않는 생체 내의 다른 부위에 이식되며; 상기 세포 전달체가 생체에 이식되었을 때, 상기 담체에 의하여 상기 이식 부위로부터의 포집된 줄기 세포의 생체 내 이동이 억제된다.
본 발명에서 홍합 접착 단백질은 홍합에서 유래된 접착 단백질로, 이에 한정되지 않지만 바람직하게는 국제특허공개 제WO2006/107183호 또는 제WO2005/092920호에 기재된 모든 홍합 접착 단백질을 포함한다.
본 발명의 바람직한 구현예에 따르면, 상기 홍합 접착 단백질 또는 이의 변이체는, 서열번호 1, 서열번호 2 및 서열번호 3의 아미노산 서열로 이루어진 군에서 선택된 아미노산 서열로 이루어진 단백질; 또는 상기 군에서 선택된 1 종 이상의 아미노산 서열이 연결된 융합 단백질일 수 있으며, 보다 바람직하게는 서열번호 1, 서열번호 2 및 서열번호 3의 아미노산 서열로 이루어진 군에서 선택된 아미노산 서열로 이루어진 단백질일 수 있고, 가장 바람직하게는 서열번호 1의 아미노산 서열로 이루어진 단백질이다.
본 발명에서 홍합 접착 단백질의 변이체(mutants)는 바람직하게는 홍합 접착 단백질의 접착력을 유지하는 전제 하에 상기 홍합 접착 단백질의 카르복실말단이나 아미노말단에 추가적인 서열을 포함하거나 일부 아미노산이 다른 아미노산으로 치환된 것일 수 있다. 보다 바람직하게는 상기 홍합 접착 단백질의 카르복실말단 또는 아미노말단에 RGD를 포함하는 3 내지 25개의 아미노산으로 이루어진 폴리펩타이드가 연결된 것이거나 홍합 접착 단백질을 이루는 타이로신 잔기 총수의 1 내지 100%, 바람직하게는 5 내지 100%가 3,4-디하이드록시페닐-L-알라닌(DOPA)로 치환된 것일 수 있다.
상기 RGD를 포함하는 3 내지 25개의 아미노산은 이에 한정되지 않지만 바람직하게는 RGD(Arg Gly Asp), RGDS(Arg Gly Asp Ser), RGDC(Arg Gly Asp Cys), RGDV(Arg Gly Asp Val), RGDSPASSKP(Arg Gly Asp Ser Pro Ala Ser Ser Lys Pro), GRGDS(Gly Arg Gly Asp Ser), GRGDTP(Gly Arg Gly Asp Thr Pro), GRGDSP(Gly Arg Gly Asp Ser Pro), GRGDSPC(Gly Arg Gly Asp Ser Pro Cys) 및 YRGDS(Tyr Arg Gly Asp Ser)로 이루어진 군에서 선택된 일종 이상일 수 있다.
상기 홍합 접착 단백질의 카르복실말단 또는 아미노말단에 RGD를 포함하는 3 내지 25개의 아미노산으로 이루어진 폴리펩타이드가 연결된 홍합 접착 단백질의 변이체는 이에 한정되지 않지만 바람직하게는 서열번호 2의 아미노산 서열로 이루어진 폴리펩타이드일 수 있다.
본 발명에서의 상기 홍합 접착 단백질은 이에 한정되지 않지만 바람직하게는 외부 유전자를 발현할 수 있는 용도로 제작된 통상의 벡터에 발현 가능하도록 삽입하여, 유전공학적인 방법으로 대량 생산할 수 있다. 상기 벡터는 단백질을 생산하기 위한 숙주세포의 종류 및 특성에 따라 적절히 선택하거나, 신규로 제작할 수 있다. 상기 벡터를 숙주세포에 형질전환하는 방법 및 형질전환체로부터 재조합 단백질을 생산하는 방법은 통상의 방법으로 용이하게 실시할 수 있다. 상기한 벡터의 선택, 제작, 형질전환 및 재조합 단백질의 발현 등의 방법은, 본원발명이 속하는 기술분야의 당업자라면 용이하게 실시할 수 있으며, 통상의 방법에서 일부의 변형도 본원발명에 포함된다.
본 발명에서 음이온성 고분자는 상기 양이온성인 홍합 접착 단백질과 결합하여 코아세르베이트를 형성할 수 있는 고분자 물질이라면 제한없이 사용될 수 있으나, 바람직하게는 상기 양이온성인 홍합 접착 단백질의 pI(Isoelectric point)보다 낮은 고분자, 더 바람직하게는 pI 수치가 2 내지 6인 고분자, 보다 더 바람직하게는 pI 수치가 2 내지 4인 고분자일 수 있다. 상기 pI 수치를 초과하거나 미만인 경우 코아세르베이트가 형성되기 어려우므로 상기 pI 범위내의 음이온성 고분자를 사용하는 것이 바람직하다.
본 발명에서 음이온성 고분자는 예를 들면, 히알루론산(hyaluronic acid), 페레독신(ferredoxin), 폴리스티렌술폰산(poly styrene sulfonic acid), 아라비아 검(gum arabic), 젤라틴(gelatin), 알부민(albumin), 카보폴(carbopol), 고 또는 저 메톡실 펙틴(high or low methoxyl pectin), 카르복시메틸 구아검 나트륨(sodium carboxymethyl guar gum), 잔탄 검(xanthan gum), 유청 단백질(whey protein), 레구민(faba bean legumin), 카르복시메틸 셀룰로오스(carboxymethyl cellulose), 알긴산(alginate), 캐러지넌(carrageenan), 헥사메타인산 나트륨(sodium hexametaphosphate), 카제인 나트륨(sodium casinate), 헤모글로빈(hemoglobin), 헤파린(heparin) 및 세포외 다당체 B40(exopolysaccharide B40)으로 이루어진 군에서 선택된 하나 이상일 수 있으며, 상기 음이온성 고분자의 평균 분자량은 이에 한정되지 않지만 바람직하게는 1kDa 내지 300kDa으로 이루어진 군에서 선택된 분자량을 가질 수 있으며 보다 바람직하게는 10kDa 내지 100kD, 더 바람직하게는 17kDa 내지 59kDa, 가장 바람직하게는 17kDa, 35kDa 또는 59kD의 분자량을 가질 수 있다. 상기 분자량을 초과하거나 미만인 경우 코아세르베이트가 형성되지 않을 수 있기 때문이다.
본 발명의 줄기세포 전달체는 목적하는 효과를 달성할 수 있는 한 1 종 이상의 생체 활성물질을 추가적으로 포함할 수 있다. 상기 생체 활성물질은 생체에 투여되거나 피부 표면에 도포할 경우 일정한 약리 활성을 나타내는 물질로, 이에 한정되지 않지만 바람직하게는 약물, 효소, 세포 및 식품첨가물로 이루어진 군에서 선택된 1 종 이상일 수 있으며, 보다 바람직하게는 항암제, 항생제, 항염증제, 호르몬, 호르몬 길항제, 인터루킨, 인터페론, 성장 인자, 종양 괴사 인자, 엔도톡신, 림포톡시, 유로키나제, 스트렙토키나제, 조직 플라스미노겐 활성제, 프로테아제 저해제, 알킬포스포콜린, 방사선 동위원소 표지 물질, 계면활성제, 심혈관계 약물, 위장관계 약물 및 신경계 약물로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
또한, 본 발명의 세포 전달체의 홍합 접착 단백질과 음이온성 고분자는 pH 2.0 내지 pH 10.0에서 1:0.01 내지 100의 중량비로 혼합되어 형성될 수 있다.
상기 혼합은 홍합 접착 단백질 또는 이의 변이체에 음이온성 고분자 및 줄기세포를 동시에 혼합하는 경우를 의미하거나 보다 바람직하게는 홍합 접착 단백질 또는 이의 변이체와 음이온성 고분자중 어느 하나가 녹아있는 용액에 줄기세포를 혼합하고, 이후 코아세르베이트 형성을 유도하기 위해 홍합 접착 단백질 또는 이의 변이체와 음이온성 고분자중 나머지 하나를 추가 혼합하는 경우를 의미한다.
상술한 바와 같이 상기 홍합 접착 단백질 및 음이온성 고분자에 의해 형성된 코아세르베이트가 줄기세포 주위에 피막을 형성하도록 한다.
또한, 홍합 접착 단백질 또는 이의 변이체와 음이온성 고분자는 이에 한정되지 않지만 바람직하게는 적정 pH로 설정된 용매에 0.0001 내지 50 중량%로 혼합할 수 있다. 또한 상기 혼합시 줄기세포는 이에 한정되지 않지만 바람직하게는 적정 pH로 설정된 용매에 부피대비 0.01 내지 20%(v/v), 보다 더 바람직하게는 0.1 내지 2%(v/v)로 혼합하는 것이 바람직하다.
상기 줄기세포 전달체를 제조하기 위한 용매의 종류, 적정 pH, 적정 온도는 코아세르베이트가 효과적으로 형성될 수 있는 공지된 조건과 동일하다.
본 명세서에서 사용되는 용어 "줄기세포"는, 자기복제능력을 가지면서 두 개 이상의 세포로 분화하는 능력을 갖는 세포를 말하며, 만능줄기세포(totipotent stem cell), 전분화능 줄기세포(pluripotent stem cell), 다분화능 줄기세포(multipotent stem cell)로 분류할 수 있다.
본 발명의 줄기세포는 목적에 따라 적절히 제한 없이 선택될 수 있으며, 인간을 포함한 포유동물, 바람직하게는 인간으로부터 유래된 공지된 모든 조직, 세포 등의 성체 세포로부터 유래할 수 있으며, 예를 들어, 골수, 제대혈, 태반(또는 태반 조직세포), 지방(또는 지방조직 세포) 등으로부터 유래할 수 있다.
예컨대, 상기 줄기세포는 골수, 지방 조직, 근육 조직, ex vivo 배양된 자기조직 간엽 줄기 세포, 동종 이계 간엽 줄기 세포, 제대혈, 배 난황낭, 태반, 제대, 골막, 태아 및 사춘기 피부, 그리고 혈액으로부터 제한없이 얻어지는 줄기세포일 수 있으며, 태아 또는 출생직후 또는 성인으로부터 유래된 줄기세포일 수 있다.
본 발명의 줄기세포는 목적하는 효과를 달성할 수 있는 한 줄기세포의 종류를 제한하지 않으나, 바람직하게는 상기 줄기세포는 지방 줄기 세포 (Adipose Stem Cell, ASC), 중간엽 줄기 세포(Mesenchymal Stem Cell, MSC), 골수줄기세포, 제대혈줄기세포, 신경줄기세포 및 유도만능줄기세포로 이루어진 군에서 선택된 줄기세포일 수 있고, 가장 바람직하게는 지방 줄기 세포 (Adipose Stem Cell, ASC) 또는 중간엽 줄기 세포(Mesenchymal Stem Cell, MSC)일 수 있다.
이식된 줄기 세포의 3차원 배양 및 생착 및 특정 세포로의 분화를 유도하기 위해서는, 이식 후 포집된 상태로 높은 세포 밀도를 유지하는 것이 중요하다. 세포-세포간 상호작용과 세포-기질간 상호작용이 관여하여 접착이 유도되면 세포들끼리 3차원 세포집합체를 형성하면서 증식할 수 있는 환경을 만들어 주어야 한다.
이에 본 발명자들은 3차원 세포집합체 형태로 세포 배양을 유도하기 위해서 세포-세포간 및 세포-기질간 상호작용할 수 있도록 높은 세포 밀도를 유지하는 방법을 개발한 것이다.
따라서, 본 발명의 세포 전달체는 줄기세포의 생존율, 증식능, 분화능 및 혈관신생능으로 이루어진 군으로부터 선택된 1 종 이상의 줄기세포능을 향상시킴으로써 원하는 치료 및/또는 재생 효과를 달성한다.
본 발명의 다른 양태에 따르면, 본 발명은 상기 줄기 세포 전달체를 포함하는 줄기세포 치료제 또는 상기 줄기 세포 전달체를 포함하는 혈관 조직 재생용 또는 혈관 이상 관련 질환의 치료용 약학적 조성물을 제공한다.
본 명세서에서 사용되는 용어 "세포 치료제"는, 세포와 조직의 기능을 복원하기 위하여 살아 있는 자가(autologous), 동종(allogenic), 이종(xenogenic) 세포를 체외에서 증식, 선별하거나 여타 방법으로 세포의 생물학적 특성을 변화시키는 등 일련의 행위를 통하여 치료, 진단, 예방 목적으로 사용되는 의약품을 말하며, 특히 "줄기세포 치료제" 배아줄기세포 치료제와 성체줄기세포 치료제로 분류할 수 있다.
상기 줄기세포 치료제는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 인체에 투여될 수 있다.
비경구 투여, 예를 들어 복강 내 투여, 정맥내 투여, 근육내 투여, 피하 투여될 수 있으나, 이에 제한되지는 않는다.
상기 줄기세포 치료제는 또한 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다. 줄기세포 치료에 일반적으로 사용되는 약제학적 담체와 함께 투여될 수 있으며, 이런 담체로 생리학적 식염수를 예로 들 수 있다.
본 발명의 줄기세포 치료제는 혈관 이상 관련 질환들(예컨대, 혈관신생 부전-연관 질환)의 세포 치료에 직접적 혹은 간접적으로 적용할 수 있다.
상기 혈관신생 부전-연관 질환은 당뇨병성 궤양; 괴저; 치유를 위해 혈관신생이 요구되는 상처; 뷰르그병; 고혈압; 뇌혈관 허혈, 신장 허혈, 폐 허혈, 지절 허혈 및 허혈성 심근경색을 포함하는 허혈성 질환; 폐색성 혈관 질환; 및 심혈관 질환으로 구성된 군으로부터 선택될 수 있다.
또한, 본 발명의 조성물은 이에 한정되지 않지만 바람직하게는 약학적 조성물의 형태일 수 있다.
본 발명의 조성물은, 조성물 총 중량에 대하여 상기 코아세르베이트를 0.0001 내지 50 중량%로 포함한다. 본 발명의 조성물은 상기 유효성분에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수있다.
본 발명의 조성물은, 투여를 위해서 상기 기재한 코아세르베이트 이외에 추가로 약제학적으로 허용 가능한 담체를 1 종이상 포함하여 제조할 수 있다. 약제학적으로 허용 가능한 담체는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올, 리포좀 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있으며, 표적 기관에 특이적으로 작용할 수 있도록 표적기관 특이적 항체 또는 기타 리간드를 상기 담체와 결합시켜 사용할 수 있다. 더 나아가 당해 기술분야의 적정한 방법으로 또는 레밍턴의 문헌(Remington's Pharmaceutical Science(최근판), Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제제화할 수 있다.
상기 조성물은 정맥내(intravein), 복막내(intraperitoneal), 근육내 (intramuscular), 피하내(subcutaneous), 피내(intradermal), 비내(nasal), 점막내(mucosal), 흡입(inhalation) 및 경구(oral) 등의 경로로 주입함으로써 생체 내 전달될 수 있다. 투여량은 대상의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다. 일일 투여량은 약 0.1 내지 100 ㎎/㎏ 이고, 바람직하게는 0.5 내지 10 ㎎/㎏ 이며, 하루 일회 내지 수회에 나누어 투여하는 것이 더욱 바람직하다.
본 발명의 또 다른 양태에 따르면, 상기 줄기 세포 전달체를 포함하는 조성물을 대상에게 투여하는 단계를 포함하는 혈관 조직 재생용 또는 혈관 이상관련 질환의 치료 방법을 제공한다.
본 발명의 방법은 상술한 조성물을 이용하므로, 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명은 가교된 코아세르베이트를 이용하여 접착성 있는 세포 전달체를 형성함으로써 세포를 포집된 상태로 전달하는 새로운 줄기세포 치료제 플랫폼에 관한 것으로, 본 발명의 세포 전달체는 생체적합성은 물론 줄기세포의 분화능을 유지할 수 있으며 산소가 부족한 조건에서도 세포 부착성을 잃어버리지 않고 생존할 수 있다. 뿐만 아니라, 저산소 환경에서 유발되는 물질대사적 반응, 특히 신생 혈관 형성을 유도하여, 혈관 재생이 용이하지 않은 생체 조직에 적용하여 빠른 재생을 유도할 수 있다.
도 1은 코아세르베이트 내에 포집될 수 있는 세포 농도와 포집 효율과의 관계를 나타낸 도이다.
도 2는 코아세르베이트 내에 포집된 줄기세포의 형태를 현미경을 통해 관찰한 도이다. 스케일 바는 50 μm이다.
도 3은 다양한 환경에서 코아세르베이트 내에 포집된 줄기 세포의 생존 유무를 일주일이 경과한 뒤에 관찰한 실험사진을 나타낸 도이다
도 4는 도 3에 개시된 코아세르베이트 내에 포집된 줄기 세포의 생존 유무를 수치화하여 나타낸 도이다.
도 5는 저 산소 조건에서 줄기 세포 생존과 사멸을 시간에 따라 관찰한 실험사진을 나타낸 도이다.
도 6은 도 5의 결과를 그래프화하여 나타낸 도이다.
도 7은 줄기세포 분화능 유지를 확인한 도이다.
도 8은 줄기세포 분화능과 관련된 유전자인 SOX2와 OCT4의 발현을 확인한 도이다.
도 9는 코아세르베이트 내에 포집되어 있는 세포에서 Hypoxia inducible factor 1α 유전자 발현양을 상대적으로 비교한 그래프를 나타낸 도이다.
도 10은 코아세르베이트 내에 포집되어 있는 세포에서 VEGF, FGF2 와 같은 신생혈관 유도와 관련된 유전자의 발현양을 상대적으로 비교한 그래프이다.
도 11은 쥐의 대동맥을 잘라 각각의 실험군을 처리하여 신생혈관 형성 정도를 확인한 도이다.
도 12는 쥐의 피하에 줄기세포 전달체를 주입하고 동물 발광 영상 분석기를 통해 2주 동안 세포의 분포를 확인한 도이다.
도 13은 도 12에서 관측한 조직 부위를 절편화하여 단위 면적당 주입한 형광 염색된 줄기세포를 비교한 도이다.
도 14는 도 12에서 관측한 조직 부위를 절편화하여 H&E staining을 통해 면역반응과 혈관 형성을 확인한 도이다.
도 15는 쥐 피하에 줄기세포 전달체를 주입하여 2주 경과 후 조직에서 줄기세포의 분화능과 관련된 단백질 발현정도를 확인한 도이다.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. 재조합 홍합접착 단백질의 제작
1-1. 재조합 홍합접착 단백질 fp-151의 제작
본 발명에서 사용한 홍합 접착 단백질 fp-151(서열번호 1)은 자연에 존재하는 홍합 접착 단백질 fp-1 중에서 80번 정도 반복되는 10개의 아미노산으로 구성된 데카펩타이드(decapeptide)가 대장균에서 발현될 수 있도록 6개의 데카펩타이드로 이루어진 fp-1 변이체를 합성하고 2 개의 fp-1 변이체 사이에 Mgfp-5의 유전자(Genbank No. AAS00463 또는 AY521220)를 넣은 후, 대장균에서 생산한 것이다 (D.S. Hwang et. al., Biomaterials 28, 3560-3568, 2007).
구체적으로 fp-1 (Genbank No. Q27409 또는 S23760)의 아미노산 서열에서, AKPSYPPTYK로 이루어진 펩타이드가 6회 반복 연결된 fp-1 변이체(이하, 6xAKPSYPPTYK라 함)를 제조하고 Mgfp-5의 N-말단에 상기 6xAKPSYPPTYK을 조합하고 또한 Mgfp-5의 C-말단에 6xAKPSYPPTYK를 조합하여 서열번호 1의 fp-151을 제조하였다. 상기 홍합 접착 단백질의 구체적 제조는 국제특허공개 제WO2006/107183호 또는 제WO2005/092920호에 나타낸 바와 동일하며, 상기 특허 문헌은 전체로서 참고문헌으로 본 발명에 포함된다.
1-2. 재조합 홍합접착 단백질 fp-151-RGD의 제작
상기 실시예 1-1의 fp-151의 C-말단에 피브로넥틴(fibronectin) RGD 그룹에서 선택된 GRGDSP 서열을 추가하여 서열번호 2의 fp-151-RGD를 제조하였다.
1-3. 재조합 홍합 접착 단백질 fp-131의 제작
홍합 접착 단백질 fp-131은 상기 실시예 1-1의 fp-151과 마찬가지 방식으로 2개의 fp-1 변이체 사이에 자연에 존재하는 홍합 접착 단백질 Mgfp-3A의 유전자(Genbank No. BAB16314 또는 AB049579)를 넣은 후, 대장균에서 생산한 것이다.
구체적으로 fp-1 (Genbank No. Q27409 또는 S23760)의 아미노산 서열에서, AKPSYPPTYK로 이루어진 펩타이드가 6회 반복 연결된 fp-1 변이체(이하, 6xAKPSYPPTYK라 함)를 제조하고 Mgfp-3의 N-말단에 상기 6xAKPSYPPTYK을 조합하고 또한 Mgfp-3의 C-말단에 6xAKPSYPPTYK를 조합하여 서열번호 3의 fp-131을 제조하였다.
실시예 2. 홍합 접착 단백질 기반 코아세르베이트(coacervate)의 제조
코아세르베이트(coacervate)는 특정 pH조건에서 특정 비율로 음이온성 전해질 고분자와 양이온성 전해질 고분자를 혼합함으로써 생성된 콜로이드의 일종이다. 상기 코아세르베이트가 형성되면 용액의 흡광도가 증가되기 때문에 코아세르베이트의 형성 여부를 확인하기 위해 주로 흡광도를 측정하게 된다(V. Ducel et. al., Colloids and Surfaces a-Physicochemical and Engineering Aspects, 232, 239-247, 2004).
본 발명자들은, 상기 실시예 1-1에서 제조된 홍합 접착 단백질 fp-151과 음가 전해질 고분자인 히알루론산을 혼합하여 코아세르베이트의 형성을 확인하였다.
구체적으로 30 kDa의 분자량을 지닌 히알루론산을 1% (w/v) 농도로 Phosphate-buffered saline 용액 (Hyclone 사)에 녹이고, 상기와 동일한 용액에 녹인 홍합 접착 단백질 fp-151을 용질(홍합 접착 단백질 및 히알루론산) 부분에서 차지하는 비율을 10%(w/w)씩 상승시키면서 혼합하였고, 그 결과 코아세르베이트가 형성됨을 확인하였다.
실시예 3. 홍합 접착 단백질 기반 코아세르베이트-줄기세포 전달체의 제작 및 확인
본 발명자들은 실시예 2에서 제작된 홍합 접착 단백질 기반 코아세르베이트를, Mesenchymal Stem Cell Medium (Sciencell사 #7501) 배지에 미리 배양된 중간엽 줄기 세포 1 X 103 내지 1 X 105 cells와 첨가하여, 줄기세포가 홍합 접착 단백질 기반 코아세르베이트로 감싸여진 형태의 세포 전달체를 얻었다. 구체적으로, 코아세르베이트는 홍합 접착 단백질과 히얄루론산을 동일한 1 중량 %로 pH 7.2~7.4인 PBS solution (Hyclone 사)에 녹인 뒤 홍합 접착 단백질과 히얄루론산의 7 대 3의 부피비로 제작할 수 있다. 줄기세포 전달체를 제작함에 있어, 응축되지 않은 코아세르베이트 형태를 줄기세포와 함께 부유시킨 뒤 응축된 형태를 제작할 수 있을 뿐만 아니라, 홍합 접착 단백질 용액으로 줄기세포를 부유시킨 뒤 히알루론산 용액을 부피비로 혼합하여 형성되는 코아세르베이트를 응축시켜 제작할 수도 있다. 이후 150 g로 3분간 원심분리기를 이용하여 밀도에 의해 세포가 포집된 코아세르베이트를 응축시켜 줄기세포 전달체를 최종적으로 제작하였다.
이에 코아세르베이트 내에 포집될 수 있는 세포 농도와 포집 효율을 확인하였다.
그 결과, 도 1에 나타낸 바와 같이, 코아세르베이트의 낮은 표면 에너지로 세포를 쉽게 포집한 뒤 중력에 의해 세포가 포집된 코아세르베이트를 모을 수 있기 때문에 단위 부피 (1 μL) 당 10,000개의 세포가 포집된 경우에도 98% 이상의 세포 포집 효율을 확인할 수 있었다.
또한, 코아세르베이트 내에 포집된 줄기세포의 형태를 현미경을 통해 관찰하였다.
그 결과, 도 2에 나타낸 바와 같이, 코아세르베이트 형상인 원형 형태의 물방울 안에 세포가 포집되어 단일 세포가 아닌 세포 군집을 형성하고 있는 것을 확인할 수 있었다. 세포의 F-actin와 핵을 염색하여 형광 현미경을 통해 관찰한 결과 세포 군집이 형성되어 있음을 재확인할 수 있었다.
실시예 4. 다양한 환경에서의 홍합 접착 단백질 기반 코아세르베이트-줄기세포 전달체의 생존 확인
본 발명자들은 상기 코아세르베이트 내에 포집된 줄기 세포(ASC 및 MSC)의 생존 유무를, 다양한 환경에서 일주일이 경과한 뒤에 관찰하였다. 산소정상상태(Normoxia)는 기체 20% 산소, 5 % 이산화탄소, 75 % controlled gas로 구성된 것이며, 저산소상태(Hypoxia)는 1% 산소, 5 % 이산화탄소, 84 % controlled gas로 구성된 것이고, 세포사멸(Anoikis) 환경은 200 μM 의 과산화수소가 Normoxia에 첨가된 것이다. 생존한 세포는 초록색, 사멸한 세포는 빨강색으로 염색되는 원리를 이용하였다. 줄기 세포의 생존 유무 결과는 도 3에 나타내었고, 도 4는 상기 결과를 그래프화하여 나타낸 것이다.
그 결과, 도 3 및 도 4에 나타낸 바와 같이, 7 일 경과 후 코아세르베이트 내에 포집된 줄기 세포는 Normoxia의 경우 98%, Hypoxia의 경우 90%, Anoikis 환경의 경우 96%의 생존율을 보였다.
또한, 저산소 조건에서의 지방 유래의 중간엽 줄기세포(한동대학교)와 골수유래의 중간엽 줄기세포(sciencell사)의 생존과 사멸을 시간에 따라 관찰하였다. 그 결과는 도 5에 나타내었고, 도 6은 상기 결과를 그래프화하여 나타낸 것이다.
도 5 및 도 6에 나타낸 바와 같이, 비교군 1의 경우, 코아세르베이트에 포집되지 않은 줄기세포를 저 산소 환경, 세포가 부착하기 힘든 표면에서 실험 결과로 세포가 부착되지 않아 세포가 관찰되지 않았다. 비교군 2의 경우, 코아세르베이트에 포집되지 않은 줄기세포를 산소가 충분하고 세포 부착이 용이한 표면에서 배양한 결과 세포가 잘 생존하는 것을 확인할 수 있었다. 실험군 1은 코아세르베이트 내에 포집된 줄기세포를 산소가 충분하고 세포 부착이 용이한 표면에서 배양한 결과 세포가 잘 생존하는 것을 확인할 수 있었다. 실험군 2는 코아세르베이트 내에 포집된 세포를 산소가 부족하고 세포 부착이 힘든 표면에서 배양하였음에도 불구하고 세포가 잘 생존하는 것을 확인할 수 있었다.
실시예 5. 홍합 접착 단백질 기반 코아세르베이트-줄기세포 전달체의 줄기세포능 유지 확인
본 발명자들은 본 발명의 홍합 접착 단백질 기반 코아세르베이트-줄기세포 전달체의 줄기세포능을 확인하였다.
그 결과, 도 7에 나타낸 바와 같이, 7 일 경과후 일반 배양 조건에서 배양한 줄기세포, Matrigel에 포집한 줄기세포, 코아세르베이트 내에 주입한 줄기세포 모두 분화능을 유지하고 있었다. 특히, 코아세르베이트 내에 주입한 줄기세포의 분화능이 더욱 향상된 것으로 확인되었다. 세포 분화능 유지를 확인하기 위해 사용한 항체는 Sox2와 Oct 4이다.
또한, 본 발명자들은 본 발명의 홍합 접착 단백질 기반 코아세르베이트-줄기세포 전달체의 줄기세포 분화능과 관련된 유전자인 SOX2와 OCT4의 발현을 확인하였다.
도 8에 나타낸 바와 같이, 일반 배양 조건에서 배양한 줄기세포를 기준으로 각각의 유전자 발현 정도를 확인한 결과, 코아세르베이트 내에 포집된 줄기세포의 분화능과 관련된 유전자가 많이 발현됨을 확인할 수 있었다.
또한, 코아세르베이트 내에 포집되어 있는 세포에서 Hypoxia inducible factor 1α 유전자 발현양을 상대적으로 비교하였다.
그 결과, 도 9에 나타낸 바와 같이, 일반적인 배양 플레이트에 배양한 줄기세포에서의 발현수준과 비교하여, 코아세르베이트 내에 포집된 줄기세포가 해당 유전자를 가장 많이 발현함을 확인하였다.
또한, 코아세르베이트 내에 포집되어 있는 세포에서 VEGF, FGF2 와 같은 신생혈관 유도와 관련된 유전자의 발현양을 상대적으로 비교하였다.
그 결과, 도 10에 나타낸 바와 같이, 일반적인 배양 플레이트에 배양한 줄기세포에서의 발현수준과 비교하여, 코아세르베이트 내에 포집된 줄기세포가 해당 유전자를 가장 많이 발현함을 확인하였다.
이상의 실험에서 유전자 증폭을 위해 사용한 프라이머 정보는 다음과 같다(GAPDH를 하우스키핑 유전자로 사용하였다):
- rat GAPDH (accession number: NM_017008.4)
정방향 프라이머(서열번호 4) 5'- GTTACCAGGGCTGCCTTCTC -3' 및 역방향 프라이머(서열번호 5) 5'- GATGGTGATGGGTTTCCCGT -3';
- rat integrin β1 (accession number: NM_017022)
정방향 프라이머(서열번호 6) 5'- ACAAGAGTGCCGTGACAACT -3' 및 역방향 프라이머(서열번호 7) 5'- CTGCAGTAAGCATCCATGTCTTCAC -3′';
- rat hypoxia inducible factor-1α (HIF-1α; accession number: NM_024359)
정방향 프라이머(서열번호 8) 5'- AGCAATTCTCCAAGCCCTCC -3' 및 역방향 프라이머(서열번호 9) 5'- TTCATCAGTGGTGGCAGTTG -3';
- rat vascular endothelial growth factor (VEGF; accession number: NM_001110335)
정방향 프라이머(서열번호 10) 5'- GCAGCATAGCAGATGTGAA -3' 및 역방향 프라이머(서열번호 11) 5'- TGAACGCTCCAGGATTTA -3';
- rat fibroblast growth factor-2 (FGF-2; accession number: NM_019305)
정방향 프라이머(서열번호 12) 5'- CACGTCAAACTACAGCTCCAA -3' 및 역방향 프라이머(서열번호 13) 5'- GACTCCAGGCGTTCAAAGA -3';
- rat octamer-binding transcription factor-4 (OCT-4; accession number: NM_001009178)
정방향 프라이머(서열번호 14) 5'- AAGTTGGCGTGGAGACTCTG -3' 및 역방향 프라이머(서열번호 15) 5'- GGACTCCTCGGGACTAGGTT -3';
- rat SRY (sex determining region Y)-box 2 (SOX-2; accession number: NM_001109181),
정방향 프라이머(서열번호 16) 5'- CAAGGGAATTGGGAGGGGTG -3' 및 역방향 프라이머(서열번호 17) 5'- TTCATCGCCCGGAGTCTAGT -3'.
본 프라이머를 바탕으로 PCR를 진행하였고 그 조건은 다음과 같다:
PCR은 변성(95℃, 10 sec), 어닐링(60℃, 15 sec), 및 연장(72℃, 20 sec)을 총 40회 반복하여 유전자를 증폭하였다.
또한, 쥐의 대동맥을 잘라 각각의 실험군을 처리하여 미세혈관이 형성되는지를 관찰하여 신생혈관을 얼마만큼 형성할 수 있는지를 확인하였다.
그 결과, 도 11에 나타낸 바와 같이, 코아세르베이트를 처리한 실험 군들에서 대동맥 주변으로 미세혈관이 형성되는 것을 확인하였다. 특히 세포를 포집한 코아세르베이트를 처리한 실험군에서 가장 많은 미세혈관을 형성한 것을 확인할 수 있었다.
또한, 쥐의 피하에 줄기세포를 주입하고 동물 발광 영상 분석기를 통해 2주 동안 세포의 분포를 확인하였다. 이때, 염색한 줄기세포를 이용하여 분석에 이용하였다.
그 결과, 도 12에 나타낸 바와 같이, 2 주가 경과된 후에도 코아세르베이트에 포집된 줄기세포가 주입한 부위에 흩어지지 않고 가장 많이 분포하고 있는 것을 확인하였다.
또한, 도 12에서 관측한 조직 부위를 절편화하여 단위 면적당 주입한 형광 염색된 줄기세포를 비교하였다.
그 결과, 도 13에 나타낸 바와 같이, 세포만 넣은 군에 비해 담체와 함께 넣은 실험군들이 더 많이 세포를 포집하고 있었고, 그 중에서도 코아세르베이트에 포집된 줄기세포가 단위 면적당 가장 많이 함유하고 있는 것을 확인하였다.
또한, 도 12에서 관측한 조직 부위를 절편화하여 H&E staining을 통해 면역반응과 혈관 형성을 확인하였다.
그 결과, 도 14에 나타낸 바와 같이, 코아세르베이트에 포집된 줄기세포는 면역반응을 최소화하였고 주변으로 신생혈관을 형성한 것을 확인할 수 있었다.
또한, 쥐 피하에 줄기세포를 주입하여 2주 경과 후 조직을 웨스턴 블롯팅하여 줄기세포의 분화능과 관련된 단백질인 OCT4, SOX2 및 신생혈관형성을 유도하는 VEGF, FGF2의 단백질 발현 정도를 확인하였다.
그 결과, 도 15에 나타낸 바와 같이, 코아세르베이트에 포집된 줄기세포에서 모든 단백질이 가장 많이 발현되는 것을 확인하였다.
따라서, 본 발명의 세포전달체를 생체 내에 이식하면 풍부한 혈관 신생 촉진인자와 줄기세포로부터 분화된 혈관세포에 의해 생체 내에서 성숙한 혈관을 효과적으로 형성할 수 있다. 본 발명에 따른 세포전달체는 손상된 혈관 조직 재생을 위한 세포치료제로서 뿐만 아니라 혈관 재생을 위한 조직공학용 복합 지지체로서 유용하게 사용될 수 있다.

Claims (11)

  1. 홍합 접착 단백질 또는 이의 변이체에 음이온성 고분자가 혼합되어 형성된 코아세르베이트(coacervate)에 줄기 세포를 접촉시키는 단계를 포함하는 줄기 세포 전달체의 제조 방법.
  2. 제1항에 있어서, 상기 코아세르베이트의 내부에 줄기세포가 봉입된 것을 특징으로 하는, 줄기 세포 전달체의 제조 방법.
  3. 제1항에 있어서, 상기 홍합 접착 단백질 또는 이의 변이체는, 서열번호 1, 서열번호 2 및 서열번호 3의 아미노산 서열로 이루어진 군에서 선택된 아미노산 서열로 이루어진 단백질; 또는 상기 군에서 선택된 1 종 이상의 아미노산 서열이 연결된 융합 단백질인 것을 특징으로 하는, 줄기 세포 전달체의 제조 방법.
  4. 제1항에 있어서, 상기 음이온성 고분자는 히알루론산(hyaluronic acid), 페레독신(ferredoxin), 폴리스티렌술폰산(poly styrene sulfonic acid), 아라비아 검(gum arabic), 젤라틴(gelatin), 알부민(albumin), 카보폴(carbopol), 고 또는 저 메톡실 펙틴(high or low methoxyl pectin), 카르복시메틸 구아검 나트륨(sodium carboxymethyl guar gum), 잔탄 검(xanthan gum), 유청 단백질(whey protein), 레구민(faba bean legumin), 카르복시메틸 셀룰로오스(carboxymethyl cellulose), 알긴산(alginate), 캐러지넌(carrageenan), 헥사메타인산 나트륨(sodium hexametaphosphate), 카제인 나트륨(sodium casinate), 헤모글로빈(hemoglobin), 헤파린(heparin) 및 세포외 다당체 B40(exopolysaccharide B40)으로 이루어진 군에서 선택된 1 종 이상인 것을 특징으로 하는, 줄기 세포 전달체의 제조 방법.
  5. 제1항에 있어서, 상기 줄기세포는 지방 줄기 세포 (Adipose Stem Cell, ASC), 중간엽 줄기 세포(Mesenchymal Stem Cell, MSC), 골수줄기세포, 제대혈줄기세포, 신경줄기세포 및 유도만능줄기세포로 이루어진 군에서 선택된 줄기세포인 것을 특징으로 하는, 줄기 세포 전달체의 제조 방법.
  6. 제1항에 있어서, 상기 홍합 접착 단백질 또는 이의 변이체와 음이온성 고분자는 pH 2.0 내지 pH 10.0에서 1:0.01 내지 100의 중량비로 혼합하는 것을 특징으로 하는, 줄기 세포 전달체의 제조방법
  7. 제1항의 방법에 따라 제조된 줄기 세포 전달체.
  8. 제7항의 줄기 세포 전달체를 포함하는 줄기세포 치료제.
  9. 제8항에 있어서, 상기 줄기 세포 전달체는 줄기세포의 생존율, 증식능, 분화능 및 혈관신생능으로 이루어진 군으로부터 선택된 1 종 이상의 줄기세포능을 향상시키는 것을 특징으로 하는, 줄기 세포 치료제.
  10. 제8항의 줄기 세포 전달체를 포함하는 혈관 조직 재생용 또는 혈관 이상관련 질환의 치료용 약학적 조성물.
  11. 제8항의 줄기 세포 전달체를 포함하는 조성물을 대상에게 투여하는 단계를 포함하는 혈관 조직 재생용 또는 혈관 이상관련 질환의 치료 방법.
PCT/KR2017/009614 2016-09-01 2017-09-01 신규한 줄기 세포 전달체 및 이의 제조 방법 Ceased WO2018044124A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/330,068 US20190307688A1 (en) 2016-09-01 2017-09-01 Novel stem cell carrier and method for preparing the same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2016-0112613 2016-09-01
KR20160112613 2016-09-01
KR10-2017-0111812 2017-09-01
KR1020170111812A KR20180025831A (ko) 2016-09-01 2017-09-01 신규한 줄기 세포 전달체 및 이의 제조 방법

Publications (1)

Publication Number Publication Date
WO2018044124A1 true WO2018044124A1 (ko) 2018-03-08

Family

ID=61301889

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/009614 Ceased WO2018044124A1 (ko) 2016-09-01 2017-09-01 신규한 줄기 세포 전달체 및 이의 제조 방법

Country Status (1)

Country Link
WO (1) WO2018044124A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060019362A1 (en) * 2004-07-26 2006-01-26 Agency For Science, Technology And Research Encapsulation of cells in biologic compatible scaffolds by coacervation of charged polymers
WO2009029406A1 (en) * 2007-08-28 2009-03-05 Pepsico, Inc. Delivery and controlled release of encapsulated lipophilic nutrients
US20100120923A1 (en) * 2008-01-24 2010-05-13 University Of Utah Research Foundation Adhesive complex coacervates and methods of making and using thereof
KR20120013626A (ko) * 2010-08-05 2012-02-15 포항공과대학교 산학협력단 홍합 접착 단백질 또는 이의 변이체에 음이온성 고분자로 형성된 코아세르베이트

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060019362A1 (en) * 2004-07-26 2006-01-26 Agency For Science, Technology And Research Encapsulation of cells in biologic compatible scaffolds by coacervation of charged polymers
WO2009029406A1 (en) * 2007-08-28 2009-03-05 Pepsico, Inc. Delivery and controlled release of encapsulated lipophilic nutrients
US20100120923A1 (en) * 2008-01-24 2010-05-13 University Of Utah Research Foundation Adhesive complex coacervates and methods of making and using thereof
KR20120013626A (ko) * 2010-08-05 2012-02-15 포항공과대학교 산학협력단 홍합 접착 단백질 또는 이의 변이체에 음이온성 고분자로 형성된 코아세르베이트

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WEN, Z. ET AL.: "Repair Me chanisms of Bone Marrow Mesenchymal Stem Cells in Myocardial Infarction", JOURNAL OF CELLULAR AND MOLECULAR MEDICINE, vol. 15, no. 5, 26 May 2011 (2011-05-26), pages 1032 - 1043, XP055471744, Retrieved from the Internet <URL:doi:10.1111/j.1582-4934.2010.01255.x> *

Similar Documents

Publication Publication Date Title
Henry et al. Adult lung spheroid cells contain progenitor cells and mediate regeneration in rodents with bleomycin-induced pulmonary fibrosis
Hyun et al. Enhancing stem cell survival in vivo for tissue repair
US11660317B2 (en) Compositions comprising cardiosphere-derived cells for use in cell therapy
Chiu Bone-marrow stem cells as a source for cell therapy
ES2520044T3 (es) SDF-1 para su uso en el tratamiento de trastornos vasculares periféricos isquémicos
Guan et al. Engineering hiPSC-CM and hiPSC-EC laden 3D nanofibrous splenic hydrogel for improving cardiac function through revascularization and remuscularization in infarcted heart
CN110352240A (zh) 围产期组织衍生的间充质干细胞:其制备方法和用途
CN103191445B (zh) 间充质干细胞的用途及其制取方法
US20180228847A1 (en) Compositions and methods for cardiac tissue repair
JP2012180355A (ja) 筋肉由来前駆細胞、その組成物、および治療法を使用した軟部組織および骨の増大および肥厚
US8911997B2 (en) Mammalian cell culture medium
Qiao et al. Synergistic effects of adipose-derived stem cells combined with decellularized myocardial matrix on the treatment of myocardial infarction in rats
CN109069875A (zh) 产生免疫耐受反应的组合物和方法
JP2020023502A (ja) 細胞増殖の刺激のための方法及び組成物、ならびにfgf2アイソフォームの生物学的に活性な混合物の提供
WO2018117569A1 (ko) 심장줄기세포의 다층세포시트 및 이의 제조방법
WO2018182278A1 (ko) 홍합 접착 단백질을 포함하는 다공성 마이크로입자 및 이의 제조방법
JP2006516134A (ja) 封入化細胞療法
Dori et al. Seven days post-injury fate and effects of genetically labelled adipose-derived mesenchymal cells on a rat traumatic brain injury experimental model
US20190307688A1 (en) Novel stem cell carrier and method for preparing the same
CN120248023A (zh) 一种用于胰岛表面修饰并抑制胰岛移植ibmir反应的多肽衍生物
WO2018044124A1 (ko) 신규한 줄기 세포 전달체 및 이의 제조 방법
JP2025015574A (ja) 虚血および心筋症の処置のための組成物および方法
US20160120911A1 (en) Transplantation of cells into the nasal cavity and the subarachnoid cranial space
WO2024250356A1 (zh) 一种细胞-微球共组装体及其制备方法和应用
CN110141682A (zh) 一种负载外源干细胞的注射型胶原材料及其在心肌损伤修复中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17847049

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17847049

Country of ref document: EP

Kind code of ref document: A1