WO2018038046A1 - Animal non humain à gène modifié exprimant le polypeptide (gpc3) humain - Google Patents

Animal non humain à gène modifié exprimant le polypeptide (gpc3) humain Download PDF

Info

Publication number
WO2018038046A1
WO2018038046A1 PCT/JP2017/029766 JP2017029766W WO2018038046A1 WO 2018038046 A1 WO2018038046 A1 WO 2018038046A1 JP 2017029766 W JP2017029766 W JP 2017029766W WO 2018038046 A1 WO2018038046 A1 WO 2018038046A1
Authority
WO
WIPO (PCT)
Prior art keywords
human
gene
gpc3
human animal
mouse
Prior art date
Application number
PCT/JP2017/029766
Other languages
English (en)
Japanese (ja)
Inventor
寺社下　浩一
裕司 日野
敬弘 石黒
恭子 木下
Original Assignee
中外製薬株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 中外製薬株式会社 filed Critical 中外製薬株式会社
Priority to JP2018535662A priority Critical patent/JP7125347B2/ja
Priority to EP17843526.9A priority patent/EP3502250B1/fr
Priority to US16/327,218 priority patent/US11793180B2/en
Publication of WO2018038046A1 publication Critical patent/WO2018038046A1/fr
Priority to JP2022082299A priority patent/JP2022134132A/ja

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/303—Liver or Pancreas
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5041—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/20—Animal model comprising regulated expression system
    • A01K2217/206—Animal model comprising tissue-specific expression system, e.g. tissue specific expression of transgene, of Cre recombinase
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C12N2015/8518—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic expressing industrially exogenous proteins, e.g. for pharmaceutical use, human insulin, blood factors, immunoglobulins, pseudoparticles

Definitions

  • the present invention relates to a genetically modified non-human animal that expresses a human GPC3 polypeptide and a method for evaluating a compound using the genetically modified non-human animal that expresses a human GPC3 polypeptide.
  • the inserted human gene stop codon (premature termination codon, PTC) is far upstream of the mouse gene stop codon.
  • an exon-exon junction derived from a mouse gene is present downstream of this stop codon. Since this structure is recognized by the nonsense mutation-dependent mRNA degradation mechanism (NMD mechanism) and mRNA is degraded, the target gene expression level is often not obtained.
  • NMD mechanism nonsense mutation-dependent mRNA degradation mechanism
  • Patent Document 1 The method expressed in this way has been reported (Patent Document 1).
  • a poly A addition signal is added immediately below the cDNA sequence of any foreign gene and inserted into a mouse.
  • the transcribed mRNA has a structure in which the exon-exon junction derived from the target gene does not occur downstream of the PTC, so NMD does not occur.
  • 3 ′ untranslated regions (3′UTR) and splicing mechanisms are involved in mRNA stability.
  • Non-patent Document 2 The poly-A addition signal present in 3'UTR contributes to mRNA stability (Non-patent Document 2), adenine / uridine-rich elements (Non-patent Literature 3) and GU-rich elements (Non-patent Document 4). It has been reported that existence contributes to protein translational regulation. In addition, it has been reported that the expression level of genes that do not have introns, that is, mRNA that does not experience splicing out, is reduced (Non-patent Document 5). On the other hand, even if it has an exon-intron structure, if the length of the gene is as short as several tens of kilobases, it is possible to replace that genomic region with the genomic region to be inserted.
  • Non-patent Document 5 there is no versatile method for producing a non-human animal that can suppress the endogenous gene expression of a non-human animal and express a foreign gene at a physiologically relevant level.
  • the present invention has been made in view of the above circumstances, and uses a genetically modified non-human animal that expresses a human GPC3 polypeptide, a method for producing the genetically modified non-human animal, and the genetically modified non-human animal.
  • An object of the present invention is to provide a screening method for therapeutic agents for various diseases.
  • the present inventors have earnestly studied a method for producing a non-human animal that is deficient in the expression of endogenous GPC3 polypeptide in a non-human animal and that can express the human GPC3 polypeptide at a physiologically relevant level. Went.
  • a non-human animal that expresses the human GPC3 gene at a physiologically relevant level can be obtained. We were able to make it.
  • non-human animals that lack the expression of endogenous GPC3 polypeptides in non-human animals and that are capable of expressing human GPC3 polypeptides at physiologically relevant levels are against human GPC3.
  • a genetically modified non-human animal that lacks expression of endogenous GPC3 polypeptide and expresses human GPC3 polypeptide.
  • the genetically modified non-human animal of [1] which expresses the human GPC3 polypeptide at a physiologically relevant level.
  • the copy number of human GPC3 mRNA in the total RNA is equivalent to the copy number of the non-human animal GPC3 mRNA in the total RNA in the wild-type non-human animal, according to [1] or [2] Genetically modified non-human animal [4]
  • the copy number of the human GPC3 mRNA in the total RNA is equal to the copy number of the monkey GPC3 mRNA in the total RNA in the wild type monkey, and the human GPC3 mRNA in the total RNA in the human.
  • the genetically modified non-human animal according to any one of [1] to [3], which is equivalent to either or both of the copy numbers.
  • [5] The genetically modified non-human animal according to any one of [1] to [4], which exhibits immunological tolerance against a human GPC3 polypeptide or a fragment thereof.
  • [6] The genetically modified non-human animal according to any one of [1] to [5], wherein the non-human animal is a non-human mammal, preferably a rodent.
  • [7] The genetically modified non-human animal according to any one of [1] to [6], wherein the non-human animal is a mouse.
  • An antigen-binding molecule that binds to a human GPC3 polypeptide is a genetically modified non-human animal according to any one of [1] to [7], [9], [10] (2) at least one evaluation index selected from the group consisting of cancer cell growth inhibitory effect, safety, pharmacokinetics, and biodistribution characteristics in a genetically modified non-human animal administered with the test substance
  • a screening method for a therapeutic agent for cancer comprising: a step of selecting an antigen-binding molecule that is superior in comparison with the control evaluation index as an evaluation index measured in step (3).
  • the screening method according to [13] wherein the antigen-binding molecule is an antibody.
  • a method for producing an antibody comprising obtaining amino acid sequence information of an antibody selected by the screening method according to [13] or [14] and introducing a gene encoding the amino acid sequence into a host cell.
  • the following invention is provided.
  • 'A genetically modified non-human animal comprising DNA encoding a human GPC3 gene to which an untranslated region has been added.
  • the genetically modified non-human animal according to [17] wherein the DNA is cDNA.
  • [22] The genetically modified non-human animal according to any one of [17] to [21], which exhibits immunological tolerance against a human GPC3 polypeptide or a fragment thereof.
  • [28] including DNA encoding a human GPC3 gene to which a base sequence containing an exon / intron structure is added on the 5 ′ side and a 3 ′ untranslated region of the GPC3 gene of a non-human animal is added on the 3 ′ side DNA constructs.
  • the DNA construct according to [28] or [29], wherein the base sequence containing the exon / intron structure is a sequence containing the second exon sequence, the intron sequence and the third exon sequence of beta globin.
  • [31] The DNA construct according to any one of [28] to [30], wherein the beta globin is mouse beta globin.
  • [35] A base sequence homologous to the 5 ′ upstream region of the target region of the non-human animal GPC3 gene on the 5 ′ side of the DNA construct, and a target region of the non-human animal GPC3 gene on the 3 ′ side of the DNA construct.
  • the knock-in vector according to [34] comprising a base sequence homologous to the 3 ′ downstream region.
  • [36] A non-human animal cell into which the knock-in vector according to [35] is introduced.
  • the non-human animal cell according to [36] wherein the cell is an embryonic stem cell (ES cell), an induced pluripotent stem cell (iPS cell), a germ line stem cell, or a fertilized egg.
  • ES cell embryonic stem cell
  • iPS cell induced pluripotent stem cell
  • a germ line stem cell or a fertilized egg.
  • the following invention is provided. [38] The following steps: (1) [1] to [7], [9], [10], [17] to [24], comprising cancer tissue or cancer cells that express human GPC3 polypeptide , [26], a step of administering a test substance to the genetically modified non-human animal according to any one of [27], (2) suppression of cancer cell proliferation in the genetically modified non-human animal administered with the test substance A step of measuring the effect, and a step of selecting a test substance in which the cancer cell proliferation inhibitory effect measured in (3) and (2) is significantly greater than that of the control. How to evaluate.
  • test substance is an antigen-binding molecule that binds to a human GPC3 polypeptide.
  • antigen-binding molecule is an antibody.
  • At least one or more CD3 genes selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ are functionally deleted on the genome, and at least one or more selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇
  • the genetically modified non-human animal according to [47] which functionally expresses a human CD3 gene consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ .
  • the T cell possessed by the non-human animal is characterized in that a non-human animal-derived T cell receptor and a human CD3 molecule form a complex on the cell membrane.
  • the genetically modified non-human animal according to any one of the above.
  • the genetically modified non-human according to any one of [47] to [50] further expressing a human immune checkpoint gene, a human cancer-specific antigen gene, and / or a human immune co-stimulatory molecule gene animal.
  • [56] The genetically modified non-human animal according to [55], wherein the cancer cell is a cell derived from lung cancer, stomach cancer, liver cancer, esophageal cancer or ovarian cancer.
  • [58] The following steps (1) to (3): (1) The first genetically modified protein according to any one of [47] to [57], wherein one of the libraries of antigen-binding molecules comprising a human CD3 binding domain and a cancer-specific antigen binding domain is used as a test substance. Administering to a human animal, (2) measuring the cell growth inhibitory effect and / or pharmacokinetic properties of the test substance on cells expressing the cancer-specific antigen; and (3) the cell growth inhibitory effect and / or drug of the test substance.
  • a screening method for a therapeutic agent for a malignant neoplastic disease Comparing the kinetic properties to the cytostatic effect and / or pharmacokinetic properties of a control antibody administered to a second genetically modified non-human animal different from the first non-human animal, A screening method for a therapeutic agent for a malignant neoplastic disease.
  • steps (1) to (3) (1) producing a genetically modified non-human animal that lacks endogenous GPC3 polypeptide expression and expresses human GPC3 polypeptide; (2) At least one or more CD3 genes selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ are functionally deficient on the genome, and at least one or more selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ Producing a genetically modified non-human animal that functionally expresses the human CD3 gene of (3) mating a genetically modified non-human animal that expresses the human GPC3 polypeptide and a genetically modified non-human animal that functionally expresses the human CD3 gene; A method for producing a non-human animal that expresses a human GPC3 polypeptide and functionally expresses a human CD3 gene.
  • Knock-in vector ver.1 (2) is a neomycin resistance gene (neo) sandwiched between human glypican-3 (hGPC3) cDNA, hp7 sequence, poly A addition signal (pA), and loP which is the substrate sequence of the recombinant enzyme Cre.
  • Cre neomycin resistance gene sandwiched between loxPs occurs, and the neomycin resistance gene sandwiched between loxPs is removed.
  • Knock-in vector ver.2 (3) is approximately 800 bases 5 'upstream of the target region of the mGpc3 gene, in the second exon of mouse beta globin, intron, third exon, hGPC3 cDNA, and third exon of mouse beta globin.
  • Knock-in vector ver. 3 (4) is obtained by changing the polyA addition signal in the third exon of mouse beta globin of knock-in vector ver. 2 (3) to the 3 ′ untranslated region of the mGpc3 gene.
  • a is the second exon of mouse beta globin
  • b is the second intron of mouse beta globin
  • c is the third exon of mouse beta globin
  • d is the third exon of mouse beta globin containing a polyA addition signal.
  • the knock-in vector ver.2 also removes neo in the same process.
  • hGPC3 knock-in mouse ver.1 (a), hGPC3 knock-in mouse ver.2 (b)] that detected the removal of the neo gene cassette of hGPC3 knock-in mouse ver.1 and hGPC3 knock-in mouse ver.2 Show. Representative examples of PCR that detected homozygotes and hemizygotes of hGPC3 knock-in mouse ver.1, hGPC3 knock-in mouse ver.2 and hGPC3 knock-in mouse ver.3 [hGPC3 knock-in mouse ver.1 (a), hGPC3 knock-in mouse ver. .2 (b), hGPC3 knock-in mouse ver. 3 (c)].
  • hGPC3KI / hGPC3KI, hGPC3KI / ⁇ , hGPC3KI / + and + / + represent a homo knock-in mouse, a hemi knock-in mouse, a hetero knock-in mouse, and a wild type, respectively. It is a figure which shows the result of the Western blot in the lung of hGPC3 knock-in mouse
  • FIG. 6 is a graph showing the expression level of GPC3 mRNA in the lungs of hGPC3 knock-in mice ver.2, ver.3, wild-type mice and cynomolgus monkeys.
  • A It is the figure which showed the result of hGPC3 knock-in mouse
  • FIG. 3 is a graph showing the antitumor effect of hGPC3_mCD3 antibody in LLC1 / hGPC3 transplantation model in hGPC3 knock-in mouse ver.3.
  • FIG. 3 is a graph showing changes in hGPC3_mCD3 antibody concentration in plasma of hGPC3 knock-in mouse ver.1 and hGPC3 knock-in mouse ver. 3 after 2 hours, 1 day and 7 days after administration of hGPC3_mCD3 antibody.
  • FIG. 3 is a graph showing the time course of IL-4, IL-6 and TNF concentrations in the plasma of wild-type mice, hGPC3 knock-in mice ver.1 and hGPC3 knock-in mice ver.3 after administration of hGPC3_mCD3 antibody.
  • Genomic DNA containing mouse Cd3 ⁇ , Cd3 ⁇ and Cd3 ⁇ genes (1) and mouse Cd3 gene modification vector (2) constructed by modifying a bacterial artificial chromosome (BAC) clone containing the entire gene region, It shows the structure of genomic DNA in which loxP and Rox sequences are inserted at the target position using a vector (3), and further shows the structure of a defective allele of Cd3 ⁇ , Cd3 ⁇ and Cd3 ⁇ genes by the action of recombinant enzymes Cre and Dre (4) .
  • BAC bacterial artificial chromosome
  • BAC clone (a) containing human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ genes, 5 ′ modified cassette (b) and 3 ′ modified cassette (c) for modifying the BAC clone, and modification using them
  • the structure of the human CD3 gene region introduction vector (d) is shown.
  • a representative example of the analyzed PCR for establishment of mouse Cd3 gene-modified ES cells is shown.
  • a representative example of PCR in which a human CD3 gene region introduction vector is introduced into a mouse Cd3 gene-modified ES cell together with a Cre expression vector and a Dre expression vector, and the genotype of the obtained ES cell clone is analyzed is shown.
  • FIG. 17A shows a representative example of a PCR result for detecting a deletion in the mouse Cd3 gene region.
  • a representative example of the PCR result for detecting the introduction of the human CD3 gene region is shown.
  • It is a representative macro photograph of the thymus collected from human CD3 gene-substituted mice, Cd3 gene-deficient mice, wild-type and human CD3 ⁇ gene-introduced mice of each established line.
  • Each genotype is a thymus extracted from a 12-13 week old male.
  • the results of measuring tissue weights of spleen and thymus collected from human CD3 gene-substituted mice, Cd3 gene-deficient mice, wild-type and human CD3 ⁇ gene-introduced mice in each established line are shown.
  • the tissue weight ratio per body weight is calculated, the values obtained for each individual are plotted with black dots, and the average value is represented by a column.
  • CD3 tissue immunostaining performed on the thymus (A) and spleen (B) of human CD3 gene-substituted mice (1C3, 8I12 and 4HH3) of each established line are shown.
  • any tissue staining was observed only in the T cell zone as in the wild type mouse.
  • no staining was observed in Cd3 gene-deficient mice, indicating that staining in human CD3 gene-substituted mice was due to the expression of the introduced human CD3 gene.
  • a representative result of FACS analysis of the abundance ratio of mature T cells in the spleen of each established line of human CD3-substituted mice is shown.
  • FIGS. 25A to 25D show cell proliferation activity (FIGS.
  • OVA-specific serum IgG1 and IgE concentrations for each individual are shown as a bar graph.
  • the numbers below the bar graph indicate individual numbers.
  • the change of the tumor volume at the time of administering HER2_CD3 antibody in the hCD3 transgenic mouse model which transplanted Hepa1-6 / HER2 cell is shown. Arrows indicate antibody administration (*: P ⁇ 0.05 (t-test)).
  • the change of the tumor volume when an anti-mouse CTLA-4 antibody, an anti-mouse PD-1 antibody and an anti-mouse PD-L1 antibody are administered in an hCD3 transgenic mouse model transplanted with Hepa1-6 / hGPC3 cells is shown. Arrows indicate antibody administration.
  • the change of the tumor volume when administering the buffer as MDX10 // TR01H113 or Control in the mouse model transplanted with Colon38 cell line is shown (in the figure, “MDX10 // TRO01H1333” and “vehicle”, respectively).
  • p 0.0021, Student's t test.
  • the change of the tumor volume when hGPC3_hCD3 antibody is administered in the human GPC3 knock-in / human CD3 gene replacement mouse model transplanted with Hepa1-6 / hGPC3 cells is shown.
  • FIG. 6 shows changes in plasma cytokine concentrations in human GPC3 knock-in / human CD3 gene-substituted mouse models transplanted with Hepa1-6 / hGPC3 cells on the day before hGPC3_hCD3 antibody administration, 6 h after administration, 24 h after administration, and 6 h after the second administration.
  • the broken line indicates the detection limit.
  • “Conservative substitutions” are those that take place within a family of amino acids that are related in their side chains and chemical properties of the amino acids.
  • amino acids can be grouped according to common side chain properties: (1) Hydrophobicity: norleucine, methionine (Met), alanine (Ala), valine (Val), leucine (Leu), isoleucine (Ile); (2) Neutral hydrophilicity: cysteine (Cys), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gln); (3) Acidity: Aspartic acid (Asp), glutamic acid (Glu); (4) Basicity: histidine (His), lysine (Lys), arginine (Arg); (5) Residues that affect chain orientation: Glycine (Gly), Proline (Pro); (6) Aromaticity: Tryptophan (Trp), Tyrosine (Tyr), Phenylalanine (Phe).
  • Non-conservative substitutions refer to exchanging one member of these classes for another class.
  • the invention includes a genetically modified non-human animal that expresses a human GPC3 polypeptide that includes a conservative amino acid substitution in the amino acid sequence described herein.
  • Target gene includes an endogenous gene of a non-human animal to which a foreign gene is to be inserted.
  • “Target region” includes a specific region of an endogenous gene of a non-human animal into which a foreign gene is to be inserted.
  • the target region refers to a region containing an endogenous gene in contact with the 5 ′ side and 3 ′ side of an inserted foreign gene.
  • the target region refers to a region of an endogenous gene whose expression is lost due to insertion of an exogenous gene.
  • Endogenous includes substances naturally derived from living organisms, tissues or cells.
  • an endogenous nucleic acid or peptide refers to a nucleic acid or peptide that is in a cell and not introduced into the cell using recombinant engineering techniques.
  • “Exogenous” includes substances derived from other organisms, tissues or cells other than the organism, tissue or cells.
  • “foreign gene” includes a gene to be introduced into the non-human animal of the present invention.
  • the foreign gene in the present invention can be used without any limitation on the species from which it is derived, but is preferably a human gene.
  • a selection marker gene such as a reporter gene such as green fluorescent protein (GFP) or ⁇ -galactosidase, or a drug (neomycin or the like) resistance gene can be used.
  • GFP green fluorescent protein
  • ⁇ -galactosidase a drug (neomycin or the like) resistance gene
  • a combination of two or more genes can be used as the foreign gene.
  • An exogenous gene may be added with an enhancer that regulates the expression of the gene.
  • the form of the foreign gene is not particularly limited, and may be, for example, cDNA or genomic DNA.
  • “Functionally linked” includes a state in which each gene is linked in a state where it can exert its intended function.
  • a nucleic acid sequence encoding a protein can be operably linked to regulatory sequences (eg, promoters, enhancers, silencer sequences, etc.) to maintain proper transcriptional regulation, but as long as it functions as such The promoter need not be contiguous with the sequence.
  • regulatory sequences eg, promoters, enhancers, silencer sequences, etc.
  • the term “functionally coupled” may be used interchangeably with the term “operably coupled”.
  • vectors include, but are not limited to, genetically engineered plasmids or viruses derived from bacteriophages, adenoviruses, retroviruses, poxviruses, herpesviruses, or artificial chromosomes.
  • non-human animal is not particularly limited as long as it is an animal other than a human, and examples thereof include mouse, rat, guinea pig, hamster, rabbit, goat, cow, horse, pig, dog, cat and monkey.
  • the non-human animal is preferably a mammal, an animal classified as a rodent, and more preferably a mouse. Examples of preferred mice include, but are not limited to, C57 / BL / 6, ICR, BALB / c.
  • Wild type includes having a normal structure and / or activity found in nature. Wild-type nucleic acids or peptides include multiple different forms and polymorphisms such as allelic variations. Also, “wild-type” non-human animals optionally include animals that are wild-type with respect to the GPC3 gene, ie, animals that have not been genetically engineered with respect to GPC3.
  • antibody is used in the broadest sense, and is not limited to these as long as it exhibits a desired antigen-binding activity, but includes a monoclonal antibody, a polyclonal antibody, a multispecific antibody (for example, , Bispecific antibodies) and antibody fragments.
  • Antibody fragment refers to a molecule other than the complete antibody, including a portion of the complete antibody that binds to the antigen to which the complete antibody binds.
  • Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab ′, Fab′-SH, F (ab ′) 2 ; diabodies; linear antibodies; single chain antibody molecules (eg, scFv And multispecific antibodies formed from antibody fragments.
  • cancer cancer
  • carcinoma tumor neoplasm
  • Glypican 3 Glypican 3 (GPC3) is one of the family of heparan sulfate proteoglycans present on the cell surface, suggesting that it may be involved in cell division during development and cancer cell proliferation However, its function is not well understood.
  • examples of polypeptide sequences for GPC3 include SEQ ID NO: 1 (human, NCBI RefSeq: NP_004475.1), SEQ ID NO: 2 (monkey, NCBI RefSeq: XP_005594665.1), SEQ ID NO: 3 (mouse, NCBI RefSeq: NP_057906.2), as a DNA sequence, SEQ ID NO: 4 (human, NCBI RefSeq: NM_004484.3), SEQ ID NO: 5 (monkey, NCBI RefSeq: XM_005594608.2), SEQ ID NO: 6 (Mouse, NCBI RefSeq: NM_016697.3).
  • glypican 3 (GPC3) or GPC3 polypeptide includes full-length GPC3 polypeptide and fragments thereof, and may include amino acid mutations.
  • the “GPC3 gene” is not particularly limited as long as it is a gene encoding a GPC3 polypeptide, and may be genomic DNA or cDNA.
  • the GPC3 gene includes a polymorphism or a mutant thereof.
  • the present invention provides a non-human animal that comprises a DNA encoding a human GPC3 gene and expresses a human GPC3 polypeptide.
  • the non-human animal of the present invention is a non-human animal, wherein DNA encoding the human GPC3 gene is inserted into the same reading frame of an endogenous GPC3 gene present on the genome of the non-human animal. Including animals.
  • the DNA encoding the human GPC3 gene may be genomic DNA or cDNA. Preferred is a cDNA, more specifically a cDNA containing an amino acid sequence coding region (CDS).
  • the amino acid sequence coding region also includes a signal sequence.
  • “same reading frame” means a unit of base sequence of every 3 bases read when mRNA is translated into protein. “Inserting into the same reading frame” includes inserting the human GPC3 gene so that the start codon ATG of the endogenous GPC3 gene of the non-human animal matches the start codon ATG of the human GPC3 gene. In addition, an exon / intron structure sequence is added to the 5 ′ side of the start codon ATG of the human GPC3 gene, and the start codon ATG of the endogenous GPC3 gene of a non-human animal matches the 5 ′ end of the exon / intron structure. Thus, the insertion of the human GPC3 gene is also included in “inserting into the same reading frame”.
  • the endogenous GPC3 gene promoter in the non-human animal and the inserted human GPC3 gene are operably linked, and the human GPC3 gene is expressed in response to activation of the promoter.
  • exogenous human GPC3 is expressed under the endogenous GPC3 expression control system, so human GPC3 is expressed at the same timing and location (tissue) as endogenous GPC3.
  • GPC3 is a gene that is also expected to be involved in development. Therefore, by adopting the above configuration, an effect of reducing the influence of genetic modification on the survival and development of non-human animals can be expected.
  • the sequence after the ATG of the endogenous GPC3 gene It is preferable to delete a sequence having a base number that is not a multiple of 3.
  • the human GPC3 gene is inserted only into the exon in which the original translation start point of the endogenous GPC3 gene is present (that is, homologous recombination occurs only with the target exon of the endogenous GPC3 gene). It is preferable.
  • the human GPC3 gene possessed by the non-human animal of the present invention is SEQ ID NO: 4, and at least 50%, 60%, 70%, preferably 75% or more, 80% or more, 85% or more. More preferably, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more homologous human GPC3 gene including.
  • the human GPC3 gene comprises a polymorphism or variant thereof.
  • the human GPC3 gene may be a gene encoding a human GPC3 polypeptide having an amino acid insertion, deletion or conservative amino acid substitution.
  • the human GPC3 polypeptide expressed by the non-human animal of the present invention is SEQ ID NO: 1, and at least 50%, 60%, 70%, preferably 75% or more, 80% or more, 85% More preferably, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more homologous human GPC3 Including polypeptides.
  • the human GPC3 gene comprises a polymorphism or variant thereof.
  • the human GPC3 polypeptide may have an amino acid insertion, deletion, or conservative amino acid substitution.
  • the homology of the base sequence and amino acid sequence can be determined by a known algorithm. Algorithms for obtaining homology between a plurality of sequences are known.
  • the homology (homology) of sequence information is determined by considering synonymous codons in the comparison between base sequences or considering the commonality of different amino acid residues in comparison between amino acid sequences. In some cases, the determination is purely based on a comparison of sequence information without consideration. The latter comparison result can preferably be expressed in terms of identity.
  • the non-human animal of the present invention lacks the expression of the endogenous GPC3 polypeptide of the non-human animal and can express the human GPC3 polypeptide at a physiologically relevant level.
  • Human GPC3 gene (including mRNA) inserted into the non-human animal of the present invention or human GPC3 polypeptide expressed from the gene can be obtained by various methods well known to those skilled in the art, such as PCR, Southern blot, RFLP (RestrictionstrictFragment Length (Polymorphis) method, Western blot, IHC, ELISA, etc.
  • “deficient in expression of endogenous GPC3 polypeptide” is not particularly limited as long as the endogenous GPC3 polypeptide in a non-human animal is not expressed.
  • a homologous recombination technique or a knockout technique based on genome editing techniques such as CRISPR / Cas9, zinc finger nuclease Z (Zinc Finger Nucleases), or Taylor (TALEN).
  • the endogenous GPC3 gene may be deleted (invalidated) on the genome, or a method of completely suppressing endogenous GPC3 gene expression using siRNA or the like may be used.
  • a foreign gene may be inserted at the position of the GPC3 gene on the non-human animal genome, for example, using a knock-in technique.
  • ⁇ expressing human GPC3 polypeptide at a physiologically relevant level '' means, for example, that the expression level of human GPC3 polypeptide or human GPC3 mRNA in a non-human animal is the following (i) ⁇ including equivalent to any expression level selected from expression levels consisting of (iii): (i) the expression level of mouse GPC3 polypeptide or mouse GPC3 mRNA in wild-type mice, (ii) expression level of monkey GPC3 polypeptide or monkey GPC3 mRNA in wild-type monkeys, and (iii) The expression level of human GPC3 polypeptide or human GPC3 mRNA in humans.
  • the expression level of human GPC3 polypeptide or human GPC3 mRNA in one or more organs of a non-human animal is selected from any of the following expression levels (i) to (iii): Including being equivalent to: (i) the expression level of mouse GPC3 polypeptide or mouse GPC3 mRNA in the organ of the wild type mouse, (ii) expression level of monkey GPC3 polypeptide or monkey GPC3 mRNA in the organ of the wild type monkey, and (iii) The expression level of human GPC3 polypeptide or human GPC3 mRNA in the human organ.
  • the expression level of human GPC3 polypeptide or human GPC3 mRNA in one or more organs of the non-human animal of the present invention is equivalent to the expression level of human GPC3 polypeptide or human GPC3 mRNA in the human organ.
  • organs include, but are not limited to, lung and trachea.
  • the other expression level is 50-150%, such as 70-130%, more specifically 80-120%. Can be considered equivalent.
  • the expression level of GPC3 polypeptide can be expressed as the weight of GPC3 polypeptide per total protein weight, and the expression level of GPC3PC mRNA is expressed as the copy number of GPC3 mRNA in the total RNA. Can be represented. Methods for quantitatively evaluating RNA copy number are known. Specifically, for example, a standard curve with a known RNA amount is used as a sample by real-time PCR, and a calibration curve (standard curve) is drawn based on the number of reaction cycles required to reach a certain signal intensity. be able to.
  • the amount of RNA can be determined by applying the obtained result to a calibration curve prepared in advance. Can do.
  • methods for determining the amount of total RNA by electrophoresis or measuring absorbance are known.
  • the total RNA may be total mRNA.
  • an antibody that binds to human GPC3 is administered to a genetically modified non-human animal that expresses a human GPC3 polypeptide, and the pharmacokinetic properties such as blood half-life of the antibody are It may be determined that “the human GPC3 polypeptide is expressed at a physiologically relevant level” by being similar to the case where the antibody is administered.
  • a genetically modified non-human animal that expresses a human GPC3 polypeptide exhibits immunological tolerance against the human GPC3 polypeptide. That is, when a living body administers a human GPC3 polypeptide to a non-human animal or transplants a cell that expresses a human GPC3 polypeptide to activate an acquired immune response system against an antigen that is foreign to the living body (self).
  • the human GPC3 polypeptide or cells expressing the human GPC3 polypeptide are recognized as foreign substances and eliminated.
  • the genetically modified non-human animal of the present invention expresses a human GPC3 polypeptide, the human GPC3 polypeptide is regarded as its own biological component and does not show an immune response thereto.
  • Whether or not the genetically modified non-human animal of the present invention exhibits immunological tolerance against human GPC3 is determined by various methods known to those skilled in the art, for example, administration of human GPC3 polypeptide or a fragment thereof to the non-human animal, This can be confirmed by measuring the anti-human GPC3 antibody titer in the non-human animal body.
  • the non-human animal expressing the human GPC3 polypeptide in the present invention has a normal immune system.
  • a non-human animal exhibiting immunological tolerance to a human GPC3 polypeptide is administered to the non-human animal after administration of the human GPC3 polypeptide or fragment thereof to the anti-human plasma.
  • This can be confirmed by measuring the antibody titer of human GPC3 antibody.
  • the adjuvant may be administered together with the human GPC3 polypeptide or a fragment thereof.
  • the antibody titer is measured, for example, on the 0th day, the 14th day, the 21st day, the 28th day, the 35th day, the 42nd day, and / or the 49th day from the day when the human GPC3 polypeptide or a fragment thereof is administered. Can be done on the day.
  • the antibody titer of an anti-human GPC3 antibody in the plasma of a genetically modified non-human animal expressing a human GPC3 polypeptide is significantly lower than the antibody titer of an anti-human GPC3 antibody of a wild-type non-human animal, It can be assessed that the genetically modified non-human animal shows tolerance to the human GPC3 polypeptide.
  • a genetically modified non-human animal is immunologically tolerant to a human GPC3 polypeptide is an advantageous feature when various characteristics of an antigen-binding molecule against human GPC3 are evaluated in the animal.
  • a case is assumed where the characteristics of an antigen-binding molecule are evaluated in a model animal in which cancer cells expressing human GPC3 are transplanted into the genetically modified non-human animal of the present invention.
  • the host animal produces an antibody against human GPC3 in an immune response to human GPC3
  • the produced antibody may interfere with the evaluation of the action of the antigen-binding molecule.
  • an immunodeficient animal transplant model there may be no problem with the host immune response.
  • an evaluation system in an immunodeficient animal deficient in the immune system cannot evaluate the action of an antigen-binding molecule involved in, for example, the immune system.
  • the genetically modified non-human animal of the present invention has an immune system, there is no such limitation.
  • the present invention provides a DNA construct for producing a non-human animal that expresses a human GPC3 polypeptide, a knock-in vector retaining the DNA construct, and a trait into which the knock-in vector has been introduced.
  • a transformed cell or a progeny cell thereof is provided.
  • the DNA construct of the present invention is a human having an exon-intron structural sequence added to the 5 ′ side and a 3 ′ untranslated region of the non-human animal GPC3 gene added to the 3 ′ side.
  • a DNA construct containing the DNA encoding the GPC3 gene is included.
  • the DNA construct of the present invention further comprises a recombinant enzyme substrate sequence (eg, a loxP sequence that is a substrate sequence of Cre), a drug selectable marker (eg, the neo gene) and / or other sequences. But it ’s okay.
  • the DNA construct of the present invention comprises a human having an exon intron structural sequence added to the 5 ′ side and a 3 ′ untranslated region of a non-human animal beta globin added to the 3 ′ side.
  • a DNA construct containing the DNA encoding the GPC3 gene is included.
  • the DNA construct of the present invention further comprises a recombinant enzyme substrate sequence (eg, a loxP sequence that is a substrate sequence of Cre), a drug selectable marker (eg, the neo gene) and / or other sequences. But it ’s okay.
  • the “exon / intron structure sequence” means a sequence containing both exons that are not removed by the splicing reaction and introns that are removed by the reaction.
  • the exon / intron structure sequence may be any sequence as long as it contains both exons and introns and the intron is removed by splicing.
  • Examples of the exon / intron structure sequence of the present invention include, but are not limited to, a betaglobin second exon sequence, a sequence containing the same intron sequence and the third exon sequence.
  • the DNA construct of the present invention has a beta globin second exon, the same intron and the third exon added to the 5 ′ side, and 3 ′ side of the GPC3 gene 3 of the non-human animal. 'Includes DNA constructs containing DNA encoding the human GPC3 gene with an untranslated region added.
  • the DNA construct of the present invention has a beta globin second exon, the same intron and the third exon added to the 5 ′ side, and the 3 ′ side of the non-human animal GPC3 gene.
  • a DNA construct comprising a DNA encoding a human GPC3 gene to which a 3 ′ untranslated region, a drug selection marker and a recombinase substrate sequence have been added.
  • the beta globin is not particularly limited, but is preferably beta globin derived from the genetically modified non-human animal.
  • the genetically modified non-human animal is a mouse, it is preferably mouse beta globin, but may be other beta globin (eg, rabbit beta globin).
  • the length of the 3 ′ untranslated region of non-human animal GPC3 added to the 3 ′ side is preferably about 800 bp or more.
  • the DNA encoding the human GPC3 gene can usually be cDNA.
  • Human GPC3 cDNA can preferably consist of its coding sequence.
  • the nucleotide sequence shown in SEQ ID NO: 10 includes the start codon (atg) to the stop codon (tga) in human GPC3 cDNA, and encodes the full-length amino acid sequence of human GPC3 (580 amino acids including signal sequence). Yes.
  • the DNA construct of the present invention has a beta globin second exon, the same intron and the third exon added to the 5 ′ side, and a 3 ′ untranslated region of the beta globin on the 3 ′ side.
  • a DNA construct containing the DNA encoding the added human GPC3 gene is included.
  • the DNA construct of the present invention has a beta globin second exon, the same intron, and the third exon added to the 5 ′ side, and the 3 ′ side of the non-human animal beta globin.
  • a DNA construct comprising a DNA encoding a human GPC3 gene to which a 3 ′ untranslated region, a drug selection marker and a recombinase substrate sequence have been added.
  • the beta globin is not particularly limited, but is preferably beta globin derived from the genetically modified non-human animal.
  • the genetically modified non-human animal is a mouse, it is preferably mouse beta globin, but may be other beta globin (eg, rabbit beta globin).
  • a DNA construct comprising the following base sequence can be shown; 5′-hGPC3) coding sequence (SEQ ID NO: 10) —hp7 sequence (SEQ ID NO: 11) —polyA addition signal (SEQ ID NO: 12) -3 ′; Or 5′-mouse beta globin second exon (SEQ ID NO: 14) —intron (SEQ ID NO: 15), third exon (SEQ ID NO: 16) —coding sequence of hGPC3 gene (SEQ ID NO: 10) —mouse beta PolyA addition signal-3 'in the third exon of globin.
  • the 5 ′ upstream sequence of the mouse GPC3 gene can be arranged upstream of the 5 ′ side.
  • 800 bp upstream of the translation start point can be used as the 5 ′ upstream sequence of the mouse GPC3 gene.
  • the 3 ′ downstream sequence of the mouse GPC3 gene can also be arranged on the 3 ′ downstream side of the above structure.
  • 800 bp of the downstream region of the stop codon can be used as the 3 ′ downstream sequence of the mouse GPC3 gene.
  • Cre, Dre, Flp and the like can be used as a recombinant enzyme that acts in a sequence-specific manner in the present invention.
  • a specific recombinase is used according to the substrate sequence to be inserted into the genomic region. That is, the loxP sequence is used for Cre, the Rox sequence is used for Dre, and the Frt sequence is used for Flp.
  • loxP sequence is the base sequence of ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 7)
  • Rox sequence is the base sequence of TAACTTTAAATAATTGGCATTATTTAAAGTTA (SEQ ID NO: 8)
  • Frt sequence is the base sequence of GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC (SEQ ID NO: 9)
  • the present invention is not limited to this.
  • neomycin resistance gene neo
  • hygromycin B phosphotransferase gene neomycin resistance gene
  • HSV- tk herpes virus thymidine kinase gene
  • diphtheria toxin A gene etc.
  • the “knock-in vector retaining a DNA construct” of the present invention refers to the ability to insert the DNA construct for producing the non-human animal into a target gene region in a host by homologous recombination.
  • a 5 ′ arm base sequence homologous to the 5 ′ upstream base sequence of the target region
  • 3 ′ on the 3 ′ side.
  • An 'arm base sequence homologous to the base sequence 3' downstream of the target region
  • the knock-in vector is constructed so that the DNA construct for producing the non-human animal is inserted into the same reading frame of the target gene in the host.
  • a base sequence upstream from the translation start point of the target gene is preferably arranged on the 5 ′ side of the translation start point of any foreign gene.
  • the 5 ′ end of the exon / intron structure serves as the translation start point of the target gene. It is preferable that the translation start point is inserted into an exon so as to match.
  • a base sequence upstream from the translation start point of the target gene is preferably arranged upstream of the 5 ′ end of the 5 ′ end of the exon-intron structure.
  • the knock-in vector of the present invention preferably has the ability to replicate in the host cell.
  • a vector can be constructed, for example, by inserting a DNA for producing the non-human animal into a known vector.
  • the knock-in vector is not particularly limited as long as it is a vector used for genetic engineering. Examples of known vectors include plasmid vectors, cosmid vectors, bacterial artificial chromosome (BAC) vectors, yeast artificial chromosome (YAC) vectors, and retroviruses. Examples include, but are not limited to, vectors, lentiviral vectors, and other viral vectors.
  • the “transformed cell into which a knock-in vector has been introduced” of the present invention is a cell into which a knock-in vector that holds DNA for producing the non-human animal has been introduced.
  • the transformed cell of the present invention is a human having an exon / intron structural sequence added to the 5 ′ side and a 3 ′ untranslated region of the non-human animal GPC3 gene added to the 3 ′ side.
  • the transformed cell of the present invention has an exon / intron structural sequence added to the 5 ′ side and a 3 ′ untranslated region of a non-human animal beta globin added to the 3 ′ side.
  • the host cell into which the knock-in vector is introduced is a cell (including a population of cells) that can differentiate into the non-human animal cell or the non-human animal cell. As such a host cell, various cells can be used according to the purpose.
  • pluripotent stem cells such as embryonic stem cells (ES cells) and induced pluripotent stem cells (iPS cells), sperm stem cells, etc.
  • Germline stem cells that have the ability to differentiate into germ cells, fertilized eggs.
  • the knock-in vector into the host cell can be performed by a known method such as electroporation.
  • the present invention provides a cell transformed with the knock-in vector of the present invention, a genetically modified non-human animal generated from the cell, and a model animal in which a cancer cell is transplanted or induced to carcinogenesis into the genetically modified non-human animal.
  • the present invention uses these genetically modified non-human animals and model animals to characterize antigen-binding substances and test substances for evaluating the therapeutic action of cancer, such as cell growth inhibitory action, safety, or pharmacokinetics. On how to evaluate
  • a method for producing a non-human animal that expresses human GPC3 polypeptide comprises a knock-in vector carrying a DNA encoding the human GPC3 gene as a host cell. Including the introduction.
  • the method for introducing a knock-in vector carrying DNA encoding the human GPC3 gene is not particularly limited, but microinjection of the knock-in vector into the pronucleus of fertilized eggs, pluripotent stem cells such as ES cells and iPS cells, sperm stem cells, etc.
  • Well-known techniques such as electroporation (electroporation), lipofection, viral infection, transformation and the like can be appropriately used.
  • the knock-in vector is an artificial nuclease such as Zinc Finger Nuclease (ZFN) or Transcription Activator-like Effector Nuclease (TALEN) that binds to and cleaves a target sequence specific to a target region on the genome.
  • ZFN Zinc Finger Nuclease
  • TALEN Transcription Activator-like Effector Nuclease
  • a chimeric animal is obtained by injecting a pluripotent stem cell into which a knock-in vector has been introduced into an early embryo by a known method such as microinjection, and transplanting it to a foster parent for development. be able to. Moreover, by breeding this chimeric animal, an individual in which the knock-in allele is homozygous can be obtained from its progeny.
  • germline stem cells when germline stem cells are used, cells that have undergone targeted recombination by introducing a knock-in vector by a known method are transplanted into the gonad of an animal to differentiate into germ cells, Knock-in animals can be created by mating animals or using germ cells collected from animals (Kanatsu-Shinohara, M. et al. (2008) Biol. Reprom. 79, 1121 -1128).
  • a fertilized egg when used, it is possible to produce a knock-in animal by transplanting and generating a fertilized egg into which a knock-in vector is injected together with an artificial nuclease or the like.
  • literature Cui, X. et al. (2011) Nat. Biotechnol. 29, 64-67
  • literature Li, T. et al. (2011) Nucleic Acids Res. 39, 6315-6325.
  • the method using CRISPR / Cas9 is described in the literature (Yang, H. et al. (2013) Cell. In press.).
  • the knock-in allele is obtained by injecting a knock-in vector into the testis or ovary of an animal, directly recombining germ cells by a technique such as electroporation, and then mating. It is also possible to obtain individuals with (Niu, Y. et al. (2008) J. Genet. Genomics. 35, 701-714).
  • the genetically modified non-human animal can be a homozygous having a knock-in allele in homozygote or a hemizygous having a single copy of a knock-in allele.
  • a homozygote is preferable in order to stably preserve the modified character during breeding. Since GPC3 is located on the X chromosome, it can be a homozygote in the case of female (XX) but hemi in the case of male (XY). Female hemizygotes, on the other hand, express human GPC3 due to the presence of the knock-in allele, but are also deficient in the endogenous GPC3 allele, so its expression is also suppressed.
  • the present invention relates to a method for producing a non-human animal that expresses a human GPC3 polypeptide comprising the following steps: (A) a step of introducing a gene encoding human GPC3 into an endogenous GPC3 allele of a stem cell genome of a non-human animal by introducing the knock-in vector of the present invention into the stem cell of the non-human animal; (B) a step of transplanting the non-human animal stem cells of step (A) into an early embryo of the same non-human animal; (C) a step of generating an early embryo of step (B) by transplanting it into a uterus of a foster parent non-human animal to obtain a non-human chimeric animal having a genome having a knock-in vector introduced into a somatic cell; and (D ) The step of breeding the chimeric animal of step (C) to obtain an individual homozygous for the knock-in allele from its progeny.
  • the present invention relates to a method for producing a non-human animal that expresses a human GPC3 polypeptide comprising the following steps: (A) a step of introducing the knock-in vector of the present invention into a fertilized egg of a non-human animal and incorporating a gene encoding human GPC3 into an endogenous GPC3 allele of the fertilized egg genome of the non-human animal; (B) a step of generating a non-human animal fertilized egg of step (A) by transplanting it into the uterus of a foster parent non-human animal to obtain a non-human animal having a genome having a knock-in vector introduced into a somatic cell; and (C ) A step of breeding the non-human animal of step (B) to obtain an individual in which the knock-in allele is homozygous from its progeny.
  • the knock-in vector usually retains the human GPC3 cDNA in an expressible manner, and the expression cassette containing the human GPC3 cDNA and its expression control region is used as an endogenous GPC3 allele on the genome of a non-human animal. Sandwiched between recombination regions for incorporation into
  • the non-human animal of the present invention has safety, therapeutic effect on disease, pharmacokinetics, biodistribution in the test substance. It can be used for various evaluations. Therefore, the present invention also provides a test substance evaluation method using such a non-human animal of the present invention.
  • the present invention includes a non-human animal for use in various evaluations and / or screenings such as safety, therapeutic effect of a disease, pharmacokinetics, biodistribution, etc., in a test substance.
  • the present invention relates to the use of the non-human animal of the present invention for use in various evaluations and / or screenings of a test substance, such as safety, therapeutic effect of a disease, pharmacokinetics, biodistribution, etc. Including.
  • test substance used in the evaluation method of the present invention is not particularly limited, and examples thereof include peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts and the like. Preferably, it is an antibody against human GPC3, and examples thereof include known antibodies described in WO2003 / 000883, WO2004 / 022739, WO2006 / 006693, WO2007 / 047291, WO2006 / 046751, WO2009 / 041062, and WO2016 / 047722, etc. .
  • Administration of the test substance to a non-human animal can be performed by, for example, tail vein administration, subcutaneous administration, intraperitoneal administration, oral administration, nasal administration, transdermal administration, pulmonary administration, etc., but is not limited thereto. .
  • test substance evaluation For example, a test substance is administered to the non-human animal of the present invention, and plasma cytokines (for example, IFN-gamma, IL-10, IL-17, IL-2, IL-4, IL-6 and TNF are included)
  • plasma cytokines for example, IFN-gamma, IL-10, IL-17, IL-2, IL-4, IL-6 and TNF are included
  • the safety of the test substance with respect to the living body can be evaluated. More specifically, the risk of test compound safety is indicated when the cytokine level is compared to the level of the same cytokine in a control and a difference is seen in both.
  • the “safety risk” means that a biological reaction that causes some disadvantage in a living body is predicted by a change in cytokine level.
  • cytokine levels The role of cytokines represented by IFN-gamma, IL-10, IL-17, IL-2, IL-4, IL-6, TNF, etc. Much information has been accumulated on the relationship between changes in cytokine levels during treatment and biological responses. Thus, one skilled in the art can predict the safety risk suggested by changes in cytokine levels.
  • the expression level of the human GPC3 gene in one or more organs of the non-human animal is equivalent to that of mouse, monkey or human
  • the safety test results using the non-human animal are Alternatively, it is possible to extrapolate to humans and predict effects in mice, monkeys or humans.
  • the non-human animal may contain cancer cells that express human GPC3.
  • the treatment of the test substance can be evaluated.
  • the therapeutic effect may be paraphrased as an antitumor effect or a cytotoxic activity. Whether or not the growth of cancer cells contained in the non-human animal has been suppressed can be evaluated by measuring the size of the cancer cells and changes thereof.
  • the non-human animal of the present invention containing cancer cells that express human GPC3 polypeptide includes non-human animals transplanted with cancer cells that express human GPC3 polypeptide.
  • the non-human animal that expresses the human GPC3 polypeptide exhibits immunological tolerance to the human GPC3 polypeptide. Therefore, even when a cancer cell expressing a human GPC3 polypeptide is transplanted into a non-human animal that expresses the human GPC3 polypeptide of the present invention, the non-human animal does not show an immune response to the cancer cell. . Therefore, the therapeutic effect of the test substance can be more accurately evaluated by using the non-human animal of the present invention as a model.
  • the non-human animal of the present invention containing cancer cells that express human GPC3 polypeptide is the non-human animal of the present invention that has developed cancer.
  • the cancer may be naturally developed or artificially induced to develop.
  • Non-human animal models that induce the onset of cancer and methods for producing the same are known. Specifically, for example, by causing insulin resistance in a non-human animal and performing high-fat diet loading, a pathological condition that progresses to hepatitis, liver fibrosis, and cirrhosis develops, and is associated with the progress of the pathological condition.
  • An animal model for developing liver cancer and a method for producing the same (WO2011013247 A1) are known.
  • CDAHFD Choline-deficient, L-amino acid-defined high fat diet containing 0.1% methionine
  • the present invention provides a model animal for evaluating the therapeutic effect of cancer by a test compound.
  • a model animal for evaluating the therapeutic effect of cancer based on the present invention can be produced using the genetically modified non-human animal of the present invention. That is, this invention relates to the manufacturing method of the model animal for evaluating the therapeutic effect of the cancer by a test compound including the following processes: (A) a step of introducing a gene encoding human GPC3 into an endogenous GPC3 allele of a stem cell genome of a non-human animal by introducing the knock-in vector of the present invention into the stem cell of the non-human animal; (B) a step of transplanting the non-human animal stem cells of step (A) into an early embryo of the same non-human animal; (C) a step of generating an early embryo of step (B) by transplanting it into the uterus of a temporary parent non-human animal to obtain a non-human animal chimeric animal having a genome having a knock-in vector introduced into a somatic
  • the present invention also provides another model animal for evaluating the therapeutic effect of cancer by the test compound.
  • a model animal for evaluating the therapeutic effect of cancer based on the present invention can be produced using the genetically modified non-human animal of the present invention. That is, this invention relates to the manufacturing method of the model animal for evaluating the therapeutic effect of the cancer by a test compound including the following processes: (A) a step of introducing the knock-in vector of the present invention into a fertilized egg of a non-human animal and incorporating a gene encoding human GPC3 into an endogenous GPC3 allele of the fertilized egg genome of the non-human animal; (B) a step of generating a non-human animal fertilized egg of step (A) by transplanting it into the uterus of a foster parent non-human animal to obtain a non-human animal having a genome having a knock-in vector introduced into a somatic cell; and (C ) Breeding the non-human animal of step (B) to obtain an individual homozygous for the knock
  • cancer cells transplanted into the non-human animal of the present invention include, for example, ovarian cancer, prostate cancer, breast cancer, esophageal cancer, kidney cancer, uterine cancer, liver cancer.
  • Preferable examples include lung cancer, pancreatic cancer, stomach cancer, bladder cancer, and colon cancer cells.
  • cancer described in the present specification includes not only epithelial malignant tumors such as ovarian cancer and gastric cancer but also non-epithelial malignancies including hematopoietic cancer such as chronic lymphocytic leukemia and Hodgkin lymphoma. Tumor also means.
  • the transplanted cancer cell in this invention is a cancer cell which expresses GPC3.
  • the cancer cells transplanted into the genetically modified non-human animal can be cancer cells derived from any animal.
  • cancer cells derived from the same species as the host non-human animal are preferable as transplanted cancer cells (allogeneic transplantation).
  • species with controlled strains such as mice and rats for laboratory animals as genetically modified non-human animals
  • a cancer cell having as high genetic commonness as possible to be a transplanted cancer cell an action not caused by a test compound such as a host immune response against the cell itself is suppressed, and the test compound against cancer The therapeutic effect can be evaluated more specifically.
  • cancer cells can be transplanted, for example, subcutaneously. Alternatively, the transferability of the test compound to the tissue can be evaluated by transplantation into a specific tissue.
  • the effective blood concentration or pharmacokinetic characteristics of the test substance can be evaluated by measuring the blood concentration of the test substance.
  • “pharmacokinetic characteristics” means characteristics such as blood half-life and elimination rate of a test substance in an animal body.
  • a substance with a lower effective blood concentration, a longer blood half-life, or a slower elimination rate is judged to have better pharmacokinetic properties.
  • the method for measuring the blood concentration of the test substance is not particularly limited. When the test substance is a protein (including an antibody), for example, an ELISA method can be used.
  • test substance is a low molecular weight compound
  • a liquid chromatograph-mass spectrometry (LC-MS) method can be used.
  • LC-MS liquid chromatograph-mass spectrometry
  • the degree of arrival of the test substance at the target site and the biodistribution characteristics can be evaluated by observing the distribution of the test substance in the body.
  • the non-human animal of the present invention transplanted with cancer cells expressing human GPC3 is administered with a human GPC3 target therapeutic drug combined with an imaging agent as a test substance, and the imaging agent is detected to detect the test substance.
  • the distribution in the body can be observed.
  • Radionuclides used for imaging include I-131, I-123, In-111 and Tc-99m for SPECT imaging, and F-18, I-124, Cu-64, Y-86 for PET imaging. However, it is not limited to these.
  • the degree of accumulation of the test substance in cancer cells is high as a result of detection of the imaging agent, the test substance is evaluated as having high specificity for cancer cells.
  • the present invention further includes the following steps (1) to (2): (1) the step of bringing the test substance into contact with the non-human animal of the present invention, its organ, tissue or cell, and (2) either the medicinal effect or toxicity of the test substance on the individual of the non-human animal, its organ, tissue or cell, Or a method for screening a therapeutic agent for malignant neoplastic disease or autoimmune disease, comprising the step of selecting a candidate test substance using both as indices.
  • the non-human animal may have been transplanted with cancer cells that express human GPC3.
  • the therapeutic effect (medicine effect) and / or safety (toxicity) of the test substance on the non-human animal individual, its organ, tissue or cell of the present invention is measured, and the test is confirmed or highly effective.
  • a substance can be selected, or a test substance with low or no toxicity can be selected.
  • the same measurement can be performed using a substance having a medicinal effect as a comparative control, and a test substance having a higher medicinal effect or lower toxicity than the control can be selected.
  • the drug effect is not particularly limited, and examples thereof include a cell growth inhibitory action, a cytotoxic action, or a tumor growth inhibitory action.
  • the present invention provides the following steps (1) to (3): (1) A step of administering a cancer cell expressing human GPC3 to a first individual of the transplanted non-human animal of the present invention using an antigen-binding molecule containing a human GPC3 binding domain as a test substance, (2) a step of measuring either or both of the cell growth inhibitory effect and pharmacokinetic properties of the test substance on the cancer cells, and (3) the cell growth inhibitory effect and pharmacokinetics of the test substance.
  • a method of screening for a therapeutic agent for a malignant neoplastic disease comprising the step of comparing with either or both of an inhibitory effect and a pharmacokinetic property.
  • the screening step of the present invention further includes (4) a step of selecting a test substance having excellent cell growth inhibitory effect and / or pharmacokinetic properties as a result of the step (3), or both. Can do.
  • the cell growth inhibitory effect and pharmacokinetic properties of the control antibody need not necessarily satisfy both at the same time. Rather, by repeating the process of screening candidates using one that has a certain evaluation, the test substance having a better effect on both characteristics is effectively squeezed as a result. be able to.
  • the present invention also provides a method for selecting such an antibody.
  • a non-human animal transplanted with a cancer cell line that expresses human GPC3 and then administered an antibody against human GPC3 as a test substance it was measured whether the growth of the cancer cell line was suppressed. By selecting an antibody that suppresses the growth, an antibody that efficiently inhibits the growth of cancer cells that express human GPC3 can be obtained. Further, in a non-human animal administered with an antibody against human GPC3, an antibody against human GPC3 having a desired pharmacokinetics can be obtained by measuring the blood concentration of the antibody and selecting an antibody having the desired blood concentration. Can be acquired.
  • the antibody whose activity has been evaluated and selected in this way is a mouse monoclonal antibody, etc.
  • the antibody is chimerized or humanized and obtained when it is administered to humans with less antigenicity and thus fewer side effects. can do.
  • the antibody thus obtained can be used as a therapeutic agent useful for the treatment of cancer expressing GPC3.
  • the cancer that is the target of the therapeutic agent evaluated, screened, or selected by the above method is any cancer as long as the target GPC3 is highly expressed.
  • cancers include breast cancer, cervical cancer, colon cancer, endometrial cancer, head and neck cancer, liver cancer, lung cancer, malignant carcinoid, and malignant glioma.
  • the cancer selected from cancer etc. is illustrated.
  • TCR T-cell receptor
  • TCR ⁇ and ⁇ chains (or ⁇ and ⁇ chains) that bind to an antigen, and a plurality of CD3 molecules (CD3 epsilon ( ⁇ ), CD3 delta ( ⁇ ), CD3 gamma ( ⁇ )) and CD247.
  • CD3 ⁇ may be represented as CD3E, CD3 ⁇ as CD3D, CD3 ⁇ as CD3G, etc., but in the present specification, it does not depend on the species.
  • CD3 ⁇ , CD3 ⁇ and CD3 ⁇ are used. That is, in the present invention, CD3 ⁇ includes CD3E and CD3e, CD3 ⁇ includes CD3D and CD3d, and CD3 ⁇ includes CD3G and CD3g.
  • CD3 ⁇ includes CD3E and CD3e
  • CD3 ⁇ includes CD3D and CD3d
  • CD3 ⁇ includes CD3G and CD3g.
  • human CD3 ⁇ refers to the human gene CD3 epsilon
  • mouse Cd3 ⁇ refers to the mouse gene Cd3 epsilon.
  • human CD3 ⁇ means CD3 delta of a human gene
  • mouse Cd3 ⁇ means Cd3 delta of a mouse gene
  • human CD3 ⁇ means CD3 gamma of a human gene
  • mouse Cd3 ⁇ means Cd3 gamma of a mouse gene.
  • one or more types of CD3 selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ are not particularly limited, but may be, for example, human CD3 ⁇ .
  • two or more kinds of CD3 selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ may be used, for example, human CD3 ⁇ and CD3 ⁇ , or human CD3 ⁇ and CD3 ⁇ , or human CD3 ⁇ and CD3 ⁇ .
  • it may be CD3 composed of human CD3 ⁇ , CD3 ⁇ , and CD3 ⁇ , that is, all three types.
  • Non-human animal that functionally expresses human CD3 gene The present invention also provides that at least one CD3 gene selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ , and CD3 ⁇ is functionally deleted on the genome, and human CD3 ⁇ And a genetically modified non-human animal that functionally expresses at least one human CD3 gene selected from the group consisting of CD3 ⁇ and CD3 ⁇ .
  • the endogenous gene is functionally defective on the genome
  • the endogenous target gene for example, CD3 ⁇ , CD3 ⁇ or CD3 ⁇
  • the embodiment is not limited, and may be an endogenous target gene (eg, CD3 ⁇ , CD3 ⁇ or CD3 ⁇ ) or protein that does not express on the non-human animal genome.
  • target on the genome of non-human animals may be deleted (invalidated), or a method of completely suppressing the expression of the target gene using siRNA or the like may be used. Further, as long as the endogenous target gene is not expressed, the foreign gene may be inserted at the position of the target gene on the non-human animal genome using, for example, a knock-in technique.
  • the animal in which at least one CD3 gene selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ is functionally deficient in the genome is a foreign CD3 such as a human CD3 gene. If not expressed, the differentiation and generation of mature T cells is inhibited.
  • the mature T cells are, for example, T cells positive for either CD4 or CD8 (but not both) (CD4 single positive cells and CD8 single positive cells, respectively). More specifically, when exogenous CD3 such as human CD3 gene is not expressed, the animal is functionally deficient in at least one CD3 gene selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ .
  • the sum of CD4 single positive cells and CD8 single positive cells in the spleen is, for example, 70% or less, preferably 60% or less, more preferably 50% or less, compared to the wild-type level or a level that is usually normal. 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, 3% or less, or 1% or less.
  • the developmental stage for counting mature T cells may be any stage as long as it is a stage where mature T cells are generated in the wild type. In general, however, it is preferably an adult (reproductive) age. It may be ⁇ 12 weeks old, for example 12 weeks old.
  • an animal in which at least one CD3 gene selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ is functionally deleted on the genome is a foreign species such as a human CD3 gene.
  • CD3 When CD3 is not expressed, antibody production is inhibited.
  • the type of antibody is not particularly limited. For example, production of IgG (eg, IgG1) may be inhibited, and / or production of IgE may be inhibited. Whether or not antibody production is inhibited can be determined by inoculating a foreign antigen and determining whether or not antibodies are produced or measuring the amount of antibody production.
  • the foreign antigen is not particularly limited, and antibody production can be confirmed using a desired antigen such as chicken ovalbumin (OVA).
  • OVA chicken ovalbumin
  • the antibody titer in an animal in which at least one CD3 gene selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ is functionally deficient in the genome is wild type For example, 70% or less, preferably 60% or less, more preferably 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, 3% or less, or 1% or less.
  • the developmental stage for measuring antibody production may be any stage as long as it is a stage in which antibodies are produced in the wild type. In general, however, it is preferably an adult age. It may be age.
  • the endogenous CD3 gene that is deficient in function may be any one or more selected from the group consisting of CD3 ⁇ , CD3 ⁇ , and CD3 ⁇ , for example, those that are at least functionally deficient in the endogenous CD3 ⁇ gene It may be.
  • Those that are functionally deficient in two or more types are also preferred, for example, endogenous CD3 ⁇ and CD3 ⁇ , or endogenous CD3 ⁇ and CD3 ⁇ , or endogenous CD3 ⁇ and CD3 ⁇ are at least functionally deficient.
  • all of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ may be functionally deficient.
  • “functionally expressing the human CD3 gene” means that human CD3 molecules are expressed on T cells of non-human animals, but in these non-human animals, immunocompetent cells including T cells are normal. It means a state that maintains a function.
  • whether or not the immunocompetent cells maintain normal function is determined, for example, by the T cell differentiation process of the non-human animal, the T cell maturation process, the thymus weight, the number of thymocytes, the functional T cells in the spleen
  • the ratio of CD4 and CD8 positive cells can be determined as an index.
  • the genetically modified non-human animal of the present invention preferably has the ability to differentiate and generate mature T cells.
  • functional expression of the human CD3 gene in the present invention may mean that mature T cells are generated in the animal.
  • the genetically modified non-human animal of the present invention is a mouse
  • the same number of thymocytes in normal mice means that the number of thymocytes in a genetically modified non-human animal is at least 1 ⁇ 10 4 or more, preferably 1 ⁇ 10 5 or more, 5 ⁇ 10 5 or more.
  • the ratio of Cd4 or Cd8 positive cells which are functional T cell surface markers, is equivalent to that of normal mice.
  • the ratio of Cd4 and Cd8 positive cells in mature T cells in normal mice is equivalent to the ratio of Cd4 positive cells in the total number of mature T cells when evaluated in the spleen.
  • the ratio is 10 to 40%, 12 to 38%, 14 to 36%, 16 to 34%, 18 to 32%, particularly preferably 20 to 30%.
  • the ratio of Cd8 positive cells in the total number of mature T cells is preferably 5-30%, 7-28%, 9-26%, 11-24%, 13-22%, particularly preferably 15- The ratio is 20%.
  • a method for evaluating the thymus weight and the number of thymus cells of non-human animals and the abundance ratio of CD4 positive cells and CD8 positive cells in the periphery for example, those skilled in the art can use well-known analysis methods such as the analysis methods described in Examples described later. Can be evaluated as appropriate. It is desirable that immunocompetent cells including T cells of human CD3-substituted mice have the same cell proliferation ability after mitogen stimulation as compared to wild-type mice.
  • “Equivalent” means that the evaluation value by thymidine incorporation, bromodeoxyuridine incorporation, MTS assay, CFSE [5- (and 6) -carboxyfluorescein diacetate succinimidyl ester] assay after mitogen stimulation is preferably 65% of the wild type. It is ⁇ 135%, 70% to 130%, 75% to 125%, 80% to 120%, particularly preferably 85 to 115%.
  • the genetically modified non-human animal of the present invention is compared with a control that does not express a human CD3 gene (an animal that lacks the endogenous CD3 gene in the same combination as the animal)
  • the ability to generate mature T cells is increased.
  • the sum of CD4 single positive cells and CD8 single positive cells in the spleen is, for example, 1.3 times or more, preferably 1.5 times or more, more preferably 1.6 times or more, 2 times or more, compared to the control, 3 times or more, 4 times or more, 5 times or more, 10 times or more, 20 times or more, 50 times or more, or 100 times or more.
  • the developmental stage for counting the mature T cells may be any stage as long as it is a stage where mature T cells are generated in the animal of the present invention. In general, however, it is preferably an adult age. It may be a week old, for example 12 weeks old.
  • the genetically modified non-human animal of the present invention has an ability to produce an antibody against a foreign antigen, for example.
  • the type of antibody is not particularly limited, and may be, for example, IgG (for example, IgG1) or IgE.
  • the foreign antigen is not particularly limited, and antibody production can be confirmed using a desired antigen such as chicken ovalbumin (OVA).
  • OVA chicken ovalbumin
  • the genetically modified non-human animal of the present invention is compared with a control that does not express a human CD3 gene (an animal that lacks the endogenous CD3 gene in the same combination as the animal) High antibody production ability.
  • the type of antibody is not particularly limited, and may be, for example, IgG (for example, IgG1) or IgE. Whether or not the antibody producing ability is increased can be determined by inoculating a foreign antigen to produce antibodies or by measuring the amount of antibody production.
  • the foreign antigen is not particularly limited, and antibody production can be confirmed using a desired antigen such as chicken ovalbumin (OVA).
  • OVA chicken ovalbumin
  • the genetically modified non-human animal of the present invention has an antibody titer of, for example, 1.3 times or more, preferably 1.5 times or more, more preferably 1.6 times or more, 2 times or more, 3 times or more, 4 times or more, 5 It is more than 10 times, more than 10 times, more than 20 times, more than 50 times, or more than 100 times.
  • the developmental stage for inducing antibody production may be any stage as long as it is a stage in which an antibody is produced in the animal of the present invention. In general, however, it is preferably an adult age, for example, 8-12 weeks of age for a mouse, It can be 12 weeks old. Antigen sensitization and antibody measurement time may be designed as appropriate.
  • sensitization is performed twice at 4-week intervals, and 100 ⁇ g of antigen is first sensitized subcutaneously on the back using complete Freund's adjuvant. After 4 weeks, sensitization can be performed subcutaneously in the back using incomplete Freund's adjuvant, and blood can be collected 1 week after the second sensitization to determine the antibody titer.
  • the state in which immunocompetent cells including T cells maintain normal functions refers to functions related to acquired immunity of genetically modified non-human animals (humoral immunity, cellular immunity). ) Includes a state in which normal functions are maintained.
  • the genetically modified non-human animal of the present invention has a full-length base sequence of at least one human CD3 gene selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ inserted into the genome.
  • a genetically modified non-human animal With respect to the full-length base sequence inserted on the genome, one or more types of CD3 selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ are not particularly limited, and may be, for example, the full-length base sequence of human CD3 ⁇ .
  • CD3 selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ , for example, full length base sequence of human CD3 ⁇ and full length base sequence of CD3 ⁇ , or full length base sequence of human CD3 ⁇ and CD3 ⁇ It may be a full-length base sequence, or a full-length base sequence of human CD3 ⁇ and a full-length base sequence of CD3 ⁇ . Further, it may be CD3 consisting of the full length base sequence of human CD3 ⁇ , the full length base sequence of CD3 ⁇ , and the full length base sequence of CD3 ⁇ , that is, all three types.
  • the “full-length base sequence” of the CD3 gene is a base sequence encoding a CD3 molecule (CD3 ⁇ , CD3 ⁇ , CD3 ⁇ ) including an extracellular region, a transmembrane region, and a cytoplasmic region. Further, it may be a base sequence including an expression regulatory region (promoter).
  • a non-limiting embodiment of the present invention is characterized in that a T cell receptor derived from a non-human animal and a human CD3 molecule form a complex on the T cell of the above-described genetically modified non-human animal.
  • a genetically modified non-human animal is provided.
  • CD3 ⁇ forms a dimer with CD3 ⁇ or CD3 ⁇ , and these dimers form a complex with a T cell receptor (TCR) ⁇ chain and a TCR ⁇ chain, thereby forming a functional TCR.
  • TCR T cell receptor
  • a human-derived TCR ⁇ chain and ⁇ chain are produced on the non-human animal T cell.
  • CD3 ⁇ , CD3 ⁇ and / or CD3 ⁇ can form a complex.
  • the above-described genetically modified non-human animal of the present invention further expresses a human cancer-specific antigen gene, a human immune checkpoint gene, and / or a human immune co-stimulatory molecule gene. It may be a genetically modified non-human animal.
  • a human cancer-specific antigen means an antigen expressed by a cancer cell that makes it possible to distinguish between cancer cells and healthy cells. For example, an antigen or cell expressed as a cell becomes malignant is cancer. It contains abnormal sugar chains that appear on the cell surface and protein molecules.
  • Immune checkpoint refers to a molecule that is expressed on an immunocompetent cell and transmits a signal that inhibits an immune response to the immunocompetent cell by binding to a ligand.
  • Immune checkpoints and their ligands include, for example, PD-1, CTLA-4, TIM3, LAG3, PD-L1, PD-L2, BTNL2, B7-H3, B7-H4, CD48, CD80,2B4, BTLA, CD160 , ⁇ CD60, CD86, or molecules such as VISTA, but are not limited to these.
  • an “immune costimulatory molecule” refers to a molecule that is expressed on an immunocompetent cell and transmits a signal that activates an immune response to the immunocompetent cell by binding to a ligand.
  • immune co-stimulatory molecules include CD28, ICOS, CD137, CD137L, CD40, CD40L, OX40, OX40L, CD27, CD70, HVEM, LIGHT, RANK, RANKL, CD30, CD153, GITR, GITRL, etc.
  • the present invention is not limited to this.
  • the above-mentioned genetically modified animal that further expresses a human cancer-specific antigen gene, a human immune checkpoint gene, and / or a human immune co-stimulatory molecule is not limited thereto, but a genetically modified animal that expresses a human CD3 gene And a genetically modified animal that expresses a human cancer-specific antigen gene, a human immune checkpoint gene, and / or a human immune co-stimulatory molecule, etc.
  • the non-human animal functionally expressing the human CD3 gene of the present invention is exemplified by a genetically modified non-human animal disclosed in WO2017 / 010423 or WO2016 / 085889.
  • a method for producing a non-human animal that functionally expresses the human CD3 gene is also exemplified by the method disclosed in WO2017 / 010423 or WO2016 / 085889.
  • Non-human animal expressing human GPC3 polypeptide and functionally expressing human CD3 gene The present invention also relates to a non-human animal expressing human GPC3 polypeptide and functionally expressing human CD3 gene.
  • the non-human animal that expresses human GPC3 polypeptide and functionally expresses the human CD3 gene of the present invention comprises: (I) lacks endogenous GPC3 polypeptide expression, expresses human GPC3 polypeptide, and (Ii) At least one or more CD3 genes selected from the group consisting of endogenous CD3 ⁇ , CD3 ⁇ and CD3 ⁇ are functionally deficient on the genome and at least one or more selected from the group consisting of human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ Functionally expresses the human CD3 gene of It is a genetically modified non-human animal.
  • a non-human animal that expresses a human GPC3 polypeptide and functionally expresses a human CD3 gene of the invention is a non-human that expresses a human GPC3 polypeptide disclosed herein. It can be obtained by mating an animal with a non-human animal that functionally expresses the human CD3 gene disclosed herein. At this time, whether or not the target non-human animal has been obtained is determined by mating a non-human animal that expresses the human GPC3 polypeptide and a non-human animal that functionally expresses the human CD3 gene. This can be determined by analyzing the genotype of the individual and confirming that the human GPC3 knock-in allele, the non-human CD3 gene region-deficient allele, and the allele having the human CD3 gene region are transmitted.
  • the present invention includes a non-human animal for use in various evaluations and / or screenings such as safety, therapeutic effect of a disease, pharmacokinetics, biodistribution, etc., in a test substance.
  • the present invention expresses a human GPC3 polypeptide for use in various evaluations and / or screenings in a test substance, such as safety, therapeutic effect of diseases, pharmacokinetics, biodistribution, and the like. It also includes the use of non-human animals that functionally express the human CD3 gene.
  • the test substance used in the above evaluation method is not particularly limited, but is preferably a peptide that binds to human GPC3, a protein, a non-peptide compound, a synthetic compound, a fermentation product, a cell, a cell extract, an antibody or It is an antibody fragment or a peptide, protein, non-peptidic compound, synthetic compound, fermentation product, cell, cell extract, antibody or antibody fragment that binds to human CD3.
  • An antibody that binds to human GPC3 or an antibody that binds to human CD3 is preferred, and a multispecific antibody that binds to human GPC3 and human CD3 is more preferred. Examples of multispecific antibodies that bind to human GPC3 and human CD3 include known antibodies described in WO2016 / 047722.
  • various evaluation methods disclosed as "method for evaluating a test substance using a non-human animal that expresses a human GPC3 polypeptide” are expressed as follows: a human GPC3 polypeptide is expressed and a human CD3 gene is expressed as It is of course possible to carry out using non-human animals that are functionally expressed.
  • Antigen-binding molecule in the present specification is not particularly limited as long as it is a molecule containing an antigen-binding domain, and may further include peptides and proteins having a length of about 5 amino acids or more.
  • the polypeptide is not limited to biologically derived peptides or proteins, and may be, for example, a polypeptide having an artificially designed sequence. Moreover, any of natural polypeptide, synthetic polypeptide, recombinant polypeptide, etc. may be sufficient.
  • a preferable example of an antigen-binding molecule includes an antigen-binding molecule containing an FcRn binding domain contained in the Fc region of an antibody.
  • an antigen-binding molecule containing an FcRn binding domain contained in the Fc region of an antibody.
  • a method for extending the blood half-life of a protein administered into a living body a method of adding the FcRn binding domain of an antibody to a target protein and utilizing the recycling function via FcRn is well known.
  • a preferable example of an antigen molecule can include an antibody.
  • an antibody refers to an immunoglobulin that is naturally occurring, or that has been partially or completely synthesized, or a fragment thereof.
  • the antibody can be isolated from natural resources such as plasma and serum in which it naturally exists, or from the culture supernatant of hybridoma cells producing the antibody, or partially or completely by using techniques such as genetic recombination Can be synthesized.
  • Preferred examples of antibodies include immunoglobulin isotypes and subclasses of those isotypes.
  • human immunoglobulins nine classes (isotypes) of IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgD, IgE, and IgM are known.
  • the antibody may include IgG1, IgG2, IgG3, and IgG4 among these isotypes.
  • the antibody provided herein is a chimeric antibody.
  • Certain chimeric antibodies are described, for example, in US Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984).
  • a chimeric antibody comprises a non-human variable region (eg, a variable region derived from a non-human primate such as a mouse, rat, hamster, rabbit, or monkey) and a human constant region.
  • a chimeric antibody is a “class switch” antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies also include antigen binding fragments thereof.
  • the antibodies provided herein are humanized antibodies.
  • Humanized antibodies and methods for their production are reviewed, for example, in Almagro and Francsson, Front and Biosci. 13: 1619-1633 (2008), and can be produced by various techniques known in the art.
  • the antibody provided herein is a human antibody.
  • Human antibodies can be produced by various techniques known in the art. Human antibodies are reviewed, for example, in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20: 450-459 (2008). .
  • the antibodies of the present invention may be isolated by screening combinatorial libraries for antibodies with the desired activity or activities. For example, various methods are known in the art for generating phage display libraries and screening such libraries for antibodies with the desired binding properties. Such methods are reviewed, for example, in Hoogenboom et al. In Methods in Molecular Biology 178: 1-37 (O'Brien et al., Ed., Human Press, Totowa, NJ, 2001).
  • the antibodies provided herein are multispecific antibodies (eg, bispecific antibodies).
  • Multispecific antibodies are monoclonal antibodies that have binding specificities at at least two different sites.
  • Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs with different specificities (Milstein and Cuello, Nature 305: 537 (1983), WO 93/08829, and Traunecker et al., EMBO J. 10: 3655 (1991)), and the knob-in-hole technology (see, eg, US Pat. No. 5,731,168).
  • Multispecific antibodies can manipulate electrostatic steering effects to create Fc heterodimeric molecules (WO2009 / 089004A1); bridge two or more antibodies or fragments (US patents) No. 4,676,980 and Brennan et al., Science, 229: 81 (1985)); making antibodies with two specificities using leucine zippers (Kostelny et al., J. Immunol., 148 (5 ): 1547-1553 (1992) ;); using the “diabody” technique to generate bispecific antibody fragments (Hollinger et al., Proc. Natl. Acad. Sci.
  • Modified antibodies with three or more functional antigen binding sites are also included in the antibodies herein (see, for example, US Patent Application Publication No. 2006/0025576 A1).
  • an antibody or fragment also includes a “dual-acting Fab” or “DAF” that includes one antigen-binding site that binds a particular antigen and a different antigen different from the antigen (eg, the US (See Patent Application Publication No. 2008/0069820)
  • the antibody or antibody fragment contains a substitution (eg, a conservative substitution), insertion, or deletion relative to a reference sequence, and includes post-translational modifications of the sequence.
  • Post-translational modifications include, but are not limited to, modification of pyroglutamic acid by pyroglutamylation of heavy or light chain N-terminal glutamine or glutamic acid.
  • hGPC3 knock-in vector ver.1 is an artificial chromosome in which the genomic region of the mouse glypican-3 gene (mGpc3) is cloned ( BAC)
  • BAC chromosome
  • the human glypican-3 gene (hGPC3) coding sequence SEQ ID NO: 10
  • hp7 sequence SEQ ID NO: 11
  • polyA addition signal SEQ ID NO: 12
  • loxP sequence SEQ ID NO: 7
  • neomycin resistance (neo) gene SEQ ID NO: 13
  • the hGPC3KI vector ver.2 is a plasmid vector that is about 800 bp in the 5 ′ upstream region of the target region of the mGpc3 gene, the second exon of mouse beta globin (SEQ ID NO: 14), intron (SEQ ID NO: 15), third Exon (SEQ ID NO: 16), hGPC3 gene coding sequence, polyA addition signal in mouse beta globin third exon, loxP sequence, neo gene, 3 ′ downstream region of mouse Gpc3 gene target region About 800 bp .
  • hGPC3KI vector ver.3 is a plasmid vector that contains about 800 bp of the 5 'upstream region of the target region of the mGpc3 gene, mouse beta globin second exon, intron, third exon, hGPC3 gene coding sequence, mGpc3 gene 3 'Untranslated region (SEQ ID NO: 17), about 800 bp of the 3' downstream region of the target region of the mGpc3 gene was inserted.
  • the structure of the vector is shown in FIG.
  • ZFN zinc finger nuclease
  • hGPC3KI vector ver.1 and hGPC3KI vector ver.2 were introduced into ES cells of C57BL (B6) by electroporation, and after selective culture with G418 Homologous recombinants were screened by PCR from the obtained drug resistant clones.
  • the hGPC3KI vector ver.2 is introduced into ES cells by electroporation with a ZFN plasmid vector or ZFN mRNA that cleaves the target sequence. And screened. For screening, the genome extracted from the drug-resistant clone was used as a PCR template.
  • composition of the PCR reaction solution for screening hGPC3KI vector ver.1 is as follows: Sample 1 micro-l, 2xGC buffer I 12.5 micro-l, dNTP (2.5 mM) 4 micro-l, primer (50 microM each) 0.1 micro-l, LA Taq (TAKARA) 0.25 micro-l, and distilled water 7.05 micro-l (25 micro-l in total).
  • PCR conditions were preheating at 94 ° C for 5 minutes, amplification cycles of 94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 5 minutes and 30 seconds, and 72 ° C for 7 minutes. Double heating for minutes.
  • forward primer [5′-AGATGGCTGCCTGTGACATTTCTGGAAGTGT-3 ′ (SEQ ID NO: 18)] and reverse primer [5′-CTGAATTAGTTCCCTTCTTCGGCTGGATAA-3 ′ (SEQ ID NO: 19)] were used.
  • a band was expected to be amplified to a size of about 5.5 kb if hGPC3KI vector ver.1 was inserted into the same reading frame of the mouse endogenous GPC3 gene.
  • the composition of the PCR reaction solution for screening hGPC3KI vector ver.2 was the same as the composition of the PCR reaction solution for screening hGPC3KI vector ver.1.
  • PCR conditions include pre-heating for 5 minutes at 94 ° C, 35 cycles of amplification cycles of 94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 3 minutes, and double heating for 7 minutes at 72 ° C It was.
  • forward primer [5′-ATGAGACCCAGCAAGCTACACGGGCT-3 ′ (SEQ ID NO: 20)] and reverse primer [5′-ACTTGAGCTCCATACTTGCAGACT-3 ′ (SEQ ID NO: 21)] were used.
  • a band was expected to be amplified to a size of about 2 kb if hGPC3KI vector ver.2 was inserted into the same reading frame of the mouse endogenous GPC3 gene.
  • hGPC3KI mouse ver.1 and hGPC3KI mouse ver.2 Homologous recombinant ES clones of hGPC3KI vector ver.1 and hGPC3KI vector ver.2 were suspended by trypsin treatment and washed with ES cell medium.
  • BALB / c female mice subjected to superovulation treatment were mated with male mice of the same strain by intraperitoneal administration of 5 IU horse chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG) at 48 hour intervals.
  • eCG horse chorionic gonadotropin
  • hCG human chorionic gonadotropin
  • the day when the plug of the female mouse was confirmed was 0.5 day, the uterus was perfused on the 3.5th day of pregnancy, and 10-15 ES cells were injected using the collected blastocyst as the host embryo.
  • the embryo after injection was transplanted into the uterus of a 2.5-day-old ICR recipient female of pseudopregnancy to obtain a litter.
  • Chimeric mice were obtained by injection of ES cells into blastocysts.
  • Male chimeric mice were mated with B6 female mice after sexual maturation, and the transfer of knock-in alleles to next-generation mice was confirmed by PCR. PCR was performed by the method described in Example 1 (3).
  • hGPC3KI mouse ver.3 Knock-in mice using hGPC3KI vector ver.3 were produced by introducing KI vector ver.3 and ZFN into fertilized eggs. Pronuclear fertilized eggs collected from B6 mice were injected with KI vector ver.3 and ZFN mRNA by the microinjection method. Among fertilized eggs injected with KI vector ver.3 and ZFN, those that had developed into 2-cell embryos were transplanted into the oviduct of ICR (recipient mouse). Founder mice containing the hGPC3KI vector ver.3 gene were identified by the PCR method.
  • the PCR reaction composition was the same as in Example 1 (3), and the primers and PCR conditions were the same as in the hGPC3KI vector ver.2 screening described in Example 1 (3).
  • a founder mouse in which a signal of about 2 kb was detected was obtained [FIG. 3 (c)].
  • the founder mouse was mated with a B6 male mouse after sexual maturation, and the transfer of the knock-in allele to the next generation mouse was confirmed.
  • the removal of the neo gene cassette was confirmed by PCR using genomic DNA obtained from weaned pups.
  • the PCR reaction composition was the same as in Example 1 (3). PCR conditions were as follows: preheating at 94 ° C for 5 minutes, 35 cycles of amplification cycle of 94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 2 minutes, and 72 ° C for 7 minutes. Double heating was used.
  • forward primer [5′-TGATGATGAAGATGAGTGCATTGGA-3 ′ (SEQ ID NO: 22)] and reverse primer [5′-TGGCCAGAACTACGGGTCCAGCT-3 ′ (SEQ ID NO: 23)] were used.
  • hGPC3KI mouse ver.1 As for the hGPC3KI mouse ver.1, a signal of about 2.5 kb was detected as an amplification product derived from the knock-in allele, whereas a signal of about 1 kb was detected in the individual sample from which the neo cassette was removed [FIG. (A)].
  • hGPC3KI mouse ver.2 a signal of about 3 kb was detected as an amplification product derived from the knock-in allele, whereas a signal of about 1.6 kb was detected in the individual sample from which the neo cassette was removed. [FIG. 4B].
  • PCR reaction composition was the same as in Example 1 (3).
  • PCR conditions for hGPC3KI mouse ver.1 were pre-heated at 94 ° C for 5 minutes, amplification cycles of 94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 15 seconds, and 72 ° C For 7 minutes.
  • PCR conditions for hGPC3KI mouse ver.2 were pre-heated at 94 ° C for 5 minutes, 94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 2 minutes amplification cycle 35 cycles, and 72 ° C For 7 minutes.
  • PCR conditions of 3 were preheating at 94 ° C for 5 minutes, 35 cycles of amplification cycles of 94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 20 seconds, and 72 ° C for 7 minutes. Double heating was used.
  • forward primer 1 [5′-AGGGCCCTGAGCCAGTGGTCAGT-3 ′ (SEQ ID NO: 24)]
  • forward primer 2 [5′-TAGCGGCTCCTCTCTTGCTCTGT-3 ′ (SEQ ID NO: 25)]
  • reverse primer [5′-GCCCGGGGCATGTGGACAGAGTCCCATACT-3 ′ (SEQ ID NO: 26)].
  • the primer used in the screening of the hGPC3KI vector ver.2 in Example 1 (3) was used.
  • the homozygote or hemizygote of hGPC3KI mouse ver.1 detects about 1.3 kb signal derived from the knock-in allele but does not detect about 0.5 kb signal derived from the wild type allele.
  • the body and hemizygote were confirmed [FIG. 5 (a)].
  • hGPC3KI mouse ver.2 was confirmed with a primer that detects a hemizygote at about 2 kb [FIG. 5 (b)].
  • Example 2 Expression analysis of hGPC3KI mice (1) Confirmation of protein expression Expression of each GPC3 protein was confirmed by Western blotting using lung lysates of hGPC3KI mice and wild-type mice. Lung lysates from hGPC3KI mice and wild type mice were prepared from one lung. After adding sample buffer (nacalai, catalog number) to each lung lysate, heat at 95 ° C for 5 minutes and dilute so that the total protein amount per lane is 50-450 micro-g SDS-PAGE Samples of After fractionation by SDS-PAGE, it was transferred to a membrane.
  • sample buffer nacalai, catalog number
  • Detection was performed using an anti-human GPC3 antibody as a primary antibody and an HRP-labeled anti-human IgG antibody as a secondary antibody. Detection was performed using the internal standard of lysate as Tubulin alpha, anti-Tubulin alpha antibody as the primary antibody, and HRP-labeled anti-rat IgG antibody as the secondary antibody.
  • the signal of hGPC3 protein was hardly detected in lung lysate 50 micro-g, but by increasing the lysate concentration, the signal detected depending on the lysate concentration. Increased in intensity (FIG. 6).
  • the signal of hGPC3 protein was detected at 30 micro-g (FIG. 7).
  • GPC3 is usually processed, there are several types of molecular weight proteins. Among them, when the anti-human GPC3 antibody used as the primary antibody is used, GPC3 protein is detected at about 20 kDa and about 60 kDa. In wild-type mice, a weak signal with the same size as the positive control was detected at around 60 kDa, but no signal was detected at around 20 kDa, so the signal detected at around 60 kDa may be a non-specific signal. High nature.
  • hGPC3Kiver.2 showed higher expression level than ver.3 for both 60kDa and 20kDa signals.
  • the expression level of hGPC3KIver.1 was significantly lower than that of hGPC3KIver.2 and ver.3.
  • cDNA used in comparing hGPC3KI mice and monkeys [Fig. 8 (a)] and wild-type mice and hGPC3KI mice [Fig. 8 (b)] were obtained using SuperScriptIIIFirst using 2.5 micro-g of total RNA as a template.
  • -Synthesis was performed by reverse transcription reaction using the Strand Synthesis System for RT-PCR (Invitrogen).
  • the cDNA used in comparing hGPC3KI mouse ver.3 and human [FIG. 9] was synthesized by reverse transcription reaction using SuperScript VILO cDNA Synthesis Kit (Invitrogen) using 0.5 micro-g of total RNA as a template.
  • Each glypican-3 was detected by real-time PCR using the synthesized cDNA as a template.
  • the primer used for detection was set in the protein coding region when comparing hGPC3KI mice, monkeys and humans. This was carried out in combination with a forward primer [5′-GAAACCTTATCCAGCCGAAGA-3 ′ (SEQ ID NO: 27)] and a reverse primer [5′-GCAAAGGGTGTCGTTTTCC-3 ′ (SEQ ID NO: 28)].
  • a forward primer [5′-GAAACCTTATCCAGCCGAAGA-3 ′ (SEQ ID NO: 27)]
  • a reverse primer [5′-GCAAAGGGTGTCGTTTTCC-3 ′ (SEQ ID NO: 28)].
  • a standard curve was prepared using a plasmid into which hGPC3 cDNA had been inserted in the range of 1.0 ⁇ 10 to 1.0 ⁇ 10 8 , and glypican-3 mRNA in each lung tissue The number of copies was calculated.
  • the composition of the real-time PCR reaction solution is as follows: sample 1 micro-l, FastStart Universal Probe Master (Roche) 5 micro-l, Universal Probe (Roche) 0.2 micro-l, primer (10 micro-M each) 0.2 micro-l and Distilled water was 3.4 micro-l (total 10 micro-l).
  • hGPC3KI mice ver.2 and ver.3 showed higher expression levels than ver.1.
  • hGPC3KI mice ver.2 and ver.3 are designed to splice out (the intron is removed by splicing) because the exon-intron structure is inserted. Therefore, it was considered that it contributed to the stability of mRNA and, as a result, led to stable synthesis of hGPC3 protein.
  • the expression level of hGPC3KI mouse ver.3 is close to that of humans and monkeys, compared with the expression level of hGPC3KI mouse ver.2.
  • the expression level of ver.2 was higher than that of the wild type.
  • the expression level of the transgene can be controlled by selecting the 3 'untranslated region (3'UTR) used for the transgene, and that the 3G UTR of the mGpc3 gene can be used to It was shown that the expression level can be adjusted to the expression level of human or monkey. As described above, the expression level of mRNA is controlled by various factors. Even if a genetically modified mouse is produced by a general method, it is very difficult to produce a mouse that exhibits the desired level of expression level. It is. However, we were able to overcome these difficulties and establish hGPC3KI mouse ver.3 that exhibits the desired level of expression. Since the expression level closest to the human expression level is shown, hGPC3KI mouse ver.3 was used for subsequent functional analysis.
  • 3'UTR 3 'untranslated region
  • Example 3 Immune tolerance against human GPC3 polypeptide (1) Immunization of antigen 0.1 mg of soluble human GPC3 protein mixed with adjuvant (Gelbu adjuvant 10: manufactured by Gerbu GmbH) in hGPC3KI mouse ver.3 and wild type mice /0.1 ml was administered subcutaneously. Administration was carried out on days 14, 21, 28, 35, 42, 49, and 56, with day 0 being the first dose.
  • the soluble human GPC3 protein was produced according to a method known to those skilled in the art.
  • human GPC3 is not a target of endogenous immunity. Therefore, when evaluating a specimen using a cancer-bearing model in which cancer cells expressing human GPC3 are transplanted in a mouse, a more accurate evaluation of drug efficacy can be performed.
  • Example 4 Anti-tumor test of anti-human GPC3 anti-mouse CD3 bispecific antibody using hGPC3KI mouse ver.3
  • LLC1 cells available from ATCC. ATCC number: CRL-1642
  • LLC1 cells LLC1 cells (LLC1 / hGPC3) in which GPC3 was forcibly expressed were used. LLC1 / hGPC3 cells were maintained and passaged in Dulbecco ⁇ s Modifid Eagle's Medium medium (SIGMA) containing 10% FBS (BIONET) and 0.5 mg / mL G418 (Nacalai Tesque).
  • SIGMA Dulbecco ⁇ s Modifid Eagle's Medium medium
  • LLC1 / hGPC3 transplantation model LLC1 / hGPC3 cells were prepared in Dulbecco ⁇ s Modifid Eagle's Medium medium (manufactured by SIGMA) at 1 ⁇ 10 7 cells / mL. This cell suspension 100 micro-L (1 ⁇ 10 6 cells / mouse) was transplanted subcutaneously into the abdomen of hGPC3KI mouse ver.3. The tumor volume was calculated by the following formula, and the model was established when the tumor volume reached about 150 to 200 mm 3 .
  • hGPC3_mCD3 bispecific antibody (hGPC3_mCD3) was prepared by combining an anti-human GPC3 (hGPC3) antibody and an anti-mouse CD3 (mCD3) antibody.
  • hGPC3 side a heavy chain represented by SEQ ID NO: 31 and a light chain represented by SEQ ID NO: 32 were used.
  • mCD3 side a heavy chain represented by SEQ ID NO: 33 and a light chain represented by SEQ ID NO: 34 were used.
  • the hGPC3_mCD3 antibody was prepared using PBS ( ⁇ ) so as to be 0.5 mg / mL (5 mg / kg administration group) and 0.1 mg / mL (1 mg / kg administration group).
  • PBS ( ⁇ ) Vehicle
  • PBS ( ⁇ ) Vehicle
  • hGPC3_mCD3 antibody The plasma concentration of hGPC3_mCD3 antibody was measured by enzyme-linked immunosorbent assay (ELISA) in which solubilized human GPC3 (shGPC3) was immobilized. 1 micro-g / mL shGPC3 solution (pH 9.6) was immobilized on a 96-well plate. Each well was washed with a TBS solution containing 0.05% tween 20, and then a sample was added. Anti-Human Kappa Light chain Goat IgG Biotin (Immunobiology Laboratories) was added as a secondary antibody, and then reacted with Streptavidin-AP conjugate (Roche Diagnostics).
  • ELISA enzyme-linked immunosorbent assay
  • Example 5 Cytokine release in hGPC3_mCD3 antibody administration
  • an hGPC3_mCD3 antibody was prepared and administered to hGPC3KI mouse ver.1, hGPC3KI mouse ver.3 and wild type mice.
  • On the day before administration 2 h, 6 h, 24 h, and 48 h after administration, about 30 microl of blood was collected by heparin treatment to obtain plasma.
  • the concentrations of IFN-gamma, IL-10, IL-17A, IL-2, IL-4, IL-6 and TNF were determined using the BDTMcytometric bead array (CBA) mouse Th1 / Th2 / Th17 cytokine kit ( (BD Bioscience).
  • CBA BDTMcytometric bead array
  • hGPC3KI mouse ver.3 The increase in cytokines in hGPC3KI mouse ver.3 indicates that the characteristic of GPC3 expression is reflected, such as the knocked-in hGPC3 gene is expressed on the membrane.
  • an anti-human GPC3 anti-human CD3 bispecific antibody was administered to monkeys, the increase in cytokines was confirmed. Therefore, hGPC3KI mouse ver.3 is a mouse that exhibits pharmacological effects similar to humans and monkeys. Therefore, it is useful for the evaluation of their pharmacological action, suggesting that it can be used for the development of drugs that specifically act on human disease-related molecules.
  • FIG. 15A An Escherichia coli artificial chromosome (BAC) clone in which the genomic region where the mouse Cd3 ⁇ , Cd3 ⁇ and Cd3 ⁇ genes are arranged was cloned was used.
  • the loxP sequence was inserted at a position of about 3.5 kb upstream of the gene region encoding mouse Cd3 ⁇ on this BAC, and the genomic region further upstream was removed leaving about 3.1 kb.
  • the loxP sequence was introduced together with the neomycin resistance (neo) gene cassette and inserted by homologous recombination using the Red / ET system (Gene Bridges).
  • clones that had been amplified correctly by the polymerase chain reaction (PCR) method were selected from the Escherichia coli clones that could grow on the kanamycin-added medium.
  • loxP and Rox sequences were placed 3 ′ downstream of the Cd3 ⁇ gene on the BAC. That is, the loxP sequence and the Rox sequence were introduced together with a hygromycin resistance (Hyg) gene cassette and inserted by homologous recombination by the Red / ET system.
  • Hyg hygromycin resistance
  • clones in which the loxP sequence and the Rox sequence were inserted as expected were selected from the Escherichia coli clones that were able to grow on the medium supplemented with hygromycin by the PCR method. Subsequently, the genomic region 3 ′ downstream from the Hyg gene cassette was removed leaving about 3.4 kb.
  • mouse Cd3 gene region modified vector into mouse embryonic stem cells (ES cells) (FIG. 15A)
  • the mouse Cd3 gene region modified vector was introduced into mouse ES cells (derived from C57BL / 6N mice) by electroporation, and homologous recombinants were screened by the PCR method from drug-resistant clones obtained after selective culture with G418.
  • As the mouse Cd3 gene region modified vector used for electroporation 60 ⁇ g was linearized with NotI, or a cyclic vector not treated with NotI was extracted with phenol / chloroform, ethanol precipitated and dissolved in PBS.
  • the ES cells used in the screening were cultured in a 96-well plate, washed twice with 200 ⁇ l of PBS solution per well, and then 5 ⁇ l of cell lysis buffer (10 ⁇ LA buffer II (for TAKARA LA Taq)) having the following composition; 25 ⁇ M MgCl 2 5 ⁇ l; 5% NP-40 5 ⁇ l; proteinase K (TAKARA, 20 mg / ml) 2 ⁇ l; distilled water 33 ⁇ l) and treated at 55 ° C. for 2 hours, followed by treatment at 95 ° C. for 15 minutes, Proteinase K was inactivated to obtain a PCR sample.
  • cell lysis buffer 10 ⁇ LA buffer II (for TAKARA LA Taq) having the following composition; 25 ⁇ M MgCl 2 5 ⁇ l; 5% NP-40 5 ⁇ l; proteinase K (TAKARA, 20 mg / ml) 2 ⁇ l; distilled water 33 ⁇ l
  • the PCR reaction mixture consisted of 1 ⁇ l of sample, 2.5 ⁇ l of 10 ⁇ LA buffer II, 2.5 ⁇ l of 25 mM MgCl 2, 4 ⁇ l of dNTP (2.5 mM), 0.1 ⁇ l of each primer (50 ⁇ M each), LA Taq (TAKARA) 0. 25 ⁇ l, and 14.55 ⁇ l of distilled water (25 ⁇ l in total).
  • PCR conditions were preheating at 94 ° C. for 2 minutes, amplification cycle 35 cycles of 98 ° C. for 10 seconds, 68 ° C. for 4 minutes and 30 seconds, and double heating at 68 ° C. for 5 minutes.
  • the used primers are as follows.
  • HygF1474 was placed as a forward primer in the Hyg gene cassette, and g4989R was placed as a reverse primer in the mouse genomic region 3 ′ downstream of the 3 ′ homologous arm on the mouse Cd3 gene-modified vector (see FIG. 16). reference).
  • a band of about 4 kb is amplified.
  • HygF1474 front) 5'-TATCAGAGCTTGGTTGACGG-3 '(SEQ ID NO: 35);
  • g4989R (rear) 5'-ACTCGTTGTGGCTTAGAAGCAGTAACAAATAC-3' (SEQ ID NO: 36).
  • a clone from which an amplification signal was obtained was confirmed by another primer set. That is, e27248F was placed as a forward primer in the mouse genomic region 5 ′ upstream of the 5 ′ homologous arm on the mouse Cd3 gene modified vector, and Neo0635R was placed as a reverse primer in the Neo gene cassette. In a sample of ES cells that have undergone homologous recombination, a band of about 4 kb is amplified.
  • Neo0635R (rear) 5′-AATCCATCTTGTTCAATGGCCGATCC-3 ′ (SEQ ID NO: 38).
  • Human CD3 gene region introduction vector and recombinant enzyme expression vector were introduced into mouse ES cells modified with Cd3 genetic region ES in which loxP sequence and Rox sequence have been correctly inserted into the target position of mouse Cd3 gene region in the above-mentioned steps
  • Human CD3 gene region introduction vector, recombinant enzyme Cre expression vector and recombinant enzyme Dre expression vector were introduced into cell clones (1D4, 5H1, 6I5 and 3A5) by electroporation, and after selective culture with puromycin The grown ES cell clones were genotyped.
  • PCR was performed to select clones in which recombination occurred between the loxP sequence and the Rox sequence arranged in the mouse Cd3 gene region by the action of Cre and Dre, and the genomic region from Cd3 ⁇ to Cd3 ⁇ was deleted. .
  • the ES cells used in the screening were cultured in a 96-well plate, washed twice with 200 ⁇ l of PBS solution per well, and then 5 ⁇ l of cell lysis buffer (10 ⁇ LA buffer II (for TAKARA LA Taq)) having the following composition; 25 ⁇ M MgCl 2 5 ⁇ l; 5% NP-40 5 ⁇ l; proteinase K (TAKARA, 20 mg / ml) 2 ⁇ l; distilled water 33 ⁇ l) and treated at 55 ° C. for 2 hours, followed by treatment at 95 ° C. for 15 minutes, Proteinase K was inactivated to obtain a PCR sample.
  • cell lysis buffer 10 ⁇ LA buffer II (for TAKARA LA Taq) having the following composition; 25 ⁇ M MgCl 2 5 ⁇ l; 5% NP-40 5 ⁇ l; proteinase K (TAKARA, 20 mg / ml) 2 ⁇ l; distilled water 33 ⁇ l
  • the PCR reaction mixture consisted of 1 ⁇ l of sample, 2.5 ⁇ l of 10 ⁇ LA buffer II, 2.5 ⁇ l of 25 mM MgCl 2, 4 ⁇ l of dNTP (2.5 mM), 0.1 ⁇ l of each primer (50 ⁇ M each), LA Taq (TAKARA) 0. 25 ⁇ l, and 14.55 ⁇ l of distilled water (25 ⁇ l in total).
  • PCR conditions were preheating at 94 ° C. for 2 minutes, amplification cycle 35 cycles of 98 ° C. for 10 seconds, 68 ° C. for 4 minutes and 30 seconds, and double heating at 68 ° C. for 5 minutes.
  • the used primers are as follows.
  • e30230F was arranged as a forward primer in the genomic region 5 ′ upstream of the mouse Cd3 ⁇ gene, and g1439R was arranged as a reverse primer in the genomic region 3 ′ downstream of the mouse Cd3 ⁇ gene (see FIG. 17A).
  • a band of about 0.7 kb is amplified.
  • e30230F forward) 5'-TAGCAGCCTTCAGATGAAGAGGGTAGGACTC-3 '(SEQ ID NO: 39);
  • g1439R (rear) 5'-TTGATGGCCCACTCACTGCTGCACTGG-3' (SEQ ID NO: 40).
  • PCR screening was performed to select a clone into which the human CD3 gene region was introduced among ES cell clones lacking the mouse Cd3 gene region.
  • the PCR sample used when the deletion of the mouse Cd3 gene region was detected was used for screening.
  • the PCR reaction mixture consisted of 1 ⁇ l of sample, 2.5 ⁇ l of 10 ⁇ LA buffer II, 2.5 ⁇ l of 25 mM MgCl 2, 4 ⁇ l of dNTP (2.5 mM), 0.1 ⁇ l of each primer (50 ⁇ M each), LA Taq (TAKARA) 0. 25 ⁇ l, and 14.55 ⁇ l of distilled water (25 ⁇ l in total).
  • PCR conditions were as follows: preheating at 94 ° C.
  • hCD3e_5arm_F2 was arranged as a forward primer in the genomic region 5 ′ upstream of the human CD3 ⁇ gene
  • hCD3e_ex2_R2 was arranged as a reverse primer in the second exon of the human CD3 ⁇ gene (see FIG. 17B).
  • a band of about 5.5 kb is amplified.
  • hCD3e_5arm_F2 front
  • hCD3e_ex2_R2 rear
  • 5′-ATGGGACTGTTACTTTTACTAAGAT-3 ′ SEQ ID NO: 42.
  • mice were suspended by trypsin treatment and washed with ES cell medium.
  • BALB / c female mice subjected to superovulation treatment were mated with male mice of the same strain by intraperitoneal administration of 5 IU horse chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG) at 48 hour intervals.
  • the day on which the plug of the female mouse was confirmed was 0.5 day, the uterus was perfused on the 3.5th day of pregnancy, and 10-15 ES cells were injected using the collected blastocyst stage embryo as a host embryo.
  • a chimeric mouse in which recombinant ES cells (black) and host blastocyst-derived cells (albino) coexisted was obtained by discriminating the color of the offspring obtained by injection of ES cells into blastocysts.
  • Male chimeric mice were mated with C57BL / 6N female mice after sexual maturation, and the transfer of knock-in alleles to next-generation mice was confirmed by PCR using genomic DNA extracted from the tissue of next-generation mice as a template. PCR was performed by the method used in the above-described screening of ES cells.
  • mice having the above-described genotypes mouse individuals that are homo-deficient in the mouse Cd3 gene region and have a human CD3 gene region, that is, human CD3 gene region-substituted mice were obtained.
  • hCD3 ⁇ Tg mouse a transgenic mouse into which only human CD3 ⁇ was introduced
  • Thymus and spleen weight of human CD3 gene-substituted mice Spleen and thymus were collected from mice (12-14 weeks old, male) and the tissue weight was measured. As shown in FIG. 4, no gross abnormality was observed in the thymus of human CD3-substituted mice.
  • tissue weight per body weight was calculated. The body weight and tissue weight (spleen, thymus) were measured for 4 male mice in each group and shown in the graph. The tissue weight ratio per body weight is calculated, the values obtained for each individual are plotted with black dots, and the average value is shown in the column (FIG. 19).
  • the Cd3 gene-deficient mice tended to increase compared to other genotype mice, but no significant difference was observed.
  • a Cd3 gene-deficient mouse showed a reduction of about one-third compared to the wild type.
  • the human CD3 gene-substituted mouse in which the human CD3 gene was introduced into this Cd3 gene-deficient mouse, recovery of thymus weight was observed, and in particular, recovery of the thymus weight equivalent to that of the wild type mouse was observed in the individual of line number 1C3. .
  • hCD3 ⁇ Tg mice atrophy of the thymus was observed as reported by Wang et al. (Wang et.al. (1994) PNAS.91: 9402-9406).
  • cDNA was synthesized by performing a reverse transcription reaction with SuperScript III First Strand cDNA Synthesis Kit (Invitrogen) using an Oligo dT (20) primer.
  • PCR By performing PCR using the synthesized cDNA as a template, human CD3 ⁇ , human CD3 ⁇ , human CD3 ⁇ , mouse Cd3 ⁇ , mouse Cd3 ⁇ and mouse Cd3 ⁇ were detected.
  • Primers for the protein coding region were set for detection of any gene expression.
  • Detection of human CD3 ⁇ was performed using a combination of forward primer E0333F (5′-AAGAAATGGGTGGTTATACACAGACACC-3 ′ (SEQ ID NO: 43)) and reverse primer E0912R (5′-TGGGCCAGCGGGAGGCAGGTTTCTCCAGAGG-3 ′ (SEQ ID NO: 44)). did.
  • Detection of human CD3 ⁇ was performed using a combination of forward primer D0092F (5′-TAGTTCGGGTGACCTGGCTTTATCACTGG-3 ′ (SEQ ID NO: 45)) and reverse primer D0685R (5′-ATGGCTGCCTTCATAGAAGCCACCAGTCTCCAGG-3 ′ (SEQ ID NO: 46)). did.
  • Detection of human CD3 ⁇ was performed using a combination of forward primer G0048F (5′-TGCTCCACGCCTTTTGCCGGAGGACAAG-3 ′ (SEQ ID NO: 47)) and reverse primer G0666R (5′-TAGGAGAGAACACCTGGAACTACTC-3 ′ (SEQ ID NO: 48)) did.
  • a combination of forward primer e0065F (5′-AGCATTCTGGAGGGATGCGTGGAACAC-3 ′ (SEQ ID NO: 49)
  • reverse primer e0699R 5′-TGCTCGGAGGGCTGGGATCTGGTCCCACAG-3 ′ (SEQ ID NO: 50) was used. Carried out.
  • Detection of mouse Cd3 ⁇ was performed using a combination of forward primer d055F (5′-TCATCCTGTGGCTTGCCTCTATTTTGTTCC-3 ′ (SEQ ID NO: 51)) and reverse primer d651R (5′-TTGCTATGGCACTTTGAGAAACCTCCATC-3 ′ (SEQ ID NO: 52)). did.
  • Detection of mouse Cd3 ⁇ was performed using a combination of forward primer g080F (5′-AATACTTCACTGGGAGAAGCAAAGAG-3 ′ (SEQ ID NO: 53)) and reverse primer g316R (5′-TAGTGCATTTTAGAGGAACTTTATTGC-3 ′ (SEQ ID NO: 54)). did.
  • the composition of the PCR reaction solution was as follows: sample 1 ⁇ l, 10 ⁇ Ex buffer 2.5 ⁇ l, dNTP (2.5 mM) 2 ⁇ l, primer (50 ⁇ M each) 0.1 ⁇ l each, Ex Taq (TAKARA) 0.25 ⁇ l, and distilled water 19 .05 ⁇ l (25 ⁇ l total).
  • PCR conditions are as follows: human CD3 ⁇ , human CD3 ⁇ , mouse Cd3 ⁇ and mouse Cd3 ⁇ are pre-heated at 94 ° C. for 2 minutes, 94 ° C. for 30 seconds, 60 ° C. for 30 seconds, and 72 ° C. for 2 minutes. Amplification cycle of 35 cycles and double heating at 72 ° C. for 5 minutes.
  • PCR primers were designed so that the amplification products of human CD3 ⁇ , human CD3 ⁇ and human CD3 ⁇ were detected at 580 bp, 594 bp and 620 bp, and the amplification products of mouse Cd3 ⁇ , mouse Cd3 ⁇ and mouse Cd3 ⁇ were detected at 635 bp, 597 bp and 237 bp, respectively.
  • Cd3 gene-deficient mice no PCR signal derived from each mouse Cd3 molecule was detected.
  • human CD3 gene-replaced mouse lines line numbers: 1C3, 3B1, 8I12 and 2A4 into which the human CD3 gene region has been introduced
  • human CD3 ⁇ Only human CD3 ⁇ and human CD3 ⁇ were detected, and none of mouse Cd3 ⁇ , mouse Cd3 ⁇ and mouse Cd3 ⁇ were detected (FIG. 20).
  • Human CD3 ⁇ , human CD3 ⁇ and human CD3 ⁇ were not detected from samples derived from wild-type mice, but mouse Cd3 ⁇ , mouse Cd3 ⁇ and mouse Cd3 ⁇ were detected (FIG.
  • mice expressing human CD3 ⁇ , CD3 ⁇ and CD3 ⁇ were obtained instead of mice Cd3 ⁇ , Cd3 ⁇ and Cd3 ⁇ as designed.
  • line 4HH3 in FIG. 6 is analyzed in an individual in which the mouse Cd3 allele is wild type and a human CD3 gene is introduced, and both human CD3 molecules and mouse Cd3 molecules are detected.
  • Example 7 Evaluation of cell proliferation ability of spleen cells in human CD3 gene-substituted mice Spleens were collected from mice (12 weeks old, male), and cells were isolated using a 70 ⁇ m mesh. A hemolytic agent (manufactured by SIGMA) was added to lyse red blood cells. T cell mitogen PHA (Phytohaemagglutinin, manufactured by SIGMA) was added to the isolated spleen cells, cultured for 5 days, and then an MTS assay was performed using a cell proliferation assay reagent (CellTiter96Aqueous One Solution Reagent, manufactured by Promega). did.
  • a hemolytic agent manufactured by SIGMA
  • T cell mitogen PHA Phytohaemagglutinin, manufactured by SIGMA
  • the cell growth activity of each genotype was expressed as a relative ratio when the activity in the absence of mitogen addition was taken as 1 (FIG. 23).
  • the cell proliferation activity with respect to mitogen stimulation tended to be lower than when mitogen was not added, which was about 60% of that of wild-type mice.
  • cell proliferation activity was increased by mitogen stimulation, and the activity was shown to be about 90% in human CD3 gene-substituted mice compared to wild-type mice. It was.
  • Example 8 Evaluation of cytokine production in spleen cells of human CD3 gene substituted mice Spleen was collected from mice, cells were isolated using a 70 ⁇ m mesh, hemolytic agent was added to lyse erythrocytes, and spleen cells were prepared did. After culturing for 3 days in a culture solution to which PHA (phytohaemagglutinin), a T cell mitogen, was added at a final concentration of 1 ⁇ g / mL, cytokines produced in the culture solution were measured (FIG. 24). As a result, spleen cells of Cd3 gene-deficient mice showed no mitogen-stimulated cytokine production, whereas human CD3 gene-substituted mice showed cytokine production and their function was restored. .
  • PHA phytohaemagglutinin
  • Example 9 Evaluation of reactivity to human CD3 antibody in spleen cells of human CD3 gene-substituted mice Spleen was collected from mice, cells were isolated using a 70 ⁇ m mesh, hemolytic agent was added to lyse erythrocytes, Spleen cells were prepared. Cells were seeded on a plate that had been solidified with an anti-human CD3 antibody, and an MTS assay was performed to evaluate cell proliferation activity after 3 days of culture (FIGS. 25A and 25B). In addition, cytokines produced in the culture were measured (FIGS. 25C and D). As a result, human CD3 gene-substituted mice specifically responded to stimulation with anti-human CD3 antibody, and showed cell proliferation activity (FIG.
  • Example 10 Evaluation of immune function of human CD3 gene-substituted mice (1) Examination of specific antibody production ability against foreign antigen sensitization To produce an antibody specific to foreign antigen, There is a functional helper T cell that can bind to the antigen peptide presented together with a major histocompatibility complex (MHC) on the surface of the antigen-presenting cell, and an instruction for causing the antibody-producing cell to produce an appropriate antibody.
  • MHC major histocompatibility complex
  • OVA ovalbumin
  • human CD3 gene replacement mice two different lines (line numbers 1C3 and 8I12) of the derived modified ES cell clones were set and compared with human CD3 ⁇ overexpressing mice. Furthermore, as a control, wild-type mice and Cd3 gene-deficient mice were set and subjected to the same antigen sensitization.
  • Hepa1-6 / HER2 transplant model Hepa1-6 / HER2 cells were prepared with Dulbecco's Modifid Eagle's Medium medium (manufactured by SIGMA) and Matrigel at 1 ⁇ 10 8 cells / mL. 100 ⁇ L (1 ⁇ 10 7 cells / mouse) of this cell suspension was transplanted subcutaneously into the abdomen of mCd3 KO homo, hCD3 Tg type mouse # 1C3 (19 weeks old). The tumor volume was calculated by the following formula, and the model was established when the tumor volume reached 160 to 234 mm 3 .
  • Tumor volume major axis x minor axis x minor axis / 2 (3) Preparation of administered drug The bispecific antibody (HER2_CD3 antibody) against Her2 and CD3 was prepared to 0.5 mg / mL (5 mg / kg administration group) using PBS (-).
  • HER2_CD3 antibody (HER2 binding heavy chain variable region: SEQ ID NO: 55 and 56, HER2 binding light chain variable region: SEQ ID NO: 57 and 58, CD3 binding heavy chain variable region: SEQ ID NO: 59 and 60, CD3 binding light chain variable Region: SEQ ID NOs: 61 and 62) were made according to methods known to those skilled in the art.
  • the Hepa1-6 / HER2 transplant model prepared in (2) is divided into groups by tumor volume, and the antibody sample prepared in (3) above is administered from the tail vein at 10 mL / kg. did.
  • PBS ( ⁇ ) Vehicle
  • (5) Evaluation of antitumor effect The antitumor effect of the HER2_CD3 antibody in the Hepa1-6 / HER2 transplantation model was evaluated by the tumor volume on the 28th day after transplantation (FIG. 27). JMP (SAS Institute Inc.) was used for statistical analysis, and statistical analysis was confirmed by Wilcoxon test using the tumor volume on the last measurement day. (Significance level was 5% on both sides) As a result, administration of HER2_CD3 antibody significantly inhibited tumor growth.
  • Hepa1-6 / hGPC3 transplantation model Hepa1-6 / hGPC3 cells were prepared with Dulbecco's Modifid Eagle's Medium medium (manufactured by SIGMA) and Matrigel at 5 ⁇ 10 7 cells / mL. 200 ⁇ L (1 ⁇ 10 7 cells / mouse) of this cell suspension was transplanted subcutaneously into the abdomen of mCd3 KO homo, hCD3 Tg type mouse # 1C3 (20 weeks old). The tumor volume was calculated by the following formula, and the model was established when the tumor volume reached 160 to 300 mm 3 .
  • Tumor volume major axis x minor axis x minor axis / 2 (3)
  • Anti-mouse CTLA-4 antibody (clone: UC10-4F10-11, manufactured by BioXcell) and anti-mouse PD-1 antibody (clone: RMP1-14, BioXcell) which are immune checkpoint inhibitors Manufactured) and anti-mouse PD-L1 antibody (clone: 10F.9G2, manufactured by BioXcell) were prepared using PBS (-) so as to be 1 mg / mL (0.2 mg / head administration).
  • the Hepa1-6 / hGPC3 transplantation model prepared in (2) is divided into groups by tumor volume, and the anti-mouse CTLA-4 antibody, anti-mouse PD-1 antibody prepared in (3) above, Anti-mouse PD-L1 antibody was administered from the tail vein at 0.2 mL / mouse.
  • PBS ( ⁇ ) Vehicle
  • Administration was carried out twice, 7 days after tumor transplantation (the day of grouping) and 12 days (5 days after grouping).
  • Evaluation of antitumor effect The antitumor effect in the Hepa1-6 / hGPC3 transplantation model was evaluated by the change in tumor volume (FIG. 28). As a result, suppression of tumor growth was observed by administration of an immune checkpoint inhibitor.
  • Example 13 In vivo drug efficacy evaluation with anti-human CTLA4 / anti-human CD3 bispecific antibody 13-1. Expression and purification of bispecific antibody that specifically binds to human CTLA4 and human CD3 As the anti-human CTLA4 side, heavy chain variable region MDX10D1H (SEQ ID NO: 63) and light chain variable region MDX10D1L (SEQ ID NO: 64) was used. At this time, the constant region reduces binding to the Fc ⁇ receptor, the heavy chain constant region mF18mN4 (SEQ ID NO: 65) modified so that the two heavy chains are hetero-associated, and the light chain constant region mk1 (SEQ ID NO: : 66) is used. These genes were inserted into animal expression plasmids.
  • the anti-human CD3 side includes a heavy chain variable region TR01H113 (SEQ ID NO: 67), a light chain variable region L0011 (SEQ ID NO: 68). At this time, the constant region reduces binding to the Fc ⁇ receptor, A heavy chain constant region mF18mP4 (SEQ ID NO: 69) and a light chain constant region mk1 (SEQ ID NO: 66) modified so that the chains are hetero-associated are used. These genes were inserted into animal expression plasmids.
  • Anti-human CTLA4 antibody and anti-human CD3 antibody were expressed using the following method.
  • a plasmid prepared by the lipofection method was applied to the FreeStyle 293-F strain (Invitrogen) derived from human fetal kidney cells suspended in FreeStyle 293 Expression Medium (Invitrogen) at a cell density of 1.33 x 10 6 cells / mL. Introduced. From a culture supernatant cultured for 4 days in a CO 2 incubator (37 ° C., 8% CO 2 , 90 rpm), an antibody was purified by a method known to those skilled in the art using a Hi Trap TM Protein G HP column (GE Healthcare). The absorbance at 280 nm of the purified antibody solution was measured using a spectrophotometer. The concentration of the purified antibody was calculated using the extinction coefficient calculated by the PACE method from the obtained measured value (Protein Science (1995) 4, 2411-2423).
  • the purified homozygotes were combined in Table 3 and mixed by a method known to those skilled in the art (WO2015 / 046467) using the difference in charge in the constant region to produce the target bispecific antibody.
  • MDX10 // TR01H113 antibody in the Colon38 cell transplantation model was administered at 200 ⁇ g / mouse or Control group (vehicle administration group) with a buffer of 0.2 on the 12th day after transplantation. mL / mouse was administered from the tail vein.
  • Example 14 Production of human GPC3 knock-in / human CD3 gene-substituted mouse Human GPC3 knock-in mouse and human CD3 gene-substituted mouse were crossed, and human GPC3 knock-in was analyzed by genotype analysis of the resulting next-generation individuals. A mouse strain was established in which alleles, mouse Cd3 gene region-deficient alleles, and alleles having human CD3 gene regions were transmitted.
  • Hepa1-6 / hGPC3 transplant model Hepa1-6 / hGPC3 cells were prepared in Dulbecco ⁇ s Modifid Eagle's Medium medium (manufactured by SIGMA) to 2 ⁇ 10 8 cells / mL, and an equal volume of Matrigel. was added (1 ⁇ 10 8 cells / mL). 100 ⁇ L of this cell suspension (1 ⁇ 10 7 cells / mouse) was transplanted subcutaneously into the abdomen of a human GPC3 knock-in / human CD3 gene-substituted mouse. The tumor volume was calculated by the following formula, and the model was established when the tumor volume reached about 160 to 360 mm 3 .
  • Tumor volume major axis ⁇ minor axis ⁇ minor axis / 2 (3)
  • Preparation of administered drug Bispecific antibody against human GPC3 and human CD3 is 0.5 mg / mL (5 mg / kg administration group), 0.1 mg / mL (1) using PBS (-). mg / kg administration group) and 0.02 mg / mL (0.2 mg / kg administration group).
  • the hGPC3_hCD3 antibody has a heavy chain variable region TR01H113 (SEQ ID NO: 67) and heavy chain constant region E2702sKsc (SEQ ID NO: 70) as anti-human CD3 side, a heavy chain variable region GCH065 (SEQ ID NO: 71) as anti-human GPC3 side, and Using a heavy chain constant region E2704sEpsc (SEQ ID NO: 72), light chain variable region L0011 (SEQ ID NO: 73) and light chain constant region k0 (SEQ ID NO: 74) as a common light chain, according to methods known to those skilled in the art It was made.
  • the Hepa1-6 / hGPC3 transplant model prepared in (2) above was divided into groups with similar tumor volumes, and the antibody sample prepared in (3) above was added at 10 mL / kg at the tail vein. More administered. As a negative control, PBS ( ⁇ ) (Vehicle) was similarly administered at 10 mL / kg from the tail vein.
  • (5) Evaluation of antitumor effect The antitumor effect of the hGPC3_hCD3 antibody in the Hepa1-6 / hGPC3 transplantation model was evaluated by the tumor volume on the 29th day after the transplantation. As a result, administration of the hGPC3_hCD3 antibody showed a dose-dependent suppression of tumor growth (FIG. 30).
  • FIG. 31 The increase in cytokine occurs when hGPC3_hCD3 antibody binds to hGPC3 expressed in the tissue and T cells are activated.
  • the increase in cytokines in human GPC3 knock-in / human CD3 gene-substituted mice indicates that, like hGPC3KI mice, the knock-in hGPC3 gene is expressed on the membrane, reflecting the original GPC3 expression characteristics.
  • the present invention is a genetically modified non-human animal that lacks the expression of endogenous GPC3 polypeptide in a non-human animal and expresses human GPC3 polypeptide at a physiologically relevant level, a method for producing the non-human animal, and the A method for evaluating a test substance using a non-human animal is provided. Therefore, the present invention is particularly applicable to the development of therapeutic agents for diseases including cancer that express human GPC3 polypeptide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Environmental Sciences (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Husbandry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

La présente invention concerne : un animal non humain à gène modifié qui ne présente pas d'expression du polypeptide (GPC3) endogène et qui exprime le polypeptide (GPC3) humain à un niveau physiologiquement raisonnable; un procédé d'obtention de l'animal non humain; un procédé d'évaluation d'une substance à analyser avec l'utilisation de l'animal non humain. L'invention concerne également un procédé d'évaluation de l'effet thérapeutique sur une maladie, de l'innocuité, de la cinétique du médicament, de la distribution biologique, etc., d'une substance à analyser avec l'utilisation de l'animal non humain comme modèle.
PCT/JP2017/029766 2016-08-22 2017-08-21 Animal non humain à gène modifié exprimant le polypeptide (gpc3) humain WO2018038046A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2018535662A JP7125347B2 (ja) 2016-08-22 2017-08-21 ヒトｇｐｃ３ポリペプチドを発現する遺伝子改変非ヒト動物
EP17843526.9A EP3502250B1 (fr) 2016-08-22 2017-08-21 Rongeurs génétiquement modifiés exprimant un polypeptide gpc3 humain
US16/327,218 US11793180B2 (en) 2016-08-22 2017-08-21 Gene-modified mouse expressing human GPC3 polypeptide
JP2022082299A JP2022134132A (ja) 2016-08-22 2022-05-19 ヒトｇｐｃ３ポリペプチドを発現する遺伝子改変非ヒト動物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2016-161777 2016-08-22
JP2016161777 2016-08-22

Publications (1)

Publication Number Publication Date
WO2018038046A1 true WO2018038046A1 (fr) 2018-03-01

Family

ID=61245019

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2017/029766 WO2018038046A1 (fr) 2016-08-22 2017-08-21 Animal non humain à gène modifié exprimant le polypeptide (gpc3) humain

Country Status (4)

Country Link
US (1) US11793180B2 (fr)
EP (1) EP3502250B1 (fr)
JP (2) JP7125347B2 (fr)
WO (1) WO2018038046A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021256555A1 (fr) 2020-06-19 2021-12-23 中外製薬株式会社 Molécule de liaison à l'antigène anti-lymphocytes t destinée à être utilisée en association avec un inhibiteur d'angiogenèse
US11612149B2 (en) 2015-07-10 2023-03-28 Chugai Seiyaku Kabushiki Kaisha Non-human animal having human CD3 gene substituted for endogenous CD3 gene

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114835798B (zh) * 2021-05-28 2024-02-23 百奥赛图(北京)医药科技股份有限公司 Cd36基因人源化非人动物的构建方法及应用

Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
WO1993008829A1 (fr) 1991-11-04 1993-05-13 The Regents Of The University Of California Compositions induisant la destruction de cellules infectees par l'hiv
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
WO1999037764A2 (fr) * 1998-01-27 1999-07-29 Vlaams Interuniversitair Instituut Voor Biotechnologie Nouveaux membres de la famille des genes de glypicane
WO2003000883A1 (fr) 2001-06-22 2003-01-03 Chugai Seiyaku Kabushiki Kaisha Inhibiteurs de proliferation cellulaire renfermant un anticorps anti-glypicane 3
WO2004022739A1 (fr) 2002-09-04 2004-03-18 Chugai Seiyaku Kabushiki Kaisha Anticorps diriges contre des peptides a n terminaux ou des peptides a c terminaux de gpc3 solubilise dans le sang
WO2006006693A1 (fr) 2004-07-09 2006-01-19 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypican 3
US20060025576A1 (en) 2000-04-11 2006-02-02 Genentech, Inc. Multivalent antibodies and uses therefor
WO2006046751A1 (fr) 2004-10-26 2006-05-04 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypicane 3 à chaîne sucrée modifiée
WO2007047291A2 (fr) 2005-10-14 2007-04-26 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypicane 3
US20080069820A1 (en) 2006-08-30 2008-03-20 Genentech, Inc. Multispecific antibodies
WO2009041062A1 (fr) 2007-09-28 2009-04-02 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypican-3 dont la cinétique dans le plasma est améliorée
WO2009089004A1 (fr) 2008-01-07 2009-07-16 Amgen Inc. Méthode de fabrication de molécules hétérodimères fc d'anticorps utilisant les effets de conduite électrostatique
WO2011013247A1 (fr) 2009-07-31 2011-02-03 株式会社ステリック再生医科学研究所 Modèle animal du cancer du foie avec stéato-hépatite
WO2014042251A1 (fr) 2012-09-13 2014-03-20 中外製薬株式会社 Animal non humain comportant un gène knock-in
WO2015046467A1 (fr) 2013-09-27 2015-04-02 中外製薬株式会社 Procédé de production d'un hétéromultimère polypeptidique
WO2016047722A1 (fr) 2014-09-26 2016-03-31 中外製薬株式会社 Agent thérapeutique induisant une cytotoxicité
WO2016085889A1 (fr) 2014-11-24 2016-06-02 Regeneron Pharmaceuticals, Inc. Animaux non humains exprimant un complexe cd3 humanisé
WO2017010423A1 (fr) 2015-07-10 2017-01-19 中外製薬株式会社 Animal non-humain ayant un gène cd3 humain substitué par un gène cd3 endogène

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2827302B1 (fr) 2001-07-13 2003-10-10 Genoway Cellule et animal transgenique modelisant la presentation antigenique humaine et leurs utilisations
AU2003251286B2 (en) * 2002-01-23 2007-08-16 The University Of Utah Research Foundation Targeted chromosomal mutagenesis using zinc finger nucleases
US7888121B2 (en) * 2003-08-08 2011-02-15 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
JP2014514314A (ja) 2011-04-20 2014-06-19 ゲンマブ エー／エス Ｈｅｒ２およびｃｄ３に対する二重特異性抗体
CN110156893B (zh) 2013-12-17 2023-03-03 基因泰克公司 抗cd3抗体及使用方法
TWI701042B (zh) 2014-03-19 2020-08-11 美商再生元醫藥公司 用於腫瘤治療之方法及抗體組成物

Patent Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
WO1993008829A1 (fr) 1991-11-04 1993-05-13 The Regents Of The University Of California Compositions induisant la destruction de cellules infectees par l'hiv
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
WO1999037764A2 (fr) * 1998-01-27 1999-07-29 Vlaams Interuniversitair Instituut Voor Biotechnologie Nouveaux membres de la famille des genes de glypicane
US20060025576A1 (en) 2000-04-11 2006-02-02 Genentech, Inc. Multivalent antibodies and uses therefor
WO2003000883A1 (fr) 2001-06-22 2003-01-03 Chugai Seiyaku Kabushiki Kaisha Inhibiteurs de proliferation cellulaire renfermant un anticorps anti-glypicane 3
WO2004022739A1 (fr) 2002-09-04 2004-03-18 Chugai Seiyaku Kabushiki Kaisha Anticorps diriges contre des peptides a n terminaux ou des peptides a c terminaux de gpc3 solubilise dans le sang
WO2006006693A1 (fr) 2004-07-09 2006-01-19 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypican 3
WO2006046751A1 (fr) 2004-10-26 2006-05-04 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypicane 3 à chaîne sucrée modifiée
WO2007047291A2 (fr) 2005-10-14 2007-04-26 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypicane 3
US20080069820A1 (en) 2006-08-30 2008-03-20 Genentech, Inc. Multispecific antibodies
WO2009041062A1 (fr) 2007-09-28 2009-04-02 Chugai Seiyaku Kabushiki Kaisha Anticorps anti-glypican-3 dont la cinétique dans le plasma est améliorée
WO2009089004A1 (fr) 2008-01-07 2009-07-16 Amgen Inc. Méthode de fabrication de molécules hétérodimères fc d'anticorps utilisant les effets de conduite électrostatique
WO2011013247A1 (fr) 2009-07-31 2011-02-03 株式会社ステリック再生医科学研究所 Modèle animal du cancer du foie avec stéato-hépatite
WO2014042251A1 (fr) 2012-09-13 2014-03-20 中外製薬株式会社 Animal non humain comportant un gène knock-in
WO2015046467A1 (fr) 2013-09-27 2015-04-02 中外製薬株式会社 Procédé de production d'un hétéromultimère polypeptidique
WO2016047722A1 (fr) 2014-09-26 2016-03-31 中外製薬株式会社 Agent thérapeutique induisant une cytotoxicité
WO2016085889A1 (fr) 2014-11-24 2016-06-02 Regeneron Pharmaceuticals, Inc. Animaux non humains exprimant un complexe cd3 humanisé
WO2017010423A1 (fr) 2015-07-10 2017-01-19 中外製薬株式会社 Animal non-humain ayant un gène cd3 humain substitué par un gène cd3 endogène

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
ALMAGRO; FRANSSON, FRONT. BIOSCI., vol. 13, 2008, pages 1619 - 1633
BLOOD, vol. 106, 2005, pages 3127 - 3133
BRENNAN, SCIENCE, vol. 229, 1985, pages 81
CUI, X. ET AL., NAT. BIOTECHNOL., vol. 29, 2011, pages 64 - 67
GRUBER, J. IMMUNOL., vol. 152, 1994, pages 5368
HOLLIGER, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448
HOOGENBOOM ET AL., METHODS IN MOLECULAR BIOLOGY, vol. 178, pages 1 - 37
IGAWA ET AL., NAT. BIOTECHNOL., vol. 28, 2010, pages 1203 - 1207
INT. J. BIOCHEM. CELL. BIOL., vol. 40, no. 11, 2008, pages 2384 - 2396
INTERNATIONAL JOURNAL OF EXPERIMENTAL PATHOLOGY, vol. 94, no. 2, April 2013 (2013-04-01), pages 93 - 103
J. CELL. BIOL., vol. 181, no. 2, 21 April 2008 (2008-04-21), pages 189 - 194
KANATSU-SHINOHARA, M. ET AL., BIOL. REPROD., vol. 79, 2008, pages 1121 - 1128
KOSTELNY, J. IMMUNOL., vol. 148, no. 5, 1992, pages 1547 - 1553
LI, T. ET AL., NUCLEIC ACIDS RES., vol. 39, 2011, pages 6315 - 6325
LIU BOWEN ET AL.: "Suppression of liver regeneration and heptocyte proliferation in hepatocyte-targeted glypican 3 transgenic mice", HEPATOLOGY, vol. 52, no. 3, September 2010 (2010-09-01), pages 1060 - 1067, XP055586252 *
LONBERG, CURR. OPIN. IMMUNOL., vol. 20, 2008, pages 450 - 459
MILSTEIN; CUELLO, NATURE, vol. 305, 1983, pages 537
MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851 - 6855
NATL. ACAD. SCI. U.S.A., vol. 85, pages 836 - 840
NIU, Y. ET AL., J. GENET. GENOMICS, vol. 35, 2008, pages 701 - 714
PROC. NATL. ACAD. SCI. U.S.A, vol. 108, no. 6, 8 February 2011 (2011-02-08), pages 2390 - 2395
PROTEIN SCIENCE, vol. 4, 1995, pages 2411 - 2423
RNA. BIOL., vol. 5, no. 4, October 2008 (2008-10-01), pages 201 - 207
TRAUNECKER ET AL., EMBO J., vol. 10, 1991, pages 3655
TUTT, J. IMMUNOL., vol. 147, 1991, pages 60
VAN DIJK AND VAN DE WINKEL, CURR. OPIN. PHARMACOL., vol. 5, 2001, pages 368 - 74
WANG ET AL., PNAS, vol. 91, 1994, pages 9402 - 9406
YANG, H. ET AL., CELL.IN PRESS, 2013

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11612149B2 (en) 2015-07-10 2023-03-28 Chugai Seiyaku Kabushiki Kaisha Non-human animal having human CD3 gene substituted for endogenous CD3 gene
WO2021256555A1 (fr) 2020-06-19 2021-12-23 中外製薬株式会社 Molécule de liaison à l'antigène anti-lymphocytes t destinée à être utilisée en association avec un inhibiteur d'angiogenèse

Also Published As

Publication number Publication date
US11793180B2 (en) 2023-10-24
EP3502250C0 (fr) 2024-04-24
EP3502250A4 (fr) 2020-04-29
JPWO2018038046A1 (ja) 2019-06-20
US20200229408A9 (en) 2020-07-23
EP3502250A1 (fr) 2019-06-26
JP7125347B2 (ja) 2022-08-24
US20190174731A1 (en) 2019-06-13
JP2022134132A (ja) 2022-09-14
EP3502250B1 (fr) 2024-04-24

Similar Documents

Publication Publication Date Title
AU2016202512B2 (en) Genetically modified t cell receptor mice
US11279948B2 (en) Genetically modified non-human animal with human or chimeric OX40
RU2726446C2 (ru) Не относящиеся к человеку животные, экспрессирующие гуманизированный комплекс cd3
EP3058819B1 (fr) Animal non humain exprimant une molécule hla classe i
JP2022134132A (ja) ヒトｇｐｃ３ポリペプチドを発現する遺伝子改変非ヒト動物
US11350614B2 (en) Genetically modified non-human animal with human or chimeric CD28
US20190373866A1 (en) Genetically Modified Non-Human Animal With Human Or Chimeric OX40
WO2017010423A1 (fr) Animal non-humain ayant un gène cd3 humain substitué par un gène cd3 endogène
US12016315B2 (en) Genetically modified non-human animal with human or chimeric CD3e
US11272695B2 (en) Genetically modified non-human animal with human or chimeric PD-1
US10945419B2 (en) Genetically modified non-human animal with human or chimeric GITR
JP2022538885A (ja) トランスジェニック哺乳動物およびその使用法
JP2019506897A (ja) ヒトのセレブロンを発現するトランスジェニックマウス
WO2018233607A1 (fr) Animal non humain génétiquement modifié avec cd40 humain ou chimérique
WO2018233606A1 (fr) Animal non humain génétiquement modifié avec gitr humain ou chimérique
US11564381B2 (en) Genetically modified non-human animal with human or chimeric LAG3
US20240130340A1 (en) Genetically modified non-human animal with human or chimeric cd3 genes
WO2022258049A1 (fr) Animal non humain génétiquement modifié comportant des pvrig humains ou chimériques
CA3216988A1 (fr) Rongeurs transgeniques exprimant des anticorps chimeriques de rongeurs-equins et leurs methodes d'utilisation

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 2018535662

Country of ref document: JP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17843526

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017843526

Country of ref document: EP

Effective date: 20190322