WO2018003988A1 - Acide nucléique et composition permettant le traitement de tumeurs, y compris de tumeurs du cerveau - Google Patents

Acide nucléique et composition permettant le traitement de tumeurs, y compris de tumeurs du cerveau Download PDF

Info

Publication number
WO2018003988A1
WO2018003988A1 PCT/JP2017/024223 JP2017024223W WO2018003988A1 WO 2018003988 A1 WO2018003988 A1 WO 2018003988A1 JP 2017024223 W JP2017024223 W JP 2017024223W WO 2018003988 A1 WO2018003988 A1 WO 2018003988A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
strand sequence
sirna
modified rna
sequence
Prior art date
Application number
PCT/JP2017/024223
Other languages
English (en)
Japanese (ja)
Inventor
近藤　豊
彰一 出口
敦至 夏目
啓佑 勝島
Original Assignee
公立大学法人名古屋市立大学
国立大学法人名古屋大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 公立大学法人名古屋市立大学, 国立大学法人名古屋大学 filed Critical 公立大学法人名古屋市立大学
Priority to JP2018525306A priority Critical patent/JPWO2018003988A1/ja
Publication of WO2018003988A1 publication Critical patent/WO2018003988A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the present invention relates to a nucleic acid for treating a tumor including a brain tumor (eg, glioblastoma) and a pharmaceutical composition containing the nucleic acid.
  • a brain tumor eg, glioblastoma
  • a pharmaceutical composition containing the nucleic acid e.g, a pharmaceutical composition containing the nucleic acid.
  • Glioblastoma is one of the malignant brain tumors with the poorest prognosis.
  • Glioblastoma has epigenetic abnormalities such as untranslated RNA, histone modification, and DNA methylation in addition to genomic abnormalities such as gene mutations, and these epigenomic abnormalities contribute to carcinogenesis and malignancy of glioblastoma. It has been suggested. Control of gene expression by long noncoding RNA (lncRNA), which is one of non-translated RNAs, is deeply involved in various life phenomena such as cell differentiation and proliferation, and in recent years, involvement in cancer has been reported.
  • lncRNA long noncoding RNA
  • lncRNA is a major untranslated RNA, has a length of more than 200 bases, and is known to have a wide range of functions such as transcriptional repression and protein interaction regulation.
  • LINC00461 is a type of lncRNA that is highly expressed in human glioblastoma cells compared to human neural stem cells. It has been found that LINC00461 (also known as Visc-2, etc.) knockout mice do not show abnormal brain structure or function (Non-patent Document 1), but the function of LINC00461 in the brain is unknown. Furthermore, regarding tissues other than the brain, it is known in Patent Document 1 that LINC00461 can be a diagnostic marker for arthritis.
  • An object of the present invention is to provide a nucleic acid that suppresses the growth of tumors such as glioblastoma targeting a specific lncRNA, that is, the LINC00461 gene, and a pharmaceutical composition containing the nucleic acid.
  • the present inventors have now analyzed that the expression of the C130071C03Rik gene (ortholog of LINC00461) increases from the early stage of carcinogenesis, and further increases during the tumor formation stage, as well as human glioblastoma. It was found that the LINC00461 gene was also highly expressed in tumor samples. The present inventors have now further demonstrated that the use of a nucleic acid that suppresses the expression of the LINC00461 gene significantly suppresses the growth of tumor cells, and thus a nucleic acid that targets the LINC00461 gene is effective in the treatment of tumors such as glioblastoma. I found out.
  • the present invention includes the following features.
  • a pharmaceutical composition for treating or preventing a subject having a tumor that expresses the gene comprising a nucleic acid that suppresses the expression of the LINC00461 gene as an active ingredient.
  • the nucleic acid is siRNA, its precursor RNA, antisense RNA, or modified RNA, or antisense DNA, or DNA encoding the siRNA or its precursor RNA, with respect to the transcript RNA of the LINC00461 gene
  • the pharmaceutical composition according to (1) which is a vector containing the antisense DNA.
  • the nucleic acid is a nucleotide sequence between positions 1 and 150, a nucleotide sequence between positions 700 and 1620, or a nucleotide sequence between positions 3050 and 3560 of the transcript RNA sequence of SEQ ID NO: 37
  • the nucleic acid is the following siRNA or a modified RNA thereof: (A) siRNA comprising the antisense strand sequence of SEQ ID NO: 5 and the sense strand sequence of SEQ ID NO: 6 or a modified RNA thereof, (B) siRNA comprising the antisense strand sequence of SEQ ID NO: 7 and the sense strand sequence of SEQ ID NO: 8 or a modified RNA thereof, (C) siRNA comprising the antisense strand sequence of SEQ ID NO: 9 and the sense strand sequence of SEQ ID NO: 10 or a modified RNA thereof, (D) siRNA consisting of the antisense strand sequence of SEQ ID NO: 11 and the sense strand sequence of SEQ ID NO: 12 or a modified RNA thereof, (E) siRNA comprising the antisense strand sequence of SEQ ID NO: 13 and the sense strand sequence of SEQ ID NO: 14 or a modified RNA thereof, (F) siRNA comprising the antisense strand sequence of SEQ ID NO: 15 and the sense
  • the modified RNA consists of a locked LNA modified nucleotide having a 2′-O, 4′-C methylene bridge, 2′-methoxy nucleotide, 2′-methoxyethoxy nucleotide, or a combination thereof, at least 2
  • the tumor is selected from the group consisting of brain tumor, breast cancer, colon cancer, prostate cancer, liver cancer, lung cancer, leukemia, cervical cancer and lymphoma, (1) to (6) A pharmaceutical composition according to any one of the above.
  • siRNA comprising the antisense strand sequence of SEQ ID NO: 5 and the sense strand sequence of SEQ ID NO: 6 or a modified RNA thereof
  • siRNA comprising the antisense strand sequence of SEQ ID NO: 7 and the sense strand sequence of SEQ ID NO: 8 or a modified RNA thereof
  • siRNA comprising the antisense strand sequence of SEQ ID NO: 9 and the sense strand sequence of SEQ ID NO: 10 or a modified RNA thereof
  • D siRNA consisting of the antisense strand sequence of SEQ ID NO: 11 and the sense strand sequence of SEQ ID NO: 12 or a modified RNA thereof
  • siRNA comprising the antisense strand sequence of SEQ ID NO: 13 and the sense strand sequence of SEQ ID NO: 14 or a modified RNA thereof
  • siRNA comprising the antisense strand sequence of SEQ ID NO: 15 and the sense strand sequence of SEQ ID NO: 16 or
  • the modified RNA consists of a locked LNA modified nucleotide having a 2′-O, 4′-C methylene bridge, 2′-methoxy nucleotide, 2′-methoxyethoxy nucleotide, or a combination thereof, at least 2
  • the antitumor nucleic acid according to (11) comprising two modified nucleotides.
  • the present invention can significantly suppress the growth of tumors such as glioblastoma.
  • This figure shows the relative expression level of C130071C03Rik (or ortholog of LINC00461) over time in a mouse model for glioma formation (20 days old, 60 days old, 90 days old, and 120 days old).
  • the vertical axis shows the expression level of C130071C03Rik when the Gapdh gene is used as an internal standard.
  • the black bar graph indicates the expression level of tumor cells having the gene mutations p53 ⁇ / ⁇ and Nf1 ⁇ / ⁇
  • the gray bar graph indicates the expression level of normal brain cells whose gene mutation is wild type.
  • the horizontal axis shows the number of days since birth. *: P ⁇ 0.05, error bar: standard deviation.
  • This figure shows the result of analyzing the expression level of LINC00461, using the results of TCGA (The Cancer Genome Atlas) exome-sequencing (4 normal cerebral cases, 151 glioblastoma cases).
  • the vertical axis represents the relative expression level (RPKM value). *: P ⁇ 0.05.
  • This figure shows the evaluation of the inhibitory effect of LINC00461 on glioblastoma cell lines (U87 and U251) by siRNAs si-LINC00461 # 1, si-LINC00461 # 2 and si-LINC00461 # 3 (Table 1 described later). (A: U87, B: U251).
  • the expression level of LINC00461 48 hours after introduction of each siRNA is shown as a relative value to the expression level of LINC00461 (referred to as “1”) when control siRNA (si-NC) is introduced. *: P ⁇ 0.05, error bar: standard deviation.
  • This figure shows the evaluation of antiproliferative effect by si-LINC00461 # 1, si-LINC00461 # 2 and si-LINC00461 # 3 (Table 1 described later) against glioblastoma cell lines U87 and U251 (A: U87, B: U251). ).
  • the number of viable tumor cells every 24 hours from the time of introduction of each siRNA is shown as a relative value (relative tumor cell number) to the number of viable tumor cells at the time of siRNA introduction (referred to as “1”).
  • * P ⁇ 0.05
  • error bar standard deviation.
  • mice administered with Alexa-647-labeled LINC00461-LNA oligomer alone are mice administered with Alexa-647-labeled LINC00461-LNA oligomer alone, and the right 3 individuals are the drug delivery formulation containing Alexa-647-labeled LINC00461-LNA oligomer.
  • Results in administered mice. 6A shows a mouse brain tissue after a drug delivery preparation (25 ⁇ g / mouse as a nucleic acid) containing a LINC00461-LNA oligomer is intravenously administered once every three days to a brain tumor orthotopic transplant mouse model. The results of hematoxylin and eosin (HE) staining are shown.
  • HE hematoxylin and eosin
  • the left 3 individuals are mouse brain tissues administered with a drug delivery preparation (control) containing an LNA oligomer for the luciferase gene (firefly GL3 luciferase), and the right 3 individuals are a drug delivery preparation containing this LINC00461-LNA oligomer (this It is a mouse brain tissue administered with the invention.
  • the dotted line indicates the tumor area and the scale bar indicates 1 mm.
  • This figure shows a mouse brain tumor tissue after a drug delivery formulation (25 ⁇ g / mouse as a nucleic acid) containing a LINC00461-LNA oligomer is intravenously administered once every 3 days to a brain tumor orthotopic mouse model.
  • the expression level of LINC00461 is shown. It is shown as a relative value with respect to the expression level (referred to as “1”) of LIN00461 in mouse brain tumor tissue administered with a drug delivery preparation (control) containing a LNA oligomer for the luciferase gene (firefly GL3 luciferase).
  • * Indicates statistical significance (n 3, p ⁇ 0.01).
  • nucleic acid that suppresses the expression of the LINC00461 gene The active ingredient of the present invention is a nucleic acid that suppresses the expression of the LINC00461 gene. As will be described below, the nucleic acid has the effect of suppressing the expression of the LINC00461 gene and thereby suppressing the growth of the tumor.
  • nucleic acids related to the present invention can be prepared using nucleic acid oligomer synthesis techniques (eg, phosphoramidite method, solid phase synthesis method, etc.) known in the literature.
  • LINC00461 gene or “LINC00461” is a kind of untranslated RNA that becomes lncRNA (long noncoding RNA) after transcription, and in humans 1 to 3 variants (variant 1, variant 2).
  • Variant 3 for example, according to NCBI (USA) information, registration number NR — 024384 (variant 1; base sequence of SEQ ID NO: 37 in the case of lncRNA), NR — 024383 (variant 2; sequence number of 38 in the case of ncRNA) Have been reported.
  • the LINC00461 gene includes the above-described base sequence, a base sequence including deletion, substitution, addition or insertion of one or several nucleotides in each of these base sequences, or the above-described base sequences. It is a natural variant consisting of a base sequence having a sequence identity of 70% or more, 80% or more or 90% or more, preferably 95% or more, more preferably 98% or more or 99% or more.
  • LINC00461 is also referred to as EyeLin1, Visc-1a, Visc-1b, Visc-2, etc., and this gene has nucleotide number 88666833 of human chromosome 5. . . 886669939 (NCBI; NC — 000005.10.). As described above, sufficient knowledge about the function of the gene has not been obtained so far.
  • sequence identity means an integer of 2 to 10, preferably an integer of 2 to 5.
  • sequence identity can be determined using a known algorithm such as BLAST for taking a sequence alignment such as a base sequence.
  • the nucleic acid that suppresses the expression of the LINC00461 gene in tumor cells is, for example, siRNA or its precursor RNA having RNA interference (RNAi) action, or a modified RNA thereof, or a transcript RNA of the LINC00461 gene. And a vector containing DNA encoding siRNA or a precursor RNA thereof.
  • RNAi RNA interference
  • Another example of the nucleic acid is antisense RNA or antisense DNA, DNA encoding the antisense RNA, a vector containing the antisense DNA, or a modified nucleic acid thereof.
  • the nucleic acid in the present invention is not limited to a specific type of nucleic acid or nucleic acid sequence as long as it suppresses the expression of the LINC00461 gene in tumor cells and suppresses the growth of the tumor, but the transcription of the LINC00461 gene of the subject is not limited.
  • a region within the base sequence of the body RNA for example, the base sequence of the transcript RNA of the human LINC00461 gene, for example within the region of nucleotide numbers 1-150, 700-1620 or 3200-3560 in the base sequence of SEQ ID NO: 37, or Target a sequence consisting of 18 to 30 nucleotides, preferably 20 to 25 nucleotides, more preferably 21 to 23 nucleotides in the region of nucleotide numbers 500 to 1420 or 3050 to 3360 in the base sequence of SEQ ID NO: 38 Toss It is preferable.
  • More specific target sequences include, for example, SEQ ID NO: 25 (nucleotide numbers 862 to 884 of SEQ ID NO: 37 or nucleotide numbers 664 to 686 of SEQ ID NO: 38), SEQ ID NO: 26 (base numbers 1595 to 1617 of SEQ ID NO: 37, or sequence SEQ ID NO: 27 (nucleotide numbers 706-728 of SEQ ID NO: 37 or nucleotide numbers 504-526 of SEQ ID NO: 38), SEQ ID NO: 28 (nucleotide numbers 46-68 of SEQ ID NO: 37), SEQ ID NO: 29 (nucleotide numbers 114 to 136 of SEQ ID NO: 37), SEQ ID NO: 30 (nucleotide numbers 1426 to 1448 of SEQ ID NO: 37 or nucleotide numbers 1234 to 1256 of SEQ ID NO: 38), SEQ ID NO: 31 (nucleotide numbers of SEQ ID NO: 37) 3269-3 91 or nucleotide numbers
  • siRNA having RNAi (RNA interference) action on LINC00461 or its precursor RNA
  • siRNA is complementary to a part of transcript RNA of LINC00461 gene, 18-25 nucleotides, preferably 20-24 nucleotides, more preferably It is a double-stranded RNA consisting of sense RNA and antisense RNA consisting of 21 to 23 nucleotides and having RNAi action.
  • Each 3 ′ end of the sense RNA and antisense RNA has an overhang of 2-5 nucleotides, preferably 2 nucleotides, eg UU, CU, AC, UC, GC (in the case of DNA, U is T Etc.). It has been pointed out that the protruding end may interact with RISC (WR Strapps et al., Nucleic Acids Res. 2010 Aug; 38 (14): 4788-4797).
  • RNAi action has a meaning commonly used in the art, and a phenomenon in which a short double-stranded RNA (siRNA) degrades a target transcript RNA specifically in its base sequence and suppresses its gene expression. It is.
  • siRNA short double-stranded RNA
  • the precursor RNA is any one of siRNA priRNA, preRNA, and shRNA.
  • the priRNA has a transcript RNA sequence for the LINC00461 gene.
  • preRNA is a preshRNA produced by enzymatic processing of priRNA.
  • shRNA is an abbreviation for short hairpin RNA, and consists of a stem of a sense strand and an antisense strand having the same sequence as siRNA and a hairpin loop, which are enzymatically produced from preshRNA.
  • the shRNA hairpin structure is cleaved into siRNA by cellular machinery and binds to the RNA-induced silencing complex (RISC), which binds to and cleaves transcript RNA having a sequence complementary to the siRNA. .
  • RISC RNA-induced silencing complex
  • the nucleic acid of the present invention comprises, for example, an siRNA comprising an antisense strand sequence of SEQ ID NO: 5 and a sense strand sequence of SEQ ID NO: 6 or a modified RNA thereof, an antisense strand sequence of SEQ ID NO: 7 and a sense strand sequence of SEQ ID NO: 8.
  • siRNA or a modified RNA thereof siRNA comprising an antisense strand sequence of SEQ ID NO: 9 and a sense strand sequence of SEQ ID NO: 10 or a modified RNA thereof, siRNA comprising an antisense strand sequence of SEQ ID NO: 11 and a sense strand sequence of SEQ ID NO: 12 or The modified RNA, the siRNA comprising the antisense strand sequence of SEQ ID NO: 13 and the sense strand sequence of SEQ ID NO: 14 or its modified RNA, the siRNA comprising the antisense strand sequence of SEQ ID NO: 15 and the sense strand sequence of SEQ ID NO: 16 or a modification thereof RNA, the antisense strand sequence of SEQ ID NO: 17 and the sequence of SEQ ID NO: 18 SiRNA comprising a strand sequence or a modified RNA thereof, siRNA comprising an antisense strand sequence of SEQ ID NO: 19 and a sense strand sequence of SEQ ID NO: 20 or a modified RNA thereof, an antisense strand sequence of
  • the nucleic acid of the present invention is a vector comprising the siRNA, a DNA encoding the precursor RNA or the antisense RNA, or an antisense DNA with respect to the transcript RNA of the LINC00461 gene.
  • a preferred precursor RNA is shRNA.
  • the vector contains a regulatory sequence that enables expression of the DNA when introduced into a cell, for example, a viral vector such as adeno-associated virus, retrovirus, lentivirus, Sendai virus, or a plasmid, artificial chromosome (for example, , Bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), human artificial chromosome (HAC), or mouse artificial chromosome (MAC)).
  • BAC Bacterial artificial chromosome
  • YAC yeast artificial chromosome
  • HAC human artificial chromosome
  • MAC mouse artificial chromosome
  • Preferred vectors are plasmids, Sendai virus vectors, adeno-associated virus vectors and the like from the viewpoint of safety.
  • the plasmid is preferably a plasmid that can be used in mammalian cells, preferably human cells, and has been proven to be safe.
  • plasmid vectors include, for example, vectors as described in JP-T-2014-508515, such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1 / hyg, pHCMV / Zeo, pCR3. 1, pEF1 / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAX1, pZeoSV2, pCI, pSVL, pKSV-10, pBPV-1, pML2d, pML2d, etc. Examples include, but are not limited to, viral vectors.
  • the regulatory sequence includes a promoter, a transcription initiation point, a terminator, and the like, and can include an enhancer, a selectable marker sequence, and the like as necessary.
  • the promoter any endogenous or exogenous promoter can be used as long as it promotes transcription initiation of the DNA in a specific host cell.
  • the promoter is a U6 or H1 promoter. It is also expressed by the daughter cell and inherited by the gene silencing effect.
  • RNA is quite unstable because it is easily degraded by ribonuclease in vivo, for example, in blood.
  • nucleotide modification of the sense strand and the antisense strand is preferably performed.
  • the modification may be at least one, preferably multiple nucleotide modifications, such as base modifications, sugar modifications, phosphodiester moiety modifications, or combinations thereof, and / or cyclic structures (double stranded stems and A structure composed of two loops), a chimeric structure containing DNA, and the like. Modifications include, but are not limited to:
  • RNA and DNA are nucleic acids composed of a chain of nucleotides consisting of sugar, base and phosphodiester bonds, and the structural differences between these nucleic acids are in the sugars in the nucleotides, that is, the sugar in RNA is ribose.
  • the sugar of DNA is 2′-deoxyribose in which the hydroxyl group at the 2 ′ position is replaced with hydrogen, and a further difference is that the bases of RNA are adenine (A), uracil (U), guanine ( G) and cytosine (C), while the base of DNA consists of adenine (A), thymine (T), guanine (G) and cytosine (C).
  • the modification of the phosphodiester moiety as the backbone includes substitution by modification with, for example, a phosphorothioate, phosphorodithioate, alkylphosphonate, or phosphoramidate bond instead of the phosphodiester bond.
  • RNA and DNA include 2′-deoxy-2′-halo (eg, fluoro, chloro or bromo) nucleotides, 2′-deoxy as exemplified in JP-T-2007-525192.
  • 2′-deoxy-2′-halo eg, fluoro, chloro or bromo
  • the 2′-O— group may be substituted with a 2′-S— group.
  • the 2′ position of the sugar as described in, for example, JP-T-2010-507579 is substituted with, for example, halogen, allyl, amino, azide, acetoxy, alkyl.
  • LNA-modified nucleotides are artificial nucleic acids developed by Takeshi Imanishi et al. (M. Abdur Rahman, Sayori Seki, Satoshi Obika, HaruhisashiYoshikawa, Kazuyuki Miki).
  • '-BNA A bridged nucleic acid analog "J. Am. Chem. Soc. 130.4886-4896 (2008)), and LNA (“ BNA (Bridged Nucleic Acid) in the nucleotide sequence of the siRNA of the present invention ". ) ").
  • the nucleotide introduced with) Comes to have a nuclease-resistant.
  • the nucleic acid of the present invention can also have an RNA / DNA chimera structure containing a deoxyribonucleotide sequence in a part of the base sequence of siRNA.
  • a deoxyribonucleotide sequence By including the deoxyribonucleotide sequence, it becomes possible to make it more nuclease resistant than the ribonucleotide sequence alone (for example, Japanese Patent No. 3803318).
  • Deoxyribonucleotides can be included at a ratio of 30% or less, preferably 20% or less, based on the total number of nucleotides in the antisense strand or sense strand of the siRNA base sequence.
  • deoxyribonucleotide may be contained in both the antisense strand and the sense strand of siRNA, or may be contained only in the sense strand. Further, deoxyribonucleotides in the base sequence of siRNA are preferably present on the 3 ′ side. For example, they may be present in a sequence in which 2 to 4 deoxyribonucleotides are continuous as protruding ends at the 3 ′ end.
  • the nucleic acid having the above circular structure is a so-called dumbbell-type single-stranded RNA.
  • the stem is composed of complementary sequences of the sense strand sequence and the antisense strand sequence of siRNA.
  • the loop is composed of, for example, about 2 to about 15 nucleotides that are non-complementary per loop linked to each end of the stem (see, eg, US Pat. No. 5,168,053, US Pat. No. 5,190). 931, U.S. Pat. No. 5,135,917, Smith and Clausel et al. (1993) Nucl. Acids Res. 21: 3405-3411, and U.S. Pat. No. 5,087,617. ).
  • nucleic acid examples include the antisense RNA (or antisense DNA) described above or a modified nucleic acid thereof.
  • Antisense RNA is a single-stranded nucleic acid that targets lncRNA, which is a transcription product of the LINC00461 gene.
  • the siRNA targeting the lncRNA degrades the lncRNA, whereas the antisense RNA (or antisense DNA) suppresses or inhibits the lncRNA function.
  • the antisense RNA or antisense DNA is preferably an RNA / DNA chimeric structure and / or a modified derivative containing one or more of the above-mentioned modified nucleotides.
  • modified nucleotides are those described above, and a more preferred example is a combination of phosphorothioate modifications and 2'-MOE nucleotides, 2'-OMe nucleotides or LNA modified nucleotides.
  • the base length of antisense RNA (or antisense DNA) or a modified derivative thereof is usually 12 to 100 nucleotides, preferably 15 to 50 nucleotides, more preferably 20 to 30 nucleotides. Although the base length can be longer than 100 nucleotides, the above range is suitable because it is disadvantageous particularly in terms of production cost.
  • the sequence of the antisense RNA or the antisense DNA is the nucleotide sequence of the LINC00461 gene transcript lncRNA or the DNA encoding it, for example, the sequence derived from human LINC00461 of SEQ ID NO: 37 or 38, or each of these nucleotide sequences and 70% 80% or more or 90% or more, preferably 95% or more, more preferably 98% or more or 99% or more, from the base sequence of LINC00461, which is a natural variant consisting of a base sequence having sequence identity,
  • the base sequence to be selected can be selected to be a base sequence complementary to this sequence or a modified base sequence thereof.
  • the nucleotide sequence of the transcript RNA of the human LINC00461 gene for example, in the nucleotide sequence of SEQ ID NO: 37, in the region of nucleotide numbers 1-150, 700-1620, 3200-3560, or of SEQ ID NO: 38 It is preferable to target a sequence consisting of 19 to 30 nucleotides, preferably 20 to 25 nucleotides, more preferably 21 to 23 nucleotides in the region of nucleotide numbers 500 to 1420 or 3050 to 3360 in the base sequence.
  • a specific target sequence is a sequence including any one of the nucleotide sequences of SEQ ID NOs: 25 to 34 as described above.
  • composition for treating or preventing tumors comprises a nucleic acid that suppresses the expression of the LINC00461 gene in tumor cells and thereby suppresses tumor growth as an active ingredient. . Since the composition of the present invention targets tumor cells, tumor growth can be suppressed, tumors can be regressed, and tumor metastasis can also be suppressed in some cases. In the present invention, since the expression of the LINC00461 gene is observed in early stage cancers of stages 1 and 2 (FIG. 1), it is also effective for early stage cancers.
  • the tumor comprising the administration of the pharmaceutical composition of the present invention or the nucleic acid that is an active ingredient thereof to a subject (eg, human) having or suspected of having a tumor or cancer expressing the LINC00461 gene
  • a method for the treatment or prevention of cancer is also provided.
  • the nucleic acid which is the active ingredient of the present invention can be used for the production of the pharmaceutical composition of the present invention.
  • the nucleic acid may be formulated in the form of a composition containing itself mixed with a carrier or the like, or may be formulated so as to be incorporated into a delivery system.
  • the dose of the nucleic acid is, but is not limited to, in humans, for example, about 0.01 mg to about 1,000 mg per dose and per kg body weight for an adult, but generally the dose or dose is determined by the subject's gender, It should be selected in consideration of age, weight, symptoms, severity, side effects, etc.
  • administration can be performed, for example, at intervals of 1 week, 2 weeks, 3 weeks, or 4 weeks, or at intervals exceeding 1 month if necessary.
  • a carrier or diluent and an additive can be mixed to form a pharmaceutical composition.
  • a so-called pharmaceutical kit can be prepared by combining the pharmaceutical composition with other anticancer agents (for example, chemotherapeutic agents, antibody drugs, etc.) and / or other treatment-related drugs.
  • the carrier or diluent can vary depending on the form of the formulation, ie, usually a solid formulation, a semi-solid formulation or a liquid (or solution) formulation, or a dosage form (or dosage form).
  • oral preparations such as tablets, capsules, granules, powders, syrups and gels, or injections, drops, transmucosal agents (eg, nasal agents), transdermal administration And parenteral administration agents such as pills, liposomes, rectal administration (or suppositories), inhalants, ointments, lotions and the like.
  • the diluent for liquid preparation includes, for example, distilled water, sterilized water, Ringer's solution, physiological saline and the like. If necessary, an appropriate amount of ethanol can be mixed.
  • an organic solvent alone or an organic solvent / water mixture can be used as a carrier or an excipient.
  • organic solvents examples include ethanol, isopropanol, isobutanol, sec-butanol, tert-butanol, acetonitrile, acetone, ketone, dimethyl sulfoxide, dimethylformamide, glycerol, polyethylene glycol, fats and oils such as cocoa butter and soybean oil, and these Is included.
  • carriers or excipients for solid formulations include maltose, lactose, sucrose, starch, gelatin, tragacanth gum, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and the like.
  • Additives are pharmaceutically acceptable, for example, excipients, extenders, fillers, binders, wetting agents, disintegrants, lubricants, emulsifiers, dispersants, buffers, preservatives, solubilizers, Examples include antiseptics, flavoring agents, soothing agents, stabilizers, tonicity agents, pH adjusters, and the like.
  • Examples of the administration route include intravenous administration, intraarterial administration, oral administration, transpulmonary administration, tissue administration, transdermal administration, transmucosal administration, rectal administration, intraperitoneal administration, intracerebral administration, and the like. .
  • intravenous administration, transdermal administration, and transmucosal administration are particularly preferable.
  • the nucleic acid can be encapsulated in, for example, liposomes.
  • a cationic liposome is usually used (Y. TAKAHASHI et al., YAKUGAKU ZASSHI 127 (10) 1525-1531 (2007)).
  • Cationic liposomes are positively charged and easily bind electrostatically to negatively charged cell membranes, and passively bound liposome membranes are taken up into the cytoplasm via endocytosis and are transferred from the endosomes. It is thought that it escapes and is released into the cytoplasm.
  • nucleic acid of the present invention may be contained or encapsulated in a non-liposomal drug delivery material such as a nano-sized polymer micelle type drug delivery material (see Table 2007/099660, Table 2007/999661, Table 2009/113645, WO2013 / 162041, Table 2010/093036, Table 2012/005376).
  • a non-liposomal drug delivery material such as a nano-sized polymer micelle type drug delivery material (see Table 2007/099660, Table 2007/999661, Table 2009/113645, WO2013 / 162041, Table 2010/093036, Table 2012/005376).
  • the present invention further provides a method for treating a subject having a tumor that highly expresses the LINC00461 gene as compared with a normal tissue, comprising administering the above composition as an anticancer agent to the subject.
  • a “subject” is a mammal, including humans, pet animals (dogs, cats, etc.), animals kept in zoos, and preferably humans.
  • the tumors that can be treated according to the present invention are preferably malignant tumors expressing the LINC00461 gene, such as brain tumors, breast cancer, colon cancer, prostate cancer, liver cancer, lung cancer, leukemia, cervical cancer and lymphoma, preferably brain tumors (eg Blastoma), but is not limited to these tumors.
  • malignant tumors expressing the LINC00461 gene such as brain tumors, breast cancer, colon cancer, prostate cancer, liver cancer, lung cancer, leukemia, cervical cancer and lymphoma, preferably brain tumors (eg Blastoma), but is not limited to these tumors.
  • the use of the above-described nucleic acid in cells of brain tumors such as glioblastoma has confirmed an excellent cell growth-suppressing effect. Therefore, the composition containing the nucleic acid of the present invention as an active ingredient is used as an anticancer agent targeting tumor cells. Was also found to be excellent.
  • compositions subject, dose, route of administration, number of doses, etc. are as described above.
  • composition of the present invention can be administered to a subject in combination with administration of other cancer therapeutic agents such as chemotherapeutic agents, pharmaceutical antibodies, immune checkpoint inhibitors.
  • Administration of the composition can occur before, simultaneously with, or after administration of other cancer therapeutic agents such as chemotherapeutic agents, pharmaceutical antibodies, immune checkpoint inhibitors.
  • chemotherapeutic agents include, but are not limited to, anticancer agents as described in JP-T-2014-508515, for example, topoisomerase inhibitors (for example, etoposide, lamptothecin, topotecan, teniposide, mitoxantrone, etc.), DNA alkylating agents (eg, cisplatin, mechloretamine, cyclophosphamide, ifosfamide, melphalan, columbucil, busulfan, thiotepa, carmustine, lomustine, carboplatin, dacarbazine, procarbazine, etc.), DNA strand breakage inducers (eg, bleomycin, Doxorubicin, daunorubicin, idarubicin, mitomycin C, etc.), microtubule inhibitors (eg, vincristine, vinblastine, etc.), antimetabolites (eg, cytarabine, methotre
  • Examples of pharmaceutical antibodies include, but are not limited to, various commercially available antibodies including trastuzumab, bevacizuzumab, panitumumab, cetuximab, rituximab, and mogamulizumab, as well as developed and marketed antibodies.
  • An immune checkpoint inhibitor is a drug for restoring the original attack power of immune cells against cancer cells by suppressing the cancer cells from avoiding attacks from immune cells.
  • PD-1 programmed cell
  • PD-L1 programmed death-ligand 1
  • the dosage of the above drug is selected in consideration of the sex, age, weight, symptom, severity, side effects, etc. of the subject, or is in a range actually used in clinical practice.
  • Example 1 ⁇ Changes in C130071C03Rik expression over time in a mouse model of glioma formation> From 15876 lncRNAs registered in a public database (GENCODE), 134 lncRNAs having base sequences conserved in humans and mice (homology,> 80%, base length,> 200 bp) were identified. Furthermore, LINC00461 highly expressed in glioblastoma cells was identified by comparing the results of RNA sequencing of human glioblastoma cells and human neural stem cells. C130071C03Rik is an orthologue of LINC00461 (human) derived from a mouse.
  • the present inventors conducted the following experiment using a genetically modified mouse model (p53 ⁇ / ⁇ , Nf1 ⁇ / ⁇ ) that naturally causes glioma (Zong H et al. Cell, 2011, 146: 209-221).
  • the glioma mouse model includes three strains of genetically-mutated mice purchased from The Jackson Laboratory (# 17530, (STOCK Iis2tm1 (ACTB-tdTomato, -EGFP) LuoTrp53tm1TyjNf1tm1Par / J), # 4600T (F-Bcg), # 4600T ) 25 MesJ), # 13749, (STOCK Iis2tm1 (ACTB-EGFP, -tdTomato) Luo / J).
  • the cerebrum of the glioma-forming mouse model was removed.
  • BD FACSAria TM II cell sorter
  • Gapdh primer sequence Gapdh-Forward CGTCCCGTAGACAAAATGGT (SEQ ID NO: 1) Gapdh-Reverse GAATTTGCCGTGAGTGGAGT (SEQ ID NO: 2)
  • C130071C03Rik primer sequence C130071C03Rik-Forward TGACACTTCAAAGAAGCATAAAATG (SEQ ID NO: 3)
  • C130071C03Rik-Reverse TGTGAATGTTTTAAGGGAGATCCT SEQ ID NO: 4
  • Example 2 ⁇ Analysis of LINC00461 expression level in human glioblastoma patient cerebrum> The data of LINC00461 in 151 cases of glioblastoma and 4 cases of normal cerebrum were obtained from the TCGA (The Cancer Genome Atlas) database, and the expression of LINC00461 was analyzed.
  • TCGA The Cancer Genome Atlas
  • LINC00461 was also highly expressed in human glioblastoma samples (FIG. 2). In addition, it was estimated that LINC00461 may be involved in glioblastoma formation.
  • siRNA that suppresses the expression of LINC00461 The present inventors produced three types of siRNA that suppress the expression of LINC00461.
  • siDirect version 2.0 http://sidirect2.rnai.jp/
  • a target sequence was searched for the LINC00461 RNA sequence (RefSeq NR — 024384) to prepare three types of siRNA (si-LINC00461 # 1 to # 10; consigned to Hokkaido System Science Co., Ltd. (Sapporo, Japan)).
  • the sequence of siRNA is shown in Table 1. For all siRNAs, 2 bases at the 3 ′ end were synthesized as DNA.
  • siRNA final concentration 50 nM was introduced into a glioblastoma cell line (U87, U251, each initial cell number 5 ⁇ 10 4 ) using Lipofectamine 3000 (Life Technologies) according to the attached protocol.
  • Silencer Select Negative Control # 1 siRNA (Life Technologies; catalog number 4390843) was used as the control siRNA. 48 hours after siRNA introduction, the expression level of LINC00461 relative to control siRNA was quantified by qRT-PCR using the GAPDH gene as an internal standard, and the effect of suppressing the expression of three types of siRNA against LINC00461 was confirmed (FIG. 3).
  • SiRNA final concentration 50 nM was introduced into a glioblastoma cell line (U87, U251; initial cell number 5 ⁇ 10 3 ) on a 96-well plate. 24, 48, and 72 hours after introduction, 10 ⁇ l of cell counting kit-8 (Dojindo Laboratories (Kumamoto, Japan); product code CK04) was added to each well, and 2 hours later, a microplate reader (versaMAX) The absorbance at 450 nm was measured.
  • cell counting kit-8 Dojindo Laboratories (Kumamoto, Japan); product code CK04
  • Example 5 ⁇ Anti-tumor effect of drug delivery formulation containing LINC00461-LNA oligomer for brain tumor orthotopic transplantation mouse model>
  • the glioblastoma cell line U87 was orthotopically transplanted into the brain of an immunodeficient mouse (BLAB / c slc-nu / nu; Nippon SLC Co., Ltd. (Shizuoka, Japan)) as a brain tumor orthotopic mouse model, and 14 days after transplantation Mice with engrafted brain tumors were prepared.
  • drug delivery materials nano-sized polymer micelle type (polyethylene glycol-polyamino acid block copolymer); K. Osada et al., J.R. Soc. . Interface (2009) 6, S325-S339;.. Miura, Y.
  • a LINC00461-LNA oligomer (antisense DNA in which 5'-side AGT and 3'-side CTT are locked nucleic acids; 5'-AGTTTATTCCGAACTTTTCTT-3 '(SEQ ID NO: 39)) is a fluorescent substance ( Labeled with Alexa-647).
  • a single LINC00461-LNA oligomer labeled with Alexa-647 was used.
  • LINC00461-LNA oligomer-encapsulated drug delivery formulation and LINC00461-LNA oligomer alone were intravenously administered to brain tumor orthotopic transplanted mice (25 ⁇ g / mouse), and the fluorescence intensity was measured by IVIS Imaging System (Caliper LifeSciences). It was confirmed that the drug delivery preparation encapsulating the LNA oligomer was specifically accumulated in the brain tumor site (FIG. 5).
  • a drug delivery formulation containing a LINC00461-LNA oligomer is continuously administered intravenously (every 3 days) to the above brain tumor orthotopic transplanted mice (mice 14 days after transplantation of glioblastoma cell line U87). Once administered (25 ⁇ g / mouse)), antitumor effects were evaluated.
  • drug delivery containing LNA oligomers for Firefly GL3 Luciferase gene (5′-TCGAAGTACTCAGCGTAAGTT-3 ′ (SEQ ID NO: 40)), which is an antisense DNA in which 5 ′ TCG and 3 ′ GTT are locked nucleic acids. Mice to which the formulation was administered were used.
  • a drug delivery formulation containing LINC00461-LNA oligomer The tumor was markedly reduced by administration of (Fig. 6).
  • RNA was extracted from mouse brain tumor tissue, and the expression level of LINC00461 was quantified by qRT-PCR, confirming the expression-suppressing effect on the drug delivery formulation containing the LINC00461-LNA oligomer (FIG. 7).
  • the drug delivery preparation encapsulating the LINC00461-LNA oligomer specifically accumulates in the brain tumor in vivo and exhibits a strong antitumor action.
  • an inhibitory effect on the growth of tumors such as glioblastoma was observed by suppressing the expression of LINC00461 in tumor cells using siRNA.
  • Useful for the treatment or prevention of tumors Useful for the treatment or prevention of tumors.
  • SEQ ID NOs: 1-4 primer SEQ ID NOs: 5-24: siRNA of human LINC00461 SEQ ID NO: 35-36: Primer SEQ ID NO: 39: LINC00461-LNA oligomer SEQ ID NO: 40: LNA oligomer for Firefly GL3 Luciferase gene

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne une composition pharmaceutique permettant le traitement ou la prévention chez le patient atteint d'une tumeur exprimant le gène LINC00461, caractérisée en ce qu'elle comprend comme principe actif un acide nucléique qui inhibe l'expression du gène LINC00461, ainsi qu'un acide nucléique antitumoral qui inhibe l'expression du gène LINC00461.
PCT/JP2017/024223 2016-06-30 2017-06-30 Acide nucléique et composition permettant le traitement de tumeurs, y compris de tumeurs du cerveau WO2018003988A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2018525306A JPWO2018003988A1 (ja) 2016-06-30 2017-06-30 脳腫瘍を含む腫瘍の治療用核酸および組成物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2016131073 2016-06-30
JP2016-131073 2016-06-30

Publications (1)

Publication Number Publication Date
WO2018003988A1 true WO2018003988A1 (fr) 2018-01-04

Family

ID=60786006

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2017/024223 WO2018003988A1 (fr) 2016-06-30 2017-06-30 Acide nucléique et composition permettant le traitement de tumeurs, y compris de tumeurs du cerveau

Country Status (2)

Country Link
JP (1) JPWO2018003988A1 (fr)
WO (1) WO2018003988A1 (fr)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CAI,H. ET AL.: "Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.", ONCOGENE, vol. 36, no. 3, 27 June 2016 (2016-06-27), pages 318 - 331, XP055449132, ISSN: 1476-5594 *
HAN,L. ET AL.: "IncRNA profile of glioblastoma reveals the potential role of lncRNAs in contributing to glioblastoma pathogenesis.", INT. J. ONCOL., vol. 40, no. 6, June 2012 (2012-06-01), pages 2004 - 2012, XP055449136, ISSN: 1791-2423 *
OLIVER,P.L. ET AL.: "Disruption of Visc-2, a Brain-Expressed Conserved Long Noncoding RNA, Does Not Elicit an Overt Anatomical or Behavioral Phenotype.", CEREB. CORTEX., vol. 25, no. 10, October 2015 (2015-10-01), pages 3572 - 3585, XP055449137, ISSN: 1460-2199 *
PASTORI,C. ET AL.: "The Bromodomain protein BRD4 controls HOTAIR, a long noncoding RNA essential for glioblastoma proliferation.", PROC. NATL. ACAD. SCI. USA, vol. 112, no. 27, 7 July 2015 (2015-07-07), pages 8326 - 8331, XP055449133, ISSN: 1091-6490 *
SHOICHI DEGUCHI ET AL.: "Dysregulation of epigenetics and long non-coding RNA in glioblastoma", FOLIA PHARMACOL.JPN., vol. 147, no. 6, 11 June 2016 (2016-06-11), pages 357 - 61, ISSN: 1347-8397 *

Also Published As

Publication number Publication date
JPWO2018003988A1 (ja) 2019-05-16

Similar Documents

Publication Publication Date Title
US9556431B2 (en) ShRNA molecules and methods of use thereof
JP6664815B2 (ja) 抗腫瘍剤
JP6414886B2 (ja) 抗癌治療に用いられる長鎖非コードｒｎａ
JP5383186B2 (ja) Ｈ１９をダウンレギュレートする核酸薬剤、及びそれを使用する方法
US8697672B2 (en) Microrna inhibition for the treatment of inflammation and myeloproliferative disorders
CN102482672A (zh) 通过抑制唐氏综合征基因的天然反义转录物治疗唐氏综合征基因相关疾病
US20190300882A1 (en) Methods of treating neuroblastoma and reagents therefor
US20170211073A1 (en) Antisense antineoplastic agent
US20090202623A1 (en) Gene therapy for cancer using small interfering rna specific to ant2 and a method to overcome tolerance to antitumor agent
CN110382698B (zh) 用于治疗眼咽肌营养不良症(opmd)的试剂及其用途
KR102353847B1 (ko) 안구인두 근이영양증(opmd)의 치료용 시약 및 이의 용도
WO2014028762A1 (fr) Compositions et procédés permettant de traiter la maladie artérielle périphérique
WO2018003988A1 (fr) Acide nucléique et composition permettant le traitement de tumeurs, y compris de tumeurs du cerveau
WO2021039879A1 (fr) Médicament à base d'acide nucléique pour le ciblage d'une molécule de cancer gastrique
EP4124656A1 (fr) Micro arn pd-l1
KR20240086730A (ko) IFITM1 shRNA를 포함하는 암 치료용 약학 조성물
WO2015082896A1 (fr) Matériaux et méthodes de traitement de l'hypertension artérielle pulmonaire
EP3820483A2 (fr) Compositions et méthodes de traitement de l'endométriose

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17820342

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018525306

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17820342

Country of ref document: EP

Kind code of ref document: A1