WO2017191021A1 - The incrna meg3 for therapy and diagnosis of cardiac remodelling - Google Patents

The incrna meg3 for therapy and diagnosis of cardiac remodelling Download PDF

Info

Publication number
WO2017191021A1
WO2017191021A1 PCT/EP2017/059984 EP2017059984W WO2017191021A1 WO 2017191021 A1 WO2017191021 A1 WO 2017191021A1 EP 2017059984 W EP2017059984 W EP 2017059984W WO 2017191021 A1 WO2017191021 A1 WO 2017191021A1
Authority
WO
WIPO (PCT)
Prior art keywords
meg3
seq
cardiac
nucleotides
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/059984
Other languages
English (en)
French (fr)
Inventor
Thomas Thum
Maria-Teresa PICCOLI
Janika VIERECK
Shashi Kumar GUPTA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medizinische Hochschule Hannover
Original Assignee
Medizinische Hochschule Hannover
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medizinische Hochschule Hannover filed Critical Medizinische Hochschule Hannover
Priority to JP2018557329A priority Critical patent/JP6928001B2/ja
Priority to US16/098,793 priority patent/US11186838B2/en
Priority to EP17722704.8A priority patent/EP3452593B1/en
Publication of WO2017191021A1 publication Critical patent/WO2017191021A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Definitions

  • the present invention relates to a compound inhibiting the expression and/or the activity of maternally expressed 3 (Meg3) for use in treating or preventing cardiac remodelling.
  • Meg3 maternally expressed 3
  • ncRNAs non-coding RNAs
  • cardiovascular diseases including cardiac diseases involving cardiac remodelling, such as cardiac hypertrophy and fibrosis, coronary artery disorders, as well as myocardial infarction.
  • microRNAs microRNAs
  • RNAs composed of approximately 20-22 nucleotides that bind other transcripts reducing the stability and/or translation of their targets.
  • miR-21 and miR-132 induce cardiac fibrosis or hypertrophy, respectively, and that in vivo repression of these miRNAs by specific AntagomiRs (being chemically engineered oligonucleotides silencing miRNAs) rescues fibrosis or hypertrophy in cardiac disease model of pressure-overload (Thum et al. Nature. 2008 456(7224):980-4.;
  • LncRNAs are mRNA-like transcripts ranging from 200 nucleotides up to 100 kilobases and are classified based on their genomic distribution relative to protein-coding genes (sense to exons and/or introns, antisense, bidirectional, or intergenic).
  • Several IncRNA transcripts are exclusively restricted to the nucleus, while others are also found in the cytoplasm.
  • IncRNAs interact with proteins as well as other RNA or DNA molecules enabling IncRNAs to influence a variety of gene regulatory mechanisms including chromatin modification, genomic imprinting, nuclear compartmentalization and architecture, as well as transcriptional and post-transcriptional regulation (Schonrock et al. Circ Res. 2012 Oct 26;111(10):1349-62.; Caley et al. ScientificWorld Journal. 2010 10:90-102).
  • IncRNAs are involved in human disease, such as cancer, metabolic and neuronal disorders.
  • GWAS Genome-wide association study
  • MIAT myocardial infarction-associated transcript
  • ANRIL antisense noncoding RNA in the INK4 locus
  • the IncRNA Kcnq1ot1 controls the expression of its antisense gene Kcnql that encodes for a potassium channel.
  • IncRNA LIPCAR can be used to predict survival in patients with heart failure (Kumarswamy et al. (2014), Circ Res.; 114(10): 1569-75). Moreover, the IncRNA Chast has been shown to promote cardiac remodelling (Viereck et al. (2016), Sci Transl Med.; 8(326):326ra22).
  • the object of the present invention is therefore the provision of novel means and methods for treating or preventing cardiac diseases, in particular cardiac remodelling. It was surprisingly found in connection with the present invention that the IncRNA maternally expressed 3 (Meg3) plays a role in the development of cardiac remodelling thereby providing novel therapeutic and diagnostic strategies.
  • Mc3 IncRNA maternally expressed 3
  • the present invention relates in first aspect to a compound inhibiting the expression and/or the activity of maternally expressed 3 (Meg3) for use in treating or preventing cardiac remodelling.
  • the present invention also encompasses a method for treating or preventing cardiac remodelling in a patient in need thereof by administering to the patient a therapeutically effective amount of a compound inhibiting the expression and/or the activity of maternally expressed 3 (Meg3).
  • Meg3 also known as GTL2; FP504; prebpl ; PRO0518; PRO2160; LINC00023; NCRNA00023; or onco-lncRNA-83 designates a maternally expressed, imprinted IncRNA (Zhang et al.
  • the human MEG3 gene is found on chromosome 14q32.2 and the mouse Meg3 gene on the distal chromosome 12.
  • the IncRNA Meg3 is known to act as a tumor suppressor (Zhang et al. (2003), J. Clin. Endocrinol. Metab. 88(11 ):5119-26).
  • Meg3 is expressed in many normal tissues, but its expression is lost in multiple cancer cell lines of various tissue origins. It inhibits tumor cell proliferation in vitro. It also interacts with the tumor suppressor p53, and regulates p53 target gene expression. Its deletion enhances angiogenesis in vivo.
  • eg3 is furthermore known to play an essential role in controlling pre- and postnatal growth and differentiation in mice and humans (Takahashi et al (2009), Hum. Molec. Genet, 18:1879-1888).
  • Meg3 is involved in the senescence of endothelial cells (Boon (2015), Physiology, Proc Physiol Soc 34, SA022).
  • reduced levels of Meg3 were detected in fibrotic liver of human and mouse (He et al. (2014), Biochim Biophys Acta, 1842(11 ):2204-15).
  • the role of Meg3 in cardiac remodelling is disclosed for the first time by the present invention.
  • ncRNA or "non-coding RNA” as used herein designates a functional RNA molecule that is not translated into a protein.
  • the DNA sequence from which a non-coding RNA is transcribed is often called in the art an RNA gene.
  • the term “IncRNA” or “long non- coding RNA” is commonly used in the art and designates an ncRNA comprising more than 200 nucleotides. As will be further detailed herein below all known mouse and human Meg3 isofoms have more than 200 nucleotides. Meg3 is therefore an IncRNA.
  • a compound inhibiting the expression of Meg3 is in accordance with the present invention a compound lowering or preventing the transcription of the gene encoding the IncRNA Meg3.
  • Such compounds include compounds interfering with the transcriptional machinery and/or its interaction with the promoter of said gene and/or with expression control elements remote from the promoter such as enhancers.
  • the compound inhibiting the expression of Meg3 specifically inhibits the expression of said IncRNA, for example, by specifically interfering with the promoter region controlling the expression of the IncRNA.
  • the transcription of Meg3 is reduced by at least 50%, more preferred at least 75% such as at least 90% or 95%, even more preferred at least 98% and most preferred by about 100% (e.g., as compared to the same experimental set up in the absence of the compound).
  • a compound inhibiting the activity of Meg3 in accordance with the present invention causes said IncRNA to perform its function with lowered efficiency.
  • the compound inhibiting the activity of Meg3 specifically inhibits the activity of said IncRNA.
  • the activity of Meg3 is reduced by at least 50%, more preferred at least 75% such as at least 90% or 95%, even more preferred at least 98%, and most preferably about 100% (e.g., as compared to the same experimental set up in the absence of the compound).
  • Means and methods for determining the reduction of activity of an RNA are established in the art and are described, for example, in Esau et al. (2004), JBC, 279:52361-52365 or Gribbings et al. (2009), Nature Cell Biology 11 , 1143-1149.
  • a compound inhibiting the activity of Meg3 may be an antisense molecule, siRNA, shRNA, antibody, ribozyme, aptamer, or small molecule.
  • the efficiency of an inhibiting compound can be quantified by methods comparing the level of activity in the presence of the inhibitor to that in the absence of the inhibitor.
  • the change in the amount of Meg3 formed may be used in the measurement of its activity.
  • the change in the amount of MMP2 formed may be used in the measurement of its activity(noting that the downregulation of Meg3 is shown in the examples to be accompanied by the downregulation of MMP2).
  • Such a method may be effected in high-throughput format in order to test the efficiency of several inhibiting compounds simultaneously.
  • High-throughput assays independently of being biochemical, cellular or other assays, generally may be performed in wells of microtiter plates, wherein each plate may contain 96, 384 or 1536 wells.
  • Handling of the plates, including incubation at temperatures other than ambient temperature, and bringing into contact of test compounds with the assay mixture is preferably affected by one or more computer-controlled robotic systems including pipetting devices.
  • mixtures of, for example 10, 20, 30, 40, 50 or 100 test compounds may be added to each well.
  • said mixture of test compounds may be de-convoluted to identify the one or more test compounds in said mixture giving rise to said activity.
  • the compounds inhibiting the expression and/or the activity of Meg3 may be formulated as vesicles, such as liposomes.
  • Liposomes have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. Liposomal delivery systems have been used to effectively deliver nucleic acids, such as siRNA in vivo into cells (Zimmermann et al. (2006) Nature, 441 :111-114). Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are phagocytosed by macrophages and other cells in vivo.
  • the compounds inhibiting the expression and/or the activity of Meg3 can be administered to the subject at a suitable dose.
  • the dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. The therapeutically effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgement of the ordinary clinician or physician. Generally, the regimen as a regular administration of the pharmaceutical composition should be in the range of 1 pg to 5 g units per day.
  • a more preferred dosage is in the range of 0.01 mg to 100 mg, even more preferably 0.01 mg to 50 mg and most preferably 0.01 mg to 10 mg per day.
  • said compound comprises or is an nucleic acid molecule, such as an siRNA
  • the total pharmaceutically effective amount of pharmaceutical composition administered will typically be less than about 75 mg per kg of body weight, such as for example less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1 , 0.5, 0.1 , 0.05, 0.01 , 0.005, 0.001 , or 0.0005 mg per kg of body weight.
  • the amount will be less than 2000 nmol of nucleic acid molecule per kg of body weight, such as for example less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075 or 0.00015 nmol per kg of body weight.
  • the length of treatment needed to observe changes and the interval following treatment for responses to occur vary depending on the desired effect.
  • the particular amounts may be determined by conventional tests which are well known to the person skilled in the art. Suitable tests are, for example, described in Tamhane and Logan (2002), “Multiple Test Procedures for Identifying the Minimum Effective and Maximum Safe Doses of a Drug", Journal of the American statistical association, 97(457):1-9.
  • the compounds inhibiting the expression and/or the activity of Meg3 are preferably admixed with a pharmaceutically acceptable carrier or excipient to form a pharmaceutical composition.
  • a pharmaceutically acceptable carrier or excipient is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type (see also Handbook of Pharmaceutical Excipients 6ed. 2010, Published by the Pharmaceutical Press).
  • the compounds inhibiting the expression and/or the activity of Meg3 or the pharmaceutical composition may be administered, for example, orally, parenterally, such as subcutaneously, intravenously, intramuscularly, intraperitoneally, intrathecally, transdermally, transmucosally, subdurally, locally or topically via iontopheresis, sublingually, by inhalation spray, aerosol or rectally and the like in dosage unit formulations optionally comprising conventional pharmaceutically acceptable carriers or excipients.
  • cardiac remodelling is defined herein as an alteration in the structure (e.g., dimensions, mass, shape) of the heart. Cardiac remodelling may occur in response to hemodynamic load and/or cardiac injury in association with neurohormonal activation. Remodelling may be described as physiologic or pathologic. For instance, pathologic (or unhealthy) cardiac remodelling is to be held distinct from physiologic (or healthy) cardiac remodelling (such cardiac remodelling or "athlete's heart") which is a normal response of the heart, for example, in response to healthy exercise or pregnancy. Among healthy subjects, rowers or cyclists tend to have the largest hearts, with an average left ventricular wall thickness of 1.3 centimeters, compared to 1.1 centimeters in average adults.
  • Cardiac remodelling is in accordance with the invention unhealthy cardiac remodelling or pathological remodelling, such as cardiac remodelling in response to stress or disease, e.g., hypertension, heart muscle injury (myocardial infarction), heart failure or neurohormones.
  • the remodelling process preferably includes increases in myocardial mass.
  • the IncRNA Meg3 plays a role in the development of cardiac remodelling.
  • cardiac remodelling was induced in C57BI/6N mice via transverse aortic constriction (TAC) and cardiac cells, including cardiac fibroblasts, were isolated from TAC and sham mice 13 weeks after surgery.
  • TAC transverse aortic constriction
  • cardiac cells including cardiac fibroblasts
  • LncRNA profiling in TAC and sham cardiac fibroblasts was performed through Arraystar's Mouse LncRNA Expression Microarray V2.0. Meg3 was identified among the most abundant IncRNAs in cardiac fibroblasts and the strongest regulated ones during pressure overload.
  • mice were subjected to 6 weeks of TAC and continuous silencing of Meg3 from week 1 until endpoint. Silencing was achieved via LNA GapmeRs and prevented the TAC-induced upregulation of MMP2, significantly reducing cardiac remodelling as evidenced by reduced cardiac fibrosis, reduced expression of pro-fibrotic molecules, decreased expression of hypertrophy markers and reduced cardiomyocytes cross-sectional area. Ejection fraction and fractional shortening were not affected by Meg3 levels; however, the left ventricular myocardial performance index measured via pulsed Doppler echocardiography revealed a functional improvement of the heart, with values of the index comparable to that of sham mice.
  • the cardiac remodelling is Heart Failure with preserved Ejection Fraction (HFpEF).
  • HFpEF Heart Failure with preserved Ejection Fraction
  • HFpEF is commonly understood as manifestation of signs and symptoms of heart failure with a normal ejection fraction (> 50%).
  • HFpEF is characterized by cardiac remodelling, in particular a decrease in left ventricular compliance, leading to increased pressure in the left ventricle. Accordingly, concentric remodelling (with or without LV hypertrophy) is seen in many HFpEF patients. Also an increased left atrial size is often seen with HFpEF as a result of the poor left ventricular diastolic function.
  • the cardiac remodelling is Heart Failure with reduced Ejection Fraction (HFrEF), myocardial infarction related cardiac remodelling, genetic cardiac disease associated cardiac remodelling, cardiac hypertrophy and/or cardiac fibrosis.
  • HFrEF Heart Failure with reduced Ejection Fraction
  • myocardial infarction related cardiac remodelling myocardial infarction related cardiac remodelling
  • genetic cardiac disease associated cardiac remodelling cardiac hypertrophy and/or cardiac fibrosis.
  • HFrEF generally occurs when the left ventricle is dilated and enlarged with poor systolic function. Around 50% of HF patients have a HFpEF and around 50% of heart failure patients have a HFrEF.
  • HfpEF HFrEF is characterized by cardiac remodelling, in particular a decrease in left ventricular compliance, leading to increased pressure in the left ventricle.
  • Myocardial infarction (Ml) is commonly known as a heart attack. Ml occurs when blood flow stops to a part of the heart causing damage to the heart muscle. After an Ml typically postinfarction cardiac remodelling is observed.
  • the acute loss of myocardium caused by the Ml results in an abrupt increase in loading conditions that induces a unique pattern of remodelling involving the infarcted border zone and remote noninfarcted myocardium.
  • Myocyte necrosis and the resultant increase in load trigger a cascade of biochemical intracellular signaling processes that initiates and subsequently modulates reparative changes, which include dilatation, hypertrophy, and the formation of a discrete collagen scar.
  • ventricular remodelling may continue for weeks or months after the Ml until the distending forces are counterbalanced by the tensile strength of the collagen scar.
  • the postinfarction cardiac remodelling after Ml is referred to herein as "myocardial infarction related cardiac remodelling".
  • a genetic (or inherited) cardiac disease is caused by changes in genes that are passed from generation to generation.
  • Many different types of heart diseases can be inherited. Examples include conditions that affect the heart muscle, called inherited cardiomyopathies, such as hypertrophic cardiomyopathy, dilated cardiomyopathy, Morbus Fabry disease, amyloidoses and arrhythmogenic right ventricular cardiomyopathy. These examples also involve cardiac remodelling.
  • Specific examples of genetic cardiac diseases which are associated with cardiac remodelling include but are not limited to hereditary hypertrophic cardiomyopythies (such as familial hypertrophic cardiomyopathy) or Morbus Fabry disease.
  • Cardiac hypertrophy is defined as an increase in size of the heart without any increase in myocyte number. This results in a thickening of the heart walls.
  • Pathological cardiac hypertrophy occurs in response to haemodynamic overload due to different forms of stress, such as hypertension, valve disease, and myocardial infarction (Ml). Prolonged hypertrophic growth of the heart results in cardiac arrhythmias, heart failure and may lead to sudden death (Frey and Olso (2003), Annu Rev Physiol; 65: 45-79).
  • cardiac hypertrophy is in accordance with the invention unhealthy cardiac hypertrophy (or pathological hypertrophy), such as cardiac hypertrophy in response to stress or disease, e.g., hypertension, heart muscle injury (myocardial infarction), heart failure or neurohormones.
  • unhealthy cardiac hypertrophy or pathological hypertrophy
  • cardiac hypertrophy in response to stress or disease e.g., hypertension, heart muscle injury (myocardial infarction), heart failure or neurohormones.
  • Fibrosis in general, is a scarring process which is characterized by fibroblast proliferation and excess deposition of extracellular matrix (ECM) proteins, which leads to distorted organ architecture and function.
  • Cardiac fibrosis thus refers to the proliferation of fibroblasts and an excess deposition of ECM proteins (in particular collagen) in the cardiac muscle.
  • the proliferation of the fibroblasts generally leads to abnormal thickening of the heart, in particular the heart valves.
  • the fibrotic ECM causes increased stiffness and induces pathological signaling within cardiomyocytes resulting in progressive cardiac failure. Also, the excessive ECM impairs mechano-electric coupling of cardiomyocytes and increases the risk of arrhythmias.
  • Fibroblasts are principally responsible for deposition of the excessive fibrotic ECM and activated fibroblasts may directly cause hypertrophy of cardiomyocytes via paracrine mechanisms further contributing to impaired cardiac function (Krenning et al. (2010), J Cell Physiol; 225(3):631-637).
  • the cardiac hypertrophy is ventricular hypertrophy, preferably left ventricular hypertrophy, and/or the cardiac fibrosis is ventricular fibrosis, preferably left ventricular fibrosis.
  • cardiac hypertrophies As well as most cases of cardiac fibrosis affect the heart ventricles. Although left ventricular hypertrophy and fibrosis is more common, cardiac hypertrophy and fibrosis can also occur in the right ventricle or both ventricles.
  • the ventricles are the chambers in the heart responsible for pumping blood either to the lungs (right ventricle) or to the rest of the body (left ventricle).
  • Meg3 comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs 1 to 21.
  • nucleic acid sequence or “nucleotide sequence”, in accordance with the present invention, includes DNA and RNA.
  • SEQ ID NOs 1 to 21 are sequences of the IncRNA Meg3 and therefore single-stranded RNA sequences.
  • nucleotide-based compounds inhibiting the expression of Meg3 may comprise DNA sequences (e.g. LNA GapmeRs) or RNA sequences (e.g. siRNAs).
  • nucleotide-based compounds inhibiting the expression of Meg3 may be single stranded (e.g. LNA GapmeRs) or double-stranded (e.g. siRNAs).
  • nucleic acid sequence is interchangeably used in accordance with the invention with the term "polynucleotide sequence".
  • Short “nucleic acid sequence” are also referred to herein as "oligonucleotide sequences". Oligonucleotide sequences are less than 50 nucleotides in length, preferably less than 40 nucleotides and most preferably less than 30 nucleotides.
  • isoforms of MEG3 are generated by alternative splicing (Zhang et al. (2010), Endocrinology; 151(3):939-947). Also in mouse multiple isoforms of Meg3 were found (Schuster-Gossler et al.
  • SEQ ID NOs 1 to 7 represent the so far known seven different isoforms of mouse Meg3 (designated herein mouse Meg3 isoforms 1 to 7). All seven mouse isoforms share the core sequence of SEQ ID NO: 8 which core sequence corresponds to exon 5 of the mouse Meg3 gene.
  • SEQ ID NOs 9 to 20 represent the known twelve different isoforms of human Meg3 (designated herein human Meg3 isoforms 1 to 12). All twelve human isoforms share the core sequence of SEQ ID NO: 21 which core sequence corresponds to exon 5 of the human Meg3 gene.
  • Meg3 comprises the nucleic acid sequence of SEQ ID NO: 8 or SEQ ID NO: 21 , and more preferably comprises the human Meg3 core sequence of SEQ ID NO: 21.
  • SEQ ID NOs 1 to 7 and 9 to 20 comprise sequences of more than 200 nucleotides; i.e. sequences ranging from 706 to 14548 nucleotides. SEQ ID NOs 1 to 7 and 9 to 20 are therefore IncRNAs.
  • the compound inhibiting the expression and/or the activity of Meg3 is a small molecule inhibitor, a nucleotide-based inhibitor or an amino acid-based inhibitor.
  • a small molecule inhibitor is a low molecular weight organic compound which is by definition not a polymer.
  • the small molecule of the invention is a molecule that binds with high affinity to Meg3 and in addition inhibits the activity of Meg3.
  • the upper molecular weight limit for a small molecule is preferably 1500Da, more preferably 1000Da and most preferably 800Da which allows for the possibility to rapidly diffuse across cell membranes so that they can reach intracellular sites of action.
  • Libraries of small organic molecules and high-throughput techniques for screening such libraries with a specific target molecule in the present case the IncRNA Meg3, and preferably a polynucleotide selected from the group consisting of SEQ ID NOs 1 to 21.
  • SEQ ID NOs 8 and 21 are preferred and SEQ ID NO: 21 is most preferred.
  • SEQ ID NO: 8 By targeting the mouse Meg3 core sequence of SEQ ID NO: 8 it is possible to inhibit all known mouse Meg3 isoforms and by targeting the human Meg3 core sequence of SEQ ID NO: 21 it is possible to inhibit all known human Meg3 isoforms.
  • Given the sequence homology of 89% of SEQ ID NOs 8 and 21 it may also be possible to target mouse and human Meg3 isoforms by a single small molecule inhibitor.
  • a nucleotide-based inhibitor comprises or consists of a nucleic acid sequence.
  • the nucleic acid is preferably complementary to a nucleic acid sequence of at least 12 contiguous nucleotides of one or more of SEQ ID NOs 1 to 21. Within SEQ ID NOs 1 to 21 , SEQ ID NOs 8 and 21 are preferred and SEQ ID NO: 21 is most preferred.
  • the nucleotide-based inhibitor may comprise or consist of RNA, DNA or both.
  • the nucleotide-based inhibitor of the invention is a molecule that binds specifically to Meg3 and in addition inhibits the activity of Meg3.
  • specific binding means that the inhibitor specifically targets the IncRNA Meg3 and does substantially not exert any off target inhibitory effects, in particular on other cellular nucleic acid molecules. It is to be understood that a nucleotide-based inhibitor specifically binding to SEQ ID NO: 8 is capable of inhibiting all known mouse Meg3 isoforms and a nucleotide-based inhibitor specifically binding to SEQ ID NO: 21 is capable of specifically inhibiting all known human Meg3 isoforms. Given the sequence homology of 89% of SEQ ID NOs 8 and 21 it may also be possible to select or design a nucleotide-based inhibitor specifically inhibiting the mouse and human Meg3 isoforms.
  • An amino acid-based inhibitor comprises or consists of an amino acid sequence and preferably an amino acid sequence of at least 25, more preferably at least 50 amino acids.
  • the amino acid-based inhibitor of the invention is a molecule that binds specifically to Meg3 and in addition inhibits the activity of Meg3.
  • the amino acid-based inhibitor preferably comprises natural amino acids but may also comprise unnatural amino acids.
  • the amino acid-based inhibitor is preferably selected or designed such that it specifically binds to a nucleic acid sequence selected from one or more of SEQ ID NOs 1 to 21. Within SEQ ID NOs 1 to 21 , SEQ ID NOs 8 and 21 are preferred and SEQ ID NO: 21 is most preferred.
  • An amino acid-based inhibitor specifically binding to SEQ ID NO: 8 is capable of specifically inhibiting all known mouse Meg3 isoforms and an amino acid-based inhibitor specifically binding to SEQ ID NO: 21 is capable of specifically inhibiting all known human Meg3 isoforms. Given the sequence homology of 89% of SEQ ID NOs 8 and 21 it may also be possible to select or design an amino acid-based inhibitor specifically inhibiting the mouse and human Meg3 isoforms.
  • the nucleotide-based inhibitor is an aptamer, a ribozyme, a siRNA, a shRNA or an antisense oligonucleotide (such as a LNA-GapmeR, an Antagomir, or an antimiR) and the amino acid-based inhibitor is an antibody or a protein drug.
  • aptamer in accordance with the present invention refers to DNA or RNA molecules being either in the natural D-conformation or in the L-conformation ("aptamer") that have been selected from random pools based on their ability to bind other molecules. Aptamers have been selected which bind nucleic acid, proteins, small organic compounds, and even entire organisms.
  • a database of aptamers is maintained at http://aptamer.icmb.utexas.edu/.
  • aptamers can be classified as DNA or RNA aptamers or peptide aptamers. Whereas the former consist of (usually short) strands of oligonucleotides, the latter consist of a short variable peptide domain, attached at both ends to a protein scaffold.
  • Nucleic acid aptamers are nucleic acid species that have been engineered through repeated rounds of in vitro selection or equivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms.
  • the molecular target envisaged by the present invention is a nucleic acid, namely the IncRNA Meg3.
  • aptamers can be produced against the target molecule of the invention.
  • Aptamers offer the utility for biotechnological and therapeutic applications as they offer molecular recognition properties that rival those of the commonly used biomolecules, in particular antibodies.
  • aptamers offer advantages over antibodies as they can be engineered completely in a test tube, are readily produced by chemical synthesis, possess desirable storage properties, and elicit little or no immunogenicity in therapeutic applications.
  • Non-modified aptamers are cleared rapidly from the bloodstream, with a half-life of minutes to hours, mainly due to nuclease degradation and clearance from the body by the kidneys, a result of the aptamer's inherently low molecular weight.
  • aptamers can be an advantage in applications such as in vivo diagnostic imaging.
  • modifications such as 2'-fluorine-substituted pyrimidines, polyethylene glycol (PEG) linkage, etc. are available to scientists with which the half-life of aptamers easily can be increased to the day or even week time scale.
  • ribozymes refers to RNA molecules that act as enzymes in the absence of proteins. These RNA molecules act catalytic or autocatalytic and are capable of cleaving e.g. other RNAs at specific target sites but they have also been found to catalyze the aminotransferase activity of the ribosome.
  • hammerhead structures can be integrated into heterologous RNA sequences and that ribozyme activity can thereby be transferred to these molecules, it appears that catalytic sequences for almost any target sequence can be created, provided the target sequence contains a potential matching cleavage site.
  • the basic principle of constructing hammerhead ribozymes is as follows: An interesting region of the RNA, which contains the GUC (or CUC) triplet, is selected. Two oligonucleotide strands, each with 6 to 8 nucleotides, are taken and the catalytic hammerhead sequence is inserted between them. Molecules of this type were synthesized for numerous target sequences. They showed catalytic activity in vitro and in some cases also in vivo.
  • Meg3 is a bona fide target for the generation of ribozymes being capable to specifically cleave Meg3.
  • the aptamers and ribozymes may comprise modified nucleotides, such as locked nucleic acids (LNAs).
  • LNAs locked nucleic acids
  • the term "antibody” as used in accordance with the present invention comprises, for example, polyclonal or monoclonal antibodies. Furthermore, also derivatives or fragments thereof, which still retain the binding specificity, are comprised in the term "antibody”.
  • Antibody fragments or derivatives comprise, inter alia, Fab or Fab' fragments, Fd, F(ab') 2 , Fv or scFv fragments, single domain V H or V-like domains, such as VhH or V-NAR-domains, as well as multimeric formats such as minibodies, diabodies, tribodies, tetrabodies or chemically conjugated Fab'-multimers (see, for example, Altshuler et al., Biochemistry (Mosc). 2010 Dec; 75(13): 1584-605, Holliger and Hudson, Nat Biotechnol., 2005; 23(9): 1126-36).
  • antibody also includes embodiments such as chimeric (human constant domain, non- human variable domain), single chain and humanized (human antibody with the exception of non-human CDRs) antibodies.
  • chimeric human constant domain, non- human variable domain
  • single chain humanized (human antibody with the exception of non-human CDRs) antibodies.
  • Various techniques for the production of antibodies and fragments thereof are well known in the art and described, e.g. in Altshuler et al., Biochemistry (Mosc). 2010 Dec; 75(13): 1584-605.
  • polyclonal antibodies can be obtained from the blood of an animal following immunisation with an antigen in mixture with additives and adjuvans and monoclonal antibodies can be produced by any technique which provides antibodies produced by continuous cell line cultures. Examples for such techniques are described, e.g.
  • recombinant antibodies may be obtained from monoclonal antibodies or can be prepared de novo using various display methods such as phage, ribosomal, mRNA, or cell display.
  • a suitable system for the expression of the recombinant (humanized) antibodies or fragments thereof may be selected from, for example, bacteria, yeast, insects, mammalian cell lines or transgenic animals or plants (see, e.g., US patent 6,080,560; Holliger and Hudson, Nat Biotechnol., 2005; 23(9): 1126-36).
  • techniques described for the production of single chain antibodies see, inter alia, US Patent 4,946,778) can be adapted to produce single chain antibodies specific for the target of this invention.
  • Surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies.
  • protein drug designates designer drugs that are derivatives of human proteins. These proteins are used as scaffold to create a protein drug by well-established screening procedures (see Tomlinson et al (2004), Nature Biotechnology, 22(5): 521-522).
  • Non-limiting examples of human proteins which serve as a scaffold for designing protein drugs are transferrin, C-type lectins, trinectins, domain antibodies, kunitz domains, lipocalins and the Fyn SH3 domain.
  • the antisense technology for the downregulation of RNA is well-established and widely used in the art to treat various diseases.
  • the basic idea of the antisense technology is the use of oligonucleotides for silencing a selected target RNA through the extraordinar specificity of complementary-based pairing (Re, Ochsner J. 2000 Oct; 2(4): 233-236).
  • oligonucleotides for silencing a selected target RNA through the extraordinarily of complementary-based pairing (Re, Ochsner J. 2000 Oct; 2(4): 233-236).
  • compound classes of siRNAs, shRNAs and antisense oligonucleotides will be provided.
  • antisense oligonucleotides are single stranded antisense constructs while siRNAs and shRNAs are double stranded antisense constructs with one strand comprising an antisense oligonucleotide sequence being (i.e. the so-called antisense strand). All these compound classes may be used to achieve downregulation or inhibition of a target RNA.
  • the target of antisense constructs in general as well as all the specific classes of antisense constructs being described herein is the IncRNA Meg3. Accordingly, the target is preferably a nucleic acid sequence selected from one or more of SEQ ID NOs 1 to 21.
  • SEQ ID NOs 8 and 21 are preferred and SEQ ID NO: 21 is most preferred.
  • SEQ ID NO: 8 it is possible to downregulate all known mouse Meg3 isoforms and by targeting SEQ ID NO: 21 it is possible to downregulate all known human eg3 isoforms.
  • Given the sequence homology of 89% of SEQ ID NOs 8 and 21 it may also be possible to target mouse and human Meg3 isoforms by a single antisense construct.
  • the antisense construct does not target the part of SEQ ID NO: 21 being shown in the 18 nucleotides of SEQ ID NO: 22 or a subsequence of SEQ ID NO: 22.
  • the part of the human Meg3 core sequence as show in SEQ ID NO: 22 is 100% identical to the DNM3 opposite strand/antisense RNA, the miRNA 3120 and the miRNA 214.
  • the target is SEQ ID NO: 22 or a subsequence thereof off target effects cannot be excluded.
  • a partial overlap of the complementary nucleic acid sequence of or comprised by an antisense construct with SEQ ID NO: 22 is generally acceptable as long as specific inhibition of Meg3 without off target effects is achieved. It is a matter of routine in the field of antisense technology to design an antisense construct with a sufficient number of nucleotide mismatches to any off target in order to ensure that no off targets become downregulated.
  • siRNA in accordance with the present invention refers to small interfering RNA, also known as short interfering RNA or silencing RNA.
  • siRNAs are a class of 12 to 30, preferably 18 to 30, more preferably 20 to 25, and most preferred 21 to 23 or 21 nucleotide- long double-stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene. In addition to their role in the RNAi pathway, siRNAs also act in RNAi-related pathways, e.g. as an antiviral mechanism or in shaping the chromatin structure of a genome.
  • RNAi RNA interference
  • siRNAs have a well defined structure: a short double-strand of RNA (dsRNA), advantageously with at least one RNA strand having an overhang. Each strand typically has a 5' phosphate group and a 3' hydroxyl (-OH) group.
  • dsRNA short double-strand of RNA
  • Each strand typically has a 5' phosphate group and a 3' hydroxyl (-OH) group.
  • This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs.
  • siRNAs can also be exogenously (artificially) introduced into cells to bring about the specific knockdown of a gene of interest. Thus, any gene of which the sequence is known can in principle be targeted based on sequence complementarity with an appropriately tailored siRNA.
  • the double-stranded RNA molecule or a metabolic processing product thereof is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation.
  • at least one RNA strand has a 5'- and/or 3'-overhang.
  • one or both ends of the double-strand have a 3'-overhang from 1-5 nucleotides, more preferably from 1-3 nucleotides and most preferably 2 nucleotides.
  • any RNA molecule suitable to act as siRNA is envisioned in the present invention.
  • siRNA duplexes composed of 21 -nt sense and 21 -nt antisense strands, paired in a manner to have 2-nt 3'- overhangs.
  • the sequence of the 2-nt 3' overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair (Elbashir et al. Nature. 2001 May 24; 411(6836):494-8).
  • 2'-deoxynucleotides in the 3' overhangs are as efficient as ribonucleotides, but are often cheaper to synthesize and probably more nuclease resistant.
  • the siRNA according to the invention comprises an antisense strand which comprises or consists of a sequence which is with increasing preference complementary to at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 21 nucleotides of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • These at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 21 nucleotides are preferably a contiguous part of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above, i.e.
  • the nucleotides are consecutive in the respective SEQ ID NO.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • siRNA is an Endoribonuclease-prepared siRNA (esiRNA).
  • esiRNA is a mixture of siRNA oligos resulting from cleavage of a long double-stranded RNA (dsRNA) with an endoribonuclease such as Escherichia coli RNase III or dicer.
  • dsRNA long double-stranded RNA
  • esiRNAs are an alternative concept to the usage of chemically synthesized siRNA for RNA Interference (RNAi).
  • RNAi RNA Interference
  • a cDNA of an IncRNA template may be amplified by PCR and tagged with two bacteriophage-promotor sequences.
  • RNA polymerase is then used to generate long double stranded RNA that is complentary to the target-gene cDNA.
  • This complentary RNA may be subsequently digested with RNase III from Escherichia coli to generate short overlapping fragments of siRNAs with a length between 18-25 base pairs.
  • This complex mixture of short double stranded RNAs is similar to the mixture generated by dicer cleavage in vivo and is therefore called endoribonuclease-prepared siRNA or short esiRNA.
  • esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. esiRNAs lead to highly specific and effective gene silencing.
  • a “shRNA” in accordance with the present invention is a short hairpin RNA, which is a sequence of RNA that makes a (tight) hairpin turn that can also be used to silence gene expression via RNA interference.
  • shRNA preferably utilizes the U6 promoter for its expression.
  • the shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the shRNA that is bound to it.
  • RISC RNA-induced silencing complex
  • the shRNA according to the invention comprises an antisense strand which comprises or consists of a sequence which is with increasing preference complementary to at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • These at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 21 nucleotides are preferably a contiguous part of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above, i.e.
  • the nucleotides are consecutive in the respective SEQ ID NO.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • antisense oligonucleotide in accordance with the present invention refers to a single-stranded nucleotide sequence being complementary by virtue of Watson-Crick base pair hybridization to the IncRNA Meg3 whereby the activity of Meg3 is blocked.
  • the antisense oligonucleotides may be unmodified or chemically modified. In general, they are relatively short (preferably between 13 and 25 nucleotides). Moreover, they are specific for Meg3, i.e. they hybridize to a unique sequence in the total pool of targets present in the target cells/organism.
  • the antisense oligonucleotide according to the invention comprises or consists a sequence which is with increasing preference complementary to at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, or at least 25 nucleotides of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • These at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, or at least 25 nucleotides are preferably a contiguous part of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above, i.e.
  • the nucleotides are consecutive in the respective SEQ ID NO.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • the antisense oligonucleotide is preferably a LNA-GapmeR, an Antagomir, or an antimiR.
  • GapmeRs LNA-GapmeRs or simply GapmeRs are potent antisense oligonucleotides used for highly efficient inhibition of mRNA and IncRNA function. GapmeRs function by RNase H dependent degradation of complementary RNA targets. They are an excellent alternative to siRNA for knockdown of mRNA and IncRNA. They are advantageously taken up by cell without transfection reagents. GapmeRs contain a central stretch of DNA monomers flanked by blocks of LNAs. The GapmeRs are preferably 14-16 nucleotides in length and are optionally fully phosphorothioated. The DNA gap activates the RNAse H-mediated degradation of targeted RNAs and is also suitable to target transcripts directly in the nucleus.
  • the LNA- GapmeR comprises a sequence which is with increasing preference complementary to at least 13 nucleotides, at least 14 nucleotides, or at least 15 nucleotides of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above.
  • SEQ ID NOs 9 to 21 it is furthermore preferred that the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • At least 13 nucleotides, at least 14 nucleotides, or at least 15 nucleotides are preferably a contiguous part of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above, i.e. the nucleotides are consecutive in the respective SEQ ID NO.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • a LNA-GapmeR targeting the mouse Meg3 nucleotides of SEQ ID NO: 23 is used in the below examples of the present application to downregulate the IncRNA Meg3.
  • SEQ ID NO: 24 shows the human Meg3 nucleotides corresponding to the mouse Meg3 nucleotides of SEQ ID NO: 23.
  • the LNA-GapmeR according to the invention comprises more preferably a sequence which is complementary to SEQ ID NO: 23 or SEQ ID NO: 24, and most preferably to SEQ ID NO: 24.
  • the three anti-human Meg3 LNA-GapmeRs of SEQ ID NOs 71 , 72 and 73 are used to downregulate the IncRNA Meg3 in human cardiac fibroblasts.
  • the LNA-GapmeR according to the invention also comprises most preferably a sequence of any one of SEQ ID NOs 71 to 73.
  • SEQ ID NOs 71 to 73 SEQ ID NO: 71 is most preferred.
  • the LNA-GapmeR technology is well established.
  • LNA-GapmeRs are routinely designed using established algorithms.
  • LNA-GapmeRs to a selected target are commercially available including positive and negative controls, for example, from Exiqon.
  • AntimiRs are oligonucleotide inhibitors that were initially designed to be complementary to a miRNA. AntimiRs against miRNAs have been used extensively as tools to gain understanding of specific miRNA functions and as potential therapeutics. As used herein, the AntimiRs are designed to be complementary to the IncRNA Meg3. AntimiRs are preferably 14 to 23 nucleotides in length.
  • An AntimiR according to the invention more preferably comprises or consists a sequence which is with increasing preference complementary to at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 8 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, or at least 23 nucleotides of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above. For instance, with respect to SEQ ID NOs 9 to 21 it is furthermore preferred that the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • At least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, or at least 23 nucleotides are preferably a contiguous part of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above, i.e. the nucleotides are consecutive in the respective SEQ ID NO.
  • AntimiRs are preferably AntagomiRs.
  • AntagomiRs are synthetic 2-O-methyl RNA oligonucleotides, preferably of 21 to 23 nucleotides which are preferably fully complementary to the selected target RNA. While AntagomiRs were initially designed against miRNAs they may also be designed against IncRNAs.
  • the AntagomiRs according to the invention therefore preferably comprises a sequence being complementary to 21 to 23 nucleotides of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • These 21 to 23 nucleotides are preferably complementary to a contiguous part of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above, i.e. the nucleotides are consecutive in the respective SEQ ID NO.
  • AntagomiRs are preferably synthesized with 2'-OMe modified bases (2'-hydroxyl of the ribose is replaced with a methoxy group), phosphorothioate (phosphodiester linkages are changed to phosphorothioates) on the first two and last four bases, and an addition of cholesterol motif at 3' end through a hydroxyprolinol modified linkage.
  • 2'-OMe and phosphorothioate modifications improve the bio-stability whereas cholesterol conjugation enhances distribution and cell permeation of the AntagomiRs.
  • Antisense molecules are preferably chemically synthesized using a conventional nucleic acid synthesizer.
  • Suppliers of nucleic acid sequence synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK).
  • antisense molecules including antisense oligonucleotides, such as LNA- GapmeR, an Antagomir, an antimiR
  • siRNA and shRNA to potently, but reversibly, silence or inhibit a IncRNA in vivo makes these molecules particularly well suited for use in the pharmaceutical composition of the invention.
  • Ways of administering siRNA to humans are described in De Fougerolies et al., Current Opinion in Pharmacology, 2008, 8:280-285. Such ways are also suitable for administering other small RNA molecules like antisense oligonucleotides or shRNAs.
  • compositions may be administered directly formulated as a saline, via liposome based and polymer-based nanoparticle approaches, as conjugated or complexation pharmaceutical compositions, or via viral delivery systems.
  • Direct administration comprises injection into tissue, intranasal and intratracheal administration.
  • Liposome based and polymer-based nanoparticle approaches comprise the cationic lipid Genzyme Lipid (GL) 67, cationic liposomes, chitosan nanoparticles and cationic cell penetrating peptides (CPPs).
  • Conjugated or complexation pharmaceutical compositions comprise PEI-complexed antisense molecules (including antisense oligonucleotides), siRNA, or shRNA.
  • viral delivery systems comprise influenza virus envelopes and virosomes.
  • the antisense molecules may comprise modified nucleotides such as locked nucleic acids (LNAs).
  • LNAs locked nucleic acids
  • the ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the Z'-endo (North) conformation, which is often found in the A-form duplexes.
  • LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever desired. Such oligomers are synthesized chemically and are commercially available.
  • the locked ribose conformation enhances base stacking and backbone pre-organization. This significantly increases the hybridization properties (melting temperature) of oligonucleotides.
  • the nucleotide-based inhibitor comprises (a) a nucleic acid sequence which comprises or consists of a nucleic acid sequence being complementary to at least 12 continuous nucleotides of a nucleic acid sequence selected from SEQ ID NOs 1 to 21 , (b) a nucleic acid sequence which comprises or consists of a nucleic acid sequence which is at least 70% identical to the complementary strand of one or more nucleic acid sequences selected from SEQ ID NOs 1 to 21 , (c) a nucleic acid sequence which comprises or consists of a nucleic acid sequence according to (a) or (b), wherein the nucleic acid sequence is DNA or RNA, (d) an expression vector expressing the nucleic acid sequence as defined in any one of (a) to (c), preferably under the control of a heart-specific promoter and/or a fibroblast-specific promoter, or (e) a host comprising the expression vector of (d).
  • nucleic acid sequences as defined in items (a) to (c) of this preferred embodiment comprise or consist of sequences being complementary to nucleotides of the Meg3 as defined by one or more of SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above.
  • SEQ ID NOs 9 to 21 it is furthermore preferred that the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • nucleic acid sequences as defined in items (a) to (c) comprise or are antisense nucleic acid sequences.
  • the nucleic acid sequence according to item (a) of this further preferred embodiment of the invention comprises or consists of a sequence which is with increasing preference complementary to at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • These at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 21 nucleotides are preferably a contiguous part of one or more selected from SEQ ID NOs 1 to 21 including the preferred target sequences within SEQ ID NOs 1 to 21 described herein above, i.e.
  • the nucleotides are consecutive in the respective SEQ ID NO.
  • the antisense construct does not target the subsequence SEQ ID NO: 22 or a subsequence thereof.
  • the format of the nucleic acid sequence according to item (a) is not particularly limited as long as it comprises or consists of at least 12 continuous nucleotides being complementary to a nucleic acid sequence selected from SEQ ID NOs 1 to 21.
  • the nucleic acid sequence according to item (a) comprises or consists of antisense an oligonucleotide.
  • the nucleic acid sequence according to item (a) reflects the above- mentioned basic principle of the antisense technology which is the use of an oligonucleotide for silencing a selected target RNA through the extraordinar specificity of complementary-based pairing. Therefore, it is to be understood that the nucleic acid sequence according to item (a) is preferably in the format of an siRNA, shRNA or an antisense oligonucleotide as defined herein above.
  • the antisense oligonucleotides are preferably LNA-GapmeRs, AntagomiRs, or antimiRs as defined herein above.
  • nucleic acid sequence according to item (b) requiring at least 70% identity to the complementary strand of one or more nucleic acid sequences selected from SEQ ID NOs 1 to 21 is considerably longer than the nucleic acid sequence according to item (a) which comprises an antisense oligonucleotide and comprises at least 12 continuous nucleotides of a nucleic acid sequence selected from SEQ ID NOs 1 to 21.
  • SEQ ID NOs 1 to 21 SEQ ID NO: 21 is the shortest sequence and SEQ ID NO: 21 comprises 96 nucleotides.
  • a sequence of at least 70% identity to the complementary strand of SEQ ID NO: 21 accordingly has to comprise at least 68 nucleotides.
  • a nucleic acid sequence according to item (b) of the above preferred embodiment of the invention is capable of interacting with, more specifically hybridizing with the target IncRNA Meg3. By formation of the hybrid the function of the IncRNA Meg3 is reduced or blocked.
  • sequence identity of the molecule according to item (b) in connection with a sequence selected from SEQ ID NOs 1 to 21 is with increasing preference at least 75%, at least 80%, at least 85%, at least 90%, at least 92.5%, at least 95%, at least 98%, at least 99% and 100%.
  • SEQ ID NOs 1 to 21 SEQ ID NOs 8 and 21 are preferred and SEQ ID NO: 21 is most preferred.
  • the sequence identity in connection with each of SEQ ID NOs 1 to 21 can be individually selected. For instance, a non-limiting example is at least 90% in connection with SEQ ID NO: 8 and at least 95% in connection with SEQ ID NO: 21. Means and methods for determining sequence identity are known in the art.
  • the BLAST (Basic Local Alignment Search Tool) program is used for determining the sequence identity with regard to one or more of SEQ ID NOs 1 to 21.
  • nucleic acid sequences which comprise a nucleotide sequence which is at least 70% identical to the complementary strand of one or more of SEQ ID NOs 1 to 21 are the complementary strands of SEQ ID NO: 8 and/or 21.
  • the nucleotide sequences may be RNA or DNA.
  • RNA or DNA encompasses chemically modified RNA nucleotides or DNA nucleotides.
  • RNA comprises the nucleotide U while DNA comprises the nucleotide T.
  • the inhibitor may also be an expression vector or host, respectively being capable of producing an nucleic acid sequence as defined in any one of items (a) to (c).
  • An expression vector may be a plasmid that is used to introduce a specific transcript into a target cell. Once the expression vector is inside the cell, the protein that is encoded by the gene is produced by the cellular-transcription and translation machinery ribosomal complexes.
  • the plasmid is in general engineered to contain regulatory sequences that act as enhancer and/or promoter regions and lead to efficient transcription of the transcript.
  • the expression vector preferably contains a heart- specific promoter and/or a fibroblast-specific promoter. Heart-specific promoters are known in the art, for example, from Boecker at al. (2004), Mol Imagin.; 3(2):69-75.
  • Using a heart-specific promoter ensures that the nucleic acid sequence is only expressed in the heart and may avoid potential unwanted side effects by expression in other organs.
  • Promoters for fibroblast-specific expression are as well known in the art, e.g., from Takeda et al (2010), J Ciin Invest. 2010; 120(1 ):254-265 or Hemmings et al. (2014), Heart; 100:A19-A20.
  • Using a fibroblast-specific promoter ensures that the nucleic acid sequence is only expressed in fibroblasts and may avoid potential unwanted side effects by expression in other cell-types, such as endothelial cells.
  • promoters being heart- specific and a fibroblast-specific are known and are most preferably used as a promoter in the context of the present invention. This is because such a promoter may avoid potential unwanted side effects by expression in other organs as well as in other cell-types.
  • Non-limiting examples of expression vectors include prokaryotic plasmid vectors, such as the pUC-series, pBluescript (Stratagene), the pET-series of expression vectors (Novagen) or pCRTOPO (Invitrogen) and vectors compatible with an expression in mammalian cells like pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMCI neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1 , pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, plZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems) pTriEx-H
  • Examples for plasmid vectors suitable for Pichia pastoris comprise e.g. the plasmids pA0815, pPIC9K and pPIC3.5K (all Intvitrogen).
  • a suitable vector is selected in accordance with good manufacturing practice.
  • Such vectors are known in the art, for example, from Ausubel et al, Hum Gene Ther. 201 1 Apr; 22(4):489-97 or Allay et al., Hum Gene Ther. May 2011 ; 22(5): 595-604.
  • a typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Moreover, elements such as origin of replication, drug resistance gene, regulators (as part of an inducible promoter) may also be included.
  • the lac promoter is a typical inducible promoter, useful for prokaryotic cells, which can be induced using the lactose analogue isopropylthiol-b-D-galactoside ("IPTG").
  • IPTG lactose analogue isopropylthiol-b-D-galactoside
  • the polynucleotide of interest may be ligated between e.g.
  • PelB leader signal which directs the recombinant protein in the periplasm and the gene III in a phagemid called pHEN4 (described in Ghahroudi et al, 1997, FEBS Letters 414:521-526).
  • Additional elements might include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing.
  • Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from retroviruses, e.g., RSV, HTLVI, HIVI, and the early promoter of the cytomegalovirus (CMV).
  • LTRs long terminal repeats
  • CMV cytomegalovirus
  • cellular elements can also be used (e.g., the human actin promoter).
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109).
  • the recombinant (poly)peptide can be expressed in stable cell lines that contain the gene construct integrated into a chromosome.
  • the co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
  • the transfected nucleic acid can also be amplified to express large amounts of the encoded (poly)peptide.
  • the DHFR (dihydrofolate reductase) marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest.
  • Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al.1991 , Biochem J. 227:277-279; Bebbington et al. 1992, Bio/Technology 70:169-175). Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance are selected.
  • the expression vectors will preferably include at least one selectable marker.
  • vectors can contain one or more origins of replication (ori) and inheritance systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, and one or more expression cassettes.
  • origins of replication include, for example, the Col E1 , the SV40 viral and the M 13 origins of replication.
  • the sequences to be inserted into the vector can e.g. be synthesized by standard methods, or isolated from natural sources. Ligation of the coding sequences to transcriptional regulatory elements and/or to other amino acid encoding sequences can be carried out using established methods.
  • Transcriptional regulatory elements parts of an expression cassette
  • These elements comprise regulatory sequences ensuring the initiation of the transcription (e.g., translation initiation codon, promoters, enhancers, and/or insulators), internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci.
  • nucleotide sequence as defined in item (a) of the above preferred embodiment of the invention is operatively linked to such expression control sequences allowing expression in prokaryotic or eukaryotic cells.
  • the host may be a prokaryotic or eukaryotic cell.
  • a suitable eukaryotic host may be a mammalian celi, an amphibian cell, a fish cell, an insect cell, a fungal cell or a plant cell.
  • Representative examples of bacterial cells are E. coli, Streptomyces and Salmonella typhimurium cells; of fungal cells are yeast cells; and of insect cells are Drosophila S2 and Spodoptera Sf9 cells. It is preferred that the cell is a mammalian cell such as a human cell.
  • Mammalian host cells that could be used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1 , Cos 7 and CV1 , quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
  • the cell may be a part of a cell line, preferably a human cell line. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • the host is preferably a host cell and more preferably an isolated host cell.
  • the host is also preferably a non-human host.
  • the present invention relates to a method for diagnosing cardiac remodelling in a patient, comprising (a) detecting the expression level of Meg3 in a sample obtained from said patient, and optionally (b) comparing said expression obtained in (a) with the expression level of Meg3 in a sample obtained from at least one healthy subject or with a predetermined standard that has been obtained from a sample of at least one healthy subject, wherein a greater than 2-fold downregulation of Meg3 is indicative for cardiac remodelling in the patient.
  • the cardiac remodelling is preferably Heart Failure with preserved Ejection Fraction (HFpEF) and/or is preferably Heart Failure with reduced Ejection Fraction (HFrEF), myocardial infarction related cardiac remodelling, genetic cardiac disease associated cardiac remodelling, cardiac hypertrophy and/or cardiac fibrosis.
  • the cardiac hypertrophy is preferably ventricular hypertrophy, more preferably left ventricular hypertrophy, and/or the cardiac fibrosis is preferably ventricular fibrosis, more preferably left ventricular fibrosis.
  • Meg3 preferably comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs 1 to 21.
  • SEQ ID NOs 1 to 21 SEQ ID NO: 8 and SEQ ID NO: 21 are preferred and SEQ ID NO: 21 is most preferred.
  • SEQ ID NO: 8 all mouse Meg3 isoforms may be detected simultaneously and by detecting SEQ ID NO: 21 all human Meg3 isoforms may be detected simultaneously.
  • the method according to the second aspect of the invention may also encompass detecting and comparing the expression level of one or more IncRNAs being with increased preference at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%, and at least 99.5% identical to any one of SEQ ID NOs 1 to 2 .
  • the method according to the second aspect of the invention may furthermore encompass detecting and comparing the expression level of one or more IncRNAs differing with increasing preference by no more than 10, such as 5, 4, 3, 2 or 1 nucleotide(s) from any one of SEQ ID NOs 1 to 21.
  • the nucleotide differences may be the addition, deletion and/or substitution of nucleotide(s).
  • the sequences the expression of which is compared, while being homologous, may also differ from each other with increasing preference by no more than 10, such as 5, 4, 3, 2 or 1 nucleotide(s).
  • sample designates a tissue sample or a body fluid sample.
  • the body fluid sample is preferably selected from blood, serum, plasma, urine, salvia, amniotic fluid, cerebrospinal fluid and lymph.
  • the tissue sample is preferably an organ sample, preferably a heart sample.
  • the "patient” or “subject” referred to herein is preferably human.
  • detecting the expression level of Meg3 means determining the amount or yield of Meg3.
  • Meg3 is initially expressed within a cell, in particular a heart fibroblast. It was found in accordance with the present invention that the IncRNA Meg3 can be detected in the sample of a patient, in particular a heart tissue sample. Meg3 being "expressed in a sample” is therefore Meg3 whose expression level can be detected in the sample by means and methods being further detailed herein below. Meg3 is downregulated in a test sample if the amount or yield of the Meg3 is significantly less as compared to the amount or yield of Meg3 in a control sample.
  • the control sample is either a sample obtained from at least one healthy subject or a predetermined standard that has been obtained from a sample of at least one healthy subject.
  • a healthy subject in particular a healthy subject with no heart condition can be routinely identified by a physician.
  • the at least one healthy subject is with increasing preference at least two, at least three, at least five, and at least ten healthy subjects.
  • individual Meg3 expression level differences may be balanced.
  • a predetermined standard it is noted that within the context of the diagnostic method of the invention is not or not always necessary to determine the Meg3 expression level in a sample of at least one healthy subject. Once Meg3 expression levels obtained from a sample of at least one healthy subject are available they may be used in the diagnostic method of the invention as a predetermined standard.
  • the expression level in the samples can be quantified by any suitable means and methods available from the art. In general relative and absolute quantification means and methods can be used. In absolute quantification no known standards or controls are needed. The expression level can be directly quantified. As well-known in the art, absolute quantification may rely on a predetermined standard curve. In relative quantification the expression level is quantified relative to a reference (such as known control expressions levels). Also in the absence of controls, one can relatively quantify the expression level when comparing e.g. fluorescence intensities. Methods to assess RNA concentration may, for example, comprise measuring the fluorescence intensity of dyes that bind to nucleic acids and selectively fluoresce when bound.
  • Such methods comprise a reverse transcription reaction and the production of cDNA, wherein the amount of the cDNA is determined thereby indirectly determining the amount of the RNA.
  • the fluorescent-based method is particularly useful for cases where the RNA concentration is too low to accurately assess some with spectrophotometry and/or in cases where contaminants absorbing at 260nm make accurate quantification by spectrophotometry difficult or impossible.
  • the expression levels are preferably normalized to a spiked-in RNA (see, for example, McCormick et al. (2011 ), Silence, 2:2).
  • a spiked-in RNA see, for example, McCormick et al. (2011 ), Silence, 2:2).
  • Known amounts of a spiked-in RNA are mixed with the sample during preparation. More preferably the RNA is externally spiked-in to the sample before the RNA isolation process is carried out.
  • the spiked-in RNA technology is well-known and commercial kits are available from a number of manufacturers.
  • the spiked-in RNA is preferably a spiked- in C. elegans RNA.
  • the primer pair of SEQ ID NOs 25 and 26 was employed in order to detect the expression level of mouse Meg3 and the primer pair of SEQ ID NOs 59 and 60 was employed in order to detect the expression level of human Meg3, wherein the uneven number is the forward primer and the even number is the reverse primer.
  • One of these primer pairs is preferably used in the diagnostic method according to the second aspect of the invention.
  • One of these primer pairs is likewise preferably incorporated into the kit of the invention being described herein below.
  • the greater than 2-fold downregulation is with increasing preference greater than 3-fold downregulation, greater than 4-fold downregulation, greater than 5-fold downregulation, greater than 6-fold downregulation, greater than 7-fold downregulation and greater than 8- fold downregulation.
  • the higher thresholds for the downregulation may increase the reliability of the method of the second aspect of the invention.
  • Meg3 expression in the course of TAC is downregulated 6 weeks after the pressure overload and thereafter. From the 6 th week onward also cardiac remodelling occurs as an adaptive response of the heart to the induced pressure overload. For this reason it can be expected that an at least 2-fold downregulation of Meg3 expression in a test patient as compared to Meg3 expression of at least one healthy subject or a predetermined standard that has been obtained from a sample of at least one healthy subject is indicative for cardiac remodelling. Measuring Meg3 expression levels is thus expected to be useful for diagnosing cardiac remodelling.
  • the sample is a heart tissue sample.
  • the heart tissue sample comprises or consists of cardiac fibroblasts.
  • the heart tissue sample comprises or is the chromatin fraction of heart tissue.
  • the detection of the expression level of Meg3 comprises (a) quantitative PCR, preferably quantitative real time PCR, or (b) a template/RNA amplification method followed by determining the expression level of Meg3 using a fluorescence- or luminescence-based quantification method.
  • quantitative PCR qPCR
  • the amount of amplified product is linked to fluorescence intensity using a fluorescent reporter molecule.
  • the point at which the fluorescent signal is measured in order to calculate the initial template quantity can either be at the end of the reaction (endpoint semi-quantitative PCR) or while the amplification is still progressing (real- time qPCR).
  • fluorescence data are collected after the amplification reaction has been completed, usually after 30-40 cycles, and this final fluorescence is used to back-calculate the amount of template present prior to PCR.
  • the more sensitive and reproducible method of real-time qPCR measures the fluorescence at each cycle as the amplification progresses. This allows quantification of the template to be based on the fluorescence signal during the exponential phase of amplification, before limiting reagents, accumulation of inhibitors, or inactivation of the polymerase have started to have an effect on the efficiency of amplification. Fluorescence readings at these earlier cycles of the reaction will measure the amplified template quantity where the reaction is much more reproducible from sample to sample than at the endpoint.
  • a non-limiting example of a template/RNA amplification method followed by determining the expression level of the IncRNA Meg3 using a fluorescence- or luminescence-based quantification method is a method combining transcription mediated amplification (TMA) and a hybridization protection assay (HPA).
  • TMA transcription mediated amplification
  • HPA hybridization protection assay
  • such a method may comprise hybridizing one or more oligonucleotides (“capture oligonucleotides”) that are complementary to Meg3.
  • the hybridized target sequences are then captured onto magnetic microparticles that are separated from the sample in a magnetic field. Wash steps may be utilized to remove extraneous components.
  • Target amplification typically occurs via TMA, which is a transcription-based nucleic acid amplification method that utilizes two enzymes, Moloney murine leukemia virus (MMLV) reverse transcriptase and T7 RNA polymerase.
  • MMLV Moloney murine leukemia virus
  • a unique set of primers is used for Meg3, preferably the primer pair of SEQ ID NOs 25 and 26 or a primer pair of SEQ ID NOs 59 and 60.
  • the reverse transcriptase is used to generate a DNA copy (containing a promoter sequence for T7 RNA polymerase) of the target sequence.
  • T7 RNA polymerase produces multiple copies of RNA amplicon from the DNA copy.
  • Detection of Meg3 expression level is achieved by HPA using single-stranded, chemiluminescent-labelled nucleic acid probes that are complementary to the one or more amplicon.
  • distinguishably labelled probes are used for each target amplicon.
  • the labelled nucleic acid probes hybridize specifically to the amplicon.
  • a "selection reagent” then differentiates between hybridized and unhybridized probes by inactivating the label on unhybridized probes.
  • the chemiluminescent signal produced by the hybridized probe is measured in a luminometer and is reported as "Relative Light Units" (RLU), thereby quantifying the Meg3 expression level.
  • the method comprises prior to the detection of the expression level of Meg3 a pre-amplification step of the RNA within the test patient's sample and/or the healthy patient's sample.
  • Performing a pre-amplification step is of particular advantage in case only a low amount of (test and/or control) sample is available.
  • the pre-amplification step allows increasing the amount of RNA within the sample before proceeding to the analysis of the expression level.
  • Means and methods for the pre-amplification of RNA are well known in the art (see, e.g., Vermeulen et al (2009) BMC Res Notes., 2:235).
  • the same method for the pre-amplification step is used such that the relative amount of RNA of the test sample as compared to the control sample is maintained.
  • the expression level data may have to be normalized for the pre-amplification step; see, e.g. Mestdagh et al. (2009), Genome Biology 2009, 10:R64.
  • the present invention relates to a kit for diagnosing cardiac remodelling in a patient, said kit comprising means for the detection of the expression level of Meg3, and instructions how to use the kit.
  • the instructions how to use the kit preferably inform inter alia that a low-expression level of the IncRNAs Meg3 is indicative for cardiac remodelling.
  • the means for the detection of the expression level of Meg3 are preferably the means required for (i) a quantitative PCR, preferably quantitative real time PCR, or (ii) a template/RNA amplification method followed by determining the expression level of Meg3 using a fluorescence- or luminescence-based quantification method.
  • a quantitative PCR preferably quantitative real time PCR
  • a template/RNA amplification method followed by determining the expression level of Meg3 using a fluorescence- or luminescence-based quantification method.
  • the means preferably comprise oligonucleotides, such as fluorescent hybridization probes or primers, which specifically hybridize to Meg3. Additional ingredients of the kits may be fluorescent or luminescent dyes, preferably coupled to said oligonucleotides.
  • kits may be enzymes, such as a reverse transcriptase and/or a polymerase.
  • Meg3 preferably comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs 1 to 21. Within SEQ ID NOs 1 to 21 SEQ ID NO: 8 and SEQ ID NO: 21 are preferred and SEQ ID NO: 21 is most preferred.
  • the kits may also encompass means for detecting IncRNAs being with increased preference at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%, and at least 99.5% identical to any one of SEQ ID NOs 1 to 21.
  • the kit may furthermore encompass means for detecting and comparing the expression level of one or more IncRNAs differing with increasing preference by no more than 10, such as 5, 4, 3, 2 or 1 nucleotide(s) from any one of SEQ ID NOs 1 to 21.
  • the nucleotide differences may be the addition, deletion and/or substitution of nucleotide(s).
  • the various components of the kit may be packaged in one or more containers such as one or more vials.
  • the vials may, in addition to the components, comprise preservatives or buffers for storage.
  • the means are primer pairs used for the specific detection of the expression level of Meg3.
  • the primer pairs of SEQ ID NOs 25 and 26, and SEQ ID NOs 59 and 60 are described herein above in connection with the method according to the second aspect of the present invention.
  • One of these primer pairs is preferably incorporated into the kit of the invention as means for the detection of the expression level of Meg3.
  • each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from.
  • FIG. 1 A) Subcellular localization of Meg3 was investigated after cell lysis and isolation of the cytoplasmic, nuclear and chromatin-associated RNA content, revealing that, in CFs, Meg3 is nuclear enriched and associated to the chromatin.
  • B) Antisense oligonucleotides (GapmeRs, Exiqon) were used to silence Meg3 expression in CFs. (p ⁇ 0.01 , *** pO.001 , n 8/9 replicates from 3 independent experiments).
  • B) Expression of TGF-beta isoforms and CTGF (n 7/8; * p ⁇ 0.05, *** p ⁇ 0.001 ; p-values represent statistically significant differences between TAC groups and the sham group).
  • C) Fibrosis levels in the left ventricles, as assessed via picro Sirius staining of heart sections (n 7/8; * p ⁇ 0.05, *** p ⁇ 0.001).
  • D) Cardiomyocyte cross sectional areas in myocardial tissues of mice undergoing 6 weeks of TAC with or without inhibition of Meg3 (n 7/8; ** p ⁇ 0.01 , ** * p ⁇ 0.001, ** * * p ⁇ 0.0001).
  • Figure 14 Effect of Meg3 inhibition on LV wall thickness and LV mass in mice undergoing 6 weeks of TAC.
  • (a) IVS and LVPW thickness in sham, and TAC mice with or without inhibition of Meg3, as measured via echocardiography (n 7/8).
  • (b) LV mass in sham, and TAC mice with or without inhibition of Meg3, as measured via echocardiography (n 7/8).
  • the Jaspar core vertebrata database was used and a 1000 bp region directly upstream of the Mmp-2 transcription start site was scanned with the TP53 matrix model (Homo Sapiens).
  • the MAGnify Kit (ThermoFisher) was used following the manufacturer's recommendations. 2 x 10 6 primary adult murine CFs were seeded in a 10 cm petri dish per experimental condition. Cross-linking of cells was performed directly on the dish without trypsinization. Sonication was performed on a Bioruptor UCD-200TM-EX for 16 cycles of 30 seconds ON, 30 seconds OFF at high power. 200.000 cells were used for each immunoprecipitation.
  • RNA from cardiac fibroblasts from sham or TAC groups obtained 13 weeks after surgery was subjected to global IncRNA profiling using the Arraystar Mouse LncRNA Microarray v 2.0 (Arraystarlnc). Isolation of cardiac cells for IncRNA detection
  • RNA from frozen tissues, frozen cell pellets or cultured cells was isolated using RNeasy Mini Kit (Qiagen) or TriFast method (Peqlab) according to the manufacturer's instructions. qRT-PCR analysis for microarray validation and quantitative detection of IncRNAs, mRNAs and genomic regions
  • cDNAs were synthesized with the iScript Select cDNA synthesis kit (Bio-Rad), and real-time RT-qPCR analysis was performed using primers listed below and the iQ SYBR Green Mix (Bio-Rad) according to the manufacturer's protocol. Gene-specific expression levels were normalized to levels of hypoxanthine-guanine phosphoribosyltransferase (Hprt) or b-actin (ActB).
  • Hprt hypoxanthine-guanine phosphoribosyltransferase
  • ActB b-actin
  • Hsa_Mmp-2 5TGACATCAAGGGCATTTCAGGAGC3' 5'GTCCGCCAAATGAACCGGTCCTTG3' HsaJHprt 5'AGGACTGAACGTCTTGCTCG3' 5'GTCCCCTGTTGACTGGTCATT3'
  • the primer sequences in the above Table correspond to SEQ ID NOs 25 to 50 and SEQ ID NOs 53 to 70, wherein each pair of two consecutive SEQ ID NOs (e.g. SEQ ID NOs 25 and 26) corresponds to one of the above shown primer pairs.
  • Human cardiac fibroblasts were purchased from Promocell and cultured in Fibroblast Growth Medium 3 (Promocell) with 0.1 ml/ml FBS, 1 ng/ml Basic Fibroblast Growth Factor (Promocell) and 5 pg/ml insulin (Promocell).
  • Mouse Meg3 5'- AAAG CAG CG AGTGTA-3' (SEQ ID NO: 51 );
  • MMP2 activity in the supernatant of mouse cardiac fibroblast or in murine myocardial tissues was analyzed through gel zymography. Serum-free cell culture supernatant concentrated with Amicon Ultra-0.5 Centrifugal Filter Unit with Ultracel-30 membrane (Millipore) or myocardial tissue extracts were analyzed on a 10% SDS-gel containing 1 mg/ml gelatin, as described previously 4 . Injection of gapmers
  • GapmeR-Meg3 (5'AAAGCAGCGAGTGTA3') (SEQ ID NO: 51) or GapmeR negative control B (5OCTCCCTTCAATCCAA3') (SEQ ID NO: 52) at a dose of 20 mg/kg (both from Exiqon) in saline (0.9% NaCI) as carriage medium, were delivered every 10 days by intraperitoneal injection, starting one week after TAC surgery. 6 weeks after surgery, cardiac function and morphometric changes were assessed by echocardiography (Vevo 2100, VisualSoncis) and Millar catheterization (1 F, PVR-1000, Millar Instruments), and the hearts were removed for biochemical analysis.
  • the Caspase-Glo 3/7 assay (Promega) was used following the manufacturer's recommendations. Briefly, 48 hours following liposomal transfection, 100 ⁇ Caspase-Glo 3/7 reagent were added to each well of a 96-well-plate and mixed with the culture medium by pipetting several times. The plate was then kept at room temperature in the dark for 1 hour. Afterwards, the developed luminescence was quantified in a plate- reading luminometer (Synergy HT Reader, BioTek) as the mean luminescence of 11 reads taken at 1 minute time intervals. Fluorescence microscopy and histology
  • paraffin sections of the left ventricle were stained with Sirius red and picric acid to visualize collagen deposition.
  • the collagen content was calculated as the percentage of the area in each heart section.
  • Cryosections of the left ventricular myocardium were visualized by wheat germ agglutinin stain coupled to Alexa Fluor 488 (Invitrogen).
  • the cell surface area of cardiomyocytes was calculated using the NIS-Elements BR 3.2 package (Nikon Instruments Inc.).
  • Immunofluorescence was performed against CD45 and CD31 for quantification of, respectively, inflammatory cell infiltration and capillary density in the heart. Fluorescent cells were counted using the NIS-Elements BR 3.2 package (Nikon Instruments Inc.).
  • Meg3 is expressed as a chromatin associated IncRNA ( Figure 2A).
  • Figure 2B By using antisense LNA GapmeRs, we were able to silence the expression of Meg3 in CFs by approximately 75% ( Figure2B).
  • MMP2 transcription is affected by Meg3 levels
  • MMP2 matrix metalloproteinase-2
  • Meg3 is upregulated after 4 weeks of TAC, slightly downregulated after 6 weeks, and more strongly downregulated after 13 weeks (Figure 5).
  • M P2 is upregulated in the first weeks of TAC, likely peaking between week 4 and 6, and decreased again after 13 weeks ( Figure 5).
  • silencing of Meg3 in the heart is expected to be a promising therapeutic approach to achieve inhibition of MMP2 and improvement of cardiac function in conditions of left ventricular pressure overload, especially in Heart Failure with Preserved Ejection Fraction (HFpEF).
  • HFpEF Heart Failure with Preserved Ejection Fraction
  • this patient subgroup is in dire need of new cardiac therapeutic medications with a focus on inhibition of cardiac fibrosis.
  • the anti-Meg3 approach is expected to be an ideal approach for this patient group.
  • Meg 3 affects binding of P53 on the promoter of Mmp-2 in cultured mouse CFs
  • Human CFs were transfected with 3 different GapmeR designs targeting human Meg3. Levels of Mmp-2, Col1a1 , alpha-SMA and Ctgf were measured via real-time PCR 48 hours following transfection. All genes were expressed at lower levels following Meg3 knockdown in human CFs (figure 18).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Cardiology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Hospice & Palliative Care (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/EP2017/059984 2016-05-02 2017-04-26 The incrna meg3 for therapy and diagnosis of cardiac remodelling Ceased WO2017191021A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2018557329A JP6928001B2 (ja) 2016-05-02 2017-04-26 心臓リモデリングの治療及び診断のためのlncRNA Meg3
US16/098,793 US11186838B2 (en) 2016-05-02 2017-04-26 LNCRNA MEG3 for therapy and diagnosis of cardiac remodelling
EP17722704.8A EP3452593B1 (en) 2016-05-02 2017-04-26 The incrna meg3 for therapy and diagnosis of cardiac remodelling

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16167961 2016-05-02
EP16167961.8 2016-05-02

Publications (1)

Publication Number Publication Date
WO2017191021A1 true WO2017191021A1 (en) 2017-11-09

Family

ID=56026647

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/059984 Ceased WO2017191021A1 (en) 2016-05-02 2017-04-26 The incrna meg3 for therapy and diagnosis of cardiac remodelling

Country Status (4)

Country Link
US (1) US11186838B2 (https=)
EP (1) EP3452593B1 (https=)
JP (1) JP6928001B2 (https=)
WO (1) WO2017191021A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024003205A1 (en) * 2022-06-30 2024-01-04 Medizinische Hochschule Hannover Long non-coding rnas as target for treating fibrosis and cancer

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3102271A1 (en) * 2018-06-01 2019-12-05 Children's National Medical Center Compositions and methods for treating and preventing muscular disorders and dystrophies, steroid side effects, and inflammation
CN116179545B (zh) * 2022-09-09 2025-10-31 上海工程技术大学 LncRNA Gm20257在制备防治病理性心肌肥厚药物中的应用

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9416422B2 (en) * 2005-02-18 2016-08-16 Sloan-Kettering Institute For Cancer Research Methods for detecting minimum residual disease
WO2007097741A1 (en) 2006-02-17 2007-08-30 The Trustees Of Columbia University In The City Of New York Method of diagnosing intrauterine growth restriction
JP5936131B2 (ja) * 2010-01-15 2016-06-15 国立大学法人京都大学 人工多能性幹細胞の選別方法
US9920317B2 (en) * 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ESTHER E. CREEMERS ET AL: "Function and Therapeutic Potential of Noncoding RNAs in Cardiac Fibrosis", CIRCULATION RESEARCH., vol. 118, no. 1, 4 November 2015 (2015-11-04), US, pages 108 - 118, XP055315901, ISSN: 0009-7330, DOI: 10.1161/CIRCRESAHA.115.305242 *
PICCOLI MARIA-TERESA ET AL: "Non-coding RNAs as modulators of the cardiac fibroblast phenotype", JOURNAL OF MOLECULAR AND CELLULAR CARDIOLOGY, vol. 92, 4 January 2016 (2016-01-04), pages 75 - 81, XP029458199, ISSN: 0022-2828, DOI: 10.1016/J.YJMCC.2015.12.023 *
ROB JANSSEN ET AL: "Cardiac Expression of Deiodinase type 3 (Dio3) Following Myocardial Infarction Is Associated With the Induction of a Pluripotency microRNA Signature from the Dlk1-Dio3 Genomic Region", ENDOCRINOLOGY, vol. 154, no. 6, 3 April 2013 (2013-04-03), US, pages 1973 - 1978, XP055315892, ISSN: 0013-7227, DOI: 10.1210/en.2012-2017 *
XINGHUA WANG ET AL: "Noncoding RNA in cardiac fibrosis", INTERNATIONAL JOURNAL OF CARDIOLOGY., vol. 187, 18 March 2015 (2015-03-18), NL, pages 365 - 368, XP055315900, ISSN: 0167-5273, DOI: 10.1016/j.ijcard.2015.03.195 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024003205A1 (en) * 2022-06-30 2024-01-04 Medizinische Hochschule Hannover Long non-coding rnas as target for treating fibrosis and cancer

Also Published As

Publication number Publication date
US11186838B2 (en) 2021-11-30
US20190136236A1 (en) 2019-05-09
EP3452593A1 (en) 2019-03-13
JP2019518439A (ja) 2019-07-04
JP6928001B2 (ja) 2021-09-01
EP3452593B1 (en) 2020-12-23

Similar Documents

Publication Publication Date Title
US20220348920A1 (en) Lncrnas for therapy and diagnosis of cardiac hypertrophy
US11208656B2 (en) IncRNAs GADLOR 1 and 2 for use in treating and preventing cardiac remodelling
JPWO2009044899A1 (ja) 細胞の増殖を制御する核酸
JP2016522675A (ja) 上皮間葉移行に関連した疾患の治療において有用な分子標的及び前記標的のインヒビター
US11186838B2 (en) LNCRNA MEG3 for therapy and diagnosis of cardiac remodelling
US11459561B2 (en) IncRNAS for therapy and diagnosis of angiogenesis
WO2006054555A1 (ja) がんまたは糖尿病治療のための医薬組成物
CA2945559C (en) Lncrnas for therapy and diagnosis of cardiac hypertrophy
HK40104753A (zh) 用於心脏肥大治疗和诊断的lncrna
HK40006990B (en) Lncrnas for therapy and diagnosis of cardiac hypertrophy
HK40006990A (en) Lncrnas for therapy and diagnosis of cardiac hypertrophy
EP4547841A1 (en) Long non-coding rnas as target for treating fibrosis and cancer
HK1233678B (en) Lncrnas for therapy and diagnosis of cardiac hypertrophy
HK1233678A1 (en) Lncrnas for therapy and diagnosis of cardiac hypertrophy
WO2019026860A1 (ja) 遺伝子発現制御方法および遺伝子発現制御物質

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2018557329

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17722704

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017722704

Country of ref document: EP

Effective date: 20181203