WO2017164699A1 - 전립선암과 관련된 단일염기다형성 및 이를 이용한 유전 위험도 점수의 개발 - Google Patents
전립선암과 관련된 단일염기다형성 및 이를 이용한 유전 위험도 점수의 개발 Download PDFInfo
- Publication number
- WO2017164699A1 WO2017164699A1 PCT/KR2017/003211 KR2017003211W WO2017164699A1 WO 2017164699 A1 WO2017164699 A1 WO 2017164699A1 KR 2017003211 W KR2017003211 W KR 2017003211W WO 2017164699 A1 WO2017164699 A1 WO 2017164699A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- base
- prostate cancer
- polynucleotide
- snps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
Definitions
- the present invention relates to single nucleotide polymorphism (SNP) associated with prostate cancer and its use, and more specifically, SNP present in 8q21-24 site, 17q12 site, or 19q13 site of the human genome, susceptibility or prognosis of prostate cancer using the same
- SNP single nucleotide polymorphism
- the present invention relates to a method for providing useful information for judging susceptibility or prognosis of judging compositions, kits, microarrays, and prostate cancer.
- Prostate cancer is one of the most common cancers in American men and is the leading cause of cancer-related deaths.
- the incidence and probable mortality rates of prostate cancer vary widely around the world, with males in developed countries having the highest rates of mortality, especially African-Americans, while Asian incidence and mortality are relatively low. These racial differences suggest that prostate cancer development is due not only to environmental differences, but also to genetic heterogeneity.
- Korean Patent Publication No. 2012-0128454 Single nucleotide polymorphism marker in CDH1 gene useful for prognostic sensitivity or prognosis
- Korean Patent Publication No. 2015-0002237 for prostate cancer diagnosis
- Biomarkers for diagnosing prostate cancer comprising the same
- Korean Patent Application Publication No. 2011-0042678 Biomarker for Prostate Cancer and Diagnosis of Prostate Cancer Using the Same
- the use of the SNP marker of the present invention nothing is known about it.
- SNP single nucleotide polymorphism
- Another object of the present invention is to provide a composition, kit and microarray for susceptibility or prognosis of prostate cancer comprising or detecting the SNP.
- Still another object of the present invention is to provide a method for providing information through a prostate genome scoring model useful for determining the susceptibility or prognosis of prostate cancer using the SNP marker.
- one embodiment of the present invention is 10 or more consecutive nucleotide sequence including SNP (single nucleotide polymorphism) is located at the 26th base of any one of SEQ ID NO: 1 to 11 or Provided is a polynucleotide consisting of complementary base sequences for susceptibility or prognosis of prostate cancer.
- SNP single nucleotide polymorphism
- the 26th base of SEQ ID NO: 1 is A
- the 26th base of SEQ ID NO: 2 is T
- the 26th base of SEQ ID NO: 3 is G
- the 26th base of SEQ ID NO: 4 is A
- the 26th base of SEQ ID NO: 5 is A
- the 26th base of SEQ ID NO: 6 is T
- the 26th base of SEQ ID NO: 7 is A
- the 26th base of SEQ ID NO: 8 is C
- the 26th base of SEQ ID NO: 9 is G
- the 26th base of SEQ ID NO: 10 is T
- Or the 26th base of SEQ ID NO: 11 may be A.
- compositions for susceptibility or prognosis of prostate cancer comprising a primer, a probe or an antibody specifically binding to the polynucleotide for susceptibility or prognosis of the prostate cancer.
- kits for determining the sensitivity or prognosis of the prostate cancer comprising the composition for determining the sensitivity or prognosis of the prostate cancer.
- the kit specifically comprises a polynucleotide or complementary polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 1
- Compositions comprising primers, probes or antibodies that bind; A primer, a probe, or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 2, or a complementary polynucleotide thereof.
- a composition comprising; A primer, a probe, or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 6, or a complementary polynucleotide thereof.
- a composition comprising; A primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 10 or complementary polynucleotides thereof.
- a composition comprising; And a primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising SNPs (monopolymorphism) located at the 26th base of SEQ ID NO: 11, or a complementary polynucleotide thereof. It includes; a composition comprising a.
- Another embodiment of the present invention is a prostate cancer comprising a polynucleotide for susceptibility or prognosis of the prostate cancer, a polynucleotide hybridizing thereto, a polypeptide specifically encoded therein, an antibody specific thereto, or a cDNA of the polypeptide.
- a microarray for susceptibility or prognosis is provided.
- the microarray is a polynucleotide consisting of 10 or more contiguous nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 1 or complementary nucleotide sequences thereof or hybridized thereto Polynucleotides; A polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolymorphism) or complementary nucleotide sequences thereof located at the 26th base of SEQ ID NO: 2, or a polynucleotide hybridizing thereto; A polynucleotide consisting of at least 10 consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto, located at the 26th base of SEQ ID NO: 6; A polynucleotide consisting of at least 10 contiguous nu
- Another embodiment of the present invention is susceptibility to prostate cancer, comprising the step of identifying a single base polymorphism (SNP) located at the 26th base of one or more of SEQ ID NO: 1 to the nucleic acid sample obtained from the subject Or it provides a method for providing information useful for prognostic determination.
- SNP single base polymorphism
- the SNPs of SEQ ID NOs: 1 to 8 are present at 8q21-24 sites of the human genome, and the SNPs of SEQ ID NOs: 9 to 10 (Each NCBI refSNP ID is rs4430796 and rs7501939) is present in the HNF1B gene at the 17q12 site of the human genome, and the SNP of SEQ ID NO: 11 (NCBI refSNP ID is rs2735839) may be present at the 19q13 site of the human genome.
- the identifying step may be a step of identifying the SNP (single nucleotide polymorphism) located in the 26th base of the nucleotide sequence of SEQ ID NO: 1, 2, 6, 10 and 11.
- the method may further comprise performing a genetic risk score analysis for SNP (single nucleotide polymorphism) located at the 26th base of the nucleotide sequences of SEQ ID NOs: 1, 2, 6, 10, and 11. have.
- SNP single nucleotide polymorphism
- the genetic risk score analysis indicates that the homozygous of non-risk alleles is 0, the heterozygous of alleles is 1, and the homozygous alleles of the 5 SNPs. risk alleles) gives 2 as a detailed score and can be analyzed based on the total cumulative score of each detailed score.
- the subject may be an Asian.
- the present invention can provide prognostic cancer susceptibility loci at the genome level to provide early diagnosis, prediction, and prevention of prostate cancer risk groups.
- the present invention can provide a composition for diagnosing prostate cancer, a diagnostic apparatus, and the like, which can be usefully used for susceptibility or prognosis of prostate cancer.
- Figure 1 shows the overall "experimental design" for the two-step analysis of the GRS.
- Figure 2 shows the overall experimental design of prostate cancer GWAS using the exome array according to the present invention. Depending on the aggressiveness of prostate cancer, the assay was divided into five comparison sub-sets.
- Figure 4 shows the distribution of the SNP selected for each criterion to select the 24 SNPs according to an embodiment of the present invention.
- Figure 5 shows a QQ plot (Quantile-Quantile plot) showing that there is no overall error in the GWAS step.
- FIG. 7 shows a regional plot with LD structure for chromosome region 8q24.21.
- FIG. 10 shows a ROC curve showing the difference between experimental and control groups by genome risk scoring model.
- the present invention is characterized by providing a single nucleotide polymorphism (SNP) marker that can be usefully used for susceptibility or prognosis of prostate cancer.
- the SNP is 8 SNPs present in the 8q21-24 region of the human genome (each NCBI refSNP ID is rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 and rs4242384), human genome Two SNPs in the HNF1B gene at the 17q12 site of (NCBI refSNP IDs are rs4430796 and rs7501939 respectively) and one SNP present in the 19q13 site of the human genome (NCBI refSNP ID is rs2735839).
- the SNPs are sites corresponding to the 26th base of the base sequences of SEQ ID NOs: 1 to 11, respectively.
- the present invention provides 10 or more consecutive base sequences or complementary bases thereof, including SNPs (monopolynucleotide polymorphism) located at the 26th base of at least one of SEQ ID NOs: 1 to 11.
- SNPs monopolynucleotide polymorphism
- the continuous base sequence is a sequence of 10 or more, preferably 10-100, most preferably 10-50 containing the SNP (monopolybasic polymorphism) It may be configured, but is not limited thereto.
- the SNPs of the present invention represented by the 26th bases of the base sequences of SEQ ID NOs: 1 to 11 are represented by "rs1512268", “rs1016343”, “rs13252298”, “rs16901979”, “rs1447295”, “rs7837688”, “ It also describes as rs4242382 “,” rs4242384 “,” rs4430796 “,” rs7501939 “, and” rs2735839 “.
- Table 1 below shows the NCBI refSNP ID and the sequence and position of the SNP for the SNP marker provided by the present invention. Those skilled in the art can easily identify the position and sequence of the SNP using the refSNP ID. However, the specific sequence of the refSNP ID registered in the NCBI may be changed in part depending on newly reported research results, and such changes should also be interpreted to be included within the scope of the present invention.
- NCBI refSNP ID order SEQ ID NO: rs1512268 AATGCAGATTGAGTTAAATTTGCAC [A / G] ATCTACAGAAAGGGTTTGCTTCACA One rs1016343 CAAGACCATGTGTTACATTTCCCTC [C / T] CATGATTACTCACAGCTTCACAGTT 2 rs13252298 CACTTGCTGTCTTCTCAGATACAAT [A / G] TCAGAAACTTATAATCCAAGAAAAA 3 rs16901979 GTGTTAATGATTTAGCATTACTTAT [A / C] TCTGGCAAATGGTATTTTTGAGATA 4 rs1447295 AGTGCCATTGGGGAGGTATGTAAAA [A / C] GTGCTATGGAAAAAAAGCAACAGGA 5 rs7837688 catttcccactagagtggtgcattt [G / T] gtacaattgggtctatgttgacacg 6
- the present invention relates to base variants of the respective SNP positions in SEQ ID NOs: 1 to 11, but when such SNP base variants are found in double stranded genomic DNA (gDNA), also includes polynucleotide sequences complementary to the nucleotide sequence. It is interpreted as.
- the present invention provides a composition for susceptibility or prognosis of prostate cancer comprising the polynucleotide comprising the SNP of the present invention or a complementary polynucleotide thereof.
- a composition for susceptibility or prognosis of prostate cancer comprising a primer, probe or antibody specifically binding to the polynucleotide of the present invention, and a kit comprising the same.
- the present invention provides a kit for susceptibility or prognosis of prostate cancer comprising a primer, a probe or an antibody that specifically binds to the polynucleotide.
- the binding refers to hybridization to specifically distinguish the base of the SNP site present in the polynucleotide sequence of the present invention.
- the hybridization condition should be a condition that can be hybridized to only one of the alleles by showing a significant difference in the hybridization strength.
- the primer may hybridize to the DNA sequence including the SNP site of the present invention to amplify the DNA fragment containing the SNP site. Therefore, it should be complementary enough to hybridize with the template, and the length thereof may generally consist of 15 to 30 bases, but is not limited thereto.
- the antibody refers to an antibody that specifically binds to a polypeptide including the SNP marker of the present invention, and the form of the antibody of the present invention is not particularly limited.
- the kit specifically comprises a polynucleotide or complementary polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 1
- Compositions comprising primers, probes or antibodies that bind; A primer, a probe, or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 2, or a complementary polynucleotide thereof.
- a composition comprising; A primer, a probe, or an antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 6, or a complementary polynucleotide thereof.
- a composition comprising; A primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 10 or complementary polynucleotides thereof.
- a composition comprising; And a primer, probe or antibody that specifically binds to a polynucleotide consisting of 10 or more consecutive nucleotide sequences comprising SNPs (monopolymorphism) located at the 26th base of SEQ ID NO: 11, or a complementary polynucleotide thereof. It includes; a composition comprising a.
- the present invention provides a susceptibility or prognosis of a prostate cancer comprising the polynucleotide, a polynucleotide hybridizing thereto, a polypeptide specifically encoded therein, an antibody specific thereto, or a cDNA of the polypeptide.
- a judgment microarray is provided.
- the microarray may be made of a conventional microarray except for including the polynucleotide of the present invention, a polynucleotide hybridizing thereto, a polypeptide specifically encoded therewith, an antibody specific thereto, or a cDNA of the polypeptide.
- Hybridization of nucleic acids on a microarray and detection of hybridization results can be carried out by methods that are generally well known.
- the microarray is a polynucleotide consisting of 10 or more contiguous nucleotide sequences including SNPs (monopolynucleotide polymorphism) located at the 26th base of SEQ ID NO: 1 or complementary nucleotide sequences thereof or hybridized thereto Polynucleotides; A polynucleotide consisting of 10 or more consecutive nucleotide sequences including SNPs (monopolymorphism) or complementary nucleotide sequences thereof located at the 26th base of SEQ ID NO: 2, or a polynucleotide hybridizing thereto; A polynucleotide consisting of at least 10 consecutive nucleotide sequences including SNPs (monopolynucleotide polymorphism) or a complementary nucleotide sequence thereof, or a polynucleotide hybridizing thereto, located at the 26th base of SEQ ID NO: 6; A polynucleotide consisting of at least 10 contiguous nu
- the present invention the nucleic acid sample obtained from the subject, the step of identifying the SNP (single nucleotide polymorphism) located at the 26th base of any one or more of the base sequence of SEQ ID NO: 1 to 11 Provides a method of providing information useful for determining the susceptibility or prognosis of prostate cancer, including.
- the identifying step may be a step of identifying the SNP (single nucleotide polymorphism) located in the 26th base of the nucleotide sequence of SEQ ID NO: 1, 2, 6, 10 and 11.
- the nucleic acid sample is meant to include both DNA (gDNA and cDNA) and RNA molecules, and known methods from various sources, including blood of the subject to determine the susceptibility or prognosis of prostate cancer (Rogers & Bendich (1994); Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Ausubel, FM et al., Current Protocols in Molecular) Biology, John Willey & Sons (1987); Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987); PNAS USA, 85: 8998 (1988); Libert F, et al., Science, 244: 569 (1989) et al.
- the SNPs of SEQ ID NO: 1 to 8 are present in the 8q21-24 region of the human genome SNPs of SEQ ID NOs: 9 to 10 (each NCBI refSNP ID is rs4430796 and rs7501939) are present in the HNF1B gene at the 17q12 site of the human genome, and SNP (NCBI refSNP ID is rs2735839) of SEQ ID NO: 11 It may be present at the 19q13 site.
- the method is, when the genotype of the 26th base of SEQ ID NO: 1 is "A", "26" of the base number of SEQ ID NO: 2, 26 of SEQ ID NO: 3
- the genotype of the first base is "G”
- the genotype of the 26th base of SEQ ID NO: 4 is "A”
- the genotype of the 26th base of SEQ ID NO: 5 is "A”
- the 26th base of SEQ ID NO: 6 Genotype of "T
- the genotype of the 26th base of SEQ ID NO: 7 is "A”
- genotype of the 26th base of SEQ ID NO: 9 if the genotype of the 26th base of SEQ ID NO: 8 is "C” Is "G”
- the genotype of the 26th base of SEQ ID NO: 10 is "A" high risk of developing prostate cancer It may include.
- the method may be performed using a prostate cancer genome risk model.
- the method may further comprise performing a genetic risk score analysis for SNP (single nucleotide polymorphism) located at the 26th base of the nucleotide sequences of SEQ ID NOs: 1, 2, 6, 10, and 11. .
- SNP single nucleotide polymorphism
- the prostate cancer genome risk model analysis method is a model in which a total of five SNPs (monobase polymorphisms) are selected based on linkage disequilibrium and scored based on the number of mutant bases of each SNP. Specifically, the genetic risk score analysis of the five SNP homozygous of non-risk alleles (homozygous of non-risk alleles) is 0, heterozygous of alleles (1), homozygous allele (homozygous of the risk alleles) is given by subscript 2, and is analyzed based on the total cumulative score of each subscale.
- the step of identifying the SNP can be carried out using a commonly known sequencing method.
- FISH fluorescence in situ hybridization
- PFGE fluorescence in situ hybridization
- Southern blot analysis single-stranded conformation
- Known methods such as assays, RNase protection assays, dot blot assays, methods using proteins that recognize nucleotide mismatches, allele-specific PCR, denaturation gradient gel electrophoresis, and the like can be used, but are not limited thereto.
- polynucleotides, compositions, kits, microarrays for determining the susceptibility or prognosis of prostate cancer using single nucleotide polymorphisms related to the prostate cancer, and methods of providing information useful for the susceptibility or prognosis of prostate cancer include yellow race, white race, Applicability to all races, including black races, will be apparent to those of ordinary skill in the art.
- a method of providing information useful for the susceptibility or prognosis of the prostate cancer of the present invention may be targeted to Asians.
- Asian means a person of origin from the mainland people of China, Mongolia, Taiwan, Singapore, Korea, Japan, Vietnam, Cambodia, Laos, Burma, Thailand, Malaysia, Indonesia, and the Philippines.
- stage I experiments were performed using blood samples taken from 1,001 prostate cancer patients enrolled at Seoul National University Bundang Hospital from November 2003 to July 2013. Record serum prostate specific antigen (PSA), clinical stages, biopsies Gleason scores, number of positive cores and pathological outcome data for all patients It was.
- TRUS-guided multi-core ( ⁇ 12) transrectal ultrasound-guided multi-core biopsies were obtained from all males using an automatic firing mechanism.
- the prostate gland was biopsied bilaterally near the base, mid-gland and apex, at least six times per side. Therefore, 12 baseline biopsy cores were obtained from all men, and additional biopsies were performed on suspected lesions if necessary. All biopsy and radical prostatectomy (RP) samples were analyzed by one urogenital pathologist.
- RP radical prostatectomy
- Exome-based discovery studies were performed using the HumanExome BeadChip 12v1-1 system (Illumina, Inc .; San Diego, Calif.), And the chip was a protein-modifier selected from exome and full-length dielectric sequences. protein-altering variants) (242,901 probes focused on non-synonymous, stop and splice). Details of the SNP content and selection strategies can be found on the Exome Array Design web page at http://genome.sph.umich.edu/wiki/Exome_Chip_Design. Genotype calling was performed using Illumina's GenTrain version 2.0 clustering algorithm with GenomeStudio software (V2011.1). Cluster boundaries were determined using Illumina's standard cluster file. To improve the accuracy of variant calling, manual reclustering and visual inspection for genotypes were performed based on the CHARGE clustering method (Grove et al. PLoS One 8; e68095). (2013)).
- the 242,186 SNPs were analyzed in 988 total prostate cancer patients and 2,641 normal controls.
- exome-wide significance read SNPs P ⁇ 1.0 ⁇ 10
- GRS Genetic risk score
- EPACTS v3.2.4 http://genome.sph.umich.edu/wiki/EPACTS
- PLINK http://pngu.mgh.harvard.edu/ ⁇ purcell/plink/
- SAS programs version 9.1; SAS institute Inc., Cary, NC, USA
- the data was analyzed using unconditional logistic regression to calculate the relative risk of prostate cancer susceptibility according to SNP genotype as OR (odds ratio).
- OR odds ratio
- the limit of statistical significance (statistical significant threshold) (P ⁇ 3.7 ⁇ 10 - 4) it was used, based on Bonferroni correction.
- Meta-analysis was performed using the METAL program (http://genome.sph.umich.edu/wiki/METAL).
- step I We selected 1,001 prostate cancer patients and 2,641 controls (step I). Participants were analyzed using HumanExome BeadChip. An additional 514 PCa cases were registered for external validation and 548 controls (independent cohorts) were analyzed for the SNP identified in step 1 (step II). The clinical characteristics of the group who participated in the experiment are shown in Table 2 below.
- the 1,001 hospital-based prostate cancer patients had an average age of 66.3 years, an average PSA of 9.19 ng / ml, and an average prostate size of 37.48 cc. Most of the biopsy Gleason scores were below 8 (39.3% for biopsy Gleason score 6 and 41.1% for biopsy Gleason score 7). Initially, 41 patients with metastatic prostate cancer (4.1%) were enrolled, and 820 patients (81.9%) experienced radical prostatectomy (RP).
- the control group selected age- and BMI-matched healthy individuals from cohort-based populations up to threefold. The 2,641 controls had mean age and BMI of 50.9 years and 24.25 kg / m 2, respectively. Subjects with a history of malignant tumors or taking drugs were excluded from the subject.
- the overall experimental design of GWAS for prostate cancer using the exome array is shown in FIG. 2.
- 988 prostate cancer patients and 2,641 controls age- and BMI-matched were identified to discover new prostate cancer susceptibility factors. .
- the assay was classified into five comparison sub-sets according to the aggressiveness of prostate cancer. Based on the lead SNPs at the genome-wide significance level, 38 SNPs were selected in the Set 1 analysis (comparison of the whole prostate cancer patients with the controls).
- 28 SNPs were selected by comparing the control group with the patients with high non-opsy Gleason score.
- nine SNPs were selected by comparing controls with high PSA prostate cancer patients.
- 23 SNPs were selected by comparing D'amico high-risk prostate cancer patients with controls.
- 40 SNPs were selected by comparing prostate cancer patients with high pathological Gleason scores with controls.
- Figure 4 represents the number of SNPs meaningfully derived from the five sets of analyzes described above, and means the distribution of SNPs that are meaningfully commonly or alone for each set.
- FIG. 7 shows a regional plot with LD structure for chromosome region 8q24.21. As can be seen, the two SNPs in the 8q24.21 region are in different LD blocks.
- OR odds ratio
- SNP single nucleotide polymorphism
- MAF minor allele frequency
- NK3-1 Three SNPs are located at 8q21-24, one at 17q12 and one at 19q13.33. All five are at or near genes previously identified in the GWA study; For example, NK3-1, PRNCR1, CASC8 / 11, HNF1B and KLK3 (Table 5).
- Table 5 shows the results of prostate cancer and exome-wide association and shows the results of previous studies of genome-wide significance for each SNP.
- the exom-wide significance was finally confirmed (p ⁇ 8.3 ⁇ 10 ⁇ 7 ).
- Genetic risk score model was produced by the above method, based on the number of base strains of the five SNPs (0 to 10-0-2 points for each SNP), GRS The distribution of was followed by a normal distribution of an average of 4.23 ⁇ 1.44 in the control group and 4.78 ⁇ 1.43 in the experimental example (FIG. 8).
- the area under the curve (AUC) was 0.605 and 95% CI ranged from 0.573 to 0.637 (FIG. 10).
- y is a or g
- y is c or t
- y is a or g
- y is a or c
- y is a or c
- y is g or t
- y is a or g
- y is a or c
- y is a or g
- y is c or t
- y is a or g
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 서열번호 1 내지 11 중 어느 하나의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된, 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드 및 이의 용도에 관한 것이다.
Description
본 발명은 전립선암과 관련된 단일염기다형성(SNP) 및 이의 용도에 관한 것으로, 보다 구체적으로 사람 유전체의 8q21-24 부위, 17q12 부위, 또는 19q13 부위에 존재하는 SNP, 이를 이용한 전립선암의 감수성 또는 예후 판단용 조성물, 키트, 마이크로어레이 및 전립선암의 감수성 또는 예후 판단에 유용한 정보제공방법에 관한 것이다.
전립선암은 미국 남성에게서 가장 흔하게 발생하는 암의 하나로 암 관련 사망의 주된 원인이 되고 있다. 전립선암의 발병율과 그로 인한 사망율은 전세계적으로 큰 차이를 나타내는데, 선진국 남성의 발병율이 높고, 특히 아프리카계 미국인의 사망율이 가장 높게 나타나는 반면에, 아시아인의 발병율과 사망율은 상대적으로 낮은 편이다. 이러한 인종적 차이는 전립선암 발병이 환경적 차이뿐만 아니라 유전적 이질성(heterogeneity)에 기인할 가능성을 시사한다.
지금까지 전립선암과 관련된 유전체 수준의 메타분석을 통해 다수의 공통된 감수성 유전자좌(susceptibility loci)를 발견하였으나, 이러한 유전체 수준의 연구(genome-wide association studies, GWAS)는 대부분 유럽인들을 대상으로 수행되었으며, 단지 10개의 유전자좌만이 동아시아인(일본 및 중국인) 그룹을 대상으로 한 대규모 메타분석을 통해 신규한 전립선암 위험 유전자좌로 동정되었다. 따라서 특히 한국인 환자를 대상으로 한 유전체 수준의 연구를 통하여 전립선암에 대한 감수성 및 예후 판단에 유용한 정보를 제공할 수 있는 새로운 마커의 개발이 시급히 요청되고 있는 실정이다.
이와 관련된 선행문헌으로는 대한민국 공개특허공보 제2012-0128454호("전립선암의 감수성 또는 예후 판단에 유용한 CDH1 유전자내의 단일뉴클레오타이드다형성 마커"), 대한민국 공개특허공보 제2015-0002237호("전립선암 진단용 바이오마커, 및 이를 포함하는 전립선암 진단용 키트"), 대한민국 공개특허공보 제2011-0042678호("전립선암에 대한 바이오마커 및 이를 이용한 전립선암 진단") 등이 있으나, 본 발명의 SNP 마커의 용도에 관해서는 알려진 바가 없다.
본 발명의 목적은 전립선암의 감수성 또는 예후 판단에 유용하게 사용될 수 있는 단일염기다형성(SNP) 마커를 제공하는 것이다.
본 발명의 다른 목적은 상기 SNP를 포함하거나 이를 검출하는 전립선암의 감수성 또는 예후 판단용 조성물, 키트 및 마이크로어레이를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 SNP 마커를 이용한 전립선암의 감수성 또는 예후 판단에 유용한 전립선 유전체 점수화 모델을 통한 정보제공방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명의 일 구현 예는 서열번호 1 내지 11 중 어느 하나의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된, 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드를 제공한다.
서열번호 1의 26번째 염기는 A, 서열번호 2의 26번째 염기는 T, 서열번호 3의 26번째 염기는 G, 서열번호 4의 26번째 염기는 A, 서열번호 5의 26번째 염기는 A, 서열번호 6의 26번째 염기는 T, 서열번호 7의 26번째 염기는 A, 서열번호 8의 26번째 염기는 C, 서열번호 9의 26번째 염기는 G, 서열번호 10의 26번째 염기는 T, 또는 서열번호 11의 26번째 염기는 A일 수 있다.
본 발명의 다른 구현 예는 상기 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 전립선암의 감수성 또는 예후 판단용 조성물을 제공한다.
본 발명의 다른 구현 예는 상기 전립선암의 감수성 또는 예후 판단용 조성물을 포함하는 전립선암의 감수성 또는 예후 판단용 키트를 제공한다.
일 구현 예에서, 상기 키트는 서열번호 1 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 서열번호 2 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 서열번호 6 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 서열번호 10 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 및 서열번호 11 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물;을 포함한다.
본 발명의 다른 구현 예는 상기 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드, 이와 혼성화하는 폴리뉴클레오티드, 이에 의해 특이적으로 코딩되는 폴리펩티드, 이에 특이적인 항체, 또는 상기 폴리펩티드의 cDNA를 포함하는 전립선암의 감수성 또는 예후 판단용 마이크로어레이를 제공한다.
일 구현 예에서, 상기 마이크로어레이는 서열번호 1 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 서열번호 2 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 서열번호 6 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 서열번호 10 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 및 서열번호 11 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드;를 포함한다.
본 발명의 또 다른 구현 예는 피험자로부터 얻은 핵산 시료에 대하여, 서열번호 1 내지 11 중 하나 이상의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)를 확인하는 단계를 포함하는 전립선암의 감수성 또는 예후 판단에 유용한 정보를 제공하는 방법을 제공한다.
상기 서열번호 1 내지 8의 SNP(각각의 NCBI refSNP ID는 rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 및 rs4242384)는 사람 유전체의 8q21-24 부위에 존재하며, 서열번호 9 내지 10의 SNP(각각의 NCBI refSNP ID는 rs4430796 및 rs7501939)는 사람 유전체의 17q12 부위에 있는 HNF1B 유전자에 존재하며, 서열번호 11의 SNP(NCBI refSNP ID는 rs2735839)는 사람 유전체의 19q13 부위에 존재할 수 있다.
상기 방법에서, 서열번호 1의 26번째 염기의 유전자형이 "A"인 경우, "서열번호 2의 26번째 염기의 유전자형이 "T"인 경우, 서열번호 3의 26번째 염기의 유전자형이 "G"인 경우, 서열번호 4의 26번째 염기의 유전자형이 "A"인 경우, 서열번호 5의 26번째 염기의 유전자형이 "A"인 경우, 서열번호 6의 26번째 염기의 유전자형이 "T"인 경우, 서열번호 7의 26번째 염기의 유전자형이 "A"인 경우, 서열번호 8의 26번째 염기의 유전자형이 "C"인 경우, 서열번호 9의 26번째 염기의 유전자형이 "G"인 경우, 서열번호 10의 26번째 염기의 유전자형이 "T"인 경우, 또는 서열번호 11의 26번째 염기의 유전자형이 "A"인 경우에 전립선암 발병 위험도가 높다고 예측할 수 있다.
상기 확인 단계는 서열번호 1, 2, 6, 10 및 11의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)를 확인하는 단계일 수 있다.
일 구현 예에서, 상기 방법은 서열번호 1, 2, 6, 10 및 11의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)에 대한 유전 위험도 점수 분석을 수행하는 단계를 더 포함할 수 있다.
또한, 상기 유전 위험도 점수 분석은 상기 5개의 SNP에 대해 동형 비-위험성 대립유전자(homozygous of non-risk alleles)는 0, 이형 대립유전자(heterozygous of alleles)는 1, 동형 위험성 대립유전자(homozygous of the risk alleles)는 2를 세부 점수로 부여하며, 각 세부 점수의 총 누적점수를 기준으로 분석하는 것일 수 있다.
또한, 상기 피험자는 아시아인일 수 있다.
본 발명은 유전체 수준에서 전립선암 감수성 유전자좌를 제공함으로써 전립선암 위험군을 조기에 진단, 예측하여 예방할 수 있는 정보를 제공할 수 있다. 또한, 본 발명은 전립선암의 감수성 또는 예후 판단에 유용하게 사용될 수 있는 전립선암 진단용 조성물 및 진단장치 등을 제공할 수 있다.
도 1은 GRS의 2 단계 분석을 위한 전체적인 실험설계를 도시한다.
도 2는 본 발명에 따른 엑솜 어레이를 이용한 전립선암 GWAS의 전체적인 실험설계를 도시한다. 전립선암의 침해성(aggressiveness)에 따라 분석실험을 5개의 비교 서브-세트(comparison sub-sets)로 분류하였다.
도 3은 발견(discovery) GWAS 단계에서의 맨하탄 플롯(Manhattan plots)이다.
도 4는 본 발명의 일 실시예에 따른 24개의 SNP를 선정하기 위하여 각 기준별로 선정된 SNP의 분포를 나타낸 것이다.
도 5는 GWAS단계에서의 전체적인 에러가 없음을 보여주는 QQ 플롯 (Quantile-Quantile plot)을 도시한다.
도 6은 발견(discovery) GWAS 단계에서의 맨하탄 플롯(Manhattan plots)의 총괄자료를 도시한다.
도 7은 염색체 영역 8q24.21에 대한 LD 구조를 갖는 regional 플롯을 도시한다.
도 8은 유전체 위험도 점수화 모델(GRS)에 대한 빈도 분포를 도시한다.
도 9는 GRS에 따른 전립선암의 승산비를 도시한다.
도 10은 유전체 위험도 점수화 모델에 의해 실험군과 대조군 사이의 차이를 보여주는 ROC 곡선을 도시한다.
본 발명은 전립선암의 감수성 또는 예후 판단에 유용하게 사용될 수 있는 단일염기다형성(SNP) 마커를 제공하는 것을 특징으로 한다. 본 발명의 일 실시예에서, 상기 SNP는 사람 유전체의 8q21-24 부위에 존재하는 8개의 SNP(각각의 NCBI refSNP ID는 rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 및 rs4242384), 사람 유전체의 17q12 부위에 있는 HNF1B 유전자에 존재하는 2개의 SNP(각각의 NCBI refSNP ID는 rs4430796 및 rs7501939) 및 사람 유전체의 19q13 부위에 존재하는 1개의 SNP(NCBI refSNP ID는 rs2735839)이다. 상기 SNP는 각각 서열번호 1 내지 11의 염기서열의 26번째 염기에 해당하는 부위이다.
본 발명의 일 양태에 따르면, 본 발명은 서열번호 1 내지 11 중 적어도 하나의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드를 제공한다. 본 발명의 일실시예에 있어서, 상기 연속적인 염기서열은 상기 SNP(단일염기다형성)를 포함하는 10개 이상, 바람직하게는 10-100개, 가장 바람직하게는 10-50의 연속적인 염기서열로 구성될 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서 서열번호 1 내지 11의 염기서열의 각 26번째 염기로 표시되는 본 발명의 SNP는 각각 "rs1512268", "rs1016343", "rs13252298", "rs16901979", "rs1447295", "rs7837688", "rs4242382", "rs4242384", "rs4430796", "rs7501939", "rs2735839"로도 기재한다. 아래 표 1은 본 발명에서 제공하는 SNP 마커에 대한 NCBI의 refSNP ID와 해당 SNP의 서열 및 위치를 나타낸 것이다. 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자라면 상기 refSNP ID를 이용하여 SNP의 위치 및 서열을 용이하게 확인할 수 있다. 다만 NCBI에 등록되어 있는 상기 refSNP ID의 구체적인 서열은 새롭게 보고되는 연구 결과에 따라 일부가 변경될 수 있으며, 이러한 변경 역시 본 발명의 범위 내에 포함되는 것으로 해석되어야 한다.
| NCBI refSNP ID | 서열 | 서열번호 |
| rs1512268 | AATGCAGATTGAGTTAAATTTGCAC[A/G]ATCTACAGAAAGGGTTTGCTTCACA | 1 |
| rs1016343 | CAAGACCATGTGTTACATTTCCCTC[C/T]CATGATTACTCACAGCTTCACAGTT | 2 |
| rs13252298 | CACTTGCTGTCTTCTCAGATACAAT[A/G]TCAGAAACTTATAATCCAAGAAAAA | 3 |
| rs16901979 | GTGTTAATGATTTAGCATTACTTAT[A/C]TCTGGCAAATGGTATTTTTGAGATA | 4 |
| rs1447295 | AGTGCCATTGGGGAGGTATGTAAAA[A/C]GTGCTATGGAAAAAAAGCAACAGGA | 5 |
| rs7837688 | catttcccactagagtggtgcattt[G/T]gtacaattgggtctatgttgacacg | 6 |
| rs4242382 | ATTTTGTCCCTCTAGTTATCTTCCC[A/G]CAGGCCCATCAAGAATCAGGCAGTA | 7 |
| rs4242384 | AGTCCCATGCTAGAAGCTGCTTTAC[A/C]AACACAGTCAGCTGCTATCTCCACA | 8 |
| rs4430796 | ATACAGAGAGGCAGCACAGACTGGA[A/G]ATGCTGCATAAAGCTTAAATTGGGC | 9 |
| rs7501939 | GGTGTAGAGGCTGAAATAGATACAG[C/T]ATTGCAACATAATAAGCAATTTTAT | 10 |
| rs2735839 | AGGGATCTGGTTCTGTCTTGTGGCC[A/G]AGTGGACCATGGGGCTATCCCAAGA | 11 |
상기 "rs1512268"SNP(서열번호 1의 26번째 염기)에서의 "A"염기, "rs1016343"SNP(서열번호 2의 26번째 염기)에서의 "T"염기, "rs13252298"SNP(서열번호 3의 26번째 염기)에서의"G"염기, "rs16901979"SNP(서열번호 4의 26번째 염기)에서의"A"염기, "rs1447295"SNP(서열번호 5의 26번째 염기)에서의"A"염기, "rs7837688"SNP(서열번호 6의 26번째 염기)에서의"T"염기, "rs4242382"SNP(서열번호 7의 26번째 염기)에서의"A"염기, "rs4242384"SNP(서열번호 8의 26번째 염기)에서의"C"염기, "rs4430796"SNP(서열번호 9의 26번째 염기)에서의"G"염기, "rs7501939"SNP(서열번호 10의 26번째 염기)에서의"T"염기, "rs2735839" SNP(서열번호 11의 26번째 염기)에서의 "A" 염기의 빈도는 정상인에 비해 전립선암 환자에게서 특히 높게 나타나므로, 상기 염기들이 존재하면 전립선암에 대한 감수성이 높은 것으로 판단할 수 있다. 또한, 상기 염기들은 전립선암 환자에서 악성이 높은 단계에서 더 높은 빈도로 나타남으로써 암의 악성 진전과 강한 상관관계를 갖는다. 따라서, 상기 SNP에서 상기 지정된 염기가 존재하면 전립선암의 악성 단계로의 진전이 예상되어 나쁜 예후로 판단될 수 있다.
본 발명은 상기 서열번호 1 내지 11에서 각 SNP 위치의 염기 변이체에 관한 것이나, 이러한 SNP 염기 변이가 이중가닥의 gDNA(genomic DNA)에서 발견되는 경우, 상기 뉴클레오티드 서열에 대하여 상보적인 폴리뉴클레오티드 서열도 포함하는 것으로 해석된다.
본 발명의 다른 일 양태에 따르면, 본 발명은 상기 본 발명의 SNP를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 포함하는 전립선암의 감수성 또는 예후 판단용 조성물을 제공한다. 본 발명의 일 구현 예에서, 본 발명의 상기 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 전립선암의 감수성 또는 예후 판단용 조성물, 및 이를 포함하는 키트를 제공한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 상기 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 전립선암의 감수성 또는 예후 판단용 키트를 제공한다.
본 발명의 일실시예에 있어서, 상기 결합은 본 발명의 폴리뉴클레오티드 서열 중에 존재하는 SNP 부위의 염기를 특이적으로 구별할 수 있도록 혼성화하는 것을 말한다. 이 경우 혼성화 조건은 혼성화 강도에 있어서 유의한 차이를 나타내어 대립형질 중 하나에만 혼성화될 수 있는 조건이어야 한다. 본 발명의 일실시예에 있어서, 상기 프라이머는 본 발명의 SNP 부위를 포함하는 DNA 서열에 혼성화하여 SNP 부위를 포함하는 DNA 단편을 증폭시키는 역할을 할 수 있다. 따라서 주형과 혼성화할 정도로 충분히 상보적이어야 하며, 그 길이는 일반적으로 15 내지 30개의 염기로 구성될 수 있으나 이에 제한되는 것은 아니다. 본 발명의 일실시예에 있어서, 상기 항체란 본 발명의 SNP 마커를 포함하는 폴리펩티드에 대해 특이적으로 결합하는 항체를 의미하며, 본 발명의 항체의 형태는 특별히 제한되지 않는다.
일 구현 예에서, 상기 키트는 서열번호 1 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 서열번호 2 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 서열번호 6 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 서열번호 10 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 및 서열번호 11 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물;을 포함한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 상기 폴리뉴클레오티드, 이와 혼성화하는 폴리뉴클레오티드, 이에 의해 특이적으로 코딩되는 폴리펩티드, 이에 특이적인 항체, 또는 상기 폴리펩티드의 cDNA를 포함하는 전립선암의 감수성 또는 예후 판단용 마이크로어레이를 제공한다. 상기 마이크로어레이는 본 발명의 폴리뉴클레오티드, 이와 혼성화하는 폴리뉴클레오티드, 이에 의해 특이적으로 코딩되는 폴리펩티드, 이에 특이적인 항체, 또는 상기 폴리펩티드의 cDNA를 포함하는 것을 제외하고 통상적인 마이크로어레이로 이루어질 수 있으며, 마이크로어레이 상에서 이루어지는 핵산의 혼성화 및 혼성화 결과의 검출은 일반적으로 널리 알려져 있는 방법을 사용할 수 있다.
일 구현 예에서, 상기 마이크로어레이는 서열번호 1 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 서열번호 2 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 서열번호 6 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 서열번호 10 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 및 서열번호 11 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드;를 포함한다.
본 발명의 다른 일 양태에 따르면, 본 발명은, 피험자로부터 얻은 핵산 시료에 대하여, 서열번호 1 내지 11 중 어느 하나 이상의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)를 확인하는 단계를 포함하는 전립선암의 감수성 또는 예후 판단에 유용한 정보제공방법을 제공한다. 구체적으로, 상기 확인 단계는 서열번호 1, 2, 6, 10 및 11의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)를 확인하는 단계일 수 있다.
본 발명의 일 실시예에 있어서, 상기 핵산 시료는 DNA (gDNA 및 cDNA) 및 RNA 분자를 모두 포함하는 의미이며, 전립선암의 감수성 또는 예후를 판단하고자 하는 피험자의 혈액을 포함한 다양한 소스로부터 공지의 방법에 따라 얻을 수 있다(Rogers & Bendich (1994); Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001); Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons(1987); Chomczynski, P. et al., Anal. Biochem. 162:156(1987); PNAS USA, 85:8998(1988); Libert F, et al., Science, 244:569(1989) 등 참조).
본 발명의 일 실시예에 있어서, 상기 서열번호 1 내지 8의 SNP(각각의 NCBI refSNP ID는 rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 및 rs4242384)는 사람 유전체의 8q21-24 부위에 존재하며, 서열번호 9 내지 10의 SNP(각각의 NCBI refSNP ID는 rs4430796 및 rs7501939)는 사람 유전체의 17q12 부위에 있는 HNF1B 유전자에 존재하며, 서열번호 11의 SNP(NCBI refSNP ID는 rs2735839)는 사람 유전체의 19q13 부위에 존재하는 것일 수 있다.
본 발명의 일 실시예에 있어서, 상기 방법은 서열번호 1의 26번째 염기의 유전자형이 "A"인 경우, "서열번호 2의 26번째 염기의 유전자형이 "T"인 경우, 서열번호 3의 26번째 염기의 유전자형이 "G"인 경우, 서열번호 4의 26번째 염기의 유전자형이 "A"인 경우, 서열번호 5의 26번째 염기의 유전자형이 "A"인 경우, 서열번호 6의 26번째 염기의 유전자형이 "T"인 경우, 서열번호 7의 26번째 염기의 유전자형이 "A"인 경우, 서열번호 8의 26번째 염기의 유전자형이 "C"인 경우, 서열번호 9의 26번째 염기의 유전자형이 "G"인 경우, 서열번호 10의 26번째 염기의 유전자형이 "T"인 경우, 또는 서열번호 11의 26번째 염기의 유전자형이 "A"인 경우에 전립선암 발병 위험도가 높은 것으로 예측하는 단계를 포함할 수 있다.
본 발명의 일 실시예에 있어서, 상기 방법은 전립선암 유전체 위험도 모델을 이용하여 수행될 수 있다. 예를 들어, 상기 방법은 서열번호 1, 2, 6, 10 및 11의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)에 대한 유전 위험도 점수 분석을 수행하는 단계를 더 포함할 수 있다.
상기 전립선암 유전체 위험도 모델 분석 방법은 연관 불균형(linkage disequilibrium)을 기준으로 총 5개의 SNP(단일염기다형성)를 선정하여 각 SNP의 변이 염기의 개수를 기준으로 점수화한 모델이다. 구체적으로, 상기 유전 위험도 점수 분석은 상기 5개의 SNP에 대해 동형 비-위험성 대립유전자(homozygous of non-risk alleles)는 0, 이형 대립유전자(heterozygous of alleles)는 1, 동형 위험성 대립유전자(homozygous of the risk alleles)는 2를 세부 점수로 부여하며, 각 세부 점수의 총 누적점수를 기준으로 분석하여 이루어진다.
본 발명의 일 실시예에 있어서, 상기 SNP(단일염기다형성)를 확인하는 단계는 일반적으로 널리 알려져 있는 염기서열 분석방법을 이용하여 수행될 수 있다. 예컨대 자동염기서열분석기를 사용한 시퀀싱 분석, PCR-RELP법, 파이로시퀀싱, 마이크로어레이에 의한 혼성화, TaqMan-PCR법, 형광 인 시투 혼성화(FISH), PFGE 분석, 서던 블롯 분석, 단일-가닥 컨퍼메이션 분석, RNase 보호 분석, 닷트 블롯 분석, 뉴클레오타이드 미스매치를 인식하는 단백질을 이용하는 방법, 대립형-특이 PCR, 변성 구배 젤 전기영동 등의 공지의 방법을 이용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 연구는 한국인 환자를 대상으로 한 유전체 수준의 연구를 기초로 하였다. 그러나, 본 발명의 전립선암에 관련된 단일염기다형성을 이용한 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드, 조성물, 키트, 마이크로어레이 및 전립선암의 감수성 또는 예후 판단에 유용한 정보제공방법 등은 황인종, 백인종, 흑인종 등을 포함한 모든 인종에게 적용할 수 있음은 당해 기술분야의 통상의 지식을 가진 자에게 자명할 것이다.
바람직하게는, 본 발명의 전립선암의 감수성 또는 예후 판단에 유용한 정보제공방법은 아시아인을 대상으로 할 수 있다. 본 발명에서, "아시아인"은 중국, 몽골, 대만, 싱가포르, 한국, 일본, 베트남, 캄보디아, 라오스, 버마, 태국, 말레이시아, 인도네시아, 및 필리핀의 본토 사람들에 기원을 두고 있는 사람을 의미한다.
이하, 실시예에 의하여 본 발명을 상세히 설명하고자 한다. 단, 아래 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 다음 실시예에 한정되는 것은 아니다.
<실시예>
실험대상 및 방법
1. 실험대상
본 연구는 도 1에 도시된 2 단계 디자인으로 수행되었다. 단계 I에서는 1,001 개의 PCa 샘플과 2,641개의 인구 컨트롤을 사용해 한국인에 관련된 표식을 찾고 다른 민족 집단에서 이전에 확인된 GWAS SNP를 조사하였다. 단계 II에서 단계 I에서 검증된 SNP를 기반으로 GRS를 계산하였다.
단계 I에서, 2003년 11월부터 2013년 7월까지 분당서울대병원에 등록된 1,001명의 전립선암 환자로부터 채취한 혈액 시료를 사용하여 실험을 수행하였다. 모든 환자들에 대하여 혈청 전립선 특이 항원(serum prostate specific antigen, PSA), 임상단계(clinical stages), 비옵시 글리슨 스코어(biopsies Gleason scores), 양성 코어(positive cores)의 수 및 병리학적 결과 데이터를 기록하였다. 오토매틱 파이어링 메커니즘(automatic firing mechanism)을 사용하여 모든 남성으로부터 TRUS-가이드 멀티-코어(≥12) 비옵시(transrectal ultrasound-guided multi-core biopsies)를 얻었다. 전립선은 기부(base), 중간선(mid-gland) 및 상단(apex) 근처에서 양측면으로(bilaterally) 생검을 실시하였으며, 한 측면당 적어도 6번 이루어졌다. 따라서 모든 남성으로부터 12개의 베이스라인 비옵시 코어(baseline biopsy cores)를 얻었으며, 필요한 경우 의심되는 병변(lesions)에서 추가적인 생검을 실시하였다. 모든 생검(biopsy) 및 근치적 전립선절제술(radical prostatectomy, RP) 시료는 한 명의 비뇨생식기 병리학자에 의해 분석되었다.
대조군 참가자는 KoGES (Korean Genome and Epidemiology Study) 연구의 일부인 KARE (Korean Association Resource)로부터 선발되었다. 안성 및 안산에 거주하는 40-69세의 참가자 총 10,038명이 2001-2002년에 시작되었다. 이에 대한 더 자세한 사항은 공개된 문헌에 기재되어 있다. (Kim et al.. Nat Genet. 43:990(2011); Cho et al.. Nat Genet. 41:527(2009))
단계 II GRS 평가를 위해 516명의 실험군과 548 명의 대조군이 충북대학교 병원에서 모집되었다. PCa의 진단은 단계 I에서 설명한 것과 동일하다.
2. 전립선암의 침해성(aggressiveness)에 따른 형질결정
임상기준들 사이의 재현성(reproducibility)을 조사하기 위하여, 암 침해성(aggressiveness) 관련 인자들인 비옵시 글리슨 스코어(biopsies Gleason scores), 초기(initial) PSA 수준, 질병위험군(disease risk group) 및 RP 후 병리학적 글리슨 스크어(pathologic Gleason score after RP)에 따라 전립선암 환자들을 선별하고, KARE 연구의 정상 대조군 3배수와 비교하였다.
1) 비옵시 글리슨 스코어 ≥ 7 인 583명의 전립선암 환자를 선별하고 1,750명의 정상 대조군과 비교하였다.
2) 초기 혈청 PSA 수준이 20 ng/ml 보다 높은 220명의 전립선암 환자를 선별하고 660명의 정상 대조군과 비교하였다.
3) D'amico에 의해 설계된 고위험군(high risk group) 344명을 선별하고 1,050명의 정상 대조군과 비교하였다. (D'Amico et al.. JAMA 280:969(1998))
4) RP 후 병리학적 글리슨 스코어 ≥ 7 인 771명을 선별하고 2,320명의 정상 대조군과 비교하였다. (도 2)
3. 엑솜 칩(Exome chip) 및 GWAS 단계에서의 품질관리(quality control)
HumanExome BeadChip 12v1-1 시스템(Illumina, Inc.; San Diego, CA)을 사용하여 엑솜-기반의 연구(Exome-based discovery study)를 수행하였으며, 상기 칩은 엑솜 및 전장유전체 서열로부터 선택된 단백질-변형체(protein-altering variants) (non-synonymous, stop 및 splice)에 초점을 맞춘 242,901개의 프로브를 포함한다. SNP 컨텐트(content) 및 선택전략의 상세는 엑솜 어레이 디자인 웹페이지(http://genome.sph.umich.edu/wiki/Exome_Chip_Design)에서 찾아볼 수 있다. 유전자형 콜링(genotype calling)은 GenomeStudio 소프트웨어(V2011.1)와 함께 Illumina's GenTrain 버젼 2.0 클러스터링 알고리즘을 사용하여 수행하였다. 클러스터 경계는 Illumina's standard cluster file을 사용하여 결정하였다. 변이체 콜링(variant calling)의 정확성을 향상시키기 위해, CHARGE 클러스터링법에 기초하여 유전자형을 위한 매뉴얼 리클러스터링(manual reclustering) 및 비주얼 인스펙션(visual inspection)을 수행하였다 (Grove et al.. PLoS One 8;e68095(2013)).
유전자형 품질관리를 위해, 유전자형의 분석후에 유전자 회신률이 95%미만인 SNP을 제외시켰다. 시도된 마커 242,901개 중 242,186개(99.71%)가 call rates >95% (average call rate: 99.98%)로 성공적으로 유전자형이 결정되었다.
이렇게 정해진 242,186개의 SNP를 총 전립선암 환자군 988명과 정상인 대조군 2,641명에서 분석하였다.
4. 반복검증 단계(replication stage)에서의 유전자형 분석
추가적인 반복검증 단계(replication stage)를 위해 24개의 리드(lead) SNPs (P < 3.7 × 10-
4)를 선별하였다. 상기 SNPs의 유전자형 분석(genotyping)은 Fluidigm 192.24 Dynamic Array TM IFC 및 Biomark HD 시스템을 사용하여 수행하였다. 품질관리(quality control)를 위해 중복(duplicates) 및 음성 대조군을 각각의 96-웰 플레이트에 포함시켰다. 유전자형 분석은 샘플 상태를 알지 못하는 테크니션에 의해 수행되었다. 중복(duplicate) 샘플 사이의 평균적인 일치율(concordance rate)은 >99% 이었다.
5-1. 엑솜-와이드 반복검증을 위한 유전자형 분석
엑솜-와이드 유의도 리드 마커를 갖는 GRS 제작을 위한 정보 마커 세트를 선택하는 경우, 선택가능한 유전자좌 수를 더 많이 확보하기 위해, 단계 I에서 5개의 엑솜-와이드 유의도 리드 SNP(P <1.0 × 10-
4)를 선택하여 반복검증을 위해 충북대학교 샘플에서 유전자형을 분석한다. 구체적인 분석 방법은 위 4와 동일하다.
5-2. GRS (genetic risk score) 제작 및 위험성 평가
전립선암 감수성(susceptibility) 유전자좌(loci)를 이용하여 GRS를 만들기 위해, 다른 종족 집단에서도 검증된 각 LD 블록에서 5개의 엑솜-와이드 유의도 리드 SNP(P < 8.30 × 10-
7)를 고려하였다. 가산 모델(additive model)을 이용하여 위험 대립유전자(risk alleles)의 누적적인 수를 기록하였다[effect allele에 대해, 동형 비-위험성 대립유전자(homozygous of non-risk alleles)는 0, 이형 대립유전자(heterozygous of alleles)는 1, 동형 위험성 대립유전자(homozygous of the risk alleles)는 2로 계산하며, 총 5개의 SNP이므로 0점부터 10점까지 스코어 값이 가능함].
6. 통계분석
EPACTS v3.2.4 (http://genome.sph.umich.edu/wiki/EPACTS), PLINK (http://pngu.mgh.harvard.edu/~purcell/plink/) 및 SAS 프로그램(version 9.1; SAS institute Inc., Cary, NC, USA)을 사용하여 single-variant association 테스트를 분석하였다. 데이터를 무조건적 로지스틱 회귀분석(unconditional logistic regression)을 사용하여 분석하여 SNP 유전자형에 따른 전립선암 감수성의 상대적 위험을 OR (odds ratio)로 계산하였다. 복합적인 비교(multiple comparisons)를 위해, 통계적 유의성의 한계(statistical significant threshold) (P < 3.7 × 10-
4)를 Bonferroni correction에 기초하여 사용하였다. 메타-분석은 METAL program(http://genome.sph.umich.edu/wiki/METAL)을 사용하여 수행하였다.
실험결과
1. 실험집단
본 발명자들은 1,001명의 전립선암 환자 및 2,641명의 대조군을 선정하였다 (단계 I). 참가자들은 HumanExome BeadChip을 사용하여 분석되었다. 외부 검증을 위해 514 PCa 사례를 추가로 등록했고 548개의 대조군(독립 코호트)이 1 단계에서 확인된 SNP에 대해 분석되었다(단계 II). 실험에 참여한 집단의 임상적 특성은 아래 표 2와 같다.
| Variables | Prostate cancer (n = 1,001) | Control (n = 2,641) | Prostate Cancer II (n=514) | Control II (n=548) |
| Mean Age (yrs) ± SD | 66.32 ± 6.65 | 50.94 ± 8.50 | 69.08 ± 7.56 | 50.04 ±13.33 |
| Median PSA (ng/ml) ± SD | 9.19 ± 138.60 | N.A | 10.10 ± 648.92 | N.A. |
| Prostate volume (ml) ± SD | 37.48 ± 17.35 | N.A | N.A | N.A. |
| Body mass index (kg/m2) ± SD | 24.47 ± 8.23 | 24.25 ± 3.04 | ||
| Pathologic stage (n_%) | - | |||
| pT2 | 460 (56.1) | - | N.A | |
| pT3a | 271 (33.0) | - | N.A | |
| pT3b | 79 (9.6) | - | N.A | |
| pT4 | 10 (1.2) | - | N.A | |
| Gleason score (n_%) | - | |||
| 6 | 393 (39.3) | - | 43 (8.4) | |
| 7 | 411 (41.1) | - | 278 (54.1) | |
| 8 | 138 (13.8) | - | 86 (16.7) | |
| 9 | 47 (4.7) | - | 95 (18.5) | |
| 10 | 12 (1.2) | 12 (2.3) |
SD = standard deviation; PSA = prostate specific antigen
실험에 참여한 모든 남성은 인종적으로 단일한 한국인 집단이다. 1,001명의 병원(hospital-based) 전립선암 환자들은 평균나이가 66.3세이고, 평균 PSA가 9.19 ng/ml이었으며, 평균 전립선 크기가 37.48 cc이었다. 대부분의 비옵시 글리슨 스코어(biopsy Gleason score)는 8 미만이었다(biopsy Gleason score 6이 39.3%, biopsy Gleason score 7이 41.1%). 처음에, 41명의 전이성 전립선암 환자(4.1%)가 등록되었고, 820명의 환자들(81.9%)이 근치적 전립선절제술(radical prostatectomy, RP)을 경험하였다. 대조군 그룹은 코호트(cohort-based) 집단으로부터 나이와 BMI가 조화된(age-/ BMI-matched) 건강한 개체를 3배수까지 선발하였다. 2,641명의 대조군은 평균 나이 및 BMI가 각각 50.9세 및 24.25 kg/m2 였다. 악성 종양의 병력이 있거나 약물을 복용하는 개체는 대상에서 제외시켰다.
2. 임상적 분류
엑솜 어레이를 이용한 전립선암에 대한 GWAS의 전체적인 실험설계는 도 2에 나타낸 바와 같다. 수집된 전립선암 시료의 품질관리(quality control) 분석 후에, 988명의 전립선암 환자와, 나이와 BMI가 조화된(age-/ BMI-matched) 2,641명의 대조군을 분석하여 새로운 전립선암 감수성 인자를 발견하였다. 임상적 기준들 간의 재현성(reproducibility)을 조사하기 위하여, 전립선암의 침해성(aggressiveness)에 따라 분석실험을 5개의 비교 서브-세트(comparison sub-sets)로 분류하였다. 유전체 규모의 유의적 수준(genome-wide significance level)에서 리드(lead) SNPs에 기초하여, 세트 1 분석에서 38개의 SNPs를 선별하였다(전체 전립선암 환자와 대조군의 비교). 세트 2 분석에서는 높은 비옵시 글리슨 스코어를 나타낸 환자와 대조군을 비교하여 28개의 SNPs를 선별하였다. 세트 3 분석에서는 높은 PSA의 전립선암 환자와 대조군을 비교하여 9개의 SNPs를 선별하였다. 세트 4 분석에서는 D'amico 고위험군 전립선암 환자와 대조군을 비교하여 23개의 SNPs를 선별하였다. 세트 5 분석에서는 높은 병리학적 글리슨 스코어의 전립선암 환자와 대조군을 비교하여 40개의 SNPs를 선별하였다.
3. 엑솜 규모의 연관(Exome-wide association) (stage I) 및 반복검증 실험(stage II)
GWAS 발견(discovery) 단계에서, 본 발명자들은 Bonferroni correction을 사용하여(P < 3.7 × 10-4, 도 3 참조), 세트 1 분석에서 38개의 SNPs를, 세트 2 분석에서 28개의 SNPs를, 세트 3 분석에서 9개의 SNPs를, 세트 4 분석에서 23개의 SNPs를, 세트 5 분석에서 40개의 SNP를 발견하였다.
본 발명자들은 연관 불균형(linkage disequilibrium), 전립선암 관련 인자들과의 관련성 수준을 첫 번째 기준으로 하고, 이전에 공개되지 않았던 SNP을 두 번째 기준으로 하여서 상기 발견된 SNPs중에서 본 연구에서 지속 발견할 타겟 SNPs을 선정하였다(도 4 참조). 도 4는 상기 기술한 5개의 세트의 분석에서 의미있게 나온 SNP의 숫자를 의미하며 각 세트별로 공통적으로 혹은 단독으로 의미있게 나온 SNP의 분포를 의미한다.
이 단계를 거친 후에, 24개의 SNPs들이 추가적인 반복(replication) 분석을 위해 선별되었고 이중 시행품질 결과에 따라 2개의 SNP를 탈락시키고 22개의 SNP에 대해 514명의 병원(hospital based) 전립선암 환자 및 548명의 정상 대조군에서 추가반복 분석을 시행하였다(표 3 참조).
| SNPID | Chr | location | Alleles | Gene | MAF | p-value | Reference |
| rs1016343 | 8q24.21 | intron | A/G | PRNCR1 | 0.3341 | 1.29E-16 | 18264097, 21743057 |
| rs13252298 | 8q24.21 | intron | G/A | PRNCR1 | 0.2761 | 1.28E-08 | 21743057 |
| rs1456315 | 8q24.21 | intron | G/A | PRNCR1 | 0.2647 | 3.11E-19 | 20676098, 23023329 |
| rs16901979 | 8q24.21 | intergenic | A/C | PRNCR1 CASC19 | 0.2468 | 5.91E-10 | 17401366, 19767754 |
| rs1447295 | 8q24.21 | intron | A/C | CASC8 | 0.1780 | 9.99E-11 | 17401363, 17401366, 19767754, 24753544 |
| rs7837688 | 8q24.21 | intergenic | A/C | CASC8 - CASC11 | 0.1572 | 1.23E-15 | 20676098 |
| rs4242382 | 8q24.21 | intergenic | A/G | CASC8 - CASC11 | 0.1912 | 1.05E-12 | 18264096 |
| rs4242384 | 8q24.21 | intergenic | C/A | CASC8 - CASC11 | 0.1799 | 2.05E-15 | 18264097, 21743057 |
| rs1512268 | 8p21.2 | intergenic | A/G | NKX3-1 | 0.3253 | 1.66E-08 | 20676098, 19767753, 22923026 |
| rs339331 | 6q22.1 | intron | G/A | RFX6 | 0.3461 | 6.21E-06 | 20676098 |
| rs4430796 | 17q12 | intron | G/A | HNF1B | 0.2983 | 1.03E-06 | 19767754, 18264096, 17603485 |
| rs7501939 | 17q12 | intron | A/G | HNF1B | 0.2684 | 2.40E-08 | 18264097, 20676098, 21743057, 19767753 |
| rs2735839 | 19q13.33 | intron | A/G | KLK3 | 0.3699 | 5.86E-07 | 18264097, 23269536 |
| rs75647314 | 4q13.2 | intron | A/C | TMPRSS11B | 0.0074 | 1.67E-29 | - |
| rs1048167 | 5q13.3 | nonsynonymous | A/G | GFM2 | 0.0047 | 1.29E-18 | - |
| rs11147922 | 13q14.11 | intron | G/A | ENOX1 | 0.3603 | 2.75E-05 | - |
| rs28484999 | 16q23.2 | intron | A/G | CDYL2 | 0.0209 | 5.96E-26 | - |
| rs6901250 | 6q22.1 | synonymous | G/A | GPRC6A | 0.4971 | 5.68E-05 | - |
| rs636252 | 6q22.1 | intergenic | G/A | GPRC6A RFX6 | 0.4825 | 2.80E-05 | - |
| rs2016588 | 6q25.3 | intergenic | A/G | RSPH3 -TAGAP | 0.4938 | 1.75E-05 | - |
| rs57006764 | 12p13.31 | nonsynonymous | A/G | PZP | 0.4282 | 3.95E-05 | - |
| rs149008055 | 15q26.1 | synonymous | G/A | FANCI | 0.0063 | 3.19E-05 | - |
OR = odds ratio; SNP = single nucleotide polymorphism
한편, 도 5의 QQ 플롯은 어떤 이유로든 I형 오류에 의한 팽창이 발생하지 않았음을 나타낸다(게놈 제어 분석에 의한 팽창 지수, λ = 0.92).
각 SNP의 부가 효과를 시험하는 전립선암 감수성 유전자좌에 대한 분석을 위한 맨해튼 플롯을 도 6에 도시한다.
도 7은 염색체 영역 8q24.21에 대한 LD 구조를 갖는 regional 플롯을 제시한다. 그림에서 알 수 있듯이 8q24.21 영역의 두 SNP는 서로 다른 LD 블록에 있다.
상기 22개의 SNPs 중 2차 분석(충북대 병원 환자를 대상으로 514명의 병원(hospital based) 전립선암 환자 및 548명의 정상 대조군에 대해 수행한 검사)을 통해 10개의 의미 있는 SNP를 선별하였다. 즉 독립적인 반복(replication) 실험에서 본 발명자들은 514명의 병원(hospital based) 전립선암 환자 및 548명의 정상 대조군에 대해 추가로 22개 SNPs의 유전자형을 분석하였다. 이중 총 10개의 SNPs이 전립선암의 유의한 유전체 변이로 확인되었다. 또한 이 10개의 SNP은 모두 변이가 있을수록 전립선암의 위험도가 증가하는 것으로 확인되었다(표 4 참조). 표 4는 본 발명의 실시예에 따른 첫 번째 분석실험(988명의 전립선암환자와 2641명의 대조군에 대해 수행한 실험)과 두 번째 분석실험(514명의 환자와 548명의 대조군에 대해 수행한 실험)에 대한 메타분석 결과이다.
| SNPID | Gene | MAF | Stage I | Stage II | Combined Meta | |||||||
| Case | Control | OR (95%CI) | P | OR (95%CI) | P | OR (95%CI) | P | |||||
| rs1512268 | NKX3-1 | 0.376 | 0.306 | 1.37 (1.23-1.53) | 1.90E-08 | 1.27 (1.06-1.52) | 8.08E-03 | 1.34 (1.22-1.47) | 6.64E-10 | |||
| rs1016343 | PRNCR1 | 0.408 | 0.306 | 1.58 (1.42-1.77) | 2.42E-16 | 1.28 (1.06-1.53) | 9.56E-03 | 1.50 (1.36-1.64) | 5.47E-17 | |||
| rs13252298 | PRNCR1 | 0.228 | 0.294 | 1.43 (1.26-1.62) | 1.49E-08 | 1.37 (1.12-1.67) | 1.94E-03 | 1.41 (1.27-1.57) | 1.13E-10 | |||
| rs16901979 | PRNCR1 - CASC19 | 0.298 | 0.228 | 1.44 (1.28-1.62) | 7.45E-10 | 1.48 (1.20-1.82) | 1.93E-04 | 1.45 (1.31-1.61) | 6.16E-13 | |||
| rs1447295 | CASC8 | 0.226 | 0.160 | 1.53 (1.34-1.74) | 1.41E-10 | 1.55 (1.24-1.94) | 1.46E-04 | 1.53 (1.37-1.71) | 9.13E-14 | |||
| rs4242382 | CASC8 - CASC11 | 0.245 | 0.171 | 1.57 (1.39-1.78) | 1.69E-12 | 1.63 (1.31-2.04) | 1.45E-05 | 1.58 (1.42-1.77) | 1.30E-16 | |||
| rs4242384 | CASC8 - CASC11 | 0.239 | 0.158 | 1.67 (1.47-1.70) | 4.37E-15 | 1.58 (1.26-1.98) | 5.94E-05 | 1.65 (1.47-1.84) | 1.37E-18 | |||
| rs7837688 | CASC8 - CASC11 | 0.213 | 0.136 | 1.73 (1.51-1.98) | 2.85E-15 | 1.49 (1.19-1.87) | 5.23E-04 | 1.66 (1.48-1.87) | 1.13E-17 | |||
| rs4430796 | HNF1B | 0.256 | 0.314 | 1.34 (1.19-1.51) | 1.12E-06 | 1.65 (1.35-2.02) | 9.70E-07 | 1.41 (1.28-1.56) | 2.49E-11 | |||
| rs7501939 | HNF1B | 0.221 | 0.286 | 1.42 (1.25-1.60) | 2.78E-08 | 1.59 (1.29-1.97) | 1.59E-05 | 1.46 (1.31-1.62) | 3.19E-12 | |||
OR = odds ratio; SNP = single nucleotide polymorphism, MAF = minor allele frequency
8개의 SNPs (rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 및 rs4242384)는 8q21-24 영역에 위치했으며, 2개의 SNPs (rs4430796 및 rs7501939)는 17q12 내의 HNF1B 유전자에 위치하는 것을 확인할 수 있었다. 모든 샘플들(1,494 cases 및 3,189 controls)의 결합(combined) 메타-분석에서, 본 발명자들은 한국인에게서 유전체 수준의 유의성으로 강한 상관성을 발견하였다.
4-1. 반복검증 단계(stage II)를 위한 5개 SNP의 선별
상기 stage I에서 도출한 22개의 SNPs에서 5개의 엑솜-와이드 유의도 리드 SNP(P <1.0 × 10-
4)를 선택하였다. 상기 5 개의 SNP 중 2 개의 SNP(rs1456315 및 rs266849)는 단계 II 샘플에서 분석이 안되었기 때문에, 높은 LD (r> 0.9) 및 유의한 신호(p <10E-05)를 갖는 인접 SNP (rs1016343 및 rs2735839)로 대체하였다.
3 개의 SNP는 8q21-24에 위치하고, 하나는 17q12에, 하나는 19q13.33에 위치한다. 다섯 개는 모두 GWA 연구에서 이전에 확인된 유전자에 또는 그 근처에 존재한다; 예를 들어, NK3-1, PRNCR1, CASC8/11, HNF1B 및 KLK3 (표 5).
표 5에 전립선암과 엑솜-와이드 연관 결과를 도시하며, 각 SNP에 대하여 게놈-와이드 유의도의 종래 연구 결과를 나타낸다. 5 가지 염기서열에 대해(8p21.2의 rs1512268, 8q24.21의 rs1016343과 rs7837688, 17q12의 rs7501939 및 19q13.33의 rs2735839) 최종적으로 엑솜-와이드 유의성을 확인했다 (p <8.3×10-7 ).
| SNP | Gene | Chromo-somal region | Korean Study (Stage I) | Previously reported results | ||||||
| (reference/risk allele, forward) | Risk allele frequency | OR(95%CI) | p-value | Genetic context | population | OR(95%CI) | p-value | |||
| case | control | |||||||||
| rs1512268 (C/T) | NKX3-1 | 8p21.2 | 0.376 | 0.306 | 1.37 (1.23-1.53) | 1.90E-08 | Intergenic | UK and Australia [14] | 1.18 (1.14-1.22) | 2.5x10-23 |
| Japanese [15] | 1.34 | 4.3x10-11 | ||||||||
| Latinos [16] | 1.21 (1.07-1.37) | 2.8x10-3 | ||||||||
| rs1016343 (C/T) | PRNCR1 | 8q24.21 | 0.408 | 0.306 | 1.58 (1.42-1.77) | 2.42E-16 | Exonic | UK and Australia [17] | 1.37 | 1x10-7 |
| European [18] | 1.31 (1.20-1.42) | 4x10-10 | ||||||||
| rs7837688 (G/T) | CASC8 - CASC11 | 8q24.21 | 0.213 | 0.136 | 1.73 (1.51-1.98) | 2.85E-15 | Intergenic | Japanese [15] | NA | 1x10-25 |
| UK and Australia [17] | 1.41 | 9x10-12 | ||||||||
| rs7501939* (T/C) | HNF1B | 17q12 | 0.779 | 0.714 | 1.41 (1.25-1.61) | 2.78E-08 | Intronic | Japanese [15] | NA | 1x10-12 |
| European [18] | 1.19 (1.11-1.28) | 2x10-6 | ||||||||
| rs2735839* (A/G) | KLK3 | 19q13.33 | 0.677 | 0.605 | 1.31 (1.19-1.47) | 6.35E-07 | Upstream | UK and Australia [17] | 0.83 (0.75-0.91) | 1.5x10-18 |
| European [18] | 1.20 (1.10-1.33) | 2x10-18 | ||||||||
| Multi-ethnic [19] | 1.20 (1.13-1.28) | 2x10-18 | ||||||||
*risk allele is the major allele
4-2. 위험도 예측을 위한 GRS
유전체 위험도 점수화 모델 (genetic risk score)을 상기의 방법으로 제작한 후, 상기 5개의 SNPs의 염기변형의 개수를 기준으로 (0개에서 10개- 각 SNP당 0~2점) 살펴보았을 때, GRS의 분포는 대조군에서 평균 4.23 ± 1.44, 실험예에서 4.78 ± 1.43의 정규 분포를 따랐다 (도 8).
도 9를 참고하면, 충북 대학교 병원의 2단계 표본(실험예 n = 514, 대조군 n = 548)에 대하여 GRS는 전립선암의 위험도 증가와 연관이 있었고; GRS가 4 인 그룹을 기준으로, 보다 높은 GRS 그룹은 증가를 나타냈고 보다 낮은 GRS 그룹은 전립선암 위험도 감소를 나타냈다. 6 이상의 GRS 점수는 통계적으로 유의한 전립선암 위험도를 나타냈다; GRS = 6, 7, 및 8 이상의 그룹에 대하여 각각 OR = 1.85, 95%CI [1.28, 2.69], OR 2.11, 95%CI [1.26, 3.53] 및 OR 3.34, 95%CI [1.05, 10.62]. GRS의 증가에 따른 PCa 위험도 증가 추세는 매우 강하고(p <0.0001, 추세 테스트), 가장 낮은 그룹(GRS<=)에 비해 가장 높은 GRS 그룹(GRS>=8)의 위험이 1)은 10배 이상 증가한 것으로 추정된다.
수신자 작용 곡선 함수를 사용하여 GRS의 예측 성능을 평가할 경우, 곡선 아래의 면적(AUC)은 0.605이었고 95%CI는 0.573에서 0.637 범위였다 (도 10).
(SEQ ID NO: l)
NCBI refSNP ID: rs1512268
aatgcagatt gagttaaatt tgcacyatct acagaaaggg tttgcttcac a
y is a or g
(SEQ ID NO: 2)
NCBI refSNP ID: rs1016343
caagaccatg tgttacattt ccctcycatg attactcaca gcttcacagt t
y is c or t
(SEQ ID NO: 3)
NCBI refSNP ID: rs13252298
cacttgctgt cttctcagat acaatytcag aaacttataa tccaagaaaa a
y is a or g
(SEQ ID NO: 4)
NCBI refSNP ID: rs16901979
gtgttaatga tttagcatta cttatytctg gcaaatggta tttttgagat a
y is a or c
(SEQ ID NO: 5)
NCBI refSNP ID: rs1447295
agtgccattg gggaggtatg taaaaygtgc tatggaaaaa aagcaacagg a
y is a or c
(SEQ ID NO: 6)
NCBI refSNP ID: rs7837688
catttcccac tagagtggtg catttygtac aattgggtct atgttgacac g
y is g or t
(SEQ ID NO: 7)
NCBI refSNP ID: rs4242382
attttgtccc tctagttatc ttcccycagg cccatcaaga atcaggcagt a
y is a or g
(SEQ ID NO: 8)
NCBI refSNP ID: rs4242384
agtcccatgc tagaagctgc tttacyaaca cagtcagctg ctatctccac a
y is a or c
(SEQ ID NO: 9)
NCBI refSNP ID: rs4430796
atacagagag gcagcacaga ctggayatgc tgcataaagc ttaaattggg c
y is a or g
(SEQ ID NO: 10)
NCBI refSNP ID: rs7501939
ggtgtagagg ctgaaataga tacagyattg caacataata agcaatttta t
y is c or t
(SEQ ID NO: 11)
NCBI refSNP ID: rs2735839
agggatctgg ttctgtcttg tggccyagtg gaccatgggg ctatcccaag a
y is a or g
Claims (14)
- 서열번호 1 내지 11 중 어느 하나의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된, 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드.
- 제1항에 있어서,서열번호 1의 26번째 염기는 A, 서열번호 2의 26번째 염기는 T, 서열번호 3의 26번째 염기는 G, 서열번호 4의 26번째 염기는 A, 서열번호 5의 26번째 염기는 A, 서열번호 6의 26번째 염기는 T, 서열번호 7의 26번째 염기는 A, 서열번호 8의 26번째 염기는 C, 서열번호 9의 26번째 염기는 G, 서열번호 10의 26번째 염기는 T, 또는 서열번호 11의 26번째 염기는 A인, 전립선암의 감수성 또는 예후 판단용 폴리뉴클레오티드.
- 제1항의 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 전립선암의 감수성 또는 예후 판단용 조성물.
- 제3항의 조성물을 포함하는 전립선암의 감수성 또는 예후 판단용 키트.
- 제4항에 있어서,서열번호 1 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물;서열번호 2 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물;서열번호 6 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물;서열번호 10 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물; 및서열번호 11 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열로 구성된 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프라이머, 프로브 또는 항체를 포함하는 조성물;을 포함하는, 전립선암의 감수성 또는 예후 판단용 키트.
- 제1항의 폴리뉴클레오티드, 이와 혼성화하는 폴리뉴클레오티드, 이에 의해 특이적으로 코딩되는 폴리펩티드, 이에 특이적인 항체, 또는 상기 폴리펩티드의 cDNA를 포함하는 전립선암의 감수성 또는 예후 판단용 마이크로어레이.
- 제6항에 있어서,서열번호 1 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드;서열번호 2 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드;서열번호 6 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드;서열번호 10 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드; 및서열번호 11 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)을 포함하는 10개 이상의 연속적인 염기서열 또는 이의 상보적인 염기서열로 구성된 폴리뉴클레오티드 또는 이와 혼성화하는 폴리뉴클레오티드;를 포함하는, 전립선암의 감수성 또는 예후 판단용 마이크로어레이.
- 피험자로부터 얻은 핵산 시료에 대하여, 서열번호 1 내지 11 중 하나 이상의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)를 확인하는 단계를 포함하는 전립선암의 감수성 또는 예후 판단에 유용한 정보를 제공하는 방법.
- 제8항에 있어서,상기 서열번호 1 내지 8의 SNP(각각의 NCBI refSNP ID는 rs1512268, rs1016343, rs13252298, rs16901979, rs1447295, rs7837688, rs4242382 및 rs4242384)는 사람 유전체의 8q21-24 부위에 존재하며, 서열번호 9 내지 10의 SNP(각각의 NCBI refSNP ID는 rs4430796 및 rs7501939)는 사람 유전체의 17q12 부위에 있는 HNF1B 유전자에 존재하며, 서열번호 11의 SNP(NCBI refSNP ID는 rs2735839)는 사람 유전체의 19q13 부위에 존재하는, 방법.
- 제8항에 있어서,서열번호 1의 26번째 염기의 유전자형이 “A”인 경우, 서열번호 2의 26번째 염기의 유전자형이 “T”인 경우, 서열번호 3의 26번째 염기의 유전자형이 “G”인 경우, 서열번호 4의 26번째 염기의 유전자형이 “A”인 경우, 서열번호 5의 26번째 염기의 유전자형이 “A”인 경우, 서열번호 6의 26번째 염기의 유전자형이 “T”인 경우, 서열번호 7의 26번째 염기의 유전자형이 “A”인 경우, 서열번호 8의 26번째 염기의 유전자형이 “C”인 경우, 서열번호 9의 26번째 염기의 유전자형이 “G”인 경우, 서열번호 10의 26번째 염기의 유전자형이 “T”인 경우, 또는 서열번호 11의 26번째 염기의 유전자형이 “A”인 경우에 전립선암 발병 위험도가 높다고 예측하는, 방법.
- 제8항에 있어서,상기 확인 단계는 서열번호 1, 2, 6, 10 및 11의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)를 확인하는 단계인, 방법.
- 제11항에 있어서,서열번호 1, 2, 6, 10 및 11의 염기서열의 26번째 염기에 위치하는 SNP(단일염기다형성)에 대한 유전 위험도 점수 분석을 수행하는 단계를 더 포함하는, 전립선암의 감수성 또는 예후 판단에 유용한 정보를 제공하는 방법.
- 제12항에 있어서,상기 유전 위험도 점수 분석은 상기 5개의 SNP에 대해 동형 비-위험성 대립유전자(homozygous of non-risk alleles)는 0, 이형 대립유전자(heterozygous of alleles)는 1, 동형 위험성 대립유전자(homozygous of the risk alleles)는 2를 세부 점수로 부여하며, 각 세부 점수의 총 누적점수를 기준으로 분석하는 것인, 방법.
- 제8항에 있어서,상기 피험자는 아시아인인, 방법.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20160035588 | 2016-03-24 | ||
| KR10-2016-0035588 | 2016-03-24 | ||
| KR1020170037540A KR101944927B1 (ko) | 2016-03-24 | 2017-03-24 | 전립선암과 관련된 단일염기다형성 및 이를 이용한 유전 위험도 점수의 개발 |
| KR10-2017-0037540 | 2017-03-24 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017164699A1 true WO2017164699A1 (ko) | 2017-09-28 |
Family
ID=59899588
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2017/003211 Ceased WO2017164699A1 (ko) | 2016-03-24 | 2017-03-24 | 전립선암과 관련된 단일염기다형성 및 이를 이용한 유전 위험도 점수의 개발 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017164699A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113643753A (zh) * | 2021-05-26 | 2021-11-12 | 中国医学科学院阜外医院 | 冠心病多基因遗传风险评分及联合临床风险评估应用 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100041037A1 (en) * | 2007-02-07 | 2010-02-18 | Julius Gudmundsson | Genetic variants contributing to risk of prostate cancer |
| US20100129799A1 (en) * | 2006-10-27 | 2010-05-27 | Decode Genetics Ehf. | Cancer susceptibility variants on chr8q24.21 |
| US20110020320A1 (en) * | 2009-05-08 | 2011-01-27 | Decode Genetics Ehf. | Genetic Variants Contributing to Risk of Prostate Cancer |
| KR20150110477A (ko) * | 2012-11-20 | 2015-10-02 | 파디아 에이비 | 공격적인 전립선 암의 존재 또는 부존재를 나타내는 방법 |
-
2017
- 2017-03-24 WO PCT/KR2017/003211 patent/WO2017164699A1/ko not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100129799A1 (en) * | 2006-10-27 | 2010-05-27 | Decode Genetics Ehf. | Cancer susceptibility variants on chr8q24.21 |
| US20100041037A1 (en) * | 2007-02-07 | 2010-02-18 | Julius Gudmundsson | Genetic variants contributing to risk of prostate cancer |
| US20110020320A1 (en) * | 2009-05-08 | 2011-01-27 | Decode Genetics Ehf. | Genetic Variants Contributing to Risk of Prostate Cancer |
| KR20150110477A (ko) * | 2012-11-20 | 2015-10-02 | 파디아 에이비 | 공격적인 전립선 암의 존재 또는 부존재를 나타내는 방법 |
Non-Patent Citations (1)
| Title |
|---|
| CUSSENOT ET AL.: "Effect of Genetic Variability Within 8q24 on Aggressiveness Patterns at Diagnosis and Familial Status of Prostate Cancer", CLINICAL CANCER RESEARCH, vol. 14, no. 17, 1 September 2008 (2008-09-01), pages 5635 - 5639, XP055425346 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113643753A (zh) * | 2021-05-26 | 2021-11-12 | 中国医学科学院阜外医院 | 冠心病多基因遗传风险评分及联合临床风险评估应用 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5843840B2 (ja) | 新しい癌マーカー | |
| KR101944927B1 (ko) | 전립선암과 관련된 단일염기다형성 및 이를 이용한 유전 위험도 점수의 개발 | |
| JP5624763B2 (ja) | 緑内障進行リスクの判定方法 | |
| KR102544414B1 (ko) | 간질 폐렴의 위험을 예측하는 방법 | |
| US10968486B2 (en) | Gene composition for detecting cell proliferative abnormality or grading disease degree and use thereof | |
| He et al. | Helicobacter pylori-related host gene polymorphisms associated with susceptibility of gastric carcinogenesis: a two-stage case-control study in Chinese | |
| WO2013070950A1 (en) | Identification of a dna methylation marker for blood-based detection of ovarian cancer | |
| JP4955385B2 (ja) | 結腸直腸細胞増殖障害の分析のための方法及び核酸 | |
| US20220162710A1 (en) | Composition for diagnosis or prognosis prediction of glioma, and method for providing information related thereto | |
| Kang et al. | Large BRCA1 and BRCA2 genomic rearrangements in Malaysian high risk breast-ovarian cancer families | |
| CN109266745B (zh) | 一种基于基因表达谱的肺癌标志物的筛选方法及应用 | |
| US9534256B2 (en) | Methods and compositions for correlating genetic markers with risk of aggressive prostate cancer | |
| US20150284806A1 (en) | Materials and methods for determining susceptibility or predisposition to cancer | |
| CN115873947A (zh) | 一种鼻咽癌遗传风险评估系统 | |
| WO2017164699A1 (ko) | 전립선암과 관련된 단일염기다형성 및 이를 이용한 유전 위험도 점수의 개발 | |
| US20130095477A1 (en) | Non-Invasive Method for the Early Detection of Stomach Cancer | |
| WO2019132581A1 (ko) | 유방암 및 난소암 등 암 진단용 조성물 및 이의 용도 | |
| WO2024096618A1 (ko) | 암 발생 위험도 예측 방법 | |
| KR20110034297A (ko) | 내인성 아토피 피부염 진단용 마커 및 그의 용도 | |
| EP3153591A1 (en) | Determination of the risk for colorectal cancer and the likelihood to survive | |
| KR102816628B1 (ko) | 대사증후군 특이적 후성유전 메틸화 마커 및 이의 용도 | |
| WO2011049322A2 (ko) | 유방암 진단을 위한 유방암 특이적 메틸화 마커 유전자의 메틸화 검출방법 | |
| WO2025234700A1 (ko) | 대장암 진단용 dna 메틸화 마커 및 이의 용도 | |
| Bakshi et al. | Single nucleotide polymorphism analysis in breast cancer using MassARRAY from Jammu and Kashmir, India | |
| Taylor et al. | A Simple Practical Guide to Genomic Diagnostics in a Pediatric Setting. Genes 2021, 12, 818 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17770669 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17770669 Country of ref document: EP Kind code of ref document: A1 |