WO2017164486A1 - Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법 - Google Patents
Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법 Download PDFInfo
- Publication number
- WO2017164486A1 WO2017164486A1 PCT/KR2016/014543 KR2016014543W WO2017164486A1 WO 2017164486 A1 WO2017164486 A1 WO 2017164486A1 KR 2016014543 W KR2016014543 W KR 2016014543W WO 2017164486 A1 WO2017164486 A1 WO 2017164486A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tesk1
- cancer
- yap
- inhibitor
- drug resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
Definitions
- the present invention relates to a composition for inhibiting anticancer drug resistance comprising a TESK1 inhibitor and a screening method of a TESK1 inhibitor, and more particularly, to inhibit expression of TESK1 or to inhibit phosphorylation of cofilin protein mediated by TESK1.
- An anticancer drug resistance inhibitor composition comprising the inhibitor as an active ingredient and a method for screening a TESK1 inhibitor comprising measuring the expression level of TESK1 or the amount of phosphorylated cophylline protein mediated by TESK1.
- Vemurafenib treatment a selective inhibitor of the BRAF V600 mutation, has a significant tumor reduction effect in patients with BRAF mutant melanoma and significantly improves patient survival, but despite the treatment of BRAF inhibitors, most blacks within 1-2 years It is known that drug resistance develops in patients with species and is a major obstacle to improving survival in patients with BRAF mutant cancer (Robert et al, Improved overall survival in melanoma with combined dabrafenib and trametinib. N. Engl. J. Med. 372 30-39. 2015.).
- Hippo / YAP Yes-associated protein signaling pathways are known to play an important role in organ size regulation, stem cell homeostasis, and cell differentiation, including YAP and transcriptional coactivator with PDZ-binding motif (TAZ). Proteins are known to act as coactivators of transcription factors such as TEADs, SMADs and RUNX. YAP / TAZ protein is known to induce invasion in breast cancer and melanoma (Cordenonsi et al, The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells.Cell 147: 759-772.
- YAP / TAZ activity is regulated by actin cytoskeleton (Zhao et al, Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev 26: 54-68. 2012.), recently actin As the amount of fiber increased, it was reported that YAP separates from Angiomotin and migrates into the nucleus (Mana-Capelli et al, Angiomotins link F-actin architecture to Hippo pathway signaling. Mol Biol Cell 25: 1676-1685. 2014. ).
- TESK1 protein is a serine / threonine kinase, which phosphorylates actin-related protein Cofilin, and is known to play an important role in stem cell differentiation determination and ciliogenesis (Kim et al. , Actin remodelling factors control ciliogenesis by regulating YAP / TAZ activity and vesicle trafficking.Nat Commun 6: 6781. 2015.).
- the present inventors have made efforts to develop a composition capable of inhibiting actin remodeling by TESK1 and effectively inhibiting anticancer drug resistance, and as a result, TESK1 inhibitor or TESK1-mediated cophylline phosphorylation inhibitor is contained as an active ingredient.
- TESK1 inhibitor or TESK1-mediated cophylline phosphorylation inhibitor is contained as an active ingredient.
- Another object of the present invention is to provide a method for screening a substance that inhibits anticancer drug resistance.
- the present invention provides a composition for inhibiting anticancer drug resistance comprising an inhibitor of expression of TESK1 or a phosphorylation inhibitor of cofilin mediated by TESK1 as an active ingredient.
- the present invention also comprises the steps of (a) contacting a candidate substance to a cell into which the TESK1 gene has been introduced; (b) measuring the expression level of TESK1; And (c) selecting a candidate substance that inhibits the expression level of TESK1 as a substance that inhibits anticancer drug resistance.
- the present invention also comprises the steps of (a) contacting a candidate substance to a cell into which the TESK1 gene has been introduced; (b) measuring the amount of phosphorylated cofilin protein mediated by TESK1; And (c) selecting a candidate substance for reducing the amount of phosphorylated cofilin protein as a substance for inhibiting anticancer drug resistance.
- 1A A graph showing the results of measuring survival curves of concentrations of PLX4032 in parental and resistant cell lines.
- 1D A graph quantifying the results of 1C.
- 2A A photograph of the change in shape of the resistant cell line.
- 2C is a graph quantifying the cell regions observed in 2B.
- 2D Photograph of actin fibers stained with phalloidin-Alexa Fluor594.
- 2F Fluorescence photograph of changes in actin fibers with time following treatment with PLX4032 (2 ⁇ M) in the parent cell line.
- FIG. 3 shows that PLX-4032 resistant melanoma cell line increases both localization and transcriptional activity of YAP / TAZ.
- 3A Immunofluorescence photograph showing the position of YAP / TAZ in the parent cell and resistant cell line.
- 3B is a graph quantifying the results of 3A.
- 3C Immunofluorescence photograph showing the position of YAP / TAZ with YAP / TAZ antibody after a certain time after treatment with PLX4032 (2 ⁇ M) in the parent cell line.
- 3D A graph quantifying the results of 3C.
- 3F A graph quantifying the band strength of 3E.
- 3G Results of qRT-PCR analysis of expression patterns of YAP / TAZ genes.
- 3H Luciferase activity analysis of the transcriptional activity of YAP / TAZ.
- 3I GSEA analysis of YAP singature genes.
- 4B is a graph measuring cell viability over time after knockdown using YAP / TAZ siRNA # 1.
- 4D is a graph quantifying the results of 4C.
- PLX4032 (PLX, 2 ⁇ M), Erlotinib (Erl, 2.5 ⁇ M), MK-2206 (2.5 ⁇ M) or a mixture thereof was treated with PLX4032 resistant cell line (SKMEL28), and then the cell viability was measured.
- 5A is a graph measuring the reactivity according to the concentration of PLX4032 in the parent cell line expressing wild type YAP or YAP-5SA.
- 5C Results of qRT-PCR assay in which the expression levels of YAP target genes were measured in cell lines into which wild-type YAP or YAP-5SA was introduced or none.
- FIG. 6 shows that the expression of EGFR, E2F1 and c-MYC pathway related genes is reduced in resistant cell lines by YAP / TAZ knockdown.
- 6A Van diagram showing genes with reduced expression by YAP / TAZ knockdown to a significant extent in resistant cell lines.
- 6D GSEA analysis of genes with reduced expression by YAP / TAZ knockdown.
- GSEA analysis shows that expression of YAP, E2F1, EGFR and c-MYC pathway related genes decreased after YAP / TAZ knockdown.
- Resistant cell lines were injected into unpatterned slides (control) or fibronectin coated micropattern slides and fluorescence micrographs double stained with phalloidin-AlexaFluor594 and anti-YAP / TAZ antibody.
- 7B is a graph quantifying the results of 7A.
- 7D is a graph quantifying the results of 7C.
- Cytochalasin D 200 nM
- Blebbistatin 50 ⁇ M
- Figure 8 shows the results of the inhibition of resistance of PLX4032 resistant melanoma cell line by TESK1 gene found by kinome siRNA library screening.
- 8A Schematic diagram showing the kinome siRNA library screening process for the discovery of synthetic lethal target genes in resistant cell lines.
- 8E Fluorescence micrographs after treatment of the indicated siRNA with resistant cell lines, followed by staining of YAP / TAZ and actin fibers.
- 8F is a graph quantifying the distribution of YAP / TAZ of 8E.
- 9A Van diagram of the number of genes that changed significantly in resistant cell lines as a result of expression microarray analysis.
- 10A Immunofluorescence micrograph showing distribution of YAP / TAZ in parental and resistant cell lines.
- 10B is a graph quantifying the results of 10A.
- 10C Immunofluorescence micrograph showing the location of YAP / TAZ with anti-YAP / TAZ antibody after treatment with PLX4032 (2 ⁇ M) in the parent cell line.
- 10D A graph quantifying the results of 10C.
- 11A Cell survival rate graph of knockdown of YAP / TAZ in parental and resistant cell lines followed by PLX4032 concentration-dependent reactivity.
- 11B is a graph of survival rate over time after YAP / TAZ knockdown.
- 11C is a graph quantifying the results of BrdU assay in cells treated in the same manner as in FIG. 4C.
- 11D shows cell viability in resistant cell lines treated with YAP / TAZ siRNA or control siRNA.
- 11E Western blotting results of detecting each target protein after treatment with PLX4032 or DMSO for 24 hours in each cell line.
- 11F Analysis of cell viability in resistant cell lines treated with siRNA or siRNA resistant flag-YAP-5SA retrovirus.
- 11G Western blotting result of introducing siRNA-resistant Flag-YAP5SA into HEK293T cell line and then detecting each protein.
- PLX4032 (PLX, 2 ⁇ M), Erlotinib (Erl, 2.5 ⁇ M), MK-2206 (2.5 ⁇ M) or mixtures thereof were treated with PLX4032 resistant cell lines, followed by cell viability analysis.
- each siRNA was injected, followed by analysis of cell viability in resistant cell lines.
- Figure 13 shows that the decrease in the amount of phosphorylated-cophylline protein by TESK1 knockdown and the decrease in cell viability of resistant cell lines caused by TESK knockdown by YAP-5SA is recovered.
- 13F cBioPortal oncomap that summarizes mutations in TESK1 occurring in human melanoma cancer samples from the TCGA database.
- the siRNA that inhibits the expression of TESK1 was treated to a cell line resistant to PLX4032, a type of BRAF inhibitor, and the survival rate of the cell was observed. (FIG. 8).
- the present invention relates to a composition for inhibiting anticancer drug resistance comprising an inhibitor of expression of TESK1 or an inhibitor of cofilin phosphorylation mediated by TESK1 as an active ingredient.
- the expression inhibitor of TESK1 may be any one having a property of inhibiting the expression of TESK1, but is preferably applicable to a living body, but is not limited thereto, for example, specific to TESK1.
- Antibodies or aptamers that bind to; It may be siRNA, RNAi or miRNA including shRNA that inhibits the expression of the TESK1 gene, and more preferably, an antisense having a sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 as a sense strand and comprising a complementary sequence thereto SiRNA consisting of strands.
- the phosphorylation inhibitor of cophylline mediated by TESK1 may be any one having a property of inhibiting phosphorylation of cophylline, but is preferably applicable to a living body, but is not limited thereto.
- it may be an antibody or aptamer that specifically binds to phosphorylated cophylline mediated by TESK1.
- the present invention confirmed that remodeling of actin cytoskeleton occurs in a cell line resistant to PLX4032, which is a kind of BRAF inhibitor (FIG. 2), and it was confirmed that the intranuclear position and transcriptional activity of YAP / TAZ protein was increased (FIG. 2). 3) It was confirmed that resistance to PLX4032 was induced by the activity of these YAP / TAZ (FIGS. 4 and 5). In addition, it was confirmed that such activation of YAP / TAZ is induced by actin remodeling, screening with kinome siRNA library, to find out the genes related to YAP / TAZ activation among the actin remodeling related genes, PLX4032 It was confirmed that resistance to overcoming was overcome (FIG. 8).
- the present invention is the first to reveal that resistance to BRAF inhibitors is induced by the activity of YAP / TAZ, and this activity of YAP / TAZ is induced by actin remodeling that occurs following BRAF inhibitor administration.
- the present invention provides a method for preparing a cell, comprising (a) contacting a candidate with a cell into which the TESK1 gene has been introduced; (b) measuring the expression level of TESK1; And (c) selecting a candidate substance that inhibits the expression level of TESK1 as a substance that inhibits anticancer drug resistance.
- the present invention (a) contacting the candidate substance to the cell into which the TESK1 gene has been introduced; (b) measuring the amount of phosphorylated cofilin protein mediated by TESK1; And (c) selecting a candidate substance for reducing the amount of phosphorylated cofilin protein as a substance for inhibiting anticancer drug resistance.
- the substance may be any one having a property of inhibiting expression of TESK1 or inhibiting phosphorylation of cophylline mediated by TESK1, but is preferably applicable to a living body, but is not limited thereto.
- natural compounds, synthetic compounds, DNA, RNA, peptides, enzymes, ligands, cell extracts or mammalian secretions more preferably antibodies specific for TESK1 or phosphorylated cophylline; Aptamers; RNAi or miRNA, including siRNA or shRNA.
- all of the cells may be used as long as the cells have anticancer drug resistance, and preferably may be melanoma cell lines having BRAF V600E mutation, more preferably SKEML28, WM3248, A375, Colo829, M14, M238 and It may be characterized in that it is selected from the group consisting of M288.
- the expression level of TESK1 may be characterized in that the expression level is reduced compared to the control group not treated with the candidate material, the amount of phosphorylated cophylline protein mediated by TESK1 is not treated with the candidate material It may be characterized by a decrease in the amount of protein compared to the control, preferably 10 to 100% reduction, more preferably 20 to 80% reduction most preferably 40 to 60% reduction in the expression level or protein amount It may be characterized in that, but is not limited thereto.
- the expression level of the TESK1 gene is all known methods for measuring the gene expression level is available, preferably measured by methods such as quantitative RT-PCR, luciferase analysis, expression microarray analysis, etc. But it is not limited thereto.
- the method for measuring the amount of phosphorylated cophylline protein mediated by TESK1 can be used as long as it is a known method capable of measuring the amount of phosphorylated protein, preferably immunofluorescence, micropattern Measurement, immunoblot, ELISA can be measured by a method such as, but is not limited thereto.
- composition of the present invention may be characterized by comprising a substance screened by the method of the present invention as an active ingredient.
- composition according to the invention may comprise the substance of the invention alone or may further comprise one or more pharmaceutically acceptable carriers.
- pharmaceutically effective amount refers to an amount that exhibits a higher response than the negative control, and preferably an amount sufficient to treat cancer.
- “pharmaceutically acceptable” means a non-toxic composition that, when administered to humans, does not inhibit the action of the active ingredient and usually does not cause an allergic reaction, such as gastrointestinal disorders, dizziness, or the like.
- the substance in the composition according to the present invention, can be administered in various oral and parenteral dosage forms during clinical administration, and when formulated, the fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used It can be prepared using diluents or excipients.
- Liquid preparations for oral administration include suspensions, solvents, emulsions or syrups, and include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. Can be.
- Formulations for non-oral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
- composition of the present invention may be any physiologically acceptable carrier, excipient or stabilizer (Remington: The Science and Practice of Pharmacy, l9th Edition, Alfonso, R., ed, Mack Publishing Co. (Easton, PA: 1995) ) And the material of the present invention with the desired purity can be prepared in the form of a lyophilized cake or aqueous solution for storage.
- Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphoric acid, citric acid and other organic acids; Antioxidants including ascorbic acid; Low molecular weight (less than about 10 residues) polypeptides; Proteins such as serum albumin, gelatin or immunoglobulins; Hydrophilic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, arginine or lysine; Monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; Chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; Salt-forming counterions such as sodium; And / or nonionic surfactants such as tween, pluronics or polyethylene glycol (PEG).
- buffers such as phosphoric acid, citric acid and other organic acids
- Antioxidants including ascor
- the dosage of the substance of the present invention to the human body may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient, and is generally 0.01-100 mg / kg / day, preferably 0.1-20 mg / kg / day and may be administered once or several times a day at regular intervals according to the judgment of a doctor or pharmacist.
- compositions of the invention may be by injection or infusion by known methods, for example by intravenous, intraperitoneal, intracranial, subcutaneous, intramuscular, intraocular, intraarterial, cerebrospinal fluid, or intralesional routes, or as described below.
- injection or infusion by a sustained release system.
- it can be administered systemically.
- composition of the present invention may be used alone or in combination with methods using surgery, hormonal therapy, chemotherapy and biological response modulators to inhibit anticancer drug resistance.
- the present invention relates to a method for inhibiting or treating anticancer drug resistance, comprising administering a composition for inhibiting or treating anticancer drug resistance comprising the inhibitor.
- the present invention relates to the use of a composition for inhibiting anticancer drug resistance comprising the inhibitor.
- the term "administration" means introducing a pharmaceutical composition of the present invention to a patient in any suitable manner.
- the route of administration of the composition of the present invention may be administered via various routes orally or parenterally as long as it can reach the target tissue, and specifically, oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, It may be administered in a conventional manner via transdermal, nasal, inhaled, intraocular or intradermal routes.
- the treatment method of the present invention includes administering a composition for inhibiting or treating the anticancer drug resistance of the present invention in a pharmaceutically effective amount.
- a suitable total daily dose may be determined by the practitioner within the correct medical judgment.
- the specific therapeutically effective amount for a particular patient may be based on the specific composition, including the type and severity of the reaction to be achieved, whether or not other agents are used in some cases, the age, weight, general health, sex and diet of the patient, time of administration, It is desirable to apply differently depending on the route of administration and the rate of release of the composition, the duration of treatment, and the various factors and similar factors well known in the medical arts, including drugs used with or concurrent with the specific composition. Therefore, the effective amount of the composition for preventing or treating cancer or macular degeneration suitable for the purpose of the present invention is preferably determined in consideration of the above-mentioned matters.
- the treatment methods of the present invention are applicable to any animal in which anticancer drug resistance may occur due to overexpression of TESK1 or increased amount of phosphorylated cophylline, which animals are not only humans and primates, but also cattle, pigs, sheep, horses. And domestic animals such as dogs and cats.
- PLX4032 (Vemurafenib) was purchased from Seeleckchem, Cytochalasin D (sigma-aldrich) was treated at a concentration of 200 nM or 5 ⁇ M, and blebbistatin (Enzo LIfe Science) was treated at 50 ⁇ M.
- SKMEL28 cell line was purchased from ATCC and WM3248 cell line was purchased from Coriell Insitute. 2 ⁇ M PLX4032 was treated with SKMEL28 and WM3248 strains for 2 months to build an anticancer drug resistant cell line, and the medium containing PLX4032 was changed every 3-4 days, and the resistant strain was cultured in a medium containing PLX4032 for use in the experiment. It was.
- 8xGTIIC-luciferase cDNA was determined by DR. Provided by Stefano Piccolo (University of Padua; Addgene plasmid # 34615), MSCV-c-MYC-IRES-GFP A pMSCV-puro vector cloned from John Cleveland (Moffitt Cancer Center; Addgene plasid # 18119) and cloned Flag-YAP wild type and flag-YAP-5SA cDNA was provided by KAIST. Silent mutations were induced at the target site of the YAP siRNA by the site directed mutagenesis method to construct a pMSCV-pruo flag-YAP-5SA vector resistant to siRNA.
- Retroviral constructs and two packaging plasmids (pCMV-VSV-G and pCMV-Gag-Pol) were co-transfected into HEK293T cells and the supernatants with retroviral particles were recovered after 24 hours of incubation. The supernatant was filtered through a 0.45- ⁇ m filter and then infected with melanoma cells with 4 ⁇ g / ml of polybrene.
- Cells were placed in 8-well Lab-Tek II chanber slides (Nunc) or 96-well clear bottom plates (BD Falcon), and then fixed at room temperature for 8 minutes with 4% paraformaldehyde and 0.1% Triton X-100 ( Sigma-Aldrich) was administered to enhance cell membrane permeability. Subsequently, the primary antibody was administered, incubated at room temperature for one hour, and then the bound antibody was detected by indirect immunofluorescence by reacting Alexa Fluor 488- or 594-conjugated secondary antibody (Life Technologies) at room temperature for 1 hour. .
- Actin filaments were stained using Alexa-Fluor 594 bound Phalloidin (Life Technologies). Fluorescence images were taken using a DeltaVision Spectris Imaging System (Applied Precision), and FIG. 2E shows a deconvoluted image of melanoma cells with a z-stem size of 0.3 ⁇ m using the SoftWorx volume rendering tool. It was produced using.
- Chips used in all micropattern experiments were purchased from CYTOO (http://www.cytoo.com).
- the cells to be used for the experiment are sprayed onto a coverslip (CYTOOchipsTM DC-L-FN) containing a fibronectin-coated micropattern chip (CYTOOchipsTM DC-L-FN) or an unpatterned Lab-Tek chamber slide, incubated for 30 minutes, and the cells that do not adhere to the slide Were removed via medium exchange, incubated for 3 hours, and fixed with 4% paraformaldehyde.
- Cells were incubated for 24 hours to test reactivity for the amount of PLX4032 and then treated with various concentrations of PLX4032 for 72 hours. Then, the amount of living cells was analyzed by measuring the absorbance at 450 nm 2 hours after treatment with Cell Counting Kit-8 reagent (CCK8; Dojindo).
- the cells treated with siRNA for 72 hours were treated with PLX4032 at various concentrations for 72 hours, and then the cell amount was analyzed through the same procedure as described above.
- the secondary antibody (Santa Cruz Biotechnology) bound to peroxidase was reacted at 4 ° C. for 1 hour, and the target protein was prepared using enhanced chemiluminescence Western blot detection solution (Thermo Scientific). Was detected.
- Nuclear and non-nuclear fractions of cells were prepared using NEPER nuclear and cytoplasmic extraction reagent (Thermo Scientific). However, cells were recovered by using a cell scraper instead of trypsin-EDTA, because the change in shape and mechanical stress caused by trypsin treatment may affect the change of YPA / TAZ's intracellular location.
- Primers were used for Primber-BLAST program, or known primers (Table 2). The accuracy of the primer was confirmed by melting curve analysis under agarose gel electrophoresis, and the relative gene expression was analyzed by ⁇ Ct method of CFX Manager software (Bio-Rad).
- Primer sequence information used in the experiment gene Primer name order SEQ ID NO: GAPDH GAPDH F CAACGGATTTGGTCGTATTG 9 GAPDH R GCAACAATATCCACTTTACCAGAGTTAA 10 ANKRD1 ANKRD1 F AGTAGAGGAACTGGTCACTGG 11 ANKRD1 R TGGGCTAGAAGTGTCTTCAGAT 12 c-MYC c-MYC F CTTCTCTCCGTCCTCGGATTCT 13 c-MYC R GAAGGTGATCCAGACTCTGACCTT 14 CTGF CTGF F AGGAGTGGGTGTGTGACGA 15 CTGF R CCAGGCAGTTGGCTCTAATC 16 CYR61 CYR61 F CAGGACTGTGAAGATGCGGT 17 CYR61 R GCCTGTAGAAGGGAAACGCT 18 SOX10 SOX10 F CTTTCTTGTGCTGCATACGG 19 SOX10 R AGCTCAGCAAGACGCTGG 20 MITF MITF F CCGTCTCACTGGATTGGT 21
- TargetAmp-Nano Labeling Kit EPICENTRE
- DAVID gene-enrichment and functional annotation analysis revealed that (i) severely mutated genes commonly detected in resistant SKMEL28 and WM3248 cell lines relative to ⁇ cell lines and (ii) genes severely inhibited by YAP / TAZ siRNA knockdown.
- Transcript factor motifs were enriched based on the TransFind algorithm (Kielbasa et al, 2010) in the list of severely suppressed genes.
- GSEA Subramanian et al, 2005
- analysis using the C6 MSigDB gene set database showed that (i) YAP-related signals were enriched in resistant cell lines compared to those of ⁇ cell lines, and (ii) gene sets suppressed by YAP / TAZ knockdown. What was analyzed.
- a 384-well format kinome-wide siRNA library targeting 607 human kinases was purchased from Dharmacon. Four different siRNAs were pooled for each kinase. Using a Biomek FX Laboratory Automation Workstation (Beckman Coulter), 3 ⁇ l of a 0.25 ⁇ M concentration siRNA library pool (62.5 nM per siRNA) was injected into a polystyrene flat bottom 384-well plate (Greiner), respectively, and 7 ⁇ l of Opti-MEM (Gibco). Reverse transcription was performed in each well by mixing 0.1 ⁇ l lipofectamine RNAiMAX dissolved in) (total siRNA concentration was 15 nM).
- Resistant WM3248 cell lines were injected into the assay plate at a concentration of 1,000 cells / well to a final volume of 50 ⁇ l, and PLX4032 was treated for 48 hours after transfection and further incubated for 72 hours. Cell death was measured by treating CCK8 reagent for 2 hours. Cell death of normalized target siRNA was calculated by Z score, siRNA targets with Z score less than -2 were identified as significant synthetic lethal hits, and siRNA targets with Z score above 2 were determined as growth promoting hits.
- the ImageJ software was used to quantify the position of YAP / TAZ using immunofluorescence of at least 150-200 stained cells with anti-YAP / TAZ antibody and edited using Adobe Photoshop CS6.
- the results of qRT-PCR and luciferase analysis were equalized by dividing by the mean value of the control group and the control group.
- Data was analyzed using GraphPad Prism version 6 (GraphPad Software), and statistical analysis values were considered when the P value was less than 0.05 in the two-sided unpaired Students t-test (* P ⁇ 0.05; ** P ⁇ 0.01).
- Relative survival after drug treatment or siRNA treatment was derived using a paired t-test (survival values were averaged to mean of control values).
- Array expression data was stored in the NCBI Gene Expression Omnibus (GEO) database (Accession Number GSE68599).
- YAP / TAZ transcriptional activity of YAP / TAZ in the resistant cell line was analyzed by the expression amount of the target genes (ANKRD1, CTGF and CYR61), and luciferase analysis was performed using the YAP / TAZ-reactive TEAD reporter.
- GEO Gene Expression Omnibus
- GSEA Gene Expression Omnibus
- Example 3 Confirmation of lower survival rate of PLX4032 resistant cell lines by YAP / TAZ knockdown and induction of PLX4032 resistance by sustained activated YAP
- Observation of changes in gene expression by YAP / TAZ knockdown revealed that the expression levels of EGFR, c-MYC and phospho-AKT (pAKT) decreased in resistant cell lines (FIGS. 4E, 12A and B), and EGFR Treatment with an inhibitor (Erlotinib) or an AKT inhibitor (MK-2206) with PLX4032 confirmed that cell viability could be reduced in PLX-4032 resistant cell lines (FIGS. 4F and 12C).
- GSEA was performed on the expressed microarray using MS6DB (C6 oncogenic signatures). According to YAP / TAZ knockdown, not only YAP signature genes, but also E2F1, PRC2 / EZH2, MYC and EGFR signature genes were significantly changed. It was confirmed that the inhibition (Figs. 6D to F).
- Example 5 Inhibition of YAP / TAZ based PLX4032 anticancer drug resistance by TESK1 inhibition
- siRNA target genes with Z values less than -2 were selected as resistance overcoming genes (FIG. 8B), which are actin regulatory genes (TESK1 and MYLK), cell cycle regulatory genes (BUB1, PLK1 and CDK9) and cell metabolism regulatory genes. (SAST and IHPK3).
- the screening method of a substance for inhibiting anticancer drug resistance can screen the substance capable of inhibiting anticancer drug resistance induced by YAP / TAZ activation by inhibiting actin remodeling by TESK1, and by the method of the present invention
- the composition comprising the screened substance as an active ingredient is effective in inhibiting anticancer drug resistance by inhibiting YAP / TAZ activity induced by actin remodeling.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Oncology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 TESK1 억제제 또는 TESK1에 의해 매개되는 코필린 인산화 억제제를 유효성분으로 함유하는 항암제 내성 억제용 조성물에 관한 것으로, 본 발명에 따른 항암제 내성 억제용 조성물은 항암제의 투여에 따라 발생하는 액틴 리모델링을 억제하여, 암세포가 항암제에 대해 저항성을 가지는 것을 억제하여, 항암제 내성 억제에 유용하다.
Description
본 발명은 TESK1 억제제를 포함하는 항암제 내성 억제용 조성물 및 TESK1 억제제의 스크리닝 방법에 관한 것으로, 보다 구체적으로는 TESK1의 발현을 억제하거나, TESK1에 의해 매개되는 코필린(cofilin) 단백질의 인산화를 억제하는 억제제를 유효성분으로 하는 항암제 내성 억제용 조성물 및 TESK1의 발현 수준 또는 TESK1에 의해 매개되는 인산화된 코필린 단백질의 양을 측정하는 단계를 포함하는 TESK1 억제제의 스크리닝 방법에 관한 것이다.
흑색종 (Malignant melanoma)은 피부암 중에서 가장 악성도가 높은 암이며 침습성과 전이성이 높아 4기로 진행하는 경우가 많고 예후가 불량한 암이다. 최근 암 유전자 염기서열 분석 분야에서 많은 발전이 이루어져, 다양한 종류의 암에서 MAPK (RAS-RAF-MEK-ERK) 신호전달체계의 중요한 인자인 BRAF 유전자의 돌연변이가 존재함이 밝혀졌고, BRAF 유전자 돌연변이의 대부분은 BRAF V600 부분의 돌연변이이며, 특히 흑색종 환자의 50% 이상에서 발견되었고, 5~10%의 대장암, 3%의 폐암, 80%의 갑상선암 환자도 이 돌연변이를 가지고 있음이 밝혀졌다.
BRAF V600 돌연변이에 대한 선택적 저해제인 Vemurafenib 치료는 BRAF 돌연변이 흑색종 환자에서 큰 종양 감소 효과를 가져 오며, 환자의 생존 기간을 유의하게 개선 하지만, BRAF 저해제 치료에도 불구하고, 1-2년 내에 대부분의 흑색종 환자에서 약제 내성이 발생하며, BRAF 돌연변이 암 환자의 생존 기간 개선에 큰 장애가 되고 있다는 것이 알려져 있다(Robert et al, Improved overall survival in melanoma with combined dabrafenib and trametinib. N. Engl. J. Med. 372. 30-39. 2015.).
BRAF 저해제의 항암제 내성 발생 기작으로 SOX10 발현 억제에 의한 EGFR 발현의 증가(Sun et al, Reversible and adaptive resistance to BRAF(V600E) inhibition in melanoma. Nature. 508. 118-122. 2014), NRAS 및 MEK1 돌연변이의 획득(Van Allen et al, The genetic landscape of clinical resistance to RAF inhibition in metastatic melanoma. Cancer Discov 4. 94-109. 2014), WNT5A 발현 증가(Anastas et al, WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors. J Clin Investig 124. 2877-2890. 2014.) 및 BRAF의 선택적 이어맞추기(alternative splicing) (Poulikakos et al, RAF inhibitor resistance is mediated by dimerization of aberrantly spliced BRAF(V600E). Nature. 480. 387-390. 2011.) 등이 제시되어 왔으나, 여러 임상적 실험 결과, 상기 기작으로는 설명할 수 없는 결과들이 개시되었다(Van Allen et al, The genetic landscape of clinical resistance to RAF inhibition in metastatic melanoma. Cancer Discov 4: 94-109. 2014.).
Hippo/YAP(Yes-associated protein) 신호전달 경로는 기관 크기 조절, 줄기세포 항상성 유지(homeostasis) 및 세포 분화(differenciation)에 중요한 역할을 한다고 알려져 있는데, YAP 및 TAZ(transcriptional coactivator with PDZ-binding motif) 단백질이 TEADs, SMADs 및 RUNX 등의 전사 인자들의 보조활성인자(coactivator)로 작용한다고 알려져 있다. YAP/TAZ 단백질은 유방암 및 흑색종에서 침윤을 유도한다고 알려져 있으며(Cordenonsi et al, The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell 147: 759-772. 2011.), 최근에는 YAP 단백질이 RAF 및 MEK 저해제 저항성과 관련이 있고, YAP 단백질 활성을 억제할 경우, BRAF 또는 KRAS 변이 암 세포주에서 항암제 민감도가 증가한다고 보고되었다(Lin et al, The Hippo effector YAP promotes resistance to RAF- and MEK-targeted cancer therapies. Nat Genet 47: 250-256. 2015.).
또한, YAP/TAZ 활성은 액틴 세포골격에 의해 조절된다는 것이 알려졌으며(Zhao et al, Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev 26: 54-68. 2012.), 최근에는 액틴 섬유의 합성양이 증가하면, YAP이 Angiomotin에서 분리되어 핵 내로 이동한다는 것이 보고되었다(Mana-Capelli et al, Angiomotins link F-actin architecture to Hippo pathway signaling. Mol Biol Cell 25: 1676-1685. 2014.). 따라서, 액틴 세포골격과 YAP/TAZ 활성의 관계는 조금씩 알려지고 있으나, 항암제 내성과 액틴 세포골격의 관계는 아직 알려진 바가 없고, YAP/TAZ에 의한 항암제 내성의 발생원인도 명확하게 밝혀진 바가 없다.
한편, TESK1 단백질은 세린/트레오닌 인산화 효소로서, 액틴 관련 단백질인 코필린(Cofilin)을 인산화시켜, 줄기세포 분화 결정(fate determination) 및 섬모형성(ciliogenesis)에 중요한 역할을 한다고 알려져 있다(Kim et al, Actin remodelling factors control ciliogenesis by regulating YAP/TAZ activity and vesicle trafficking. Nat Commun 6: 6781. 2015.).
이에, 본 발명자들은 TESK1에 의한 액틴 리모델링을 억제하여, 항암제 내성을 효과적으로 억제할 수 있는 조성물을 개발하기 위해, 예의 노력한 결과, TESK1 억제제 또는 TESK1에 의해 매개되는 코필린의 인산화 억제제를 유효성분으로 함유한 조성물의 경우, 액틴 리모델링에 의한 YAP/TAZ의 활성을 방지하여, 항암제 내성을 억제할 수 있다는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 액틴 리모델링을 억제하여 항암제 내성을 억제하는 조성물을 제공하는데 있다.
본 발명의 다른 목적은 항암제 내성을 억제하는 물질의 스크리닝 방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 TESK1의 발현 억제제 또는 TESK1에 의해 매개되는 코필린(cofilin)의 인산화 억제제를 유효성분으로 포함하는 항암제 내성 억제용 조성물을 제공한다.
본 발명은 또한, (a) 후보물질을 TESK1 유전자가 도입된 세포에 접촉시키는 단계; (b) TESK1의 발현 수준을 측정하는 단계; 및 (c) TESK1의 발현 수준을 억제하는 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계를 포함하는 항암제 내성을 억제하는 물질의 스크리닝 방법을 제공한다.
본 발명은 또한, (a) 후보물질을 TESK1 유전자가 도입된 세포에 접촉시키는 단계; (b) TESK1에 의해 매개되는 인산화된 cofilin 단백질의 양을 측정하는 단계; 및 (c) 인산화된 cofilin 단백질의 양을 감소시키는 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계를 포함하는 항암제 내성을 억제하는 물질의 스크리닝 방법을 제공한다.
도 1은 본 발명에서 구축한 PLX4032 저항성 흑색종 세포주의 성질을 확인한 결과이다.
1A: 모세포주 및 저항성 세포주의 PLX4032의 농도별 생존 곡선을 측정한 결과를 나타낸 그래프이다.
1B: 저항성 세포주에서 BRAF V600E(c.1799T>A) 변이를 확인한 서열분석 결과이다.
1C: BrdU incorporation을 분석한 면역형광 실험 결과이다.
1D: 1C의 결과를 정량화한 그래프이다.
1E: SOX10 및 MITF의 발현양을 모세포주와 저항성 세포주에서 측정한 qRT-PCR 결과이다.
1F: 모세포주와 저항성 세포주에서 목적 단백질을 검출한 웨스턴 블로팅 결과이다.
도2는 PLX4032 저항성 세포주가 액틴 세포골격 리모델링이 된다는 것을 확인한 결과이다.
2A: 저항성 세포주의 모양 변화를 관찰한 사진이다.
2B: 모세포주 및 저항성 세포주의 세포 윤곽(boundaries)을 관찰한 면역형광 염색 사진이다.
2C: 2B에서 관찰한 세포 영역을 정량화한 그래프이다.
2D: phalloidin-AlexaFluor594로 염색한 액틴 섬유를 관찰한 사진이다.
2E: 2D에서 염색한 세포주를 Z-축에서 관찰한 사진이다.
2F: 모세포주에 PLX4032(2μM)를 처리한 다음 시간에 따른 액틴 섬유의 변화를 관찰한 형광 사진이다.
2G: 발현 마이크로어레이 분석 결과이다.
도3은 PLX-4032 저항성 흑색종 세포주가 YAP/TAZ의 핵 내 분포(localization) 및 전사활성이 모두 증가한다는 것을 확인한 결과이다.
3A: 모세포주 및 저항성 세포주에서 YAP/TAZ의 위치를 항체로 나타낸 면역형광 사진이다.
3B: 3A의 결과를 정량화한 그래프이다.
3C: 모세포주에 PLX4032(2μM)를 처리한 다음, 정해진 시간이 지난후, YAP/TAZ 항체로 YAP/TAZ의 위치를 관찰한 면역형광 사진이다.
3D: 3C의 결과를 정량화한 그래프이다.
3E: 세포핵과 세포질로 분리한 다음, 각 목적 단백질의 웨스턴 블로팅 결과이다.
3F: 3E의 밴드 세기를 정량화한 그래프이다.
3G: YAP/TAZ 유전자의 타겟 유전자들의 발현 양상을 분석한 qRT-PCR 분석 결과이다.
3H: YAP/TAZ의 전사활성을 분석한 루시퍼레이즈 활성분석 결과이다.
3I: YAP singature 유전자들의 GSEA 분석 결과이다.
도 4는 YAP/TAZ 녹다운에 의한 PLX4032 내성 흑색종 세포주의 성장 억제 효과를 확인한 결과이다.
4A: YAP/TAZ 녹다운 이후, 모세포주 및 저항성 세포주에서 PLX4032의 농도에 따른 생존률을 측정한 그래프이다.
4B: YAP/TAZ siRNA #1을 이용한 녹다운 이후, 시간에 따른 세포 생장률(cell viability)을 측정한 그래프이다.
4C: BruU-incorporation 결과를 분석한 면역형광 사진이다.
4D: 4C의 결과를 정량화한 그래프이다.
4E: siRNA를 처리한 이후, 각 목적 단백질을 검출한 웨스턴 블로팅 결과이다.
4F: PLX4032(PLX, 2μM), Erlotinib(Erl, 2.5μM), MK-2206(2.5μM) 또는 이들의 혼합물을 PLX4032 저항성 세포주(SKMEL28)에 처리한 다음, 세포 생존률을 측정한 결과이다.
4G: 저항성 세포주(SKMEL28)에 각 siRNA를 처리한 다음, CCK8 assay를 통해 세포 생존률을 측정한 결과이다.
도 5는 YAP-5SA에 의해 모 흑색종 세포주에서 PLX4032 저항성이 유도되는 것을 확인한 결과이다.
5A: 야생형 YAP 또는 YAP-5SA를 발현하는 모세포주에서 PLX4032의 농도에 따른 반응성을 측정한 그래프이다.
5B: 야생형 YAP 또는 YAP-5SA를 발현하는 모세포주에 PLX4032(2μM) 또는 DMSO를 24시간동안 처리한 다음, 각 목적 단백질을 검출한 웨스턴 블로팅 결과이다.
5C: 야생형 YAP 또는 YAP-5SA가 도입되거나, 아무것도 도입하지 않은 세포주에서 YAP 타겟 유전자들의 발현양을 측정한 qRT-PCR 분석 결과이다.
도 6은 YAP/TAZ 녹다운에 의해, EGFR, E2F1 및 c-MYC pathway 관련 유전자들의 발현이 저항성 세포주에서 감소하는 것을 확인한 결과이다.
6A: 저항성 세포주에서 YAP/TAZ 녹다운에 의해 의미있는 정도로 발현이 감소한 유전자들을 나타낸 밴 다이어그램이다.
6B: YAP/TAZ 녹다운에 의해 발현이 감소한 유전자들의 유전자 ontology 분석 결과이다.
6C: YAP/TAZ 녹다운에 의해 발현이 감소한 유전자들의 프로모터 지역에서 의미있게 존재하는 전사 모티프를 분석한 결과이다.
6D: YAP/TAZ 녹다운에 의해 발현이 감소한 유전자들의 GSEA 분석 결과이다.
6E: YAP/TAZ 녹다운 이후, YAP, E2F1, EGFR 및 c-MYC pathway 관련 유전자들의 발현이 감소한 것을 나타내는 GSEA 분석 결과이다.
6F: E2F1, EGFR 및 c-MYC pathway 관련 GSEA 분석에서 10개씩 가장 많이 발현 양상이 변화한 유전자들을 나타낸 heatmap 이다.
도 7은 PLX4032 저항성 세포주에서 YAP 활성화가 액틴 스트레스 섬유의 형성 및 액토마이오신 수축에 의해 일어나는 것을 확인한 결과이다.
7A: 저항성 세포주를 패턴이 없는 슬라이드(대조군) 또는 피브로넥틴이 코팅된 마이크로패턴 슬라이드에 주입하고 phalloidin-AlexaFluor594 및 항-YAP/TAZ 항체로 이중 염색한 형광 현미경 사진이다.
7B: 7A의 결과를 정량화한 그래프이다.
7C: 각각의 약제를 저항성 세포주에 처리한 다음 YAP/TAZ 및 액틴 섬유를 염색한 형광 현미경 사진이다.
7D: 7C의 결과를 정량화한 그래프이다.
7E: PLX4032(2μM), Cytochalasin D(200nM), Blebbistatin(50μM) 또는 이들의 조합을 저항성 세포주에 처리한 다음, 세포 생존률을 측정한 결과이다.
7F: Cytochalasin D(200nM) 또는 Blebbistatin(50μM)을 저항성 세포주에 처리한 다음, YAP 타겟 유전자들의 발현을 분석한 qRT-PCR 결과이다.
7G: PLX4032(2μM), Cytochalasin D(200nM), Blebbistatin(50μM) 또는 이들의 조합을 YAP5SA 또는 아무것도 도입하지 않은 저항성 세포주에 처리한 다음, 세포 생존률을 측정한 결과이다.
도 8은 kinome siRNA 라이브러리 스크리닝으로 찾은 TESK1 유전자에 의한 PLX4032 저항성 흑색종 세포주의 저항성 억제를 확인한 결과이다.
8A: 저항성 세포주에서 합성치사(synthetic lethal) 타겟 유전자를 발굴하기 위한 kinome siRNA 라이브러리 스크리닝 과정을 간략히 나타낸 모식도이다.
8B: siRNA 처리후, 평준화 한 세포 생존률을 나타낸 Z 점수 그래프로서, Z 점수가 -2 미만인 siRNA 타겟 유전자들이 합성치사 타겟이다.
8C: TESK1 siRNA 도입 후, 저항성 세포주에서 TESK1 mRNA가 녹다운 된 것을 확인한 qRT-PCR 분석 결과이다.
8D: 표시된 siRNA로 처리한 다음 세포 생존률을 분석한 결과이다.
8E: 표시된 siRNA를 저항성 세포주에 처리한 다음, YAP/TAZ 및 액틴 섬유를 염색한 형광 현미경 사진이다.
8F: 8E의 YAP/TAZ의 분포를 정량화한 그래프이다.
8G: YAP/TAZ 타겟 유전자(ANKRD1, CTGF 및 CYR61) 및 TESK1의 발현양을 분석한 qRT-PCR 결과이다.
도 9는 모세포주와 저항성 세포주의 발현 양상을 비교하여, 액틴 세포골격 조절과 관련된 유전자들의 발현 양상이 변화한 것을 확인한 결과이다.
9A: 발현 마이크로어레이 분석 결과, 저항성 세포주에서 의미있게 변화한 유전자들의 개수를 측정한 밴 다이어그램이다.
9B: 유전자 ontology 분석 결과이다.
도 10은 저항성 세포주에서 YAP/TAZ의 핵 내 분포 및 YAP signature 유전자들의 발현 모두 증가한다는 것을 확인한 결과이다.
10A: 모세포주 및 저항성 세포주에서 YAP/TAZ의 분포를 나타내는 면역형광 현미경 사진이다.
10B: 10A의 결과를 정량화한 그래프이다.
10C: 모세포주에 PLX4032(2μM)를 처리한 다음, 정해진 시간이 지난 후에 항-YAP/TAZ 항체로 YAP/TAZ의 위치를 검출한 면역형광 현미경 사진이다.
10D: 10C의 결과를 정량화한 그래프이다.
10E: 기존의 공지된 발현 데이터셋(GSE55583, GSE44753 및 GSE35230)에서 모세포주 및 BRAF 저해제 내성 흑색종 세포주의 YAP/TAZ 타겟 유전자(ANKRD1, CTGF 및 CYR61)의 발현 양상을 비교한 것이다.
10F: GSEA 분석을 통해 발현이 증가된 YAP sinature 유전자들을 나타낸 heatmap 이다.
도 11은 YAP/TAZ 녹다운 확인 및 모세포주와 저항성 세포주에 YAP/TAZ 녹다운에 의한 민감성을 측정한 결과이다.
11A: 모세포주 및 저항성 세포주에서 YAP/TAZ를 녹다운 한 다음, PLX4032의 농도별 반응성을 측정한 세포생존률 그래프이다.
11B: YAP/TAZ 녹다운 이후, 시간에 따른 새포 생존률을 측정한 그래프이다.
11C: 도 4C와 같은 방식으로 처리한 세포에서 BrdU assay의 결과를 정량화한 그래프이다.
11D: YAP/TAZ siRNA 또는 대조군 siRNA로 처리한 저항성 세포주에서 세포 생존률을 분석한 결과이다.
11E: 각 세포주에 PLX4032 또는 DMSO를 24시간 처리한 다음, 각 목적 단백질을 검출한 웨스턴 블로팅 결과이다.
11F: siRNA 또는 siRNA 저항성인 flag-YAP-5SA 레트로바이러스를 처리한 저항성 세포주에서 세포 생존율을 분석한 결과이다.
11G: HEK293T 세포주에 siRNA 저항성인 Flag-YAP5SA를 도입한 다음, 각 단백질을 검출한 웨스턴 블로팅 결과이다.
도 12는 YAP/TAZ 녹다운이 저항성 세포주에서 c-MYC 발현을 억제하는 결과 및 AKT 억제가 저항성 세포주의 생존률을 억제하는 것을 확인한 결과이다.
12A: 저항성 세포주에서 c-MYC의 발현양상을 측정한 면역형광 현미경 사진이다.
12B: 저항성 세포주에서 YAP/TAZ 타겟 유전자 및 c-MYC의 발현을 분석한 qRT-PCR 결과이다.
12C: PLX4032(PLX, 2μM), Erlotinib(Erl, 2.5μM), MK-2206(2.5μM) 또는 이들의 혼합물을 PLX4032 저항성 세포주에 처리한 다음, 세포 생존률을 분석한 결과이다.
12D: 각각의 siRNA를 처리한 다음, c-MYC 단백질을 검출한 웨스턴 블로팅 결과이다.
12E: 각각의 siRNA를 5일간 처리한 다음, 저항성 WM3248 세포주의 생존률을 분석한 결과이다.
12F: MSCV-mock 또는 MSCV-c-MYC를 주입한 다음 48시간이 지난후, c-MYC단백질을 검출한 웨스턴 블로팅 결과이다.
12G: 각각의 레트로바이러스로 감염시킨 후, 각각의 siRNA를 주입한 다음, 저항성 세포주에서 세포 생존률을 분석한 결과이다.
도 13은 TESK1 녹다운에 의한 인산화-코필린 단백질 양의 감소 및 YAP-5SA에 의해 TESK 녹다운으로 발생한 저항성 세포주의 세포 생존률 감소가 회복되는 것을 확인한 결과이다.
13A: 컨트롤 siRNA 또는 TESK1 siRNA를 60시간 동안 처리한 다음, 저항성 세포주에서 목적 단백질을 검출한 웨스턴 블로팅 결과이다.
13B: 항-코필린 및 항-인산화-코필린 항체를 이용하여 siRNA를 처리한 저항성 세포주에서 목적 단백질을 검출한 웨스턴 블로팅 결과이다.
13C: mock 또는 YAP-5SA 레트로바이러스로 감염시킨 다음, 각각의 siRNA를 처리한 저항성 세포주의 세포 생존률을 분석한 결과이다.
13D: 모세포주와 저항성 세포주에서 TESK1의 발현량을 분석한 qRT-PCR 결과이다.
13E: 모세포주와 저항성 세포주에 DMSO 또는 PLX4032(2μM)을 처리한 다음, 목적 단백질을 검출한 웨스턴 블로팅 결과이다.
13F: TCGA 데이터베이스에서 인간 흑색종 암 샘플에서 발생하는 TESK1의 변이를 정리한 cBioPortal oncomap이다.
발명의 상세한 설명 및 바람직한
구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명에서는 TESK1 억제제의 항암제 내성 억제 효과를 확인하고자 하였다.
본 발명에서는, TESK1의 발현을 억제하거나, TESK1에 의해 매개되는 코필린(cofilin) 단백질의 인산화를 억제할 경우, 항암제 내성이 억제되어 항암제에 대한 민감도가 증가하고, 항암제 저항성 세포주의 생존률이 감소하는 것을 확인하였다.
즉, 본 발명의 일 실시예에서는 TESK1의 발현을 억제하는 siRNA를 BRAF 저해제의 일종인 PLX4032에 대해 저항성을 가지는 세포주에 처리하고, 세포의 생존률을 관찰한 결과, 저항성 세포주의 생존률이 감소하는 것을 확인하였다(도 8).
따라서, 본 발명은 일 관점에서, TESK1의 발현 억제제 또는 TESK1에 의해 매개되는 코필린(cofilin)의 인산화 억제제를 유효성분으로 포함하는 항암제 내성 억제용 조성물에 관한 것이다.
본 발명에 있어서, 상기 TESK1의 발현 억제제는 TESK1의 발현을 억제하는 특성을 가지는 것은 어떠한 것도 가능하나, 바람직하게는 생체에 적용이 가능한 것으로, 이에 한정되지 아니하나, 예를 들어, TESK1에 특이적으로 결합하는 항체 또는 압타머; TESK1 유전자의 발현을 억제하는 siRNA, shRNA를 포함하는 RNAi 또는 miRNA 일 수 있고, 더욱 바람직하게는 서열번호 1 또는 서열번호 2로 표시되는 서열을 센스가닥으로 가지고, 이에 대한 상보적 서열을 포함하는 안티센스 가닥으로 이루어진 siRNA 일 수 있다.
본 발명에 있어서, 상기 TESK1에 의해 매개되는 코필린의 인산화 억제제는 코필린의 인산화를 억제하는 특성을 가지는 것은 어떠한 것도 가능하나, 바람직하게는 생체에 적용이 가능한 것으로, 이에 한정되지 아니하나, 예를 들어 TESK1에 의해 매개되는 인산화된 코필린에 특이적으로 결합하는 항체 또는 압타머 일 수 있다.
본 발명은 BRAF 저해제의 일종인 PLX4032에 대해 내성을 가지는 세포주에서 액틴 세포골격의 리모델링이 발생하는 것을 확인하였고(도 2), YAP/TAZ 단백질의 핵내 위치 및 전사 활성이 증가하는 것을 확인하였으며(도 3), 이러한 YAP/TAZ의 활성에 의해 PLX4032에 대한 내성이 유도되는 것을 확인하였다(도 4 및 도 5). 또한, 이러한 YAP/TAZ의 활성화가 액틴 리모델링에 의해 유도된다는 것을 확인하였으며, kinome siRNA 라이브러리로 스크리닝하여, 액틴 리모델링 관련 유전자 중, YAP/TAZ 활성화와 관련된 유전자를 발굴하여, 이를 억제할 경우, PLX4032에 대한 내성이 극복되는 것을 확인하였다(도 8).
즉, 본 발명은 BRAF 저해제에 대한 내성이 YAP/TAZ의 활성에 의해 유도되고, 이러한 YAP/TAZ의 활성은 BRAF 저해제 투여에 따라 발생하는 액틴 리모델링에 의해 유도된다는 것을 최초로 밝힌 것이다.
따라서, 본 발명은 다른 관점에서, (a) 후보물질을 TESK1 유전자가 도입된 세포에 접촉시키는 단계; (b) TESK1의 발현 수준을 측정하는 단계; 및 (c) TESK1의 발현 수준을 억제하는 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계를 포함하는 항암제 내성을 억제하는 물질의 스크리닝 방법에 관한 것이다.
본 발명은 또다른 관점에서, (a) 후보물질을 TESK1 유전자가 도입된 세포에 접촉시키는 단계; (b) TESK1에 의해 매개되는 인산화된 cofilin 단백질의 양을 측정하는 단계; 및 (c) 인산화된 cofilin 단백질의 양을 감소시키는 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계를 포함하는 항암제 내성을 억제하는 물질의 스크리닝 방법에 관한 것이다.
본 발명에 있어서, 상기 물질은 TESK1의 발현을 억제하거나, TESK1에 의해 매개되는 코필린의 인산화를 억제하는 특성을 가지는 어떠한 것도 가능하나, 바람직하게는 생체에 적용이 가능한 것으로, 이에 한정되지 아니하나, 예를 들어 천연 화합물, 합성 화합물, DNA, RNA, 펩티드, 효소, 리간드, 세포 추출물 또는 포유동물의 분비물 일 수 있고, 더욱 바람직하게는 TESK1 또는 인산화된 코필린에 특이적인 항체; 압타머; siRNA 또는 shRNA를 포함하는 RNAi 또는 miRNA 일 수 있다.
본 발명에 있어서, 상기 세포는 항암제 내성을 가지는 세포이면 모두 이용가능하나, 바람직하게는 BRAF V600E 변이를 가지는 흑색종 세포주일 수 있고, 더욱 바람직하게는 SKEML28, WM3248, A375, Colo829, M14, M238 및 M288로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 TESK1의 발현 수준은 후보 물질을 처리하지 않은 대조군에 비하여 발현 수준이 감소하는 것을 특징으로 할 수 있고, TESK1에 의해 매개되는 인산화된 코필린 단백질의 양은 후보 물질을 처리하지 않은 대조군에 비하여 단백질의 양이 감소하는 것을 특징으로 할 수 있으며, 바람직하게는 10 내지 100% 감소, 더욱 바람직하게는 20 내지 80% 감소 가장 바람직하게는 40 내지 60%의 발현 수준 또는 단백질 양의 감소를 나타내는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, TESK1 유전자의 발현 수준은 유전자 발현 수준을 측정할 수 있는 공지된 방법은 모두 이용가능하며, 바람직하게는 정량적 RT-PCR, 루시퍼레이즈 분석, 발현 마이크로어레이 분석 등의 방법으로 측정할 수 있으나 이에 한정되는 것은 아니다.
본 발명에 있어서, TESK1에 의해 매개되는 인산화된 코필린 단백질의 양을 측정하는 방법은 인산화된 단백질의 양을 측정할 수 있는 공지된 방법이면 모두 이용가능하며, 바람직하게는 면역형광분석, 마이크로패턴 측정, 면역 블롯, ELISA 등의 방법으로 측정할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 항암제 내성은 액틴 리모델링에 의해 발생하는 것을 특징으로 할 수 있고, 상기 액틴 리모델링은 세포주에서 YAP/TAZ 단백질의 핵 내 분포 및 전사활성을 촉진시켜 항암제 내성을 유도하는 것을 특징으로 할 수 있으나 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 항암제는 암을 치료하는 효과가 있는 약물이면 제한없이 이용가능하나, 바람직하게는 BRAF 저해제(inhibitor)인 것을 특징으로 할 수 있고, 더욱 바람직하게는 PLX4032(vemurafenib), Dabrafenib (GSK2118436), RAF265, sorafenib, SB590885, PLX 4720, GDC-0879 및 ZM 336372로 구성된 군에서 선택되는 하나 이상인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 암은 고형암이면 모두 가능하나, 바람직하게는 흑색종, 갑상선암, 간암, 교세포종, 난소암, 대장암, 두경부암, 방광암, 신장세포암, 위암, 유방암, 전이암, 전립선암, 췌장암 및 폐암으로 구성된 군에서 선택되는 것을 특징으로 할 수 있고, 더욱 바람직하게는 흑색종인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 조성물은 본 발명의 방법에 의해 스크리닝 된 물질을 유효성분으로 포함하는 것을 특징으로 할 수 있다.
본 발명에 따른 조성물은 본 발명의 물질을 단독으로 포함하거나 하나 이상의 약학적으로 허용되는 담체를 추가로 포함할 수 있다. 상기에서 “약학적으로 유효한 양”이란 음성 대조군에 비해 그 이상의 반응을 나타내는 양을 말하며 바람직하게는 암을 치료하기에 충분한 양을 말한다.
상기에서 “약학적으로 허용되는” 이란 생리학적으로 허용되고 인간에게 투여될 때, 활성성분의 작용을 저해하지 않으며 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 비독성의 조성물을 말한다.
본 발명에 따른 조성물에 있어서, 상기 물질은 임상 투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화 할 경우에는 보통 사용하는 충전제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 제조될 수 있다.
경구투여를 위한 고형 제제에는 정제, 환자, 산제, 과립제, 캡슐제, 트로키제 등이 포함되며, 이러한 고형 제제는 하나 이상의 본 발명의 상기 화학식 1의 아릴 유도체, 또는 이의 약학적으로 허용가능 한 염에 적어도 하나 이상의 부형제 예를 들어, 전분, 탄산칼슘, 수크로오스 (sucrose) 또는 락토오스 (lactose) 또는 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용될 수 있다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제 또는 시럽제 등이 해당되는데, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들어 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비 경구 투여를 위한 제제에는 멸균된 수용액, 비 수성용제, 현탁용제, 유제, 동결건조제제, 좌제가 포함된다.
본 발명의 조성물은 임의의 생리학적으로 허용가능 한 담체, 부형제 또는 안정화제 (Remington: The Science and Practice of Pharmacy, l9th Edition, Alfonso, R., ed, Mack Publishing Co. (Easton, PA: 1995))와 바람직한 순도를 갖는 본 발명의 물질을 혼합하여 저장하기 위해 동결건조된 케이크 또는 수용액의 형태로 제조할 수 있다. 허용가능 한 담체, 부형제 또는 안정화제는 사용된 투여량 및 농도에서 수용자에게 비독성이고, 완충용액, 예를 들어 인산, 시트르산 및 다른 유기산; 아스코르브산을 비롯한 항산화제; 저분자량 (약 10개 미만의 잔기) 폴리펩티드; 단백질, 예를 들어 혈청 알부민, 젤라틴 또는 면역글로불린; 친수성 중합체, 예를 들어 폴리비닐피롤리돈; 아미노산, 예를 들어 글라이신, 글루타민, 아스파라긴, 아르기닌 또는 라이신; 단당류, 이당류, 및 글루코스, 만노스 또는 덱스트린을 비롯한 다른 탄수화물; 킬레이트제, 예를 들어 EDTA; 당 알콜, 예를 들어 만니톨 또는 소르비톨; 염-형성 반대이온, 예를 들어 나트륨; 및 (또는) 비이온성 계면활성제, 예를 들어 트윈, 플루로닉스 또는 폴리에틸렌 글리콜 (PEG)이 포함된다.
또한, 본 발명의 물질의 인체에 대한 투여량은 환자의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있으며, 일반적으로 0.01 - 100 mg/kg/일이며, 바람직하게는 0.1 - 20 mg/kg/일이며, 또한 의사 또는 약사의 판단에 따라 일정시간 간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다.
본 발명의 조성물의 투여 경로는 공지된 방법, 예를 들어 정맥 내, 복강 내, 뇌 내, 피하, 근육 내, 안내, 동맥 내, 뇌척수 내, 또는 병변 내 경로에 의한 주사 또는 주입, 또는 하기 기재된 서방성 (sustained release) 시스템에 의한 주사 또는 주입이다. 바람직하게는 전신으로 투여될 수 있다.
본 발명의 조성물은 항암제 내성 억제를 위하여 단독으로, 또는 수술, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
본 발명은 또 다른 관점에서 상기 억제제를 포함하는 항암제 내성 억제 또는 치료용 조성물을 투여하는 것을 포함하는, 항암제 내성을 억제 또는 치료하는 방법에 관한 것이다.
본 발명은 또 다른 관점에서 상기 억제제를 포함하는 항암제 내성 억제용 조성물의 용도에 관한 것이다.
본 발명에서 용어, "투여"는 어떠한 적절한 방법으로 환자에게 본 발명의 약제학적 조성물을 도입하는 것을 의미한다. 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있으며, 구체적으로, 구강, 직장, 국소, 정맥내, 복강내, 근육내, 동맥내, 경피, 비측내, 흡입, 안구 내 또는 피내경로를 통해 통상적인 방식으로 투여될 수 있다.
본 발명의 치료방법은 본 발명의 항암제 내성의 억제 또는 치료용 조성물을 약학적 유효량으로 투여하는 것을 포함한다. 적합한 총 1일 사용량은 올바른 의학적 판단범위 내에서 처치의에 의해 결정될 수 있다는 것은 당업자에게 자명한 일이다. 특정 환자에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 따라서 본 발명의 목적에 적합한 암 또는 황반변성의 예방 또는 치료용 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다.
또한, 본 발명의 치료 방법은 TESK1의 과발현 또는 인산화된 코필린의 양 증가로 인하여 항암제 내성이 발생할 수 있는 임의의 동물에 적용가능하며, 동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.
[실시예]
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
<실험방법>
본 실험에 사용된 방법은 다음과 같다.
시약, 세포 배양 및 PLX4032-저항성 세포주 구축
PLX4032(Vemurafenib)은 Seeleckchem에서 구매하였고, Cytochalasin D(sigma-aldrich)는 200nM 또는 5μM의 농도로 처리하였으며, blebbistatin(Enzo LIfe Science)는 50μM 농도로 처리하였다. SKMEL28 세포주는 ATCC에서 구매하였고, WM3248 세포주는 Coriell Insitute에서 구매하였다. SKMEL28 및 WM3248 균주에 2μM의 PLX4032를 2달 동안 처리하여 항암제 내성 세포주를 구축하였으며, 3-4일 간격으로 PLX4032가 포함된 배지를 갈아주었고, 내성 균주는 PLX4032가 포함된 배지에서 배양하여 실험에 사용하였다.
플라스미드, 트랜스펙션, 레트로바이러스 감염
8xGTIIC-luciferase cDNA는 DR. Stefano Piccolo(University of Padua; Addgene plasmid #34615)로부터 제공받았고, MSCV-c-MYC-IRES-GFP는 Dr. John Cleveland(Moffitt Cancer Center; Addgene plasid #18119)로부터 제공받았으며, Flag-YAP 야생형과 flag-YAP-5SA cDNA가 클로닝되어 있는 pMSCV-puro 벡터는 임대식 박사(KAIST)로부터 제공받았다. YAP siRNA의 타겟 사이트에 사일런트 변이를 사이트 디렉티드 뮤타지네시스 방법으로 유도하여, siRNA에 저항성이 있는 pMSCV-pruo flag-YAP-5SA 벡터를 제작하였다.
| siRNA mame | Sense 서열 | Knockdown 확인 | 서열번호 |
| TESK1 si#1 | 5'-GACCCGUCCUCAAUAACAA dTdT-3' | qRT-PCR | 1 |
| TESK1 si#2 | 5'-UGAACAAGCUCCCCAGUAA dTdT-3' | qRT-PCR | 2 |
| YAP si#1 | 5'-GACAUCUUCUGGUCAGAGA dTdT-3' | WB | 3 |
| TAZ si#1 | 5'-ACGUUGACUUAGGAACUUU dTdT-3' | WB | 4 |
| YAP si#2 | 5'-CUGGUCAGAGAUACUUCUU dTdT-3' | WB | 5 |
| TAZ si#2 | 5'-AGGUACUUCCUCAAUCACA dTdT-3' | WB | 6 |
| c-MYC si#1 | 5'-AACGUUAGCUUCACCAACA dTdT-3' | WB | 7 |
| c-MYC si#2 | 5'-CGAUGUUGUUUCUGUGGAA dTdT-3' | WB | 8 |
레트로바이러스 컨스트럭트와 두 개의 패키징 플라스미드)pCMV-VSV-G 및 pCMV-Gag-Pol)을 HEK293T 세포에 co-transfection한 다음, 24시간 배양한 이후에 레트로바이러스 파티클이 있는 상등액을 회수하였다. 상기 상등액을 0.45-μm 필터에 걸른 다음, 흑색종세포에 4μg/ml의 폴리브렌(polybrene)과 함께 감염시켰다.
면역형광법, 현미경 및 이미지 분석
8-well Lab-Tek II chanber slide(Nunc) 또는 96-well clear bottom plates(BD Falcon)에 세포를 투입한 다음, 4% 파라포름알데하이드로 8분간 상온에서 고정시키고, 0.1% 트리톤 X-100(Sigma-Aldrich)를 투여하여 세포막의 투과성을 증진시켰다. 그 뒤, 일차 항체를 투여하고, 한 시간 동안 상온에서 배양한 다음, Alexa Fluor 488- 또는 594-가 결합한 이차 항체(Life Technologies)를 1시간 동안 상온에서 반응시켜 결합한 항체를 간접면역형광법으로 검출하였다.
액틴 필라멘트는 Alexa-Fluor 594가 결합된 Phalloidin(Life Technologies)를 이용하여 염색하였다. 형광 이미지는 DeltaVision Spectris Imaging System(Applied Precision)을 이용하여 촬영하였고, 도 2의 E는 0.3μm 크기의 z-stem size를 가지는 흑색종 세포의 데콘볼루션된(deconvoluted) 이미지를 SoftWorx volume rendering tool을 이용하여 제작하였다.
마이크로패턴 실험
모든 마이크로패턴 실험에 사용한 칩은 CYTOO(http://www.cytoo.com)에서 구입하여 사용하였다. 실험에 사용할 세포들을 피브로넥틴이 코팅된 1600μm2 크기의 마이크로패턴 칩을 포함하는 coverslip(CYTOOchipsTM DC-L-FN) 또는 패턴이 없는 Lab-Tek chamber 슬라이드에 뿌린 다음, 30분간 배양하고, 슬라이드에 붙지 않은 세포들을 배지 교환을 통해 제거한 뒤, 3시간 동안 배양하고, 4% 파라포름알데하이드로 고정하였다.
BrdU incorporation 분석
5,000개/well로 8-well Lab-Tek II chamber 슬라이드에 세포를 뿌린 다음, FBS가 포함된 배지에서 24시간을 배양하고, 각각 DMSO 또는 2μM의 PLX4032를 24시간 동안 처리하고, BrdU(Sigma-ALdrich)를 45분 동안 처리한 뒤, 세포를 고정하였으며, 그 다음 2N HCl을 30분간 처리하여 DNA를 denature하였고, 그 다음 항-BrdU 항체를 이용하여 세포를 염색하였다.
세포생사판별시험(cell viability assay)
PLX4032 양에 대한 반응성을 실험하기 위하여 24시간 동안 세포를 배양한 다음, 다양한 농도의 PLX4032를 72시간 동안 처리하였다. 그 다음 살아있는 세포의 양을 Cell Counting Kit-8 reagent(CCK8; Dojindo)를 처리한 후 2시간 뒤에 450nm에서 흡광도를 측정하여 분석하였다.
siRNA를 처리한 다음 PLX4032 양에 대한 반응성을 실험하기 위해서는 72시간동안 siRNA를 처리한 세포에, 다양한 농도의 PLX4032를 72시간 동안 처리한 다음, 상기와 동일한 과정을 거쳐 세포 양을 분석하였다.
면역 블롯 분석
세포들을 프로테이즈 및 포스파테이즈 저해제(Merck Millipore)가 포함된 RIPA 라이시스 버퍼를 이용하여 얼음에서 lysis 한 다음, sonication 하고, 13,000rpm, 4℃에서 10분간 원심분리하였다. 각 단백질 분획들(10-20μg)을 SDS-폴리아크릴아마이드 젤에서 전기영동한 다음, 니트로셀룰로스 멤브레인으로 트랜스퍼하여 5% skim milk를 포함한 TBST버퍼에서 30분간 블로킹하였다. 인산화된 단백질 검출을 위해서는 블로킹 버퍼를 2% BSA가 포함된 PBS를 사용하였다.
4℃에서 overnight으로 일차 항체를 반응시킨 다음, 퍼록시데이즈가 결합된 이차 항체(Santa Cruz Biotechnology)를 4℃에서 1시간 동안 반응시키고, enhanced chemiluminescence Western blot detection solution(Thermo Scientific)을 이용하여 타겟 단백질을 검출하였다.
준세포 분획 제조(Subcellular Fractionation)
NEPER nuclear and cytoplasmic extraction reagent(Thermo Scientific)을 이용하여 세포의 핵 및 비핵(non-nuclear) 분획을 제조하였다. 다만, 트립신-EDTA 대신 cell scraper를 이용하여 세포를 회수하였는데, 이는 트립신 처리로 인해 발생하는 세포의 모양 변화 및 기계적 스트레스가 YPA/TAZ의 세포 내 위치변화에 영향을 줄 수 있기 때문이다.
정량적 RT-PCR
RNeasy kit(Qiagen)을 이용하여 세포로부터 전체 RNA를 추출하였다. 1μg의 추출한 RNA를 RNasin Plus RNase 저해제(Promega)와 M-MLV 역전사효소(Promega)를 이용하여 cDNA로 제조하였다. 프라이머와 iQ SYBR Green Supermix (Bio-Rad)를 cDNA와 섞어, CFX96 system(Bio-rad)에서 실시간 qRT-PCR로 증폭하여, mRNA의 발현레벨을 분석하였다.
프라이머는 Primber-BLAST 프로그램을 이용하거나, 기존의 공지된 프라이머를 이용하였다(표 2). 프라이머의 정확도는 아가로즈 젤 전기영동 밑 멜팅 커브 분석을 통해 확인하였고, 상대적인 유전자 발현량은 CFX Manager software(Bio-Rad)의 ΔΔCt 방법으로 분석하였다.
| 유전자 | 프라이머 이름 | 서열 | 서열번호 |
| GAPDH | GAPDH F | CAACGGATTTGGTCGTATTG | 9 |
| GAPDH R | GCAACAATATCCACTTTACCAGAGTTAA | 10 | |
| ANKRD1 | ANKRD1 F | AGTAGAGGAACTGGTCACTGG | 11 |
| ANKRD1 R | TGGGCTAGAAGTGTCTTCAGAT | 12 | |
| c-MYC | c-MYC F | CTTCTCTCCGTCCTCGGATTCT | 13 |
| c-MYC R | GAAGGTGATCCAGACTCTGACCTT | 14 | |
| CTGF | CTGF F | AGGAGTGGGTGTGTGACGA | 15 |
| CTGF R | CCAGGCAGTTGGCTCTAATC | 16 | |
| CYR61 | CYR61 F | CAGGACTGTGAAGATGCGGT | 17 |
| CYR61 R | GCCTGTAGAAGGGAAACGCT | 18 | |
| SOX10 | SOX10 F | CTTTCTTGTGCTGCATACGG | 19 |
| SOX10 R | AGCTCAGCAAGACGCTGG | 20 | |
| MITF | MITF F | CCGTCTCTCACTGGATTGGT | 21 |
| MITF R | TGGGTCTGCACCTGATAGTG | 22 | |
| TESK1 | TESK1 F | AGGTCTACAAGGTTCGGCAC | 23 |
| TESK1 R | GTGCACACAGACTCCCATGA | 24 |
루시퍼레이즈 분석
5,000 세포/well의 농도로 96-well plate에 SKMEL28 및 WM3248 세포주를 뿌린 다음, 8XGTUIIC-luciferase 벡터(1μg/ml) 및 pcDNA3.1-His-lacZ(1μg/ml)을 Lipofectamine LEX 및 PLUS reagent를 이용하여 24시간 동안 코-트랜스펙션하였다. Reporter lysis 버퍼를 이용하여 세포를 회수한 다음, luciferase assy kit(Promega)를 이용하여 루시퍼레이즈의 활성을 측정하였다. 트랜스펙션 효율 측정을 위한 β-갈락토시데이즈 활성은 β-Galactosidase enzyme assay system(Promega)를 이용하여 측정하였다.
발현 마이크로어레이 분석
RNeasy kit(Qiagen)을 이용하여 세포로부터 전체 RNA를 추출하였다. Illumina Expression BeadChip에 이용하기 위하여 TargetAmp-Nano Labeling Kit(EPICENTRE)을 이용하여 바이오틴이 결합된 cRNA를 제작하였다. 750ng의 상기 cRNA를 Human HT-12 v4.0 Expression Beadchip에 17시간 동안 58℃에서 혼성화한 다음, Amersham fluorolink streptavidin-Cy3(GE Healthcare Bio-Sciences)를 이용하여 어레이 신호를 검출하였다. 어레이 스캔은 Illumina bead array reader 컨포칼 스캐너를 이용하여 수행하였다.
DAVID 유전자-enrichment 및 functional annotation 분석은 (i) 母세포주 대비 저항성 SKMEL28 및 WM3248 세포주에서 흔하게 검출되는 심각하게 변이된 유전자 및 (ii) YAP/TAZ siRNA 녹다운에 의해 심각하게 억제된 유전자를 밝혀 수행하였다. 상기 심각하게 억제된 유전자 리스트들에서 TransFind 알고리즘(Kielbasa et al, 2010)에 기반하여 전사인자 모티프를 enrich하였다. C6 MSigDB 유전자 세트 데이터베이스를 이용한 GSEA(Subramanian et al, 2005) 분석을 통해 (i) YAP 관련 신호가 母 세포주에 비해 저항성 세포주에서 enrich되어 있는지 및 (ii) YAP/TAZ 녹다운을 통해 억제된 유전자 세트가 무엇이 있는지를 분석하였다.
Kinome siRNA 라이브러리 스크리닝
607개의 인간 인산화효소(kinase)를 타겟으로 하는 384-웰 포맷의 kinome-wide siRNA 라이브러리를 Dharmacon으로부터 구입하였다. 각 인산화효소당 4개의 서로 다른 siRNA를 풀링하였다. Biomek FX Laboratory Automation Workstation (Beckman Coulter)를 이용하여 0.25μM 농도의 siRNA 라이브러리 풀(각 siRNA 당 62.5nM) 3μl를 폴리스티렌 flat bottom 384-well plate(Greiner)에 각각 주입하고, 7μl의 Opti-MEM(Gibco)에 녹아 있는 0.1μl lipofectamine RNAiMAX를 혼합하여 각 웰에서 역전사를 수행하였다(전체 siRNA 농도는 15nM 임).
저항성 WM3248 세포주를 assay plate에 1,000cells/well의 농도로 최종 부피 50μl가 되도록 주입하고, PLX4032를 트랜스펙션 이후에 48시간 동안 처리한 다음, 72시간 동안 추가로 배양하였다. CCK8 reagent를 2시간 동안 처리하여 세포 생사를 측정하였다. 노멀라이즈한 타겟 siRNA의 세포 생사를 Z 점수로 계산하였으며, Z 점수가 -2 미만인 siRNA 타겟들을 significant synthetic lethal hit으로 판별하고, Z 점수가 2 초과인 siRNA 타겟들을 growth promoting hit으로 판별하였다.
정량화 및 통계분석
ImageJ 소프트웨어를 이용하여 항-YAP/TAZ 항체에 의한 최소 150-200개의 염색된 세포의 면역형광을 이용하여 YAP/TAZ의 위치를 정량화 하였고, Adobe Photoshop CS6를 이용하여 편집하였다. qRT-PCR 및 루시퍼레이즈 분석의 결과값들은 대조군과 실험군 모두 대조군의 평균값으로 나누어 평준화하였다. GraphPad Prism version 6(GraphPad Software)를 이용하여 데이터를 분석하였고, 통계분석값은 two-sided unpaired Students t-test(*P<0.05; **P<0.01)에서 P 값이 0.05 미만일 때 고려하였다. 약물 처리 또는 siRNA 처리 후 상대적인 생존률은 paired t-test를 이용하여 도출하였다(생존률 값은 대조군 값의 평균으로 평준화시켰음).
Data Accession
어레이 발현 데이터는 NCBI Gene Expression Omnibus (GEO) 데이터베이스(Accession Number GSE68599)에 저장하였다.
실시예 1: PLX4032 처리를 통한 BRAF 변이 흑색종 세포에서의 액틴 리모델링 확인
2μM의 PLX4032를 SKMEL28 및 WM3248 세포주에 2달 동안 처리하여 BRAF V600E 변이를 가지면서 PLX4032에 저항성을 가지는 흑색종 세포주를 제작하였다. 이들 세포주에 농도별로 PLX4032를 처리하여 PLX4032에 대한 저항성을 확인한 결과, 제작한 세포주들이 PLX4032에 대한 저항성을 나타나는 것을 확인하였고(도 1A), 서열분석을 통해 상기 세포주들이 BRAF V600E 돌연변이를 가지는 것을 확인하였으며(도 1B), 母세포주에 비하여, 제작한 세포주들이 PLX4032를 처리하더라도, 세포분열의 억제가 이루어지지 않는 것을 확인하였고(도 1C 및 D), 기존에 PLX4032 저항성 세포주에서 알려진 바와 같이 SOX10 및 MITF 유전자의 발명이 억제되고, EGFR의 발현 및 인산화-ERK의 발현이 증가하는 것을 확인하여, 제작한 세포주가 PLX4032에 저항성을 가지는 세포주인 것을 확인할 수 있었다(도 1E 및 F).
또한, 저항성 SKMEL28 및 WM3248 세포주의 모양을 관찰한 결과, 저항성을 가짐에 따라 그 모양이 변하는 것을 확인하였고(도 2A), 세포 boundary 및 세포 면적을 측정한 결과, 저항성을 가짐에 따라, 세포 boundary 및 면적이 증가하는 것을 확인하였다(도 2B 및 C). 그리고 PLX4032에 대한 저항성을 가지게 됨에 따라, 세포주에서 액틴 스트레스 섬유(stress fiber)의 형성이 증가하는 것을 확인하였으며(도 2D), 저항성 세포주는 apical 액틴 양이 줄고, 정상 세포주에 비해 훨신 평평한 형태를 가진다는 것을 확인하였다(도 2E). PLX4032를 처리한 다음 액틴의 리모델링을 시간에 따라 관찰한 결과, PLX4032 처리 후, 12시간 또는 24시간 후에는 변화가 관찰되지 않았지만, 지속적인 처리 후 7일 째 되는 날에 액틴 스트레스 섬유의 합성이 증가하는 것을 관찰할 수 있었다(도 2F).
저항성 세포주에 액틴 리모델링이 유전자 발현 패턴의 변화를 포함하는 지를 확인하기 위하여, SKMEL28 및 WM3248 세포주에서 발현 마이크로어레이 분석을 수행한 결과, 저항성 세포주에서 829개의 유전자 발현이 변화된 것을 확인하였고(도 9A), 유전자 ontology 분석을 수행한 결과, 다양한 종류의 액틴 관련 기능을 가진 유전자들이 저항성 세포주에서 변이한 것을 확인할 수 있었다(도 9B). 예를 들어, 액틴 조절과 관계된 CORO2B, TPM2 및 ZYX 유전자들의 발현은 향상된 데 비해, ARPC1B, FMN2 및 SVIL 유전자의 발현은 억제된 것을 확인하였다(도 2G)
실시예 2: PLX4032 저항성 세포주에서 YAP/TAZ의 위치 및 전사 활성 확인
실시예 1에서 제조한 PLX4032 저항성 SKMEL28 및 WM3248 세포주에서 YAP/TAZ와 액틴 리모델링의 연관성을 파악하기 위해, YAP/TAZ의 세포 내 위치(localization)를 母세포주 및 저항성 세포주에서 항체로 검출한 결과, 저항성 세포주에서 YAP/TAZ가 핵 내에 더 많이 위치한다는 것을 확인하였다(도 3A, B 및 도 10A, B). 뿐만 아니라, 모세포주에 PLX4032를 처리한 시간이 길어짐에 따라, 핵 내에 존재하는 YAP/TAZ의 양이 점점 증가하는 것을 확인하였고(도 3C, D 및 도 10C 및 D), 핵과 세포질을 각각 분리하여 확인한 결과, 저항성 세포주에서 핵 내 YAP/TAZ의 양이 세포질에 비하여 높다는 것을 확인하였다(도 3E 및 F).
또한, 저항성 세포주에서 YAP/TAZ의 전사활성을 타겟 유전자(ANKRD1, CTGF 및 CYR61)의 발현 양으로 분석하였고, YAP/TAZ-반응성 TEAD 리포터를 이용한 루시퍼레이즈 분석을 수행하였으며, Gene Expression Omnibus(GEO) 데이터베이스 분석 및 GSEA(gene set enrichment analysis) 분석 등을 수행한 결과, PLX-4032 저항성 SKMEL28 및 WM3248 세포주에서 YAP/TAZ의 전사활성이 증가하는 것을 확인하였다(도 3G, H, I 및 도 10E, F).
실시예 3: YAP/TAZ 넉다운에 의한 PLX4032 저항성 세포주의 생존률 저하 및 지속적으로 활성화된 YAP에 의한 PLX4032 저항성 유도 확인
YAP 및 TAZ를 siRNA를 이용하여 모두 넉다운시킨 결과(도 4E 및 도 11E), 저항성 세포주에서 PLX4032에 대한 민감도가 변화하는 것을 확인하였다(도 4A 및 도 11A). 또한, siRNA를 처리한 PLX4032 저항성 세포주에서 PLX4032에 의한 세포 성장 저해가 siRNA를 처리한 다음 7일째 되는 날 까지 유지되는 것을 확인할 수 있었다(도 4B 및 도 11B). 또한, BruU incorporation assay를 수행한 결과, PLX-4032 저항성 세포주에서 siRNA를 처리할 경우, 세포 분열이 방지되는 것을 확인 할 수 있었다(도 4C, D 및 도 11C). 뿐만 아니라, PLX-4032 저항성 세포주의 세포 생존률은 PLX를 처리한 상태에서, 매우 낮은 농도의 YAP/TAZ siRNA를 처리하더라도 매우 급격하게 감소하는 것을 확인하였다(도 11D). 또한, 지속적인 활성을 나타내는 YAP-5SA 변이체를 siRNA가 처리된 저항성 세포주에 도입한 결과, siRNA에 의해 나타난 항암제 내성 극복 효과가 모두 회복되는 것을 확인할 수 있었다(도 11F 및 G).
YAP/TAZ 녹다운에 의한 유전자 발현의 변화를 관찰한 결과, EGFR, c-MYC 및 phospho-AKT(pAKT)의 발현 레벨이 저항성 세포주에서 감소하는 것을 확인하였고(도 4E, 도 12A 및 B), EGFR 억제제(Erlotinib) 또는 AKT 억제제(MK-2206)을 PLX4032와 함께 처리할 경우, PLX-4032 저항성 세포주에서 세포 생존률을 낮출 수 있다는 것을 확인하였다(도 4F 및 도 12C).
YAP/TAZ가 과활성(hyperactivation) 되는 것이 BRAF 저해제 내성을 유도할 수 있는지 확인하기 위하여, YAP-5SA를 모세포주에 발현시킨 결과, PLX4032 처리에 대한 내성을 모세포주가 획득하는 것을 확인하였고(도 5A), EGFR의 발현레벨이 증가한 것을 확인하였으며, phospho-ERK 및 c-MYC의 발현양 역시 PLX4032를 처리하더라도 유지되는 것을 확인할 수 있었다(도 5B 및 C).
실시예 4: YAP/TAZ 타겟 유전자 발굴
YAP/TAZ siRNA 또는 대조군 siRNA를 처리한 PLX-4032 저항성 세포주의 유전자 발현 마이크로어레이를 분석한 결과, SKMEL28 세포주에서는 598개, WM3248 세포주에서는 545개(311개 중복)의 유전자 발현이 의미있게 저해되는 것을 확인하였다(도 6A). 유전자 온톨로지(gene ontology) 분석을 수행한 결과, 저해되는 유전자들의 기능은 세포 주기 및 세포분열(mitosis) 관련 유전자인 것으로 나타났다(도 6B). 또한, TransFind 알고르짐을 이용하여, 발현이 저해된 유전자들의 프로모터에서 가장 많은 전사 모티프를 분석한 결과, E2F 결합 모티프가 가장 많은 것으로 나타나, YAP/TAZ에 의해 나타나는 PLX4032 저항성은 E2F와 관련된 세포 주기가 핵심 메커니즘인 것을 확인할 수 있었다(도 6C).
또한, MSigDB(C6 oncogenic signatures)를 이용하여 상기 발현 마이크로 어레이에 대해 GSEA를 수행한 결과, YAP/TAZ 녹다운에 따라, YAP signature 유전자 뿐만 아니라, E2F1, PRC2/EZH2, MYC 및 EGFR signature 유전자들이 의미있게 저해되는 것을 확인하였다(도 6D 내지 F).
실시예 5: 액틴 스트레스 섬유 및 세포 골격 tension에 의한 YAP/TAZ 활성화 및 PLX4032 내성 유도
액틴 스트레스 섬유 합성 및 수축성의 증가가 PLX4032 내성 흑색종 세포주에서 YAP/TAZ 활성화를 유도하는 중요한 인자임을 확인하기 위하여, 저항성 세포주의 spreading area를 adhesive 마이크로패턴(thery, 2010)을 이용하여 억제한 결과, YAP/TAZ의 핵 내 양이 감소하는 것을 확인하였고(도 7A 및 B), 액틴 중합을 방해하는 cytochalasin D 또는 액티노마이신 수축을 방해하는 blebbistatin을 처리한 결과, YAP/TAZ의 핵 내 양이 감소하는 것을 확인하였다(도 7C 및 D).
또한, PLX4032 내성 세포주에 cytochalasin D 또는 blebbistatin을 PLX4032와 함께 처리할 경우, PLX4032를 단독으로 처리할 때와 비교하여 세포 성장을 획기적으로 억제할 수 있는 것을 확인하였고(도 7E 및 F), YAP5SA를 발현할 경우, cytochalasin D 또는 blebbistatin의 처리에 따른 세포 성장 억제효과가 회복되는 것을 확인함으로써, 액틴 모듈레이션이 PLX4032 저항성 세포주의 생존률에 중요하다는 것을 확인하였다(도 7G).
실시예 5: TESK1 억제에 의한 YAP/TAZ 기반 PLX4032 항암제 내성 억제
607개의 인간 인산화 효소를 타겟팅하는 Kinome siRNA 라이브러리를 저항성 WM3248 세포주에 주입한 다음, 2μM의 PLX4032를 처리하고 72시간 후에 세포 생존률을 측정하였다(도 8A). 그 결과, Z 값이 -2 미만인 siRNA 타겟 유전자들을 내성 극복 유전자로 선정하였는데(도 8B), 이는 액틴 조절 유전자(TESK1 및 MYLK), 세포 주기 조절 유전자(BUB1, PLK1 및 CDK9) 및 세포 대사 조절 유전자(SAST 및 IHPK3)를 포함하는 것으로 나타났다.
이 중, 액틴과 관련된 단백질인 코필린 단백질의 인산화에 관여하는 TESK1 유전자를 후보로 결정하고, TESK1의 발현을 siRNA로 억제한 결과 저항성 SKMEL28 세포주의 세포 생존률이 TESK1 siRNA를 처리할 경우, 대조군에 비해 획기적으로 떨어지는 것을 확인하였고(도 8C 및 D), TESK1의 녹다운에 의해, 액틴 스트레스 섬유의 합성 및 YAP/TAZ의 핵 내 양이 감소하는 것을 확인하였으며(도 8E 및 F), YAP/TAZ 타겟 유전자들의 발현이 감소하는 것을 확인하였고(도 8G), YAP-5SA를 처리할 경우, TESK 녹다운에 의한 세포 생존률 억제현상이 극복되는 것을 확인할 수 있었다(도 13).
또한, TESK1의 발현양 또는 인산화된 코필린 단백질의 양은 PLX-4032 저항성과는 관계없는 것을 확인하였다(도 13).
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명에 따른 항암제 내성을 억제하는 물질의 스크리닝 방법은 TESK1에 의한 액틴 리모델링을 억제하여 YAP/TAZ 활성화에 의해 유도되는 항암제 내성을 억제할 수 있는 물질을 스크리닝 할 수 있으며, 본 발명의 방법에 의해 스크리닝된 물질을 유효성분으로 포함하는 조성물은 액틴 리모델링에 의해 유도되는 YAP/TAZ 활성을 억제하여, 항암제 내성을 억제하는데 효과적이다.
서열목록 첨부하였음.
Claims (12)
- TESK1의 발현 억제제 또는 TESK1에 의해 매개되는 코필린(cofilin)의 인산화 억제제를 유효성분으로 포함하는 항암제 내성 억제용 조성물.
- 제1항에 있어서, 상기 TESK1의 발현 억제제는 TESK1에 특이적으로 결합하는 항체 또는 압타머; TESK1 유전자의 발현을 억제하는 siRNA, shRNA를 포함하는 RNAi, 또는 miRNA 인 것을 특징으로 하는 항암제 내성 억제용 조성물.
- 제1항에 있어서, 상기 TESK1에 의해 매개되는 코필린의 인산화 억제제는 인산화된 코필린에 특이적으로 결합하는 항체 또는 압타머인 것을 특징으로 하는 항암제 내성 억제용 조성물.
- 제2항에 있어서, 상기 억제제는 서열번호 1 또는 서열번호 2로 표시되는 서열을 센스가닥으로 가지고 이에 대한 상보적 서열을 포함하는 안티센스 가닥으로 이루어진 siRNA인 것을 특징으로 하는 항암제 내성 억제용 조성물.
- 제1항에 있어서, 상기 항암제 내성은 액틴 리모델링에 의해 발생하는 것을 특징으로 하는 항암제 내성 억제용 조성물.
- 제1항에 있어서, 상기 항암제는 BRAF 저해제인 것을 특징으로 하는 항암제 내성 억제용 조성물.
- 제6항에 있어서, 상기 BRAF 저해제는 PLX4032(vemurafenib), Dabrafenib (GSK2118436), RAF265, sorafenib, SB590885, PLX 4720, GDC-0879 및 ZM 336372로 구성된 군에서 선택되는 하나 이상인 것을 특징으로 하는 항암제 내성 억제용 조성물.
- 제1항에 있어서, 상기 암은 흑색종, 갑상선암, 간암, 교세포종, 난소암, 대장암, 두경부암, 방광암, 신장세포암, 위암, 유방암, 전이암, 전립선암, 췌장암 및 폐암으로 구성된 군에서 선택되는 것을 특징으로 하는 항암제 내성 억제용 조성물.
- 다음 단계를 포함하는 항암제 내성을 억제하는 물질의 스크리닝 방법:(a) 후보물질을 TESK1 유전자가 도입된 세포에 접촉시키는 단계;(b) TESK1의 발현 수준을 측정하는 단계; 및(c) TESK1의 발현 수준을 억제하는 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계.
- 다음 단계를 포함하는 항암제 내성을 억제하는 물질의 스크리닝 방법:(a) 후보물질을 TESK1 유전자가 도입된 세포에 접촉시키는 단계;(b) TESK1에 의해 매개되는 인산화된 cofilin 단백질의 양을 측정하는 단계; 및(c) 인산화된 cofilin 단백질의 양을 감소시키는 후보물질을 항암제 내성을 억제하는 물질로 선택하는 단계.
- 제9항 또는 제10항에 있어서, 상기 후보 물질은 천연 화합물, 합성 화합물, DNA, RNA, 펩티드, 효소, 리간드, 세포 추출물 또는 포유동물의 분비물인 것을 특징으로 하는 방법.
- 제9항 또는 제10항에 있어서, 상기 세포는 SKMEL28, WM3248, A375, Colo829, M14, M238 및 M288로 구성된 군에서 선택되는 것을 특징으로 하는 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020160034101A KR101921676B1 (ko) | 2016-03-22 | 2016-03-22 | Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법 |
| KR10-2016-0034101 | 2016-03-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017164486A1 true WO2017164486A1 (ko) | 2017-09-28 |
Family
ID=59900595
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/014543 Ceased WO2017164486A1 (ko) | 2016-03-22 | 2016-12-12 | Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101921676B1 (ko) |
| WO (1) | WO2017164486A1 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150130451A (ko) * | 2013-03-15 | 2015-11-23 | 제넨테크, 인크. | 암 치료 방법 및 항암제 내성 예방을 위한 방법 |
| KR20160009485A (ko) * | 2014-07-15 | 2016-01-26 | 연세대학교 산학협력단 | Glrx3 억제제를 포함하는 항암제에 대한 감수성 증진용 조성물 및 항암제 내성 진단을 위한 마커 |
-
2016
- 2016-03-22 KR KR1020160034101A patent/KR101921676B1/ko not_active Expired - Fee Related
- 2016-12-12 WO PCT/KR2016/014543 patent/WO2017164486A1/ko not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150130451A (ko) * | 2013-03-15 | 2015-11-23 | 제넨테크, 인크. | 암 치료 방법 및 항암제 내성 예방을 위한 방법 |
| KR20160009485A (ko) * | 2014-07-15 | 2016-01-26 | 연세대학교 산학협력단 | Glrx3 억제제를 포함하는 항암제에 대한 감수성 증진용 조성물 및 항암제 내성 진단을 위한 마커 |
Non-Patent Citations (3)
| Title |
|---|
| JANJI, B. ET AL.: "The Actin Filament Cross-linker L-plastin Confers Resistance to TNF-alpha in MCF-7 Breast Cancer Cells in a Phosphorylation-dependent Manner", JOURNAL OF CELLULAR AND MOLECULAR MEDICINE, vol. 14, no. 6A, 2010, pages 1264 - 1275 * |
| KIM, M. H. ET AL.: "Actin Remodeling Confers BRAF Inhibitor Resistance to Melanoma Cells through YAP/TAZ Activation", THE EMBO JOURNAL, vol. 35, no. 5, 2015, pages 462 - 478 * |
| TOSHIMA, J. ET AL.: "Cofilin Phosphorylation by Protein Kinase Testicular Protein Kinase 1 and Its Role in Integrin-mediated Actin Reorganization and Focal Adhesion Formation", MOLECULAR BIOLOGY OF THE CELL, vol. 12, 2001, pages 1131 - 1145 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11040027B2 (en) | 2017-01-17 | 2021-06-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101921676B1 (ko) | 2018-11-26 |
| KR20170109909A (ko) | 2017-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2017022962A1 (ko) | Ripk 억제제를 유효성분으로 포함하는 면역질환의 예방 또는 치료용 조성물 | |
| WO2016018088A1 (ko) | Met 저해제에 대한 감수성 예측용 신규한 바이오 마커 및 이의 용도 | |
| WO2019194586A1 (en) | Novel target for anti-cancer and immune-enhancing | |
| WO2022216096A1 (ko) | 항암 및 면역증강용 신규 타겟 | |
| WO2023140664A1 (ko) | 리포칼린 2 또는 이의 수용체의 발현 억제제를 유효성분으로 함유하는 비알코올성지방간염에 의해 유도된 간섬유화 예방 또는 치료용 약학 조성물 | |
| WO2023096126A1 (ko) | Mdsc 활성 저해 약물의 선별 방법 | |
| WO2017164486A1 (ko) | Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법 | |
| WO2010137770A1 (ko) | 신규한 gpcr 단백질 및 이의 용도 | |
| WO2018236194A1 (ko) | Gas6 단백질 또는 이의 수용체 활성화제를 포함하는 섬유증의 예방 또는 치료용 조성물 | |
| WO2024177416A1 (ko) | Egfr 표적치료제 내성암 치료용 약학 조성물 | |
| WO2017171373A2 (ko) | Egfr 표적 제제에 대한 저항성을 억제하기 위한 조성물 | |
| WO2023163497A1 (ko) | Ednra 억제제를 유효성분으로 포함하는 대장암의 예방 또는 치료용 약학적 조성물 | |
| WO2017030395A1 (ko) | 비만 치료 또는 예방용 약학 조성물 | |
| WO2023167544A1 (ko) | Fam167a를 포함하는 bcr-abl 비의존성 타이로신 키나아제 억제제 내성을 진단하기 위한 바이오마커 및 fam167a를 타겟으로 하는 만성 골수성 백혈병 예방 또는 치료용 조성물 | |
| WO2019245269A1 (ko) | Flt3 억제제를 유효성분으로 포함하는 만성 골수성 백혈병 약물 내성 억제용 조성물 | |
| WO2023172032A1 (ko) | Nmur2 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 조성물 | |
| WO2022119349A1 (ko) | Kras 억제제에 대한 내성 억제용 조성물 | |
| WO2017061828A1 (ko) | Plrg1 (pleiotropic regulator 1) 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학 조성물 | |
| WO2011090283A2 (ko) | Sh3rf2 발현 또는 활성 억제제를 함유하는 암의 예방 또는 치료용 조성물 | |
| WO2017048069A1 (ko) | 신규한 피라졸린 유도체 및 이의 용도 | |
| WO2021033973A1 (ko) | Mitf 억제제를 유효성분으로 함유하는 골수-유래 억제세포 저해용 조성물 | |
| WO2024039196A1 (ko) | 암의 진단, 전이가능성 또는 예후 예측용 바이오 마커 및 이의 용도 | |
| WO2025249993A1 (ko) | 암 질환 치료용 조성물 및 이의 스크리닝 방법 | |
| WO2024085603A1 (ko) | USP47 (Ubiquitin-specific protease 47) 발현 억제를 통한 c-Myc 관련 질병의 예방 또는 치료용 조성물 및 이의 용도 | |
| WO2025053611A1 (ko) | Pdk3 저해제를 포함하는 말초신경종양 예방 또는 치료용 약학 조성물 및 이의 용도 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16895612 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16895612 Country of ref document: EP Kind code of ref document: A1 |