WO2017147278A1 - Commutateur de classe personnalisé de gènes d'immunoglobuline dans un lymphome et un hybridome par la technologie crispr/cas9 - Google Patents

Commutateur de classe personnalisé de gènes d'immunoglobuline dans un lymphome et un hybridome par la technologie crispr/cas9 Download PDF

Info

Publication number
WO2017147278A1
WO2017147278A1 PCT/US2017/019097 US2017019097W WO2017147278A1 WO 2017147278 A1 WO2017147278 A1 WO 2017147278A1 US 2017019097 W US2017019097 W US 2017019097W WO 2017147278 A1 WO2017147278 A1 WO 2017147278A1
Authority
WO
WIPO (PCT)
Prior art keywords
grna
sequence
igh
seq
composition
Prior art date
Application number
PCT/US2017/019097
Other languages
English (en)
Inventor
Roberto Chiarle
Taek-Chin Cheong
Original Assignee
The Children's Medical Center Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Children's Medical Center Corporation filed Critical The Children's Medical Center Corporation
Priority to US15/999,476 priority Critical patent/US11530253B2/en
Publication of WO2017147278A1 publication Critical patent/WO2017147278A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
    • C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • This disclosure relates to class switch recombination (CSR) of the immunoglobulin (Ig) heavy chain genes mediated by targeted genomic editing.
  • CSR class switch recombination
  • CSR DNA double strand breaks
  • DSBs DNA double strand breaks
  • RAGl/2 recombinase activating gene 1/2
  • AICDA activation-induced cytidine deaminase
  • ADD generates DSBs in the Ig locus by targeting repetitive sequences in the switch (S) regions that precede each Ig heavy (IgH) coding sequence.
  • Paired DSBs in the switch regions are then joined by the classical and alternative non-homologous end-joining (NHEJ) pathways to generate a switch of the IgH.
  • NHEJ non-homologous end-joining
  • This long range joining is thought to be part of a general mechanism of DNA repair where two DSBs are joined in cis over long chromosome distances.
  • Efficient CSR can be obtained in absence of AID or S regions after the introduction of DSBs by site-specific I-Scel endonuclease.
  • Class switching occurs after the activation of a mature B cell via its membrane-bound antibody molecule (i.e., the cell surface B cell receptors) to generate the different classes of antibodies.
  • Ligand or antigen binding to the cell surface B cell receptor triggers an intracellular cell signaling process that brings about CSR and produces the various classes of antibodies.
  • the various classes of antibodies all have the same variable domains as the original antibody generated in the immature B cell during the process of V(D)J recombination, but possessing distinct constant domains in their heavy chains.
  • the order of arrangement of the nucleic acid sequence encoding the heavy chain segments are as follows: for human, they are ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), al (for IgAl), ⁇ 2 (for IgG2), ⁇ 4 (for IgG4), ⁇ (for IgE), and al (for IgA2); and for mouse, they are ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), y2b (for IgG2b), y2a (for IgG2a), ⁇ (for IgE), and a (for IgA).
  • Nar ' ve mature B cells produce both IgM and IgD, which are the first two heavy chain segments in the Ig locus. After activation by an antigen, these activated B cells proliferate. If these activated B cells encounter specific signaling molecules, e.g., via their CD40 and cytokine receptors, the cytokines are modulated by T helper cells, the activated B cells then undergo antibody class switching to produce IgG, IgA or IgE antibodies. Ligand or antigen binding to the cell surface B cell CD40 or cytokine receptor triggers an intracellular cell signaling process that brings about CSR. During class switching, the constant region of these activated B cells Ig heavy chain changes but the variable regions, and therefore antigenic specificity, stay the same.
  • the activated B cell undergoes CSR and produces the various heavy chain classes of Ig antibodies that have target the antigen, i.e., have the same antigenic specificity.
  • T cell cytokines that are responsible for class switching in mouse and humans are IL-4 and IL-5 produced by T helper 2 cells (Th2), IFN gamma (IFNy) produced by T helper 1 cells (Thl), and TGFbeta (TGFP) produced by T regulatory cells (Treg).
  • Th2 T helper 2 cells
  • IFNy IFN gamma
  • Thl T helper 1 cells
  • TGFP TGFbeta
  • TGFp induces the class switching to IgG2b and IgG4.
  • the cytokine IL-4 induces the class switching to IgGl
  • IL-5 induces the class switching to IgA
  • IFNy induces the class switching to IgG3
  • TGFp induces the class switching to IgA.
  • These cytokines also may have suppressive effect on production of IgM and other subclasses that are not the induced class switched.
  • CSR immunoglobulin heavy chain genes
  • IgH immunoglobulin heavy chain genes
  • the new approach allows the antibody production of any class of one's choosing as desired and on demand.
  • the new approach is based on a CRISPR/Cas9 system for targeted editing of the genome at the IgH chain locus to bring about CSR.
  • Embodiments of the present disclosure are based on this new approach.
  • the new approach is an artificial means that does not depend on the activation of B cells, or the B cell membrane-bound antibody molecule (i.e., the B cell receptor), or intracellular signaling in the B cell triggered by the ligand binding of the cell-surface B cell receptor, or the T cell derived cytokines such IL-4, IL-5, IFNgamma, and TGFbeta in order to induce CSR.
  • B cells or the B cell membrane-bound antibody molecule (i.e., the B cell receptor)
  • intracellular signaling in the B cell triggered by the ligand binding of the cell-surface B cell receptor or the T cell derived cytokines such IL-4, IL-5, IFNgamma, and TGFbeta in order to induce CSR.
  • Applications of the CRISPR/Cas9 system to edit the genome have widely expanded to include DNA gene knock-out, deletions, chromosomal rearrangements, RNA editing and genome-wide screenings.
  • the inventors showed the application of CRISPR/Cas9 system bring about CSR in the immunoglobulin (Ig) locus of the heavy chain segment (IgH).
  • the CRISPR/Cas9 technology was used to edit the mouse and human IgH genes in vivo and produced various Ig subclass antibodies by design and choice.
  • a (1) Caspase 9 (Cas9) enzyme or similar enzyme and (2) specifically engineered guide RNAs (gRNAs) via vectors such as retrovirus or lentivirus into IgM+ mouse B cells and hybridomas, the inventors were able to induce CSR of the IgH locus to produce to the IgH chain of the desired subclass.
  • the inventors induced CSR in all human B cell lines tested with high efficiency to targeted IgH subclass.
  • the inventors engineered mouse hybndomas to secrete the Fab' fragment instead of the whole Ig using this new approach.
  • the inventors showed that the IgH genes in mouse and human cells can be edited to obtain any desired IgH switching.
  • compositions, methods, and kits for inducing CSR in the IgH locus and thereby producing an antibody of a desired IgH subclass do not depend on the activation of B cells, the B cell membrane-bound antibody molecule (i.e., the B cell receptor), or the T cell derived cytokines to induce CSR.
  • compositions methods, and kits for the rapid production of Fab or Fab' or F(ab') 2 fragments from a monoclonal antibody, more specifically, from a hybridomal clonal cell.
  • the compositions and methods do not involve papain digestion.
  • the compositions and methods could transform a hybridoma that produces a whole Ig into a hybridoma producing only the Fab or Fab' or F(ab') 2 (that of course recognizes the same antigen) within one week.
  • compositions for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs.
  • the at least two gRNAs are non-identical, ie., they are distinct.
  • the at least two gRNAs are engineered single strand RNA with a guide sequence at the 5 '-end which is complementary to a target nucleic acid sequence on the IgH chain locus in the genome. This targeted approach provide the specificity.
  • composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs for use in directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass.
  • composition comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding at least two gRNAs, for use in directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass, wherein the at least two gRNAs are distinct.
  • composition comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, a second vector comprising a nucleic acids encoding a first gRNA, and a third vector comprising a nucleic acids encoding a second gRNA, for use in directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass, wherein the first and second gRNAs are distinct.
  • composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a gRNAfor use in a rapid method of production of a monoclonal antibody having a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment.
  • composition comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding a gRNAfor use in a rapid method of production of a monoclonal antibody having a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment.
  • composition comprising at least three coding nucleic acids, one nucleic acid encoding a Cas9 nuclease or nickase, a second nucleic acid encoding a first gRNA, and a third nucleic acid encoding a second gRNA, wherein the first and second gRNAs are distinct.
  • This composition is useful for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass.
  • composition comprising at least two coding nucleic acids, one nucleic acid encoding a Cas9 nuclease or nickase, and a second nucleic acid encoding a gRNA.
  • This composition is useful for rapid production of a monoclonal antibody having a desired IgH subclass from a hybridoma clonal cell or for the production of a monoclonal Fab or Fab' or F(ab') 2 fragment from a hybridoma clonal cell .
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, at least two gRNAs are non- identical, ie., they are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding at least two gRNAs, wherein the first and second gRNAs are distinct.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, a second vector comprising a nucleic acids encoding a first gRNA, and a third vector comprising a nucleic acids encoding a second gRNA, wherein the first and second gRNAs are distinct.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, at least two gRNAs are non-identical, ie., they are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising at least three coding nucleic acids, one nucleic acid encoding a Cas9 nuclease or nickase, a second nucleic acid encoding a first gRNA, and a third nucleic acid encoding a second gRNA, wherein the first and second gRNAs are distinct.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA selected from the sequences in Table 1.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • a method for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising contacting the mammalian cell with a composition described herein, for example, a composition comprising a vector or vectors described herein or a composition comprising nucleic acids described herein.
  • a method for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising contacting the mammalian cell with a vector or vectors comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs described herein, or contacting with a composition comprising the vector (s), or contacting with a composition comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs described herein, whereinat least two gRNAs are non-identical, ie., they are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • a rapid method of producing monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising providing a hybridoma clonal cell and contacting the hybridoma clonal cell with a vector or vector(s) comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a gRNA described herein, or a composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a gRNA described herein or with a composition comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA described herein, wherein the gRNA targets the papain or peps
  • a mammalian cell comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • a mammalian cell comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • composition comprising a population of mammalian cells comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • composition comprising a population of mammalian cells comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • a mammalian hybridoma clonal cell comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and an exogenous nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • a mammalian hybridoma clonal cell comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and an exogenous nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • composition comprising a population of mammalian hybridoma clonal cells comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and an exogenous nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • composition comprising a population of mammalian hybridoma clonal cells comprising comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • the vector is a polycistronic vector comprising at least three coding nucleic acid sequences, wherein one nucleic acid encoding a Cas9 nuclease or nickase, a second nucleic acid encoding a first gRNA, and a third nucleic acid encoding a second gRNA, wherein the first and second gRNAs are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • the vector described herein is a tri-cistronic vector.
  • the vector is a mono- cistronic vector consisting essentially of a coding nucleic acid, wherein the nucleic acid encodes either a Cas9 nuclease or nickase, or a gRNA, wherein the gRNA target a S region in an IgH chain locus in a mammalian cell or targets the papain or pepsin cleavage site of the Fc region on the antibody in a mammalian cell.
  • the vector is a dicistronic vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • the vector or vectors described expresses the Cas9 nuclease or nickase and the gRNA described in vivo in the mammalian cell.
  • the vector described herein is a viral vector.
  • a viral vector for example, a lentivirus, a retrovirus, an adenovirus, or an adeno-associated virus that are known in the art for transfections of nucleic acids into mammalian cells.
  • At least two gRNAs are non- identical, ie., they are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • the gRNA is an engineered single strand RNA with a guide sequence at the 5 '-end which is complementary to a targeted nucleic acid sequence on the IgH chain locus in the genome.
  • the targeted nucleic acid sequence on the IgH chain locus is an S region in the IgH chain locus in a mammalian cell.
  • the targeted nucleic acid sequence on the IgH chain locus is the papain or pepsin cleavage site of the Fc region on the antibody in a mammalian cell.
  • the gRNA comprises a gRNA guide sequence.
  • the gRNA guide sequence comprises a seed sequence.
  • the guide sequence is located at the the 5 '-end of the gRNA.
  • the seed sequence is located at the the 5 '-end of the gRNA.
  • the guide sequence is complementary to a targeted nucleic acid sequence on the IgH chain locus in the genome.
  • the seed sequence is complementary to a targeted nucleic acid sequence on the IgH chain locus in the genome.
  • the gRNA comprises a gRNA guide sequence and a Cas recognition sequence (tracrRNA). The tracrRNA is for the binding of the Cas9 nuclease or nickase which in turn is brought the targeted S region of the IgH locus by the gRNA guide sequence.
  • the gRNA consists of a gRNA guide sequence and a tracrRNA sequence.
  • the gRNA consists essentially of a gRNA guide sequence and a tracrRNA.
  • the gRNA guide sequence described herein comprises a seed region or seed sequence consisting of at least 10 consecutive nucleotides of a target sequence in a IgH gene locus present in the mammalian cell wherein the target sequence of the gRNA is contiguous to a protospacer adjacent motif (P AM) in the IgH locus.
  • P AM protospacer adjacent motif
  • the gRNA guide sequence or seed sequence described herein is from about 10 nucleotides to more than about 25 nucleotides.
  • the region of base pairing between the guide sequence and the corresponding target site sequence can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, or more than 25 nucleotides in length.
  • the guide sequence is about 17-20 nucleotides in length, such as 20 nucleotides.
  • the seed region or seed sequence of a gRNA guide sequence is selected from the sequence disclosed in Table 1, 4, and 5.
  • the gRNA guide sequence or seed sequence described herein is complementary to the guide sequence selected from the sequence disclosed in Table 1, 4, and 5, and does not contain the PAM.
  • the gRNA guide sequence or seed sequence described herein comprises the guide sequence selected from the sequence disclosed in Table 1, 4, and 5, and does not contain the PAM.
  • the gRNA guide sequence or seed sequence described herein comprises the guide sequence selected from the sequence disclosed in Table 1, 4, and 5, and contains the PAM.
  • the gRNA guide sequence or seed sequence described herein consists of the guide sequence selected from the sequence disclosed in Table 1, 4, and 5, and does not contain the PAM.
  • the gRNA guide sequence or seed sequence described herein consists of the guide sequence selected from the sequence disclosed in Table 1, 4, and 5, and contains the PAM.
  • the gRNA guide sequence or seed sequence described herein consists essentially of the guide sequence selected from the sequence disclosed in Table 1, 4, and 5, and does not contain the PAM.
  • the gRNA guide sequence or seed sequence described herein consists essentially of the guide sequence selected from the sequence disclosed in Table 1, 4, and 5, and contains the PAM.
  • the PAM is recognized by a ribonucleoprotein complex comprising a Cas9 nuclease or nickase.
  • the PAM motif that is contiguous with the gRNA guide sequence is located at the 3'-end of the gRNA.
  • the PAM motif that is contiguous with the gRNA guide sequence is located at the 3'-end of the target sequence.
  • the target sequence for the gRNA guide sequence is within a switch (S) region which is upstream from a gene segment/nucleic acid sequence that encode a subclass constant region of an antibody heavy chain in the IgH locus.
  • FIG. 5 A and 15 A are identical to FIG. 5 A and 15 A.
  • the target sequence for the gRNA guide sequence is located at the 5 '-end of the targeted S region in the IgH locus. See FIG. 1A and 2A.
  • the target sequence for the gRNA guide sequence is located at the 3 '-end of the targeted S region in the IgH locus. See FIG. 1A and 2A.
  • the at least two gRNAs guide sequences targeted different S regions in the IgH locus to bring about CSR (see FIG. 1A, 2A, 7A, 7B, 11, and 12A, and Tables 1 and 4).
  • the target sequence for the gRNA guide sequence flanks an S region of an IgH locus, either the 5 '-end or the 3-end of the S region.
  • the target sequence for the gRNA guide sequence flanks a gene segment/nucleic acid sequence that encode a constant region of an antibody heavy chain (as known as an exon constant region gene segment in the IgH locus).
  • the exon constant region gene segment in the IgH locus is selected from the group consisting of mu ( ⁇ ), delta ( ⁇ ), gamma ( ⁇ ), alpha (a), or epsilon ( ⁇ ).
  • the exon constant region gene segment in the IgH locus is selected from the group consisting of ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), al (for IgAl), ⁇ 2 (for IgG2), ⁇ 4 (for IgG4), ⁇ (for IgE), and a2 (for IgA2).
  • the exon constant region gene segment in the IgH locus is selected from the group consisting of ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), y2b (for IgG2b), y2a (for IgG2a), ⁇ (for IgE), and a (for IgA).
  • the gRNA comprises a gRNA guide sequence that comprises a seed sequence selected from Tables 1, 4 and 5.
  • the desired IgH subclass is selected from the group consisting of IgAl, IgA2, IgM, IgE, IgD, IgGl, IgG2, and IgG3 and IgG4.
  • the desired IgH subclass is selected from the group consisting of IgA, IgM, IgE, IgD, IgGl, IgG2a, IgG2b, and IgG3.
  • the mammalian cell is a B lymphocyte or a hybridoma cell.
  • the B lymphocyte is a naive or activated B lymphocyte.
  • the mammalian cell is a human, mouse, rat, donkey, monkey, pig, horse, hamster, or guinea pig cell.
  • the B lymphocyte is derived from a mouse, a rat, a human, a donkey, a monkey, a pig, a horse, a hamster, or a guinea pig.
  • the gRNAs targeting the DNA proximal to the papain cleavage site of the IgGl coding sequence are provided.
  • the gRNAs' guide sequences are GATGCAACAAGTGGCCATGT (SEQ ID NO: 1) and TGTGCTCTTCCTATGCAAAC
  • the Cas9 nuclease or nickase is a hSpCas9 nuclease, a hSaCas9 nuclease, a hSpCas9 nickase, a hSaCas9 nickase or a dCas9- Fokl nuclease.
  • the Cas9 nuclease or nickase is modified such that the protein is human-codon optimized.
  • FIGS. 1 A-1E Induction of class switch recombination (CSR) by CRISPR/Cas9 system in mouse cells
  • FIG. 1A Top: Genomic organization of the mouse IgH constant region locus and position of the gRNAs used in this study. Bottom: Schematic representation of four possible CSR products induced by deletion of DNA segments between ⁇ and Syl regions. Black arrows on the bottom schematic representation indicate the positions for the PCR primers designed to sequence the deletion sites. Gels show PCR amplicons obtained with the indicated primers.
  • FIG. IB An example chromatogram showing a perfect spliced ⁇ 5' and Syl 3' genomic junction, as well as representative sequences of spliced junctions identified from 30 clones obtained in the CRISPR/Cas9 mediated CSR. Ref. Seq. in the sequence of the predicted genomic junction between
  • FIGS. ID-IE IgM+ hybridomas were transduced with four different combinations of lentiviruses expressing Cas9 nuclease and gRNAs as above. Representative zebra plots (FIG. ID) and average percentages ⁇ SD of CSR (FIG. IE) from six independent experiments are presented.
  • FIG. 2A-2D Induction of CSR by CRISPR/Cas9 system in human B cell lines
  • FIG. 2 A Top: Genomic organization of the human IgH constant region locus and position of the gRNAs.
  • FIG. 2B Representative sequences of junctions identified from 30 clones for ⁇ 3' and
  • Syl 3' genomic region Ref. Seq. is the sequence of the predicted genomic junction between ⁇ 3' and Syl 3' region, bold sequence represent downstream sequence of the Syl 3' region, and non-bold regular sequence represent upstream sequence of the ⁇ 3' region. Dashes are the deleted bases during the CSR. Figure discloses SEQ ID NOS 408 and 408-417, respectively, in order of appearance.
  • FIG. 2C IgM+ JEKO-1 cells were transduced with lentiviruses expressing Cas9 nuclease and gRNAs targeting ⁇ and Sy3, Syl, or Sal flanking regions. Cells were collected, co-stained with antibodies against CD 19 and IgG or IgA, and analyzed by flow cytometry. Representative zebra plots from three independent experiments are presented. Percentages of events are indicated in the corresponding quadrants.
  • FIG. 2D To induce sequential CSR from IgM to IgG and then to IgA, IgM+ JEKO-1 cells were transduced with lentiviruses expressing Cas9 nuclease and gRNAs targeting ⁇ 3' and Sy3 3' flanking regions to generate IgG3+ JEKO-1 cells. IgG3+ cells were transduced again with lentiviruses expressing Cas9 nuclease and gRNAs targeting ⁇ 5' and Sal 3' flanking regions. Four days later, cells were collected, co-stained with IgM, IgG, or IgA antibodies, and analyzed by flow cytometry.
  • FIG. 3 CSR in a panel of human B cell lymphoma lines.
  • Ten different human B cell lymphoma lines (JEKO-1, GRANTA-519, UPN-1, UPN-2, MAVER-1, MINO, Z138, BL-41, BJAB, and MEC-1) were transduced with lentiviruses expressing Cas9 nuclease and gRNAs targeting and Sy3, Syl, or Sal flanking regions. Two days later, cell lines were selected with puromycin (0.2 ⁇ g/ml) for 3 days.
  • FIGS. 4A-4E Biological effects of IgH subclass switch in human lymphoma cell growth.
  • FIGS. 4A-4C To understand the growth of B cells after switch of the IgH subclass,
  • JEKO-1 cells were co-transduced with two lentiviruses expressing Cas9 nuclease and gRNAs targeting 8 ⁇ , Sy3 3' (FIG. 4A), 8 ⁇ , Syl 3' (FIG. 4B), and 8 ⁇ , Sal 3' (FIG. 4C) flanking regions.
  • Cells were co- stained with antibodies against IgM and IgG or IgA and analyzed by flow cytometry over time.
  • FIG. 4D Statistical analysis of relative growth rates from in FIGS. 4A-4C. Data are from at least four experiments in each condition. **P ⁇ 0.01; ***P ⁇ 0.001.
  • FIGS. 5A-5E Generation of Fab' fragments by CRISPR/Cas9 system in mouse hybridomas.
  • FIG. 5A Top: schematic representation of mouse IgG antibody and target sites of two different gRNAs used for Fab' fragment production.
  • Fab' fragments were produced by frameshift (left) or deletion (right) of the IgH Fc fragment, respectively.
  • Bottom schematic depiction of 5' gRNA (scissors) in reference to the papain cleavage site. PAM sequence is underlined in Fc 5' gRNA.
  • Figure discloses SEQ ID NOS 436- 438 and 418, respectively, in order of appearance.
  • FIG. 5B IgGl+ hybridomas were transduced with lentivirus expressing Cas9 nuclease and gRNAs targeting Fc 5' or Fc 5' and Fc3' regions. gRNAs targeting ⁇ 5', Syl 3' or Fc 3' were used as negative controls. Hybridomas were selected with puromycin, stained with IgM and IgGl antibodies, and analyzed by flow cytometry. Representative zebra plots from three different IgGl+ hybridomas are presented. Percentages of events are indicated in the corresponding quadrants.
  • FIGS. 5D-5E Western blot analyses of Fab' fragments from hybridoma supernatants.
  • IgGl+ hybridomas were transduced with lentiviruses expressing Cas9 nuclease and gRNAs targeting Fc 5' or Fc 5' and Fc3' regions and IgGl -negative single clones were obtained by serial dilution. Examples of two clones from the frameshift approach (FIG. 5D; #1.1 and #1.2; purity >99%) and two clones from the deletion approach (FIG. 5E; #1.3 and #1.4; purity >99%) are shown. Supernatants were loaded on a SDS-PAGE in non-reducing condition, and developed with an anti-mouse kappa light chain antibody. Three different IgGl+ hybridomas were used as controls.
  • FIGS. 6A-6B LentiCRISPR v2 vector and surveyor assay
  • FIG. 6A Schematic overview of lentiCRISPR v2 vector (ADDGENE #52961).
  • FIG. 6B Evaluation of the efficiency of gRNAs targeting in mouse fibroblast cells.
  • Locus modification efficiencies were analyzed 5 days after transduction using Surveyor nuclease assay. Estimated indel formation is indicated below each target. Open white arrowheads indicate expected bands. N.D.: not detected.
  • FIGS. 7A-7B Detection of inversions and excision circles
  • FIG. 7A Top: Schematic overview of an example of inversion between ⁇ 5' and Syl
  • FIG. 7B Top: Schematic overview of an example of excision circle between ⁇ 5' and
  • FIGS . 8A-8D RetroCRISPR vectors and detection of CSR in mouse splenic B cells.
  • FIG. 8A Schematic overview of RetroCRISPR v2 vector.
  • FIG. 8B Schematic overview of RetroCRISPR v2 vector.
  • pMSCVgfp :AID vector
  • FIGS. 8C-8D Untouched mouse B cells isolated from the spleen of 129S2 WT (FIG.
  • FIG. 8C AED-deficient mice were activated by CD40 antibody and IL-4 for 1 day and then transduced with retrovirus expressing Cas9 nuclease and gRNAs used in (FIG. 8B).
  • GFP expressing- retrovirus or ADD expressing-retrovirus was used as negative or positive control, respectively.
  • IgGl+ cells were gated on the GFP positive population. Representative zebra plots are presented and percentages of events are indicated in the corresponding quadrant.
  • FIG. 9 Examples of CSR in hybridomas.
  • Hybridoma #3 IgM+ from FIG. ID was transduced with four different combinations of lentiviruses expressing Cas9 nuclease and gRNAs used in FIG. 1 A and selected with puromycin (3 ⁇ g/ml) for 3 days.
  • Live cells were seeded in 96-well plates to isolate single cell clones, stained with IgGl and IgM antibodies, and analyzed by flow cytometry. Data were analyzed by FlowJo software. Out of 189 hybridomas, 12 were IgGl-positive pure clones.
  • FIG. 10 Examples of Sanger sequencing of the splice junction between ⁇ and Sa flanking regions. Representative sequences of junctions identified from 30 clones for 3' and Sal 3' genomic region. PCR products were purified and cloned into pGEM-T vector. Ref. Seq. is the sequence of the predicted genomic junction between ⁇ 3' and Sal 3' region. Bold sequence represent downstream sequence of the Sal 3' region. Non-bold regular sequence represent upstream sequence of the ⁇ 3' region. Underlined bases are base insertions created during the CSR; Dashes are deleted bases created during the CSR. Figure discloses SEQ ID NOS 419 and 419-427, respectively, in order of appearance.
  • FIG. 11 Detection of excision circles in JEKO-1 cells. Schematic overview of excision circles generated with four different combinations of gRNA targeting ⁇ and Sy3 or Syl flanking regions. Black arrows indicate primers used for PCR. Cutting sites are indicated with scissors. Open white arrowheads in the gels indicate non-specific band.
  • FIGS. 12A-12B Detection of inversions in JEKO-1 cells.
  • FIG. 12A Schematic overview of an example of an inversion resulting from gRNA targeting ⁇ 5' and Sy3 3' flanking regions. Black little arrows indicate primers for PCR. Cutting sites are indicated with scissors.
  • FIG. 12B Detection of excised circle by PCR on genomic DNA extracted from JEKO-1 cells transduced with two lentiviruses expressing Cas9 nuclease and gRNAs targeting ⁇ and Sy3 or Syl flanking regions.
  • FIG. 13 Simultaneous CSR switching in JEKO-1 cells.
  • IgM-expressing JEKO-1 cells were co-transduced with three lentiviruses expressing Cas9 nuclease and gRNAs targeting 8 ⁇ , Syl 3', and Sal 3' flanking regions. Two days later, cells were selected with puromycin (0.2 ⁇ g/ml). At day 7, cells were collected, co-stained with antibodies IgM, IgG, or IgA, and analyzed by flow cytometry. Data were analyzed by FlowJo software. Representative zebra plots from one of three independent experiments are presented. Percentages of events are indicated in the corresponding quadrants.
  • FIG. 14 Sequential CSR in JEKO-1 cells. To induce sequential class switching from
  • IgM-expressing JEKO-1 cells were transduced with lentiviruses expressing Cas9 nuclease and gRNAs targeting ⁇ 3' and Syl 3' flanking regions to generate IgGl -expressing JEKO-1 cells.
  • IgGl -expressing cells were then transduced with lentiviruses expressing Cas9 nuclease and gRNAs targeting ⁇ 5' and Sal 3' flanking regions.
  • cells were collected, co-stained with antibodies IgM, IgG, or IgA, and analyzed by flow cytometry. Data were analyzed by FlowJo software. Representative zebra plots from one of three independent experiments are presented.
  • FIGS. 15A-15B Detection of frameshift versus deletion frequency in Fab' producing hybndomas.
  • FIG. 15A Schematic overview of the PCR approach to distinguish between frameshift or deletion mediated removal of IgH Fc portion in single cell clones obtained from IgH negative hybndomas. Black little anow indicates the primers for Fc 5' forward primer, the Fc 5' reverse primer and the Fc 3' reverse primer, respectively. The circle represents IgH hinge region.
  • FIG. 15B Gels of PCR reactions were performed with the indicated primer sets.
  • FIGS. 16A-16B Examples Sanger sequencing of the spliced junctions in Fab' producing hybridomas clones wherein the Fab' are made with frameshift or deletion of the IgH Fc portion.
  • FIG. 16A Examples of Sanger sequencing of the junctions of the Fc 5' region with frameshift mediated removal of the IgH Fc portion in Fab' hybridomas clones # 1, #5, #10, and #12.
  • Ref. Seq. is sequence of the predicted genomic junction of Fc 5' region. Black downward pointing anow indicates the Cas9 cutting site.
  • PAM sequence is underlined or boxed.
  • Figure discloses SEQ ID NOS 428, 429, 428, 430, 428, and 431, respectively, in order of appearance.
  • FIG. 16B Examples of Sanger sequencing of junctions of the Fc 5' region with deletion mediated removal of the IgH Fc portion in Fab' hybridomas clones #36, #37, #48 and #53, deletion mediated removal by way of the described Cas9/gRNA deletion.
  • Ref. Seq. is the sequence of the predicted genomic spliced junction between Fc 5' and Fc3' regions.
  • Bold sequence represent downstream sequence of the Fc 3' region.
  • Non-bold sequence represent upstream sequence of the Fc 5' region.
  • Figure discloses SEQ ID NOS 432, 433, 432, 434, 432, and 435, respectively, in order of appearance.
  • FIG. 17 Generation of hybridomas producing Fab' fragments.
  • IgGl -expressing hybridoma (#1 from FIG. 5B) was transduced with lentivirus expressing Cas9 nuclease and gRNAs targeting Fc 5' (frameshift) or Fc 5' and Fc3' together (deletion). Cells were selected with puromycin (3 ⁇ g/ml) for 3 days, and cultured in 96-well plates to isolate IgGl -negative single cell clones expressing only Fab' fragments. Hybridomas were stained with IgM and IgGl antibodies, and analyzed by flow cytometry. Two clones from the frameshift approach (#1.1 and 1.2) and 2 clones from deletion approach (#1.3 and #1.4) were generated with purity >99%. Data were analyzed by Flow Jo software.
  • FIGS. 18A-18F Detection of Fab' fragments in the supernatants of hybridomas.
  • Two clones from the frameshift approach (#1.1 and 1.2) and 2 clones from deletion approach (#1.3 and #1.4) as in FIG. 17 were isolated and cultured in HBSS for 1 day.
  • Embodiments of the present disclosure relate to compositions, methods, and kits for directing CSR of the IgH chain genes in vivo in order to producing antibodies of any Ig subclass of one's choosing.
  • the compositions, methods and kits described herein use the CRISPR/Cas9 system to edit the IgH chain segments (or exons) in the IgH locus, thereby inducing CSR of the IgH chain genes.
  • the compositions, methods, and kits do not depend on the activation of B cells, the B cell membrane-bound antibody molecule (i.e., the B cell receptor), or the T cell derived cytokines to induce CSR.
  • Ig class switching also known as isotype switching, isotypic commutation or CSR, is a biological mechanism that changes a B cell's production of immunoglobulin (antibodies) from one type to another, such as from the isotype IgM to the isotype IgG.
  • antibodies immunoglobulin
  • the constant-region portion of the antibody heavy chain is changed, but the variable region of the Ig heavy chain stays the same (the terms "variable” and “constant” refer to changes or lack thereof between antibodies that target different epitopes). Since the variable region does not change, class switching does not affect antigen specificity. Instead, the antibody retains affinity for the same antigens, but can interact with different effector molecules.
  • class switching occurs after activation of a mature B cell via its membrane- bound antibody molecule (i.e., the B cell receptor) to generate the different classes of antibody, all with the same variable domains as the original antibody generated in the immature B cell during the process of V(D)J recombination, but possessing distinct constant domains in their Ig heavy chains.
  • the B cell receptor membrane- bound antibody molecule
  • Naive mature B cells produce both IgM and IgD, which are the first two heavy chain segments in the IgH locus. After activation by antigen, these B cells proliferate. If these activated B cells encounter specific signaling molecules via their CD40 and cytokine receptors (both modulated by T helper cells), they undergo antibody class switching to produce IgG, IgA or IgE antibodies. During class switching, the constant region of the IgH chain changes but the variable regions, and therefore antigenic specificity, stay the same. This allows different daughter cells from the same activated B cell to produce antibodies of different isotypes or subtypes (e.g. IgGl, IgG2 etc.).
  • the order of arrangement of the heavy chain (IgH) exons in the IgH locus in the human genome is as follows: ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), al (for IgAl), ⁇ 2 (for IgG2), ⁇ 4 (for IgG4), ⁇ (for IgE), and a2 (for IgA2).
  • the order of arrangement of the heavy chain (IgH) exons in the IgH locus in the mouse genome is as follows: ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), y2b (for IgG2b), y2& (for IgG2a), ⁇ (for IgE), and a (for IgA).
  • ⁇ for IgM
  • ⁇ for IgD
  • ⁇ 3 for IgG3
  • ⁇ for IgGl
  • y2b for IgG2b
  • y2& for IgG2a
  • ⁇ for IgE
  • CSR is a biological mechanism that allows the class of antibody produced by an activated B cell to change during a process known as isotype or class switching.
  • DSB is the key initiating step of CSR 3"5 .
  • DSBs are introduced at the Ig genes by the activity of B cell specific enzymes such as RAGl/2 and AED3-5.
  • Double-stranded breaks are generated in DNA at conserved nucleotide motifs, called switch (S) regions, which are upstream from gene segments that encode the constant regions of antibody heavy chains; these occur adjacent to all heavy chain constant region genes with the exception of the ⁇ -chain.
  • S switch
  • DNA is nicked and broken at two selected S-regions by the activity of a series of enzymes, including activation-induced (cytidine) deaminase (ADD), uracil DNA glycosylase and apyrimidic/apurinic (AP)-endonucleases.
  • the intervening DNA between the S-regions is subsequently deleted from the chromosome, removing unwanted ⁇ or ⁇ heavy chain constant region exons and allowing substitution of a ⁇ , a or ⁇ constant region gene segment.
  • the free ends of the DNA are rejoined by a process called non-homologous end joining (NHEJ) to link the variable domain exon to the desired downstream constant domain exon of the antibody heavy chain.
  • NHEJ non-homologous end joining
  • free ends of DNA may be rejoined by an alternative pathway biased toward microhomology joins.
  • ADD generates DSBs in the Ig locus by targeting repetitive sequences in the switch (S) regions that precede each IgH chain coding sequence 3"5 . Paired DSBs in the switch regions are then joined by the classical and alternative NHEJ pathways to generate a switch of the IgH 6 .
  • This long range joining is thought to be part of a general mechanism of DNA repair where two DSBs are joined in cis over long chromosome distances 7 .
  • efficient CSR can be obtained in absence of AID or S regions after the introduction of DSBs by site-specific I-Scel endonuclease 8 .
  • CRISPR CRISPR Associated
  • CRISPR Associated systems have great potentials for RNA-guided genome editing, including multiplexing genome engineering, gene targeting by homologous recombination, regulation of transcription, chromosomal translocation formation, high-throughput functional genomic screens and even RNA editing 1 ' 2 ' 9 ' 10 . It has been demonstrated that when two DSBs are simultaneously introduced in a cell in vitro or in vivo by CRISPR/Cas9 activity, a variety of gene rearrangements are generated, including large deletions (up to 12Mb), inversions and chromosomal translocations 11"14 .
  • the inventors used a CRISPR/Cas9 system to bring about an RNA-guided genome editing and thereby bring about CSR in the IgH locus.
  • the CRISPR/Cas9 system was used to edit both the mouse and human IgH chain genes in vivo so as to produce various Ig subclass antibodies by design.
  • viral vector vehicles such as retrovirus or lentivirus
  • the inventors were able to induce CSR of the IgH chain to the desired subclass.
  • the inventors induced CSR in all human B cell lines tested with high efficiency to targeted IgH subclass.
  • the inventors engineered mouse hybridomas to secrete the Fab' fragment instead of the whole Ig using this new approach.
  • the inventors showed that the Ig genes in mouse and human cells can be edited to obtain any desired IgH switching.
  • This CRISPR/Cas9 system based CSR in the B cells and hybridomas occurs independent of B cell activation by cytokines or by interaction with the cell-surface CD-40 receptor on the B cell or with the assistance of T helper cells.
  • compositions, methods' and kits for making antibodies having desired IgH subclass e.g., IgAl, IgA2, IgGl, IgG2, IgG3, IgG4, IgM, IgE, and IgD
  • desired IgH subclass e.g., IgAl, IgA2, IgGl, IgG2, IgG3, IgG4, IgM, IgE, and IgD
  • the gRNA sequences target the excision site of the respective ⁇ , ⁇ , ⁇ , a, or ⁇ region gene segment in the IgH locus, these gene segment codes for the constant region of an IgH chain.
  • the guide RNA sequences in combination with the CRISPR/Cas genome editing system brings about the targeted excision of the respective ⁇ , ⁇ , ⁇ , a, or ⁇ constant region gene segment in the IgH locus.
  • a guide RNA is designed and used in combination with a Cas9 nuclease or nickase to specifically introduce a cut in a targeted/target gene DNA or targeted sequence in the IgH locus.
  • a target or targeted sequence is located at the S region of the IgH locus.
  • This cut allows one to specifically modify the targeted gene by, e.g., by homologous recombination.
  • two distinct gRNAs are used to specifically introduce two distinct cuts in the targeted/target gene DNA or targeted sequence, and the broken ends are allowed to homologously recombine, thereby permitting specific deletions are introduced in the targeted/target gene DNA or targeted sequence. In this way, the targeted/target gene DNA or targeted sequence is modified.
  • the first gRNA is designed in either one of the regions that flank the Switch ⁇ (either at the 5'-end or at the 3'end of ⁇ ; see Tables 4 and 5 for genomic coordinates and seed sequences; also see FIG. 1A); the second gRNA is designed in either one of the regions that flank the desired Switch (either at the 5'-end or at the 3'end of Sy, Se or Sa depending on whether one desires a class switch to IgG, IgE, or IgA respectively).
  • the first gRNA is designed for targeting either one of the regions that flank the S ⁇ region (5'-end or 3'-end) and the second gRNA is designed for targeting either one of the regions that flank the S a region (5 '-end or 3'- end).
  • the first gRNA is designed for targeting either one of the regions that flank the S ⁇ region (5 '-end or 3 '-end) and the second gRNA is designed for targeting either one of the regions that flank the S ⁇ region (5 '-end or 3 '-end).
  • the first gRNA is designed for targeting either one of the regions that flank the S ⁇ region (5 '-end or 3 '-end) and the second gRNA is designed for targeting either one of the regions that flank the Sy region (5 '-end or 3 '-end). If the IgG is IgGl, then the second gRNA is designed for targeting either one of the regions that flank the Syl region (5'-end or 3'-end). ). If the IgG is IgG2b, then the second gRNA is designed for targeting either one of the regions that flank the Sy2b region (5 '-end or 3 '-end).
  • a pair gRNAs will be selected accordingly: for example for a switch from a IgG subclass to IgA, the first gRNA will be designed in either the 5 '-end or at the 3'end of the corresponding Sy subclass; whereas the second gRNA in either the 5 '-end or at the 3'end of Sa. (see FIG. 1A for the selection of the S region).
  • compositions, methods, and kits described herein provide the possibility of diversifying the antibody production from already established hybridomas. For example, when there is an antibody that already has been tested to show good specificity and titer. However, this good antibody is an IgGl, and it would be better to have an IgG2 or IgA having the same antigenic specificity, i.e. having the same variable region and recognize the same antigenic epitope.
  • the corresponding hybridoma that produced the good antibody of the IgGl subclass can then be induced in vitro to switch classes, and an IgG2 antibody can be obtained in one week from this hybridoma that previously produced IgGl antibodies.
  • compositions and methods described herein can transform a hybndoma that produces a whole Ig into a hybndoma producing only the Fab or Fab' or F(ab') 2 within one week, and the F'ab produced recognizes the same antigen as the whole Ig.
  • compositions for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs.
  • composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs for use in directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass.
  • the composition comprises one or more vectors.
  • Each vector comprises a nucleic acid encoding the Cas9 or gRNA or both the Cas9 and the gRNA.
  • the vector is a polycistronic vector, or a dicistronic vector, or a monocistric vector.
  • composition comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding at least two gRNAs, for use in directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass, wherein the at least two gRNAs are distinct.
  • composition comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, a second vector comprising a nucleic acids encoding a first gRNA, and a third vector comprising a nucleic acids encoding a second gRNA, for use in directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass, wherein the first and second gRNAs are distinct.
  • composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a gRNA for use in a rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment.
  • composition comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding a gRNAfor use in a rapid method of production of a monoclonal antibody having a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment.
  • composition comprising at least three coding nucleic acids, one nucleic acid encoding a Cas9 nuclease or nickase, a second nucleic acid encoding a first gRNA, and a third nucleic acid encoding a second gRNA, wherein the first and second gRNAs are distinct.
  • This composition is useful for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass.
  • composition comprising at least two coding nucleic acids, one nucleic acid encoding a Cas9 nuclease or nickase, and a second nucleic acid encoding a gRNA.
  • This composition is useful for rapid production of a monoclonal antibody having a desired IgH subclass from a hybridoma clonal cell or for the production of a monoclonal Fab or Fab' or F(ab') 2 fragment from a hybridoma clonal cell .
  • compositions for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs.
  • composition comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs for use in directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass.
  • a vector comprising a nucleic acid encoding a
  • Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • the vector is a viral vector.
  • composition comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a gRNA for use in a rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment.
  • a vector comprising a nucleic acid encoding a
  • Cas9 nuclease or nickase and nucleic acids encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • provided herein is a method for directing CSR of the IgH chain locus in a mammalian cell to a desired IgH subclass comprising contacting the mammalian cell with a composition of described herein.
  • a method for directing CSRof the IgH chain locus in a mammalian cell to a desired IgH subclass comprising contacting the mammalian cell with a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, or contacting with a composition comprising a vector described herein or contacting with a composition comprising the nucleic acids described.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, at least two gRNAs are non- identical, ie., they are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding at least two gRNAs, wherein the first and second gRNAs are distinct and are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, a second vector comprising a nucleic acids encoding a first gRNA, and a third vector comprising a nucleic acids encoding a second gRNA, wherein the first and second gRNAs are distinct and are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, at least two gRNAs are non- identical, ie., they are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus, and each gRNA comprise sequences selected from the sequences disclosed in Table 1, 4 and 5.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, at least two gRNAs are distinct, non-identical, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising at least three coding nucleic acids, one nucleic acid encoding a Cas9 nuclease or nickase, a second nucleic acid encoding a first gRNA, and a third nucleic acid encoding a second gRNA, wherein the first and second gRNAs are distinct.
  • kits for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, at least two gRNAs are non-identical, ie., they are distinct, and they are designed to target a S region in an IgH chain locus in a mammalian cell, with each gRNA targeting a different S region in the IgH locus, and each gRNA comprise sequences selected from the sequences disclosed in Table 1, 4 and 5.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA comprise sequences selected from the sequences disclosed in Table 1.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA comprise sequences selected from the sequences disclosed in Table 1.
  • kits for the use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising a first vector comprising a nucleic acid encoding a Cas9 nuclease or nickase, and a second vector comprising nucleic acids encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • compositions for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide gRNAs, wherein the first gRNA is designed in either one of the regions that flank the region, either at the 5 '-end or at the 3 'end of region, and the second gRNA is designed in either one of the regions that flank a second desired S region (either at the 5 '-end or at the 3 'end of Sy, Se or Sa). The second desired S region is not the same with the region.
  • compositions for directing CSR of an IgH chain locus in a mammalian cell to a desired IgH subclass comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, wherein the first gRNA is designed to target in either one of the regions that flank the region, either at the 5 '-end or at the 3 'end of ⁇ , and the second gRNA is designed in either one of the regions that flank a second desired S region (either at the 5 '-end or at the 3 'end of Sy, Se or Sa).
  • compositions for directing CSR of an IgH chain locus in a mammalian cell from a IgG subclass to IgA comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, wherein the first gRNA is designed to target in either the 5 '-end or at the 3 'end of the corresponding Sy subclass; whereas the second gRNA is designed to target in either the 5 '-end or at the 3 'end of Sa.
  • the at least two gRNAs are non-identical, ie., they are distinct.
  • compositions for directing CSR of an IgH chain locus in a mammalian cell from a IgG subclass to IgA comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide RNAs (gRNAs), wherein the first gRNA is designed to target in either the 5 '-end or at the 3 'end of the corresponding Sy subclass; whereas the second gRNA in either the 5 '-end or at the 3 'end of Sa.
  • gRNAs guide RNAs
  • compositions for directing CSR of an IgH chain locus in a mammalian cell from a IgG subclass to IgE comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide RNAs (gRNAs), wherein the first gRNA is designed to target in either the 5 '-end or at the 3 'end of the corresponding Sy subclass; whereas the second gRNA is designed to target in either the 5 '-end or at the 3 'end of Se.
  • gRNAs guide RNAs
  • compositions for directing CSR of an IgH chain locus in a mammalian cell from a IgG subclass to IgE comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two gRNAs, wherein the first gRNA is designed to target in either the 5 '-end or at the 3 'end of the corresponding Sy subclass; whereas the second gRNA is designed to target in either the 5 '-end or at the 3 'end of Se.
  • a rapid method of producing monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising providing a hybridoma clonal cell and contacting a hybridoma clonal cell with (i) a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acidsencoding a gRNA, or (ii) a composition described herein.
  • a composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA or a composition comprising a nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA.
  • the gRNA is designed to target the Fc region (constant region) of the antibody.
  • the gRNA is designed to target the papain or pepsin cleavage site in the Fc region of the antibody.
  • the hybridoma clonal cell produces antibodies that have already been tested to show good specificity and titer.
  • a rapid method of producing monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab or Fab' or F(ab') 2 fragment comprising providing a hybridoma clonal cell; and contacting a hybridoma clonal cell with a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a gRNA.
  • the gRNA is designed to target the Fc region (constant region) of the antibody.
  • the gRNA is designed to target the papain or pepsin cleavage site in the Fc region of the antibody.
  • the hybridoma clonal cell produces antibodies that have already been tested to show good specificity and titer.
  • a mammalian cell comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • a mammalian cell comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • composition comprising a population of mammalian cells comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • composition comprising a population of mammalian cells comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and exogenous nucleic acids encoding at least two gRNAs, wherein the at least two gRNAs are distinct.
  • a mammalian hybridoma clonal cell comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and an exogenous nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • a mammalian hybridoma clonal cell comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and an exogenous nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • composition comprising a population of mammalian hybridoma clonal cells comprising a vector or vectors comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and an exogenous nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • composition comprising a population of mammalian hybridoma clonal cells comprising comprising an exogenous nucleic acid encoding a Cas9 nuclease or nickase and a nucleic acid encoding a gRNA, wherein the gRNA targets the papain or pepsin cleavage site of the Fc region on the antibody.
  • the CRISPR/Cas9 genome editing is carried out with a Type II CRISPR system.
  • this system includes Cas9, CRISPR RNA (crRNA), trans- activating crRNA (tracrRNA) along with an optional section of DNA repair template that is utilized in either non-homologous end joining (NHEJ) or homology directed repair (HDR).
  • NHEJ non-homologous end joining
  • HDR homology directed repair
  • Cas9 (CRISPR associated protein 9) is an RNA-guided DNA endonuclease enzyme associated with the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive immunity system in Streptococcus pyogenes, among other bacteria.
  • S. pyogenes utilizes Cas9 to memorize and later interrogate and cleave foreign DNA, such as invading bacteriophage DNA or plasmid DNA. Cas9 performs this interrogation by unwinding foreign DNA and checking whether it is complementary to the 20 basepair spacer region of the guide RNA. If the DNA substrate is
  • Cas9 cleaves the invading DNA.
  • the CRISPR/Cas9 mechanism has a number of parallels with the RNA interference (RNAi) mechanism in eukaryotes.
  • RNAi RNA interference
  • Cas9 proteins require the presence of a gRNA and a protospacer adjacent motif (P AM), which immediately follows the gRNA target sequence in the targeted polynucleotide gene sequence.
  • P AM protospacer adjacent motif
  • the PAM is located at the 3' end of the gRNA target sequence but is not part of the gRNA. Different Cas proteins require a different PAM.
  • selection of a specific polynucleotide gRNA target sequence (e.g., on the APP nucleic acid sequence) by a gRNA is generally based on the recombinant Cas protein used.
  • the PAM for the S. pyogenes Cas9 CRISPR system is 5 -NRG-3', where R is either A or G, and characterizes the specificity of this system in human cells.
  • the PAM of S. aureus is NNGRR.
  • the S. pyogenes Type II system naturally prefers to use an "NGG" sequence, where "N" can be any nucleotide, but also accepts other PAM sequences, such as "NAG” in engineered systems.
  • the Cas9 derived from Neisseria meningitidis normally has a native PAM of NNNNGATT, but has activity across a variety of PAMs, including a highly degenerate NNNNGNNN PAM.
  • the PAM for a Cas9 protein used in accordance with the present disclosure is a NGG trinucleotide-sequence.
  • the synthetic, man-made, non-naturally occurring guide RNA constitutes the homing device for the endonuclease component of the CRISPR/Cas system.
  • the endonuclease in the CRISPR Cas system is a Cas endonuclease.
  • the Cas endonuclease can cleave a single strand (a nicknase) or two strands of a dsDNA (nuclease).
  • the gRNA and the Cas endonuclease together form a protein- RNA complex.
  • the gRNA is the homing device of the a protein-RNA complex because the gRNA brings the Cas endonuclease to a specific location (a targeted location) on a double-stranded DNA (ds DNA, ie. part of the genomic DNA) for cleaving the DNA at that specific location via the endonuclease catalytic activity while the endonuclease is in the protein-RNA complex, a ribonucleoprotein complex. Therefore, the gRNA is used for "targeting" the endonuclease component of the CRISPR/Cas system to a specified site on a dsRNA genome destined for cleavage.
  • ds DNA double-stranded DNA
  • the gRNA "homes" in on the specific location (the targeted sequence) on the dsDNA (the genomic DNA) where cleavage is intended by having a targeting sequence that is complementary to the sequence found on the specific location (the targeted sequence).
  • the specified location (the targeted sequence) on a dsDNA genome where cleavage by the endonuclease is intended and desired is the targeted sequence.
  • the complementary sequence on the gRNA usually the guide sequence or the seed sequence, the sequence being complementary to the targeted location on the dsDNA genome is the targeting sequence. Therefore, the target specificity of Cas9 stems from the guide RNA:DNA complementarity and engineering Cas9 to specifically cleave at targeted new DNA is straightforward and well known in the art. See Cong, L.; Ran, F.
  • PAM sequence on the host genome is recognized by the protein structure of Cas9.
  • PAM is a short sequence and is not very specific (e.g. the SpCas9 PAM sequence is 5'-NGG-3' and in the human genome, such PAM sequence occurs roughly every 8 to 12 base pairs).
  • the native Cas endonuclease such as Cas9 requires a guide RNA (gRNA) composed of two disparate RNAs that associate to make the guide - the CRISPR RNA (crRNA), and the trans-activating RNA (tracrRNA).
  • the tracrRNA is for binding the Cas endonuclease (e. Cas9 recognition) and for the recognition of the PAM sequence.
  • the crRNA is for bringing the Cas endonuclease to a targeted location/sequence on dsDNA, the targeted location/sequence is the site where cleavage by the Cas endonuclease is intended.
  • the targeted or target sequence for the gRNAs using the type II CRISPR system of S. pyogenes described in this disclosure have the formula having N12-20NGG, where NGG represent the PAM site from S. pyogenes, and N12-20 represents the 12-20 nucleotides directly 5' to the PAM site. Additional PAM site sequences from other species of bacteria include NGGNG, NNNNGATT,
  • N any nucleotide (standard or modified) and W is a nucleotide with weak interactions, such as A or T/U.
  • W is a nucleotide with weak interactions, such as A or T/U.
  • gRNA refers to a guide RNA which is a fusion between the gRNA guide sequence (crRNA) and the Cas9 recognition sequence (tracrRNA). It provides both targeting specificity and scaffolding/binding ability for Cas9 nuclease or nickase. gRNAs of the present disclosure do not exist in nature, i.e., is a non-naturally-occuring nucleic acid.
  • the gRNAs of the present disclosure generally comprises (or consists of) a "gRNA guide sequence” and a Cas (e.g., Cas9) recognition sequence (tracrRNA), which is necessary for Cas (e.g., Cas9) binding to the targeted IgH locus.
  • a Cas e.g., Cas9 recognition sequence
  • gRNA guide sequence refers to the nucleotide sequence that is complementary to the nucleotide sequence that immediately precedes the PAM (i.e., in 5' of the PAM) in the genomic DNA. It corresponds to the protospacer or the target polynucleotide gene sequence. It is what gets put into a gRNA expression plasmid; it does not include the PAM sequence. It is the sequence that confers target specificity. It requires a Cas9 recognition sequence (tracrRNA) to bind to Cas9.
  • the gRNA guide sequence is between 16-25 nucleotides, preferably between 18-22 nucleotides and even more preferably 19 nucleotides or 20 nucleotides long.
  • the gRNA guide sequence recognizes and binds to the targeted gene of interest, which is the selected sequence that immediately precedes the PAM. It hybridizes with (i.e., is complementary to) the opposite strand of a target gene sequence, which comprises the protospacer and the PAM (i.e., it hybridizes with the DNA strand opposite to the PAM).
  • the gRNA guide sequence comprises a targeting sequence that is complementary to the targeted/target sequence having the formula N12-20NGG but minus the NGG (PAM).
  • a Cas recognition sequence refers to the portion of the gRNA that links the gRNA guide sequence (crRNA) to the Cas nuclease. It acts as a guide for binding a endonuclease or nickase and brings the endonuclease or nickase to the target genomic DNA for the enzyme to effectuate DSBs.
  • crRNA gRNA guide sequence
  • a gRNA with a bound endonuclease or nickase will cleave the target genomic nucleic acid when the gRNA guide sequence complementarily binds to the target sequence.
  • Cas recognition sequence is a Cas9 recognition sequence.
  • tracrRNA Cas9 recognition sequences
  • the gRNA comprises a "gRNA guide sequence" (crRNA) or "gRNA targeted sequence” which corresponds to the target sequence on the target polynucleotide gene sequence (here, it is the S regions of the endogenous the IgH locus, for example, in the 8 ⁇ , Sy3, Syl, Sy2b, Sy2a, Se or Sa regions of the IgH locus) that is followed by a PAM sequence. See Table 1, 4 and 5.
  • the gRNA comprises a "G" at the 5' end of the polynucleotide sequence. The presence of a "G” in 5' is preferred when the gRNA is expressed under the control of the U6 promoter.
  • the CRISPR/Cas9 system of the present disclosure can use crRNA of varying lengths.
  • the crRNA may comprise at least a 10 nts, at least 11 nts, at least a 12 nts, at least a 13 nts, at least a 14 nts, at least a 15 nts, at least a 16 nts, at least a 17 nts, at least a 18 nts, at least a 19 nts, at least a 20 nts, at least a 21 nts, at least a 22 nts, at least a 23 nts, at least a 24 nts, at least a 25 nts, at least a 30 nts, or at least a 35 nts of the targeted S regions of the IgH locus which is followed by a PAM sequence.
  • the crRNA can be least 17 nucleotides (17, 18, 19, 20, 21, 22, 23), preferably between 17 and 30 nts long, more preferably between 18-22 nucleotides long. In an embodiment, crRNA is between 10-40, 10-30, 12-30, 15-30, 18-30, or 10-22 nucleotides long.
  • the PAM sequence can be "NGG", where "N” can be any nucleotide.
  • a gRNA's crRNA can target any region of a target gene (e.g., APP) which is immediately upstream (contiguous, adjoining, in 5') to a PAM (e.g., NGG) sequence. In an embodiment, the gRNA's crRNA can target any region which is followed by a PAM identified on Tables 1, 4 and 5.
  • the guide sequence can comprise from about 10 nucleotides to more than about 25 nucleotides.
  • the region of base pairing between the guide sequence and the corresponding target site sequence can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, or more than 25 nucleotides in length.
  • the guide sequence is about 17-20 nucleotides in length, such as 20 nucleotides.
  • the gRNA described herein comprises a crRNA comprising a seed region of at least 10 consecutive nucleotides of a targeted sequence in a IgH gene polynucleotide sequence present in the cell and a Cas9 recognition sequence, wherein the targeting sequence of the gRNA is contiguous to a PAM in the IgH gene polynucleotide sequence and wherein the PAM is recognized by a ribonucleoprotein complex comprising a Cas9 nuclease or nickase.
  • the crRNA is complementary to the targeted sequence in an IgH gene locus polynucleotide sequence.
  • the seed region in the crRNA is complementary to the targeted sequence in an IgH gene locus polynucleotide sequence, i.e., the various S regions, or Fc region.
  • the location on the IgH gene polynucleotide sequence that is targeted is the IgH locus.
  • the 'seed sequence' or “seed region” is the sequence closest to the PAM.
  • the seed sequence is most important for targeting and specificity.
  • the PAM is most important for for Cas9 recognition and the cleavage of the nucleic acid backbone.
  • the gRNA's crRNA also refered to as gRNA guide sequence
  • gRNA guide sequence with a 20 nt homology to the targeted sequence can tolerate several mismatches. It is therefore of paramount importance to select target sites which are unique and do not have closely homologous sequences elsewhere in the genome.
  • the guide sequence of gRNA comprises a seed region of at least 10 consecutive nucleotides of a target sequence preceding a PAM in an IgH locus sequence present in the mammalian cell.
  • the guide sequence of gRNA comprises a seed region perfectly complementary to a targeted sequence in the endogenous the IgH locus of the cell.
  • the guide sequence of gRNA comprises a seed region sequence selected from the sequences disclosed in Table 1, 4 and 5.
  • the guide sequences of gRNAs described herein comprise seed regions that are perfectly complementary to targeted sequences in the S regions of the endogenous the IgH locus of the cell.
  • a mismatch between a gRNA guide sequence and targeted sequence of the S region is also permitted as along as it still allows hybridization of the gRNA with the complementary strand of the gRNA target polynucleotide sequence on the targeted gene.
  • the seed sequence of between 8-12 consecutive nucleotides in the gRNA, which perfectly matches a corresponding portion of the targeted gRNA sequence is preferred for proper recognition of the target sequence.
  • the remainder of the guide sequence may comprise one or more mismatches.
  • the seed sequence of between 16-25 consecutive nucleotides in the gRNA which perfectly matches a corresponding portion of the gRNA targeted sequence.
  • gRNA activity is inversely correlated with the number of mismatches.
  • the gRNA of the present invention comprises 7 mismatches, 6 mismatches, 5 mismatches, 4 mismatches, 3 mismatches, more preferably 2 mismatches, or less, and even more preferably no mismatch, with the corresponding gRNA target gene sequence (less the PAM).
  • the gRNA nucleic acid sequence is at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identical to the gRNA target polynucleotide sequence in the gene of interest (e.g., IgH locus).
  • the binding affinity is thought to depend on the sum of matching gRNA-DNA combinations.
  • the gRNA guide sequence of the present disclosure consists of at least 16 or 17 contiguous nucleotides of the targeted sequence in the S regions of the endogenous the IgH locus of the cell.
  • the gRNA further comprises a a cis-blocking sequence, which is complementary and capable of hybridization to at least a portion of the above-described guide sequence.
  • the blocking sequence can be 5-20 nucleotides long, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.
  • the cis-blocking sequence hybridizes to the guide sequence and forms a duplex stem.
  • the formation of the stem makes fewer nucleotides on the guide sequence available to both target and non-target sequences, but unzipping of the stem is more thermodynamically favorable for hybridization of the target sequence to the guide sequence, and hybridization of the guide sequence to non-target sequences is thus reduced.
  • thermodynamic secondary structural properties of the guide sequence and/or the entire guide RNA as a whole can be used to create a cis- blocking sequence.
  • GC content and/or length of the blocking sequence can be used to achieve the desired level of binding affinity.
  • the cis- blocking sequence can be designed to weakly base pair with part of the guide sequence of the guide RNA, thereby sequestering this region from binding to off-target DNA sequences that only partially match the guide sequence.
  • Such weak base-pairing in the cis-blocked stem will be out-competed and melted by a fully cognate DNA target sequence when the cis-blocked guide RNA-Cas9 complex recognizes the on-target sequence.
  • Cas9-guided binding and/or cleavage of a cognate DNA target occurs with improved specificity when a well-designed cis-blocking sequence is included.
  • the blocking sequence may be 3 ' or 5' with respect to the guide sequence if they are in the same RNA molecule. If the guide RNA consists of two or more RNA molecules, they can be in separate RNA molecules.
  • the target nucleic acid sequences selected for the above-mentioned gRNA are located in the S regions of the endogenous the IgH locus, for example, in the ⁇ , Sy3, Syl, Sy2b, Sy2a, Se or Sa regions of the IgH locus.
  • the gRNA described here is an engineered single strand RNA with a guide sequence located at the 5 '-end and the guide sequence is complementary to a target nucleic acid sequence on the IgH chain locus in the genome.
  • the target nucleic acid sequence on the IgH chain locus in the genome for the gRNA guide sequence is a S region in an IgH chain locus in a mammalian cell.
  • the target nucleic acid sequence on the IgH chain locus in the genome for the gRNA guide sequence is the papain or pepsin cleavage site of the Fc region on the antibody in a mammalian cell.
  • the target nucleic acid sequence selected for the above-mentioned gRNA is located at the 5 '-end of a S region of the endogenous the IgH locus, for example, in the ⁇ , Sy3, Syl, Sy2b, Sy2a, Se or Sa regions of the IgH locus.
  • the target nucleic acid sequence selected for the above-mentioned gRNA is located at the 3 '-end of a S region of the endogenous the IgH locus, for example, in the 8 ⁇ , Sy3, Syl, Sy2b, Sy2a, Se or Sa regions of the IgH locus.
  • the target nucleic acid sequence selected for the above-mentioned gRNA is located in S regions described in Tables 4 and 5 of the mouse and human genome.
  • the targeted nucleic acid sequence selected for the above-mentioned gRNA is located anywhere within the targeted S region. In other embodiments of any composition, method, or kit described, the targeted nucleic acid sequence for the above-mentioned gRNA is located at either the 5 '-end of the 3 '-end of the targeted S region.
  • the S regions are on average about ⁇ 200-300 base pair long and the estimated number of occurrence of a particulary type of PAM sequence in a nucleotide sequence of ⁇ 200-300 base pair long is approximately 4-5. Accordingly, in an S region, there can be several gRNA target sequences. See Table 5.
  • the PAM comprises a
  • gRNAs guide sequences for genome editing is determined using publicly available softwares for identifying and design effective candidate gRNA guide sequences, e.g. CRISPR gRNA program at the Board Institute of the Massachusetts Institute of Technology. Many online tools are available to aid in designing effective gRNA guide sequences for genome editing using the
  • CRISPR/Cas 9 system A skilled artisan simply insert the targeted DNA sequence of the selected S region into the software program (see Table 4 for genome location of the S regions that can be targeted and used in the program to generate effective gRNA guide sequences).
  • the program then provides a list of candidate gRNA guide sequences.
  • gRNA guide sequences with a score of 20 & above according to the CRISPR gRNA program are selected.
  • the candidate gRNA guide sequences are easily tested according to the methods described in the EXAMPLE section and is well within the skills of one in the art.
  • Table 5 shows a list of gRNA seed sequences that have a score of 20 & above according to the CRISPR gRNA program, and are located at the 5' and 3' end of the different S regions.
  • the target sequence for the gRNA guide sequence is within a switch (S) region which is upstream from a gene segment/nucleic acid sequence that encode a constant region of an antibody heavy chain, i.e., the Fc region.
  • S switch
  • the method comprises two gRNAs, a first gRNA which guide sequence targeting a first S region of the IgH locus and a second gRNA which guide sequence targeting a second S region on the IgH, wherein the first S region and the second S region targeted by the two respective gRNAs are different.
  • the first S region targeted is ⁇ and the second S region targeted is Sa, or the the first S region targeted is and the second S region targeted is Se.
  • the target sequence for the gRNA guide sequence flanks an S region.
  • the target sequence for the gRNA guide sequence flanks a gene segment/nucleic acid sequence that encode a constant region of an Ig heavy chain.
  • the exon that is the constant region gene segment in the IgH gene is the constant region gene segment in the IgH gene.
  • DSBs created by the Cas9 allows the excision of the constant region gene segment of the antibody, leaving behing the coding sequence for the variable region intact. This results in producing the Fab fragment.
  • the exon constant region gene segment in the IgH gene is selected from the group consisting of ⁇ , ⁇ , ⁇ , a, or ⁇ .
  • the exon constant region gene segment in the IgH gene is selected from the group consisting of ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), al (for IgAl), ⁇ 2 (for IgG2), ⁇ 4 (for IgG4), ⁇ (for IgE), and a2 (for IgA2).
  • the guide sequence of the gRNA comprises sequences selected from Table 1, 4 and 5.
  • the guide sequence of the gRNA is selected from Table 1, 4 and 5.
  • the guide sequence of the gRNA is complementary to those described in Table 1, 4 and 5.
  • the kit further provides an instruction table similar to that of Table 4 for teaching the selection of gRNA for the desired class switching.
  • the gRNAs and endonuclease can be introduced to the cells where genome editing is to be carried out by a number of methods known in the art. For example, electroporation of DNA, RNA or ribonucleocomplexes is the most common and cheaper system. For more efficient delivery of the gRNAs and endonuclease, delivery systems such as those based on lentivirus (LVs), adenovirus (AdV) and adeno-associated virus (AAV) are used. Plasmids and vectors for the one-stop-expression of both the gRNAs and the Cas 9 protein in a single vector are commercially. For example, ORIGENE vectors that have the lenti-viral backbone.
  • Various site-specific endonucleases are used for the compositions and methods described herein. These are often called nucleases and nickases.
  • Site-specific endonucleases are known in art. For example, see U.S. Patent No. 8,697,359; International PCT Patent Publication Nos: WO 2015/168800, the contents of each are incorporated by reference in its entirety.
  • dCas9-FoKI nucleases are designed recombinant dimeric nucleases (RFNs) that can recognize extended sequences and edit endogenous genes with high efficiency in human cells.
  • nucleases comprise a dimerization-dependent wild type Fokl nuclease domain fused to a catalytically inactive Cas9 (dCas9) protein.
  • Dimers of the fusion proteins mediate sequence specific DNA cleavage when bound to target sites composed of two half-sites (each bound to a dCas9 (i.e., a Cas9 nuclease devoid of nuclease activity) monomer domain) with a spacer sequence between them.
  • the dCas9-FoKI dimeric nucleases require dimerization for efficient genome editing activity and thus, use two gRNAs for introducing a cut into DNA.
  • the recombinant Cas protein that can be used in accordance with the present invention is i) derived from a naturally occurring Cas; and ii) has a nuclease (or nickase) activity to introduce a DSB (or two SSBs in the case of a nickase) in cellular DNA when in the presence of appropriate gRNA(s).
  • a nuclease or nickase activity to introduce a DSB (or two SSBs in the case of a nickase) in cellular DNA when in the presence of appropriate gRNA(s).
  • Cas9 nuclease refers to a recombinant protein which is derived from a naturally occurring Cas9 which has nuclease activity and which function with the gRNAs of the present invention to introduce DSBs in the targeted DNA.
  • the Cas9 nuclease is a dCas9 protein (i.e., a mutated Cas9 protein devoid of nuclease activity) fused with a dimerization-dependent Fokl nuclease domain.
  • the Cas protein is a Cas9 protein having a nickase activity.
  • Cas9 nickase refers to a recombinant protein which is derived from a naturally occurring Cas9 and which has one of the two nuclease domains inactivated such that it introduces single stranded breaks (SSB) into the DNA. It can be either the RuvC or HNH domain.
  • the Cas protein is a Cas9 nuclease.
  • the Cas9 protein can be derived from any naturally occurring source.
  • Cas9 proteins are natural effector proteins produced by numerous species of bacteria including Streptococcus pyogene, Streptococcus thermophiles, Staphylococcus aureus, and Neisseria meningitides.
  • the Cas protein useful for the compositions, methods, or kits disclosed is a Cas9 nuclease/nickase derived from S. pyogene, S. thermophiles, S. aureus or N. meningitides.
  • the Cas9 recombinant protein useful for the compositions, methods, or kits disclosed is a human-codon optimized Cas9 derived from S. pyogenes (hSpCas9).
  • the Cas9 recombinant protein useful for the compositions, methods, or kits disclosed is a human-codon optimized Cas9 derived from S. aureus (hSaCas9).
  • the Cas9 cuts 3-4 base-pair (bp) upstream of the PAM sequence.
  • the degree of off-target effects depends on a number of factors, including: how closely homologous the off-target sites are compared to the on-target site, the specific site sequence, and the concentration of Cas9 and guide RNA (gRNA). These considerations only matter if the PAM sequence is immediately adjacent to the nearly-homologous target sites. The mere presence of additional PAM sequences should not be sufficient to generate off-target DSBs; there needs to be extensive homology of the protospacer followed by PAM.
  • the Cas or other nuclease/nickase recombinant protein useful for the compositions, methods, or kits disclosed preferably comprises at least one nuclear localization signal (NLS) to target the protein into the cell nucleus.
  • NLS nuclear localization signal
  • nuclear localization signal refers to an amino acid sequence, which 'tags' a protein for import into the cell nucleus by nuclear transport. Typically, this signal consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface. Different nuclear localized proteins may share the same NLS. An NLS has the opposite function of a nuclear export signal, which targets proteins out of the nucleus.
  • NLSs can be further classified as either monopartite or bipartite.
  • NLS are known in the art, for example, in U.S. Patent No: 6759231 and in U.S. Patent Application No: US20130023643, the contents are incorporated by reference in their entirety.
  • the Cas9 nuclease or nickase is a hSpCas9 nuclease, a hSaCas9 nuclease, a hSpCas9 nickase, a hSaCas9 nickase or a dCas9- Fokl nuclease, wherein the "h" therein indicates human codon optimized.
  • a humanized Cas9 construct is publicly available for example at the repository Addgene (for example Addgene plasmids pX330TM, pX335TM (nickase), pX458TM, pX459TM, pX460TM, pX461TM, pX462TM, pX165TM pX260TM, pX334TM (nickase)).
  • Addgene for example Addgene plasmids pX330TM, pX335TM (nickase), pX458TM, pX459TM, pX460TM, pX461TM, pX462TM, pX165TM pX260TM, pX334TM (nickase)
  • the desired IgH subclass is selected from the group consisting of IgAl, IgA2, IgM, IgE, IgD, IgGl, IgG2, and IgG3 and IgG4.
  • the vector described herein is a viral vector.
  • a viral vector for example, a lentivirus, a retrovirus, an adenovirus, or an adeno-associated virus.
  • ORIGENE vectors that have the lenti-viral backbone.
  • the mammalian cell is a B lymphocyte or a hybridoma cell.
  • the B lymphocyte is a naive or activated B lymphocyte.
  • the mammalian cell is a human, mouse, rat, donkey, monkey, pig, horse, hamster, or guinea pig cell.
  • the B lymphocyte is derived from a mouse, a rat, a human, a donkey, a monkey, a pig, a horse, a hamster, or a guinea pig.
  • the vector described expresses the Cas9 nuclease or nickase and the at least gRNA in vivo in the mammalian cell.
  • the gRNA guide sequences targeting the DNA proximal to the papain or pepsin cleavage site of the IgGl coding sequence are provided.
  • the gRNA guide sequences targeting the DNA proximal to the papain or pepsin cleavage site of the heavy chain of the immunoglobulin are provided.
  • the gRNA guide sequences are GATGCAACAAGTGGCCATGT (SEQ ID NO: 1) and TGTGCTCTTCCTATGCAAAC (SEQ ID NO: 2).
  • immunoglobulin refers to glycoprotein molecules produced by plasma cells and white blood cells. They act as a critical part of the immune response by specifically recognizing and binding to particular antigens, such as bacteria or viruses and aiding in their destruction. Immunoglobulin is abbreviated as "Ig” and is used interchangeably with antibody. Each Ig molecule consists of four polypeptide chains: two heavy chains (H chains) and two light chains (L chains). There are five antigenically different kinds of H chains, and this difference is the basis for the classification of immunoglobulins. Antibody isotypes are categorized according to differences in their amino acid sequence in the constant region (Fc) of the antibody H chains.
  • IgA The five major classes (as known as isotypes) of Ig in placental mammals based on the Fc regions of the H chains in the molecule: are IgA, IgD, IgE, IgG, and IgM. Each class varies in its chemical structure and in its number of antigen-binding sites and adheres to and reacts only with the specific antigen for which it was produced. Igs are categorized into two main forms: soluble antibodies that are secreted, and surface bound B-cell receptors contains a hydrophobic transmembrane region.
  • the term "immunoglobulin heavy chain locus” or “immunoglobulin heavy chain segment” or “IgH locus” refers to the genomic germline organization of the DNA encording all the major classes of the Ig heavy chain.
  • the locus includes V (variable), D (diversity), J (joining), and C (constant) DNA segments for the Ig heavy chain polypeptide.
  • V variable
  • D diversity
  • J joining
  • C constant DNA segments for the Ig heavy chain polypeptide.
  • a recombination event at the DNA level joins a single D segment with a J segment; this partially rearranged D-J gene is then joined to a V segment.
  • the rearranged V-D-J is then transcribed with the IGHM constant region; this transcript encodes a mu heavy chain.
  • V-D-J- Cmu-Cdelta pre-messenger RNA which is alternatively spliced to encode either a mu or a delta heavy chain.
  • Mature B cells in the lymph nodes undergo switch recombination, so that the V-D-J gene is brought in proximity to one of the IGHG, IGHA, or IGHE genes and each cell expresses either the gamma, alpha, or epsilon heavy chain. Recombination of many different V segments with several J segments provides a wide range of antigen recognition.
  • IgH chain segment or "IgH chain gene” when used in the context of inducing CSR of the IgH locus to produce to the IgH chain of the desired subclass, the terms refers to C (constant) DNA segments for the Ig heavy chain polypeptide isotypes, that is, the C DNA for the IgA, IgD, IgE, IgG, and IgM isotypes.
  • upstream of a gene segment refers to the 5 '-end of the gene segment, wherein the gene segment is a DNA.
  • Fab fragments of an antibody refers to the antigen-binding fragment of an immunoglobulin molecule, containing the variable regions of both light and heavy chains of the Ig molecule.
  • Fc portion or "Fc binding” or “Fc fragment” of an antibody refers to the constant region of the antibody. It is the crystallizable fragment of an immunoglobulin molecule composed of the constant regions of the heavy chains and is responsible for binding to antibody receptors (Fc receptor) on cells and the Clq component of complement.
  • the term "monoclonal antibody” refers to an antibody produced by a clone or genetically homogeneous population of fused hybrid cells, a hybridoma. All monoclonal antibodies produced from the same clone are identical and have the same antigenic specificity, i.e., have the same Ig isotype, same Fab fragments, and variable regions of both light and heavy chains of the Ig molecule.
  • hybridoma refers to a hybrid or fusion cell that is produced in the laboratory by fusing an antibody-producing lymphocyte (which does not readily divide) with a non- antibody-producing cancer cell (which divides rapidly). The hybridoma proliferates and produces a continuous supply of a specific monoclonal antibody.
  • lymphocyte refers to any of the mononuclear non-phagocytic leukocytes found in the blood, lymph, and lymphoid tissues; they comprise the body's immunologically competent cells and their precursors. They are divided on the basis of ontogeny and function into two main classes, B and T lymphocytes, responsible for humoral and cellular immunity, respectively. Most are small lymphocytes 7-10 um in diameter with a round or slightly indented heterochromatic nucleus that almost fills the entire cell and a thin rim of basophilic cytoplasm that contains few granules.
  • small lymphocytes When activated by contact with antigen binding to their cell-surface receptors, small lymphocytes becomes activated and begin macromolecular synthesis, the cytoplasm enlarges until the cells are 10-30 um in diameter, and the nucleus becomes less completely heterochromatic; they are then referred to as large lymphocytes or lymphoblasts. These cells then proliferate and differentiate into B and T memory cells and into the various effector cell types, B cells into plasma cells, which produces and secretes soluble antibodies, and T cells into helper, cytotoxic, and suppressor cells.
  • B lymphocyte refers to a type of white blood cell of the lymphocyte subtype that circulates in the blood and lymph, are non thymus-dependent, it is responsible for the production of immunoglobulins, and produces antibodies when it encounters specific antigens.
  • B lymphocytes are also called B cells. They function in the humoral immunity component of the adaptive immune system by secreting antibodies. Additionally, B cells present antigen (they are also classified as professional antigen-presenting cells (APCs)) and secrete cytokines.
  • B lymphocyte can be characterized immunophenotypically by CD 19 surface markers. Other B cell markers include CD9, CD 10, CD20, CD24, Fc receptor, Bl, BA-1, and B4 la.
  • B cells In mammals, B cells start out from hematopoietic stem cells in the bone marrow, migrates to the spleen to mature and upon maturation, then move on to the secondary lymphoid organs, such as the spleen and lymph nodes. They are the precursor of the plasma cells and express surface immunoglobulins but does not release them. Prior to encounters specific antigens, they are termed as "naive" B lymphocytes. Once exposed to an antigen, the naive B cell is now “activated” and either becomes a memory B cell or a plasma cell that produces and secretes antibodies specific to the antigen that was originally bound, i.e., the antigen that activated the nar ' ve" B cell. Plasma cells do not last long in the circulation, this is in contrast to memory cells that last for very long periods of time. Memory cells do not secrete antibody until re-activated by their specific antigen again.
  • PAM sequence refers to a 2-6 base pair DNA sequence immediately following the DNA sequence targeted by the Cas9 nuclease or nicknase in the CRISPR bacterial adaptive immune system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • Cas CRISPR Associated
  • PAM is a component of the invading virus or plasmid, but is not a component of the bacterial CRISPR locus.
  • PAM is an essential targeting component (not found in bacterial genome), which distinguishes bacterial self from non-self DNA, thereby preventing the CRISPR locus from being targeted and destroyed by nuclease.
  • the term "protospacer” when used in the context of PAM refers to short sequences ( ⁇ 20bp) of known foreign DNA separated by a short palindromic repeat and kept like a record against future encounters.
  • the foreign DNA inserted is usually an invading viral or plasmid DNA.
  • Homology and “homologous” refers to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing each position in the aligned sequences. A degree of homology between nucleic acid or between amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the sequences. As the term is used herein, a nucleic acid sequence is "homologous" to another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (as used herein, the term “homologous” does not infer evolutionary relatedness, but rather refers to substantial sequence identity).
  • sequence similarity in optimally aligned substantially identical sequences may be at least 60%, 70%, 75%, 80%, 85%, 90% or 95%.
  • the units e.g., 66, 67...81, 82, ...91, 92%.
  • coding or "encoding” in the context of a nucleic acid encoding a Cas 9 nuclease or nickase, or gudie RNA means the nucleic acid contains instruction or information therein to specify the genetic code for a endonuclease.
  • the instruction or information in a coding nucleic acid can be transcribe and translated to the encoded protein.
  • Substantially complementary nucleic acids are nucleic acids in which the complement of one molecule is substantially identical to the other molecule. Two nucleic acid or protein sequences are considered substantially identical if, when optimally aligned, they share at least about 70% sequence identity. In alternative embodiments, sequence identity may for example be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 98% or at least 99%. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol.
  • T is referred to as the neighborhood word score threshold.
  • Initial neighborhood word hits act as seeds for initiating searches to find longer HSPs.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1 % SDS at 42°C.
  • hybridization to filter- bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% SDS, 1 mM EDTA at 65°C, and washing in 0.1 x SSC/0.1 % SDS at 68°C.
  • Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
  • identity means the percentage of identical nucleotide at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ea., Oxford University Press, New York, 1988; Biocomputing: Informatics and - 14 Genome Projects, Smith, D. W., ea., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H.
  • nucleic acids refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., nucleotide sequence encoding an antibody described herein or amino acid sequence of an antibody described herein), when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection.
  • a specified region e.g., nucleotide sequence encoding an antibody described herein or amino acid sequence of an antibody described herein
  • sequences are then said to be “substantially identical.”
  • This term also refers to, or can be applied to, the compliment of a test sequence.
  • the term also includes sequences that have deletions and/or additions, as well as those that have substitutions.
  • the preferred algorithms can account for gaps and the like.
  • identity exists over a region that is at least about 25 amino acids or nucleotides in length.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence algorithm program parameters Preferably, default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • complementary base pair refers to A:T and G:C in DNA and A:U in RNA.
  • DNA consists of sequences of nucleotide only four nitrogenous bases: base or base adenine (A), thymine (T), guanine (G), and cytosine (C). Together these bases form the genetic alphabet, and long ordered sequences of them contain, in coded form, much of the information present in genes.
  • Most RNA also consists of sequences of only four bases. However, in RNA, thymine is replaced by uridine (U).
  • nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof ("polynucleotides”) in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid molecule/polynucleotide also implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated.
  • conservatively modified variants thereof e.g. degenerate codon substitutions
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). Nucleotides are indicated by their bases by the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G).
  • A adenine
  • C cytosine
  • T thymine
  • G guanine
  • nucleic acid sequence refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof.
  • the nucleic acid can be either single-stranded or double-stranded.
  • a single-stranded nucleic acid can be one strand nucleic acid of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA.
  • the template nucleic acid is DNA.
  • the template is RNA.
  • Suitable nucleic acid molecules are DNA, including genomic DNA, ribosomal DNA and cDNA.
  • RNA RNA
  • rRNA RNA
  • tRNA RNA
  • the nucleic acid molecule can be naturally occurring, as in genomic DNA, or it may be synthetic, ie., prepared based up human action, or may be a combination of the two.
  • the nucleic acid molecule can also have certain modification such as 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-0- methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0- DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), 2'-0-dimethylaminoethyloxyethyl (2'-0- DMAEOE), or 2'-0 ⁇ N-methylacetamido (2'-0-NMA), cholesterol addition, and phosphorothioate backbone as described in US Patent Application 20070213292; and certain ribonucleoside that are is linked between the 2'-oxygen and the 4'-carbon atoms with a methylene unit as described in US Pat No. 6,268,490, wherein both patent and patent application are incorporated hereby reference in their entirety.
  • vector refers to a nucleic acid construct designed for delivery to a host cell or transfer between different host cells.
  • a vector can be viral or non-viral.
  • the term “vector” refers broadly to any plasmid, phagemid or virus encoding an exogenous nucleic acid.
  • the term is also be construed to include non-plasmid, non-phagemid and non-viral compounds which facilitate the transfer of nucleic acid into virions or cells, such as, for example, poly-lysine compounds and the like.
  • the vector may be a viral vector that is suitable as a delivery vehicle for delivery of the nucleic acid, or mutant thereof, to a cell, or the vector may be a non-viral vector that is suitable for the same purpose.
  • examples of viral and non-viral vectors for delivery of DNA to cells and tissues are well known in the art and are described, for example, in Ma et al. (1997, Proc. Natl. Acad. Sci. U. S. A. 94: 12744-12746).
  • viral vectors include, but are not limited to, a recombinant Vaccinia virus, a recombinant adenovirus, a recombinant retrovirus, a recombinant adeno-associated virus, a recombinant avian pox virus, and the like (Cranage et al., 1986, EMBO J. 5: 3057-3063; International Patent Application No. W094/17810, published August 18,1994; International Patent Application No. W094/23744, published October 27,1994).
  • non-viral vectors include, but are not limited to, liposomes, polyamine derivatives of DNA, and the like.
  • viral vector is used according to its art-recognized meaning. It refers to a nucleic acid vector construct that includes at least one element of viral origin and may be packaged into a viral vector particle. The vector may be utilized for the purpose of transferring DNA, RNA or other nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.
  • lentiviral vector refers to a vector having a nucleic acid vector construct that includes at least one element of lentivirus origin.
  • lentivirus refers to a group (or genus) of retroviruses that give rise to slowly developing disease. Viruses included within this group include HIV (human
  • immunodeficiency virus including HIV type 1, and HIV type 2), the etiologic agent of the human acquired immunodeficiency syndrome (ADDS); visna-maedi, which causes encephalitis (visna) or pneumonia (maedi) in sheep, the caprine arthritis-encephalitis virus, which causes immune deficiency, arthritis, and encephalopathy in goats; equine infectious anemia virus, which causes autoimmune hemolytic anemia, and encephalopathy in horses; feline immunodeficiency virus (TTV), which causes immune deficiency in cats; bovine immune deficiency virus (BIV), which causes lymphadenopathy, lymphocytosis, and possibly central nervous system infection in cattle; and simian immunodeficiency virus (SrV), which cause immune deficiency and encephalopathy in sub-human primates.
  • ADDS human acquired immunodeficiency syndrome
  • visna-maedi which causes encephalitis (visna) or pneumonia (ma
  • viruses Diseases caused by these viruses are characterized by a long incubation period and protracted course. Usually, the viruses latently infect monocytes and macrophages, from which they spread to other cells. HIV, FIV, and SIV also readily infect T lymphocytes, i.e., T-cells.
  • contacting or "contact” as used herein in connection with contacting a cell includes subjecting the cell to an appropriate culture media which comprises the indicated composition.
  • compositions for directing class switch recombination (CSR) of an immunoglobulin heavy (IgH) chain in a mammalian cell to a desired IgH subclass comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide RNAs (gRNA).
  • CSR class switch recombination
  • each of the at least two gRNAs comprises a guide sequence that comprises a seed region of at least 10 consecutive nucleotides of a target sequence in a IgH gene polynucleotide sequence present in the cell or at least 10 consecutive nucleotides complementary to a target sequence in a IgH gene polynucleotide sequence present in the cell, and a Cas9 recognition sequence, wherein the target sequence of the gRNA guide sequence is contiguous to a protospacer adjacent motif (P AM) in the IgH gene polynucleotide sequence and wherein the PAM is recognized by a ribonucleoprotein complex comprising a Cas9 nuclease or nickase.
  • P AM protospacer adjacent motif
  • nuclease a hSaCas9 nuclease, a hSpCas9 nickase, a hSaCas9 nickase or a dCas9-Fokl nuclease.
  • S switch
  • IgH gene is selected from the group consisting of ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgGl), al (for IgAl), ⁇ 2 (for IgG2), ⁇ 4 (for IgG4), ⁇ (for IgE), and a2 (for IgA2).
  • the gRNA comprises a guide sequence or seed sequence that is selected from Table 1 and Table 4 and Table 5 or the the gRNA comprises a guide sequence or seed sequence that is complementary to a sequence selected from Table 1 and Table 4 and Table 5.
  • composition of any one of paragraphs 1-11, wherein the desired IgH subclass is selected from the group consisting of IgAl, IgA2, IgM, IgE, IgD, IgGl, IgG2, and IgG3 and
  • IgH (IgH) chain locus in a mammalian cell to a desired IgH subclass comprising contacting the mammalian cell with a composition of any one of paragraphs 1-13.
  • IgH IgH chain in a mammalian cell to a desired IgH subclass comprising contacting the mammalian cell with a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide RNAs (gRNA), or contacting with a composition comprising said vector.
  • a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide RNAs (gRNA), or contacting with a composition comprising said vector.
  • gRNA guide RNA
  • sequences that comprising a seed region of at least 10 consecutive nucleotides of a target sequence in the IgH gene polynucleotide sequence present in the cell and a Cas9 recognition sequence or at least 10 consecutive nucleotides complementary to a target sequence in a IgH gene polynucleotide sequence present in the cell, wherein the target sequence of the gRNA guide sequence is contiguous to a protospacer adjacent motif (P AM) in the IgH gene polynucleotide sequence and wherein said PAM is recognized by a ribonucleoprotein complex comprising a Cas9 nuclease or nickase.
  • P AM protospacer adjacent motif
  • the Cas9 nuclease or nickase is a hSpCas9 nuclease, a hSaCas9 nuclease, a hSpCas9 nickase, a hSaCas9 nickase or a dCas9-Fokl nuclease.
  • exon constant region gene segment in the IgH gene is selected from the group consisting of ⁇ , ⁇ , ⁇ , a, or ⁇ .
  • exon constant region gene segment in the IgH gene is selected from the group consisting of ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for IgM), ⁇ (for IgM), ⁇ 3 (for IgG3), ⁇ (for IgM), ⁇ (for IgM), ⁇ 3 (for IgG3), ⁇ (for IgM), ⁇ (for IgM), ⁇ (for IgD), ⁇ 3 (for IgG3), ⁇ (for
  • IgGl al (for IgAl), ⁇ 2 (for IgG2), ⁇ 4 (for IgG4), ⁇ (for IgE), and a2 (for IgA2).
  • gRNA guide sequence is complementary to a sequence selected from Table 1 and Table 4 and Table 5.
  • lymphocyte or a hybndoma.
  • the B lymphocyte is a mammalian B lymphocyte.
  • the mammals can be human, mouse, guinea pig, rat, or rabbit.
  • a monoclonal Fab fragment comprising: (a) providing a hybridoma clonal cell; and (b) contacting a mammalian cell with a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding a guide RNA (gRNA).
  • gRNA guide RNA
  • the gRNA comprises a guide sequence which comprising a seed region of at least 10 consecutive nucleotides of a target sequence in the IgH gene polynucleotide sequence present in the cell and a Cas9 recognition sequence, wherein the target sequence of the gRNA guide sequence is contiguous to a protospacer adjacent motif (PAM) in the IgH gene polynucleotide sequence and wherein said PAM is recognized by a ribonucleoprotein complex comprising a Cas9 nuclease or nickase.
  • PAM protospacer adjacent motif
  • a composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide RNAs (gRNA) for use in directing class switch recombination (CSR) of an immunoglobulin heavy (IgH) chain in a mammalian cell to a desired IgH subclass.
  • gRNA guide RNAs
  • a composition comprising a vector comprising a nucleic acid encoding a Cas9 nuclease or nickase and nucleic acids encoding at least two guide RNAs (gRNA) for use in rapid method of production of monoclonal antibody of a desired IgH subclass or producing a monoclonal Fab fragment.
  • gRNA guide RNAs
  • gRNA the 20-nt target sequences were selected to precede a 5'-NGG protospacer-adjacent motif (PAM) sequence.
  • PAM protospacer-adjacent motif
  • Oligonucleotides were purchased from Integrated DNA technology (IDT), annealed and cloned into the BsmBI-BsmBI sites downstream from the human U6 promoter in LentiCRISPR v2 plasmid, which was a gift from Feng Zhang (ADDGENE plasmid #52961). Oligonucleotides used in this study for cloning are listed in Table 2.
  • RetroCRISPR vl plasmid To generate RetroCRISPR vl plasmid, all gRNAs were first cloned in LentiCRISPR v2 vector. To obtain retroviral backbone, pMSCVgfp::AID plasmid, a gift from Nina Papavasiliou
  • RetroCRISPR vl plasmid (FIG. 8A). Since smaller size of plasmid is more efficient to produce retroviral particles, we decided to make a RetroCRISPR v2 plasmid.
  • the construct harboring 5CWWHI-P2A-GFP-C was PCR amplified using pMSCVgfp:AED as a template with forward primer: 5'-
  • RetroCRISPR v2 plasmid PCR products were cloned into RetroCRISPR vl plasmid digested with BamHI and Clal restriction enzymes (FIG. 8B).
  • HEK293FT cells (Invitrogen), Phoenix-ECO cells, and GP2-293 packaging cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 units/ml penicillin-streptomycin (P/S), and 2 mM L-Glutamine (L-Glu). Cells were cultured at 37°C in 5% C0 2 atmosphere.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • P/S penicillin-streptomycin
  • L-Glu 2 mM L-Glutamine
  • 5.5xl0 6 HEK293FT cells were plated per 10 cm dish. The following day, cells were transfected by calcium phosphate transfection method with 7.2 ⁇ g of lentiCRISPR plasmid, 3.6 ⁇ g of VSVG, 3.6 ⁇ g of RSV-REV, and 3.6 ⁇ g of PMDLg/pPRE. The media was changed 8 h post-transfection. The viral supernatant was collected 48 h post-transfection, passed through a 0.45 ⁇ filter, pooled and used either fresh or snap frozen.
  • retroviral particle for human cells 3.5xl0 6 GP2-293 packaging cells were plated per 10 cm dish. The following day, cells were transfected by Xfect transfection reagent (Clontech) with 10 ⁇ g of retroviral plasmid and 5 ⁇ g of pVSVG retrovirus envelop plasmid. The media was changed 4h post-transfection. The viral supernatant was collected 48 h post-transfection, passed through a 0.45 ⁇ filter, pooled and used either fresh or snap frozen.
  • Naive B cells were separated from total spleen cell suspensions using a-CD43 magnetic microbeads (Miltenyi).
  • the CD43-negative fraction was cultured with a-CD40 (1 ⁇ g/ml; eBioscience) and IL-4 (20 ng/ml; PeproTech) for 4 days.
  • Retrovirus infection was performed 24 h post-activation.
  • Activated-B cells were transduced with viral supernatant supplemented with 6 ⁇ g/ml polybrene. The viral supernatant was exchanged for fresh medium containing a-CD40 and IL-4 6 h later.
  • Hybridomas were generated as previously describedl5 and cultured in RPMI 1640 medium GlutaMax (Invitrogen) supplemented with 15% FBS and 100 units/ml P/S. Hybridomas were maintained at 37°C in 5% C0 2 atmosphere. For transduction, 2xl0 5 cells were plated into six-well plates and transduced with viral supernatant supplemented with 6 ⁇ g/ml polybrene. The viral supernatant was exchanged for fresh medium 6 h later. After 2 days, cells were treated with 3 ⁇ g/ml of puromycin to select resistant cells until non-infected cells were completely dead.
  • All human lymphomas used in this study were cultured and maintained in RPMI 1640 medium supplemented with 10% FBS, 100 units/ml P/S, and 2 mM L-Glu. All cell lines were cultured at 37°C in 5% C0 2 atmosphere. For transduction, 2xl0 5 cells were plated into six-well plates and transduced with viral supernatant supplemented with 6 ⁇ g/ml polybrene. The viral supernatant was exchanged for fresh medium 6 h later. After 2 days, cell lines were treated with 0.2 ⁇ g/ml of puromycin to select resistant cells until non-infected cells were completely dead.
  • JEKO-1 cells were first transduced with lentiviruses to induce deletion between ⁇ and Sy3, cultivated for 5 days and then transduced with GFP-reporter ⁇ 3 ⁇ 1021 ⁇ or control MIGR1 retrovirus.
  • Genomic DNA isolation, PCR, and Sequencing analysis Mouse fibroblast, hybridomas, and JEKO-1 cells were transduced with lentiviruses, selected with puromycin, and collected after 5 days of transduction. Genomic DNA was extracted using Rapid lysis buffer containing 10 ⁇ g/ml Proteinase K by incubating at 56°C overnight. Primers used for PCR amplifications to detect deletions, inversions, and excision circles from mouse fibroblasts, hybrodomas, or JEKO-1 cells are listed in Table 3. PCR products were gel purified and cloned using pGEM-T easy vector system (Promega). Mutations were identified by Sanger sequencing.
  • IgGl antibody (BD Pharmingen) or APC-conjugated a-IgM for 30 min on ice, and analyzed using a FACSVerse flow cytometer (BD Biosciences). IgGl+ cells were gated on GFP. Data were analyzed by Flow Jo software.
  • Human lymphoma cells were co-stained with APC-conjugated a-CD19 and either FITC- conjugated a-IgM or FITC-conjugated a-IgG or FITC-conjugated a-IgA antibodies (MyBioSource) for 30 min on ice to detect IgG or IgA switching, respectively.
  • FITC- conjugated a-IgM or FITC-conjugated a-IgG or FITC-conjugated a-IgA antibodies MyBioSource
  • JEKO-1 cells were transduced with three different lentiviruses indicated in FIG. 14.
  • Cells were co-stained with PE- conjugated a-IgG and FITC-conjugated a-IgA antibodies (MyBioSource) for 30 min on ice.
  • FITC-conjugated a-IgM and PE-conjugated a-IgG were stained with the three following combinations: FITC-conjugated a-IgM and PE-conjugated a-IgG, FITC-conjugated a-IgA and PE-conjugated a-IgG, or PE-conjugated a-IgM and FITC-conjugated a-IgA antibodies (MyBioSource) for 30 min on ice.
  • Cells were analyzed using a FACSVerse flow cytometer (BD biosciences). Data were analyzed by Flow Jo software (Flow Jo).
  • samples were loaded on 4-15% Mini-PROTEIN TGX gels (BIO-RAD), transferred on nitrocellulose membrane (GE Healthcare), blocked with 5% Skim milk (BIO-RAD), incubated with Rat monoclonal a-mouse kappa light chain (HRP) (clone H139-52.1, Abeam) or Goat polyclonal a-mouse IgG-H&L chain (HRP) (GE Healthcare), and developed with ECL solution (GE Healthcare).
  • HRP Rat monoclonal a-mouse kappa light chain
  • HRP Goat polyclonal a-mouse IgG-H&L chain
  • ECL solution GE Healthcare
  • CSR CRISPR/Cas9 mediated class switch recombination
  • CSR is a DNA deletion induced by two DSBs occurring in the S regions preceding the IgH constant sequences
  • the inventors sought to engineer CSR by CRISPR/Cas9-mediated DNA deletion.
  • the inventors first designed a system to target the mouse IgH locus. Given that S regions are highly repetitive, the inventors generated lentiviral vectors expressing Cas9 and guide-RNA (gRNA) targeting the more specific DNA sequences flanking immediately upstream ( ⁇ 5' gRNA and Syl 5' gRNA) or downstream ( ⁇ 3' gRNA and Syl 3' gRNA) of the S regions that precede the mouse C ⁇ and Cyl IgH constant sequences (FIG. 1A and FIG. 6A).
  • gRNA Cas9 and guide-RNA
  • mice B cells When activated in vitro by anti-CD40 antibody and IL4, mouse B cells typically are induced to high levels of CSR (FIG. 8C) 15 , impairing a precise assessment of CSR induced by the CRISPR/Cas9 system.
  • CSR CRISPR/Cas9
  • retroviruses are more efficient to transduce primary B cells than lentiviruses, the inventors generated a retroviral vector that expressed Cas9 and the same gRNA used in fibroblasts (FIGS. 8A-8B).
  • CRISPR/Cas9 mediated CSR in mouse hybridoma cells.
  • the inventors transduced IgM+ hybridoma cells.
  • higher levels of CSR than in primary B cells were observed in all hybridomas tested with all gRNA combinations (range 4% to 11%) (FIGS. ID-IE).
  • similar levels of CSR were observed when the entire ⁇ and Syl regions were conserved ( ⁇ 3' gRNA with Syl 5' gRNA) or deleted ( ⁇ 5' gRNA with Syl 3' gRNA) (FIGS. 1A, ID-IE).
  • IgH subclasses for example IgGl vs IgG4
  • IgGl vs IgG4 IgH subclasses
  • the inventors designed Cas9-gRNA lentiviral vectors to target the regions flanking the human ⁇ ( ⁇ 5' gRNA and ⁇ 3' gRNA), Sy3 (Sy3 3' gRNA), Syl (Syl 3' gRNA) and Sal (Sal 3' gRNA) regions (FIG. 2a).
  • the inventors selected a panel of IgM+ human lymphoma cell lines that included mantle cell lymphoma (JEKO-1, GRANTA-519, UPN-1, UPN- 2, MAVER-1, MINO and Z138), Burkitt lymphoma (BL-41 and BJAB) and chronic lymphocytic leukemia (MEC-1).
  • the inventors investigated whether human B cells could be engineered to undergo consecutive rounds of CSR, i.e. whether B cells induced to switch first from IgM to IgG3 (or IgGl) were then editable to a sequential switch to IgA.
  • the inventors first induced CSR to IgG3 or IgGl by lentiviral transduction with ⁇ 3' gRNA and Sy3 3' gRNA or Syl 3' gRNA and isolated pure IgG3+ or IgGl+ clones (FIG. 2D and FIG. 14).
  • IgH subclasses of IgH had contrasting biological effects on lymphoma growth, as IgGl+ cells had a significant growth disadvantage over IgM+ cells, whereas IgG3+ or IgA+ cells were positively selected (FIGS. 4A-4D), thus indicating that different IgH subclasses in B cell lymphoma have different biological properties.
  • the inventors further investigated whether loss of BCR signaling the lead to growth disadvantage in IgH negative cells could be rescued by compensatory activation of key pathways downstream of the BCR signaling. This is an important biological concept because the BCR signaling is essential for the survival of malignant B cells through the activation of key downstream molecules such as the PI3K5 pathway 18 .
  • the inventors took advantage of a newly discovered point mutation (PI3K5E1021K) that constitutively activates PI3K5 independently of upstream BCR signaling and was recently described in patients with immunodeficiency and impaired CSR20, 21.
  • Fab' fragments are preferable to whole antibodies.
  • purified antibodies are often processed by enzymatic digestion with proteases, such as papain or pepsin, followed by further purification to remove the Fc binding portion and to maintain the antigen-specific binding portion (Fab' fragment) 22 .
  • proteases such as papain or pepsin
  • the inventors designed gRNAs targeting the DNA proximal to the papain cleavage site of the IgGl coding sequence.
  • the inventors tested either a frameshift approach where the deletion of the Fc portion is achieved by an out-of-frame NHEJ-mediated repair of the DSB introduced by Cas9 (Fc 5') or a complete deletion approach where the DNA sequence for the Fc portion is deleted by two flanking DSBs (Fc 5' and Fc 3') (FIG. 5 A).
  • Fc 5' out-of-frame NHEJ-mediated repair of the DSB introduced by Cas9
  • Fc 5' and Fc 3' FIG. 5 A
  • IgGl-negative engineered hybridomas secreted Fab' fragments together with the expected kappa-light chain 24
  • control IgGl+ hybridomas secreted the whole IgGl as expected (FIGS. 5D-5E).
  • both the Fab' fragments and the whole IgGl completely disappeared when the SDS-PAGE gel was run in reducing conditions (FIG. 18).
  • hybridomas producing Fab' fragments can be generated rapidly and effectively by CRISPR/Cas9 technology.
  • the predominance of precise junctions between the two DSBs generated by Cas9 reflects the described property of Cas9 to generate blunt ends 3bp upstream of the PAM sequence 26 . Blunt ends are then joined by the c-NHEJ pathway, which could also be responsible for small deletions or insertions 6 .
  • IgG antibodies are preferred for applications such as western blot analysis, immunohistochemistry and ELISA whereas IgM clones are typically discarded because IgM are pentameric, more difficult to purify and less stable than IgG.
  • IgG subclasses have different stability, as well as biological and biochemical properties. For examples, effector functions in terms of triggering FcyR-expressing cells, activating complement, phagocytosis or antibody-dependent cell-mediated cytotoxicity are different within IgGl, IgG2, IgG3, and IgG4 subclasses 30 .
  • hybridoma can be engineered to produce Fab' fragments instead of the corresponding whole IgH molecule.
  • Fab' fragments were directly produced and secreted by hybridoma cells in culture at comparable levels to the unedited whole IgH molecules. This approach would largely simplify the method for the production of Fab' fragments that is currently based on several steps of protease cleavage followed by purification of the resulting fragments.
  • BCR inhibition has recently changed the treatment landscape for B-cell malignancies 33"38 .
  • Inhibitors of key molecules in BCR signaling such as PI3K5 inhibitors (idelalisib) or Bruton tyrosine kinase-BTK inhibitors (ibrutinib) have been recently approved by the FDA for the treatment of CLL or MCL39 and others are under investigation 40 .
  • PI3K5 inhibitors idelalisib
  • ibrutinib Bruton tyrosine kinase-BTK inhibitors
  • Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012).
  • gRNA guide RNA
  • Table 5 The guide sequences of guide RNA (gRNA) identified in the 5 '-end and the 3 '-end of the different S regions for the mouse and human IgH locus (see Table 4 for the genome location of the S regions). These gRNA guide sequences are contiguous with a PAM having the NGG motif. The last three nucleotides of the gRNA guide sequences are the PAM sequences, shown is in bold here.
  • AAGCAACCCTGGATTGAAGG AGG (SEQ ID NO: 108)
  • AAGGGTAAGGAGAGGCCTAC AGG (SEQ ID NO: 124)
  • CTCTGCTGCCTCAGCTGTCC TGG SEQ ID NO: 127)
  • AAATCCAGTGTAGAAAGGGT AGG (SEQ ID NO: 156)
  • AAGAGGGACTCTAGGCCTGC TGG (SEQ ID NO: 60)
  • CAAGAGGGACATTGTGGGG AGG (SEQ ID NO: 212)
  • CTGCCCACTCCCTTTCTACC AGG SEQ ID NO: 287)
  • CAAAGGGTCAGGGGGAGGAG TGG (SEQ ID NO: 320)
  • ATCCCTCACCTCTTGCTCTG TGG (SEQ ID NO: 74)
  • Naive human B cell IgAl 5'
  • CAGCTCAGCGCTGTCATACC TGG (SEQ ID NO: 76)
  • CTGCCTCTCCTCTACACTGG AGG (SEQ ID NO: 395)

Abstract

La présente invention décrit des cellules produisant un anticorps génétiquement modifié comprenant des séquences chromosomiques corrigées associées à une région constante de chaîne lourde d'immunoglobuline, le locus d'IgH. En particulier, ces cellules sont générées au moyen d'un procédé de correction à médiation par CRISPR/Cas9. La présente invention décrit également des séquences guides d'ARN guide spécifiques (ARNg) qui ciblent la séquence chromosomique de la région constante de chaîne lourde d'immunoglobuline dans les régions de commutation.
PCT/US2017/019097 2016-02-25 2017-02-23 Commutateur de classe personnalisé de gènes d'immunoglobuline dans un lymphome et un hybridome par la technologie crispr/cas9 WO2017147278A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/999,476 US11530253B2 (en) 2016-02-25 2017-02-23 Customized class switch of immunoglobulin genes in lymphoma and hybridoma by CRISPR/CAS9 technology

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662299864P 2016-02-25 2016-02-25
US62/299,864 2016-02-25

Publications (1)

Publication Number Publication Date
WO2017147278A1 true WO2017147278A1 (fr) 2017-08-31

Family

ID=59685603

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/019097 WO2017147278A1 (fr) 2016-02-25 2017-02-23 Commutateur de classe personnalisé de gènes d'immunoglobuline dans un lymphome et un hybridome par la technologie crispr/cas9

Country Status (2)

Country Link
US (1) US11530253B2 (fr)
WO (1) WO2017147278A1 (fr)

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
WO2021188831A1 (fr) * 2020-03-18 2021-09-23 The Rockefeller University Édition de gènes d'anticorps dans des lymphocytes b et co-expression d'une protéine cargo
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
EP3844290A4 (fr) * 2018-09-13 2022-07-06 Ramot at Tel-Aviv University Ltd. Modification génétique de récepteurs de lymphocytes b et leurs utilisations dans la sécrétion d'anticorps induite par l'antigène
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103160515A (zh) * 2011-12-15 2013-06-19 华南农业大学 一种基于杂交瘤细胞的单链抗体的制备方法
US20140356908A1 (en) * 2013-03-15 2014-12-04 Erasmus University Medical Center Binding molecules
WO2014204726A1 (fr) * 2013-06-17 2014-12-24 The Broad Institute Inc. Administration et utilisation de systèmes crispr-cas, vecteurs et compositions pour le ciblage et le traitement du foie

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7604995B2 (en) * 2003-07-11 2009-10-20 New York University Compositions, kits, and methods for stimulation of homologous recombination
US20100076057A1 (en) 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
WO2010075424A2 (fr) 2008-12-22 2010-07-01 The Regents Of University Of California Compositions et procédés de réduction de gènes procaryotes
DK2836226T3 (en) 2012-02-24 2017-09-18 Hutchinson Fred Cancer Res COMPOSITIONS AND PROCEDURES FOR TREATING HEMOGLOBINOPATHY
US9637739B2 (en) 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
WO2013169398A2 (fr) 2012-05-09 2013-11-14 Georgia Tech Research Corporation Systèmes et procédés pour améliorer la spécificité et l'activité de nucléases
JP6343605B2 (ja) 2012-05-25 2018-06-13 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Ｒｎａ依存性標的ｄｎａ修飾およびｒｎａ依存性転写調節のための方法および組成物
MX2014014650A (es) 2012-05-30 2015-10-14 Univ Washington Minivectores superenrollados como una herramienta para la reparacion, alteración y reemplazo de ácido desoxirribonucleico.
JP6329537B2 (ja) 2012-07-11 2018-05-23 サンガモ セラピューティクス， インコーポレイテッド 生物学的薬剤の送達のための方法および組成物
DK2872625T3 (en) 2012-07-11 2017-02-06 Sangamo Biosciences Inc METHODS AND COMPOSITIONS FOR TREATING LYSOSOMAL STORAGE DISEASES
PL3494997T3 (pl) 2012-07-25 2020-04-30 The Broad Institute, Inc. Indukowalne białka wiążące dna i narzędzia perturbacji genomu oraz ich zastosowania
WO2014022702A2 (fr) 2012-08-03 2014-02-06 The Regents Of The University Of California Procédés et compositions permettant de réguler l'expression génique par maturation de l'arn
CN104769112A (zh) 2012-11-01 2015-07-08 菲克特生物科学股份有限公司 用于在细胞中表达蛋白质的方法和产品
US8697359B1 (en) 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
KR20160034901A (ko) * 2013-06-17 2016-03-30 더 브로드 인스티튜트, 인코퍼레이티드 서열 조작에 최적화된 ｃｒｉｓｐｒ-ｃａｓ 이중 닉카아제 시스템, 방법 및 조성물
AU2015247323B2 (en) 2014-04-18 2021-07-01 Editas Medicine, Inc. CRISPR-Cas-related methods, compositions and components for cancer immunotherapy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103160515A (zh) * 2011-12-15 2013-06-19 华南农业大学 一种基于杂交瘤细胞的单链抗体的制备方法
US20140356908A1 (en) * 2013-03-15 2014-12-04 Erasmus University Medical Center Binding molecules
WO2014204726A1 (fr) * 2013-06-17 2014-12-24 The Broad Institute Inc. Administration et utilisation de systèmes crispr-cas, vecteurs et compositions pour le ciblage et le traitement du foie

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHEONG, TK ET AL.: "Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system", NATURE COMMUNICATIONS, vol. 7, no. 10934, 9 March 2016 (2016-03-09), pages 1 - 10, XP055272094 *
DEDEOGLU, F ET AL.: "Induction of activation-induced cytidine deaminase gene expression by IL -4 and CD 40 ligation is dependent on STAT6 and NFkB", INTERNATIONAL IMMUNOLOGY, vol. 1 6, no. 3, March 2004 (2004-03-01), pages 395 - 404, XP055412723 *
JANEWAY, CA ET AL., IMMUNOBIOLOGY: THE IMMUNE SYSTEM IN HEALTH AND DISEASE, 2001, New York *
ZHENG, S ET AL.: "Non-coding RNA generated following lariat-debranching mediates targeting of AID to DNA", CELL, vol. 161, no. 4, 7 May 2015 (2015-05-07), pages 762 - 773, XP029224280 *

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
EP3844290A4 (fr) * 2018-09-13 2022-07-06 Ramot at Tel-Aviv University Ltd. Modification génétique de récepteurs de lymphocytes b et leurs utilisations dans la sécrétion d'anticorps induite par l'antigène
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2021188831A1 (fr) * 2020-03-18 2021-09-23 The Rockefeller University Édition de gènes d'anticorps dans des lymphocytes b et co-expression d'une protéine cargo
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
US20210047386A1 (en) 2021-02-18
US11530253B2 (en) 2022-12-20

Similar Documents

Publication Publication Date Title
US11530253B2 (en) Customized class switch of immunoglobulin genes in lymphoma and hybridoma by CRISPR/CAS9 technology
US11912746B2 (en) PD-1 homing endonuclease variants, compositions, and methods of use
Cheong et al. Editing of mouse and human immunoglobulin genes by CRISPR-Cas9 system
Ellis et al. Genetic engineering of T cells for immunotherapy
JP7142571B2 (ja) リンパ球における高レベル且つ安定な遺伝子移入のための方法
US11732255B2 (en) CBLB endonuclease variants, compositions, and methods of use
IL302641A (en) Genetically engineered cells and methods for their preparation
WO2017070429A1 (fr) Procédés consistant à éditer des polynucléotides codant pour un récepteur de lymphocytes t
US11530395B2 (en) TGFBetaR2 endonuclease variants, compositions, and methods of use
US10793843B2 (en) CBLB endonuclease variants, compositions, and methods of use
JP6965466B2 (ja) 操作されたカスケード構成要素およびカスケード複合体
US20200360439A1 (en) Engineered chimeric guide rna and uses thereof
CA3118830A1 (fr) Therapie contre le cancer des cellules immunitaires anti-ptk7
US20220235380A1 (en) Immune cells having co-expressed shrnas and logic gate systems
Ou et al. Reprogramming of the heavy-chain CDR3 regions of a human antibody repertoire
US20220162648A1 (en) Compositions and methods for improved gene editing
Costello et al. Chicken MBD4 regulates immunoglobulin diversification by somatic hypermutation
WO2023064928A2 (fr) Cellules immunitaires ayant des arnsh co-exprimés et des systèmes de porte logique
TW202235617A (zh) 用於減少細胞中ii類mhc之組合物及方法
WO2016176152A2 (fr) Vecteurs de virus spumeux re-ciblés
Edelstein et al. Challenges and opportunities in gene editing of B cells
US20200377878A1 (en) Modified t cells and uses thereof
US20230128917A1 (en) Genetically engineered immune cells having a disrupted cd83 gene
Ou et al. Efficient reprogramming of the heavy-chain CDR3 regions of a human antibody repertoire
EP4319773A1 (fr) Modification d'acides nucléiques codant pour epor

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17757198

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17757198

Country of ref document: EP

Kind code of ref document: A1