WO2017142165A1

WO2017142165A1 - Stem cells overepxressing heme oxygenase-1, and pharmaceutical composition containing same

Info

Publication number: WO2017142165A1
Application number: PCT/KR2016/012274
Authority: WO
Inventors: 권오경; 김용선; 이승훈
Original assignee: 서울대학교산학협력단
Priority date: 2016-02-19
Filing date: 2016-10-28
Publication date: 2017-08-24
Also published as: KR20170098056A; KR101870238B1

Abstract

Provided are: stem cells overexpressing heme oxygenase-1; and a pharmaceutical composition for treating nerve damage, an anti-inflammatory composition and an antioxidant composition, which contain the same.

Description

【Specification】

[Name of invention]

Stem Cells Overexpressing Heme Oxygenase and Pharmaceutical Compositions Comprising the Same

Provided are stem cells overexpressing ham oxygenase-1 (Heme oxygenase-1), and pharmaceutical compositions, anti-inflammatory compositions and antioxidant compositions for treating neuronal damage comprising the same. [Background technology]

In nerve damage, such as spinal cord injury, peroxides secreted over hours to days after primary physical injury further damage the nerve (the spinal cord). Methylprednisolone sodium rotsinate for the treatment of such damage

Antioxidants have been used but have not been successful. Genetically engineered stem cells (eg, mesenchymal stem cells), on the other hand, are brain derived neurotrophic factor (BDNF), nerve growth factor (NGF), and neurotrophin-3 (neurotrophin). -3; NT-3) has been studied for the transfer of factors, but most transplanted cells die within the first few days due to oxidative stress, hypoxia, and immune reactions, which is inadequate to achieve the desired effect. It was.

Therefore, the development of more effective treatment techniques for nerve damage such as spinal cord injury is required.

[Content of invention]

Problem to be solved

One example provides fungal cells overexpressing Heme oxygenase-1 (ΗΟ-1).

Another example includes stem cells overexpressing the heme oxygenase-1. Provided is a composition for nerve regeneration.

Another example is neuronal regeneration of stem cells overexpressing the heme oxygenase-1. Provided is a method of nerve regeneration comprising administering to a subject in need. Another example provides a pharmaceutical composition for preventing and / or treating nerve damage or a disease associated with nerve damage, including stem cells overexpressing ham oxygenase-1.

Another example is the prophylaxis and / or treatment of a disease related to nerve damage or nerve damage, comprising administering the stem cells overexpressing ham oxygenase-1 to a subject in need of amelioration and / or treatment of nerve damage. Provide a method.

Another example provides an anti-inflammatory composition comprising stem cells overexpressing the heme oxygenase-1.

Another example provides a method of inhibiting inflammation comprising administering the stem cells overexpressing heme oxygenase ᅳ 1 to a subject in need of inflammation inhibition. Another example provides an antioxidant composition comprising stem cells overexpressing the ham oxygenase-1.

Another example provides an antioxidant method comprising the step of administering a pleasant cell overexpressing the heme oxygenase-1 to a subject in need of antioxidant.

[Measures of problem]

In the present invention, it is more important to prevent further spinal cord injuries by strengthening antioxidant and anti-inflammatory effects at the early stage of spinal cord injury, which is seriously caused by oxidative and inflammatory damage, and therefore, stem cells having enhanced antioxidant and / or anti-inflammatory effects. It is proposed that the neural regeneration and / or neurorecovery effect can be obtained by using.

In the present invention, it was confirmed that stem cells overexpressing heme oxygenase-1 have excellent antioxidant activity, have a spinal cord function recovery effect, a reduction in fibrosis, a neuronal regeneration effect, and an inhibitory effect on inflammatory factors, and thus, heme oxygenase-1 Uses related to neuronal regeneration and / or anti-inflammatory and / or antioxidant effects of stem cells overexpressing are proposed.

One example provides stem cells that overexpress heme oxygenase-1.

Heme oxygenase-l (HO-1 or HMOX-1; EC 1.14.99.3) is an endogenous enzyme, an essential enzyme for heme catabolism, and heme Acts to decompose to iron, biliverdin, and carbon dioxide. Heme oxygenase-1 may be found in all animals, such as humans, dogs, mice, It may be derived from a mammal, but is not limited thereto. In one embodiment, the heme oxygenase is human heme oxygenase-1 (NCBI Accession No.

NP_002124.1 (coding gene (cDNA): NM— 002133.2), ADZ76424.1 (coding gene

(cDNA): JF323038.1), etc.), heme oxygenase-1 (NCBI Accession No. NP- 001 181898.1 (coding gene (cDNA): NM_001194969.1), etc.), mouse heme oxygenase-1 (NCBI Accession No. NP—034572.1 (coding gene (cDNA): NM_010442.2), etc.) and the like, but is not limited thereto.

The stem cells may be selected from the group consisting of embryonic stem cells and adult stem cells, for example adult stem cells.

Adult stem cells are stem cells extracted from umbilical cord blood (umbilical cord blood) or adult bone marrow, blood, and the like, and refer to primitive cells immediately before they are differentiated into specific organ cells. The adult stem cells are hematopoietic stem cells,

It may be at least one selected from the group consisting of mesenchymal stem cells, neural stem cells and the like. The adult stem cell may be an adult stem cell of a mammal, such as a human, a dog, or a mouse. Adult stem cells are difficult to proliferate and are prone to differentiation. Instead, adult stem cells can be used to reproduce various organs required by actual medicine, and to be differentiated according to the characteristics of each organ after transplantation. It can be advantageously applied to the treatment of incurable diseases / incurable diseases.

In one embodiment, the adult enjoyment cells may be mesenchymal stem cells, such as mammalian mesenchymal stem cells such as humans, dogs, or mice. Mesenchymal stem cells (MSCs), also called mesenchymal stromal cells (MSCs), are known as osteoblasts, chondrocytes, myocytes, adipocytes, etc. Pluripotent cells capable of differentiating into various cell types

(means multipotent stromal cells) ᅳ Mesenchymal stem cells are called placenta and cord blood

(umbilical cord blood), adipose tissue, adult muscle, corneal stroma

may be selected from pluripotent cells derived from non-marrow tissues such as corneal stroma, dental pulp of teeth, and the like.

The stem cells overexpressing the heme oxygenase, for example, in addition to the intrinsic heme oxygenase-1 gene, are foreign (i.e. allogeneic or Stem cells having a higher expression level of heme oxygenase _] compared to stem cells that do not contain the foreign heme oxygenase gene, further comprising a heme oxygenase-1 gene derived from heterologous stem cells It may mean, but is not limited thereto, and may mean all stem cells in which the expression of heme oxygenase-1 is increased by wild-type stem cells by all conventional gene overexpression techniques. The foreign heme oxygenase gene may be, for example, included in a recombinant vector and introduced into stem cells. That is, the stem cell overexpressing the heme oxygenase-1 may include a recombinant vector containing a foreign heme oxygenase gene. The endogenous heme oxygenase-1 gene and / or the foreign heme oxygenase-1 gene may be of mammalian origin and may be of the same or different origin from each other.

The recombinant vector may include conventional gene expression control sequences, such as a promoter, a terminator, in addition to the heme oxygenase-1 gene. In the recombinant vector, gene expression control sequences such as promoters, transcription termination sequences, and the like may be operably linked with the heme oxygenase-1 gene, which is a foreign gene to be inserted. The term "operatively linked" means a functional link between a gene expression control sequence and another nucleotide sequence. The gene expression control sequence may be "operatively linked" to regulate transcription and / or translation of the inserted heme oxygenase-1 gene.

The promoter is one of the transcriptional regulatory sequences that regulate the transcriptional initiation of a particular gene and is typically a polynucleotide fragment about 100 to about 2000 bp or about 100 to about 2500 bp in length. In one embodiment, the promoter can be used without limitation as long as it can regulate transcriptional initiation in animal cells, such as mammalian cells (especially stem cells such as adult stem cells). For example, the promoter may be a CMV promoter (e.g., a CMV immediate-early promoter), an SV40 promoter, an adenovirus promoter, a pi promoter, a trp promoter, a lac promoter, a toe promoter, a T7 promoter, vaccinia Promoters of prokaryotic or mammalian viruses, such as the virus 7.5Κ promoter, the tk promoter of HSV, the SV40E1 promoter, the Respiratory syncytial virus (RSV) promoter, and metallothionine Metallothionin promoter, β-actin promoter, ubiquitin C promoter,

EF1 (elongation factor 1) promoters (e.g., EFl-alpha promoters), human IL-2 (human interleukin-2) gene promoters, human lymphotoxin gene promoters, human GM-CSF (human granulocyte-macrophage colony) stimulating factor) genes "promoter, PGK (phosphoglycerate kinase) promoter (eg, PGK1 promoter, etc.) may be one or more selected from the group consisting of animal cell promoters, but is not limited thereto.

The transcription terminator may include a polyadenylation sequence (pA) and the like.

The term "vector" means all means for expressing a gene of interest in a host cell. The vector includes elements for expression of a gene of interest (ie, ham oxygenase-1 gene), and includes a replication origin, a promoter, an operator, a transcription terminator, and the like. And may further comprise appropriate enzyme sites (eg, restriction enzyme sites) for introduction of the host cell into the genome and / or selection markers to confirm successful introduction into the host cell, and the like (FIG. 1). The recombinant vector may further comprise a transcriptional regulatory sequence other than a promoter.

The replication origin may be Ω replication origin, SV40 replication origin, pMBl replication origin, adeno replication origin, AAV replication origin, BBV replication origin and the like.

In addition, the recombinant vector may further comprise a selection marker. The selection marker is one gene selected from the group consisting of drug resistance genes such as antibiotics, metabolic related genes, gene amplification genes, etc. as a gene for confirming whether a recombinant vector has been successfully introduced into a host cell or for stable cell line construction. It may be abnormal. Since the selection marker is not a factor that significantly affects the expression efficiency according to the optimal combination of vector, which is the core technology of the present invention, all genes commonly used as selection markers (eg, antibiotic resistance genes and / or metabolism-related Enzyme genes, etc.) may be used without limitation. ) Resistance gene, neomycin (neomycin) resistance Gene, blasticidin resistance gene, zeocin resistance gene, hygromycin resistance gene, puromycin resistance gene, thymidine kinase (TK) gene, dihydrofolate reduction gene At least one selected from the group consisting of an enzyme (Dihydrofolate reductase, DHFR) gene, glutamine synthetase (GS) gene, etc., but is not limited thereto.

For example, the vector may include plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors (e.g., Lentiviral vector),

It may be selected from the group consisting of viral vectors, such as adeno-associated virus vectors. Vectors that can be used as the recombinant vector include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColEl, pKT230 _: pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFRl). , pHV14, pGEX series, pET series, pUC19, etc.), phage (e.g., λ ^ ⁴ λΒ, λ-α½ΐΌη, λΔζ1, Μ13, etc.) or viruses (e.g., SV40, Lentiviral vector, etc.) It may be produced by, but is not limited thereto.

The transport (introduction) of the recombinant vector into the host cell may employ a transport method well known in the art. The delivery method may include, for example, micro-injection method, calcium phosphate precipitation method, electroporation method, liposome-mediated transfection method, gene bombardment, Lentiviral Expression system (System Biosciences), but not limited thereto. It doesn't happen.

The method for selecting a recombinant cell (transformer) into which the expression vector is introduced can be easily carried out according to methods well known in the art using conventional selection markers. For example, if the selectable marker is a specific antibiotic resistance gene as described above, the cells may be removed from the medium containing the antibiotic.

By culturing, recombinant cells into which a recombinant vector has been introduced can be easily selected.

The host cell, as described above, stem cells isolated from humans, dogs, mice and the like, for example, hematopoietic stem cells (hematopoietic stem cells),

It may be one or more adult stem cells selected from the group consisting of mesenchymal stem cells, neural stem cells, etc., in one embodiment placenta, umbilical cord blood, fat Adipose tissue, adult muscle may be one or more mesenchymal stem cells selected from pluripotent cells derived from non-marrow tissues such as adult muscle, corneal stroma, dental pulp of teeth, etc. .

The heme oxygenase-1 gene included in the recombinant vector may be derived from allogeneic or heterologous stem cells, which are host cells into which the recombinant vector is to be introduced.

Stem cells overexpressing ham oxygenase-1, including the recombinant vector containing heme oxygenase-1 as described above, have excellent antioxidant activity (see Examples 4 and 5), and are applied to lesion sites of spinal cord injured animals. Spinal cord function restoring effect at the time of transplantation (see Examples 7 and 6 and 7), reduction of fibrosis (see Examples 8 and 8 and 9), neuronal regeneration effect and inflammatory factor inhibitory effect (Examples 9 and 10, And FIGS. 10 to 25). Thus, another example is overexpressing ham oxygenase-1.

It is proposed an application as a pharmaceutical composition and / or method which has an effect of ameliorating, preventing and / or treating the related symptoms of stem cells.

One example provides a composition for nerve regeneration comprising stem cells overexpressing the heme oxygenase-1. Another example provides a method for nerve regeneration comprising administering the stem cells overexpressing ham oxygenase-1 to a subject in need of nerve regeneration. The nerve regeneration may mean an action of restoring a damaged nerve by promoting regeneration of nerve cells in the damaged nerve tissue.

Another example provides a pharmaceutical composition for preventing and / or treating a nerve injury or a disease associated with nerve injury, including stem cells overexpressing the heme oxygenase-1. Another example is the prophylaxis and / or treatment of a disease related to nerve damage or nerve damage, comprising administering the stem cells overexpressing ham oxygenase-1 to a subject in need of amelioration and / or treatment of nerve damage. Provide a method. The nerve damage may mean, for example, damage to the central nervous system or damage to the peripheral nervous system such as the brain and spinal cord, and the damage may be chronic or acute injury. In one embodiment, the nerve injury may be acute injury of the central nervous system, but

It is not limited. Diseases related to nerve damage include diseases related to central nervous system damage, such as cerebral infarction, brain tumor, meningitis, brain trauma, multiple sclerosis, and brain lesions, muscular dystrophy, myelomyelitis, myotrophic lateral sclerosis, myasthenia gravis, muscular dystrophy, multiple myositis, etc. Peripheral nervous system damage related diseases may be selected from the group consisting of.

Another example provides an anti-inflammatory composition comprising stem cells overexpressing the heme oxygenase-1. Another example provides a method of inhibiting inflammation comprising administering the stem cells overexpressing heme oxygenase-1 to a subject in need of inflammation inhibition. Another example is to overexpress the heme oxygenase-1

Provided is a composition for the prophylaxis and / or treatment of inflammation or inflammation-related diseases comprising the enjoyment cells ᅳ Another example is to prevent and / or treat the stem cells overexpressing the heme oxygenase-1 Provided are methods for the prevention and / or treatment of inflammation or inflammation-related diseases comprising administering to a subject in need thereof. The inflammation-related disease may be selected from the group consisting of infectious or non-infectious inflammation, soft tissue injury, fracture, degenerative arthritis, immunomediated inflammation or immunomediated inflammatory disease (eg, immunomediated arthritis, etc.).

Another example provides an antioxidant composition comprising stem cells overexpressing the heme oxygenase-1. Another example provides an antioxidant method comprising administering the stem cells overexpressing heme oxygenase-1 to a subject in need of antioxidant.

The subject (patient) may be an animal selected from mammals such as humans, dogs, mice, or (isolated) cells, tissues, body fluids (such as cerebrospinal fluid), or cultures derived from the animals, for example, Animals or cells (isolated) derived therefrom that require neuronal regeneration, prevention and / or treatment of nerve damage or nerve damage related diseases, inhibition of inflammation, prevention and / or treatment of inflammation or inflammation related diseases, or antioxidants, Tissue or body fluids, and the like. In one embodiment, the administration subject is the heme oxygenase _1 (eg, foreign heme oxygenase _ ₁₎ or an animal from which stem cells overexpress it (eg, a mammal such as a human, dog, mouse), or (Isolated) cells, tissues, body fluids (such as cerebrospinal fluid), or cultures thereof derived from the animal.

The pharmaceutical composition, overexpressing heme oxygenase-1 as an active ingredient

In addition to stem cells, it may further include a pharmaceutically acceptable carrier, which is commonly used in the formulation of drugs containing nucleic acids, lactose, dextrose, sucrose, sorbbi, manny, starch Acacia rubber, calcium phosphate, Alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, saline, syrup, methyl cellulose, methylhydroxybenzoate,

It may be one or more selected from the group consisting of propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but is not limited thereto. The pharmaceutical composition may also further include one or more selected from the group consisting of diluents, excipients, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like, which are conventionally used for preparing pharmaceutical compositions.

In one embodiment, the pharmaceutical composition may be a composition for cell transplantation for transplantation into a lesion.

Administration of the stem cells overexpressing the heme oxygenase-1 may be performed by various routes such as administration to an injury site (eg, cell transplantation), or intravenous administration (intravenous injection).

【Effects of the Invention】

The present invention provides a stem cell overexpressing heme oxygenase-1 and its medicinal use, excellent antioxidant capacity, exerts a spinal cord function recovery effect, fibrosis reduction effect, nerve cell regeneration effect and inflammatory factor inhibitory effect, Neuronal regeneration and / or anti-inflammatory and / or antioxidant effects may be obtained. [Brief Description of Drawings]

La to lc exemplarily show a cleavage map of a recombinant vector comprising the heme oxygenase-1 gene.

FIG. 2 shows recombinant mesenchymal stem cells overexpressing heme oxygenase-1 gene (hereinafter 'MSC-HO-1') and recombinant mesenchymal stem cells (hereinafter 'MSC') without overexpression of heme oxygenase-1 gene -GFP ') is a graph showing the cell viability.

3 is a Western blot showing the expression levels of heme oxygenase-1 in MSC-HO-1 and MSC-GFP.

4 is a graph quantifying the results of FIG.

Figure 5 is a graph showing the antioxidant capacity of the MSC-HO-1 and MSC-GFP in UAE (uric acid equivalents). 6 is a dog transplanted with MSC-HO-1 after induction of spinal cord injury (hereinafter,

This is a graph showing the Basso _: Beattie, and Bresnahan (BBB) scores of the MSC-HO-1 transplant group and the MSC-GFP transplant group (hereinafter referred to as the MSC-GFP transplant group).

Figure 7 shows the spinal cord injury induced MSC-HO-1 transplant group and MSC-GFP transplant group

In a graph showing the Tarlov score, (A) shows the Tarlov score determined by the revised Tarlov grade, and (B) shows the Tarlov score determined by the revised Tarlov grade (X: mean; +: median).

8 is a spinal cord lesions stained with hemaroxylin & eosin, (A) is a microscopic view of the damage site of the MSC-GFP transplant group, (B) is MSC-HO-1 Microscopic picture of the injury site of the transplant group.

FIG. 9 quantifies and shows fibrous tissue based on the results of FIG. 8.

It is a graph.

10 is a fluorescence image obtained as a result of immunofluorescence staining with an antibody against heme oxygenase-1.

1 is a fluorescence image obtained by immunofluorescence staining using an antibody against GFAP (glial fibrmary acidic protein)

12 is a fluorescence image obtained as a result of immunofluorescence staining with an antibody against beta 3-tubulin.

FIG. 13 is a fluorescence image obtained by immunofluorescence staining using an antibody against NF-M (neurofilament medium). FIG.

14 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against a nuclear nuclear antigen (NEU)

15 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against galactosylceramidase (GALC).

16 shows pSTAT3 (phosphorylated-signal transducer and activator of transcription)

Fluorescence image obtained as a result of immunofluorescence staining using the antibody for 3).

17 is a graph showing the results of quantifying the expression levels of heme oxygenase -l (HO-1), GFAP, beta 3-tubulin, NF-M, and NeuN shown in FIGS. 10 to 14. 18 is a graph showing the results of quantifying the amount of green fluorescent protein (GFP) expression in FIGS. 10 to 14. 19 shows the number of HO-1 secretory cells and the number of neuronal marker expressing cells in the MSC-HO-1 transplant group and the MSC-GFP transplant group (the HO-1 and various neuronal markers are derived from transplanted cells or endogenous cells, respectively). Is a graph showing the ratio to the total cell number.

Figure 20 Overexpressed protein in MSC-HO-1 transplant group and MSC-GFP transplant group

Western blot results showing expression levels of HO-1 and GFP.

FIG. 21 is a graph quantifying the results of FIG. 20.

22 is an inflammation marker in the MSC-HO-1 transplant group and the MSC-GFP transplant group.

Western blot results showing expression levels of TNF-alpha, IL6, COX2, p-STAT3, and GALC.

FIG. 23 is a graph quantifying the results of FIG. 22.

24 is a Western blot showing the expression levels of GFAP, beta 3-tubulin, NF-M, and NeuN, which are neuronal markers in the MSC-HO-1 transplant group and the MSC-GFP transplant group. FIG. 25 is a graph quantifying the results of FIG. 24.

[Specific contents to carry out invention]

Hereinafter, the present invention will be described in more detail with reference to examples, which are merely illustrative and are not intended to limit the scope of the present invention. It is apparent to those skilled in the art that the embodiments described below may be modified without departing from the essential gist of the invention. Example ₁ Heme Geoxygenase Overexpression Mesenchymal Stem Cells Preparation

1.1. Isolation and Cultivation of Mesenchymal Stem Cells Derived from Adipose Tissue in Canine

Canine adipose tissue-derived MSCs (cADMSCs) from dogs were obtained according to known methods (Lim JH, Byeon YE, Ryu HH, Jeong YH, Lee YW, Kim WH, et al., Transplantation of canine umbilical cord blood-derived mesenchymal stem cells in experimentally induced spinal cord injured dogs.J Vet Sci, 2007. 8 (3): p. 275-82).

In summary, adipose tissue was aseptically isolated from the gluteal subcutaneous fat after general anesthesia of the biennial beagle dog. All about animals Experimental measures followed a manual approved by the Animal Protection Agency and Seoul National University's Use Committee (SNU-141231-1).

The separated adipose tissue was washed with phosphate saturated saline (PBS), and then treated with collagenase type I (1 mg / mL; Sigma-Aldrich, St Louis, MO, USA) for 2 hours at 37 ° C. Then, the obtained semicoal water was washed with PBS and centrifuged at 300 × g for 10 minutes. The pellet (ie stromal vascular section) is resuspended, filtered through 100 nylon mesh, and then 37 ° C. and 5% in medium containing 10% fetal bovine serum (FBS, Gibco BRL, Grand Island, NY, USA). Incubated under wet C0 ₂ conditions.

Medium was changed at 48 hour intervals until confluent of the cells. After the confluence of cells reached 90%, the obtained culture was trypsinized, stored in liquid nitrogen, or subcultured. The obtained cells were transformed in cell passage 1 and incubated up to passage 3 before being used for the experiment.

1.2. Cloning of Heme Geoxinase -l (HO-l) in Dogs

The dog's coding gene (cDNA: NM-001 194969.1) was cloned from dog (beagle; Canis lupus familiar is). Lentiviral Expression system (System Biosciences, Mountain View, CA, USA) was used for this.

In summary, using Phusion DNA polymerase (Thermo Scientific, Pittsburgh, PA, USA) and dog heme oxygenase (hereinafter referred to as ΉΟ-Γ) specific (canine HO-1-specific) primer set 1 (see Table 1) The 879 bp gene fragment was amplified and cloned into the pEGFP-Cl vector to produce a pEGFP-C 1 HMOX1 recombinant vector (5604 bp) (see FIG. La). Amplify the dog HO-1 coding gene (867bp) using primer set 2 (see Table 1), and, using EcoRI and BamHI restriction enzymes, amplify the amplified gene (867bp) in pLenti6.3 V5-DEST verA vector ( Insert into Invitrogen Life Technologies; 8541 bp) (see FIG. Lb) and use primer set 3 (see Table 1)

The lentiviral expression vector was cooked by cloning in pCDH-EFl-MCS-BGH-PGK-GFP-T2A-Puro vector (see FIG. l c).

Specific base sequences of the primer sets used are shown in Table 1 below.

In summary:.

Table 1 HO-1 Forward primer GACAGCATGCCCCAGGAT (SEQ ID NO: 1) Plastic timer

TCACAGCCTAAGGAGCCAGT (SEQ ID NO: 1 HO-1 Reverse primer

2)

gtccggactcagatct atggagcgccctcagccc

HMOX1 Bglll Forward primer

Primer gacagcatgccccaggat (SEQ ID NO: 3) set 2 cttgagctcgagatct tcacatgacataaagtcc (SEQ ID NO:

HMOX1 Bglll Reverse primer

4)

CAAGGATGACGATGACAAG

HMOX—FLAG Forward primer

Primer atggagcgccctcagccc (SEQ ID NO: 5) Set 3 Gccctctagactcgag tcacatgacataaagtcc

HMOX XhoI Reverse primer

(SEQ ID NO: 6)

1.3. Construction of HO-1 Overexpressing Mesenchymal Stem Cells

HEK293T cells (Thermo Scientific Waltham, Mass., USA) were incubated at 37 ^° C. and 5% CO ₂ conditions in DMEM containing 10% FBS and P / o penicillin / streptomycin. ^Twenty four hours before transfection, 4χ10 ^ό ΗΕΚ293Τ cells were seeded in a 100 mm dish. The next day, using TurboFect (Thermo Scientific, Waltham, Mass., USA), 20ul with Lentiviral packaging mix (System Biosciences, San Diego, Calif., USA) encoding viral proteins Gag-Pol, Rev, and VSV-G. 2 ug of the lentiviral expression vector prepared in Example 1.2 was transfected into the prepared HEK293T cells (cells for lentiviral production).

Viral particles expressing HO-1 gene labeled with green fluorescent protein (GFP) were collected and transduced into cADMSCs of cell passage 1 prepared in Example 1.1 above. After cADMSCs reached 90% confluence, successfully transduced cell selection was performed using puromycin (3 g / ml, Gibco-BRL). Puromycin selection confirmed that approximately 40% of the cells were successfully transduced. In this manner, recombinant cADMSCs (hereinafter, "MSC-HO-l") into which foreign HO-1 gene was introduced (that is, overexpressing HO-1) were prepared. The selected recombinant cADMSCs were passaged and cells of cell passage 3 were used for the next experiment. All procedures in the course of the experiment are the Institutional Biosecurity Committee (SNUIBC) was performed to comply with (SNUIBC-R150716-1-1). Example 2 Measurement of Cell Viability of ΗΟ-1 Overexpressing Mesenchymal Stem Cells Recombinantly Transduced with HO-1 Gene Prepared in Example 1.3

After incubating cADMSCs (hereinafter 'MSC-ΗΟ-Γ), reaching 90% confluence,

Treatment with trypsin, using the AO / PI cell viability kit (F23001, Logos Biosystems, Annandale, VA 22003, USA) and dual fluorescence cell counter (Luna-FL, Logos Biosystems, Annandale, VA 22003, USA) Thus cell viability was measured. For comparison, cADMSCs without transduction (hereinafter 'cADMSCs') and pCDH-EFl-MCS-pA-PGK-copGFP-T2A-Puro vector (System without the HO-1 gene)

Biosciences) (ie, no overexpression of HO-1 was induced) cADMSCs (hereinafter referred to as

The same test was performed for 'MSC-GFP').

The obtained result is shown in FIG. In Figure 2, the y-axis shows the ratio of viable cell numbers to total cell numbers (survival;%). As shown in FIG. 2, the cell viability of cADMSCs, MSC-GFP, and MSC-HO-1 was 92.79 ± 4.61%, respectively.

There was no significant difference in viability between mesenchymal stem cells, with or without transduction, at 92.55 ± 1.32% and 91.53 3 3.25%. Example 3: Analysis of ΗΟ-1 Expression

Western blot was performed to analyze the amount of HO-1 expression in cADMSCs, MSC-GFP, and MSC-HO-1 prepared in Example 2. Clear cell lysates of each of these cells were obtained using PRO-PREP ™ protein extraction solution (iNtRoN Biotechnology). Protein concentration of the cell lysate was determined using the Bradford method.

(Bradford MM, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 1976. 72 (1): p. 248-54).

Each cell lysate sample was prepared in equal amounts (20 g), separated by electrophoresis on 10% sodium dodecyl sulfate polyacrylamide gels (SDS-PAG), and transferred to a polyvinylidene fluoride (PVDF) membrane. Membrane blots were washed with TBST (10 mM Tris-HCl, H 7.6, 150 mM NaCl, 0.05% Tween-20) and for 1 hour in 5% skim milk. Blocking. Primary antibodies were diluted and cultured together at the following concentrations: anti-actin antibody (Sigma-Aldrich, St, Louis, MO, USA): 1: 1000; anti-heme oxygenase 1 antibody (Abeam, Cambridge, UK): 1: 2000; And anti-GFP antibody (Thermo Scientific Waltham, MA, USA): 1: 1000. The membrane was washed and primary antibodies were detected using goat anti-rabbit IgG (Abeam, Cambridge, UK) or goat anti-mouse IgG (Abcam, Cambridge, UK) bound to horseradish peroxidase. The bands obtained are enhanced

Visualization was performed using chemiluminescence (Amersham Pharmacia Biotech, Buckinghamshire, UK).

The obtained electrophoretic photograph is shown in FIG. 3, and the graph of the results of FIG. 3 quantified using the image J program is shown in FIG. 4. As can be seen from the Western blot analysis of FIGS. 3 and 4, HO-1 expression in MSC-HO-1 was significantly higher than that in cADMSCs and MSC-GFP. In addition, in the case of GFP _: the expression of GFP was rarely measured in cADMSCs so that the cells were negative.

Can be used as a control, MSC-GFP and MSC-HO-1 are both

Expression of GFP was observed to confirm that the cells were cells that successfully transformed. (*, #: p <0.05). Example 4 Total Antioxidant Activity

Total anti-oxidant capacity (TAC) assay kit (Cell Biolabs)

The anti-oxidant capacity of the cell extract was measured using OxiSelect ™ San Diego, CA, USA.

The cells prepared in Example 1 were cultured, washed three times with PBS, scraped cells adhered to the bottom, suspended in cold PBS solution at a concentration of ⁷ lxlO per ml, crushed by sonicator, and centrifuged (10,000xg, at 4 ^° C). 10 minutes).

The supernatant was centrifuged in a 96-well microtiter plate in an amount of 20ul per well, and the reaction mixture was added to each well and mixed. In each well, add 180 ul of IX Reaction buffer, 50 ul of IX copper ion reagent, and 50 ul of 1 X stop solution to initiate reaction and incubate at 37 ^° C for 5 minutes. Finally, stop solution (The Total Anti-oxidant Capacity ( TAC) Assay Kit (Cell Biolabs OxiSelect ™, San Diego, CA, USA) was added to terminate the reaction, and the absorbance of the obtained reaction product was measured at 490 nm. Measured. The absorbance values obtained are proportional to the total reducing capacity of the sample.

The results obtained are expressed in uric acid equivalents (UAE). The standard curve was used to determine the UAE (mM) of the sample. Where y = 0.462x + 0.061 (R2 = 0.9938). The y value represents the absorbance and this value was used to obtain UAE (mM) showing the same OD at 490 nm.

The obtained antioxidant activity results are shown in FIG. 5. As shown in FIG. 5, the UAE level of MSC-HO-1 was significantly higher compared to cADMSCs and MSC-GFP, while there was no significant difference between cADMSCs and MSC-GFP (*, #, **: p <0.05). Example 5 Induction of Spinal Cord Injury in Dogs

Eight healthy beagle dogs (two year old female) were used. All dogs were judged to be in good condition with good health and neurological status and had a unique admission number from Seoul National University's Laboratory Animal Resources Agency (SNU-150209-3). All experiments were conducted in compliance with Animal Care and Use Guidelines (Institute of Laboratory Animal Resources, Seoul National University, Korea).

Spinal cord injury (balloon compression method; Lim JH, Byeon YE, Ryu HH, Jeong YH, Lee YW, Kim WH, et al., Transplantation of canine umbilical cord blood-derived mesenchymal stem cells in experimentally induced spinal cord injured dogs.J Vet Sci, 2007. 8 (3): p. 275-82).

In summary, for the prepared dogs, cephazoline sodium (40 mg / kg) (Cefazoline; Chong Kun Dang, Seoul, Korea), tramadol (4 mg / kg) (Toranzin; Samsung Pharm., Seoul, Korea) And intravenous administration with zolazepam hydrochloride (5 mg / kg) (Zoletil 50; Virbac, SA, Carros, France) and subcutaneous administration of atropine sulfate (0.05 mg / kg) (Atropine; Cheil Pharm., Seoul, South Korea). .

Anesthesia was maintained by inhalation of 2% isoflurane (Aerrane; Il Sung, Korea) in oxygen. Anesthetic monitor Datex-Ohmeda (Microvitec Display, Bradford, UK) was used to check rectal temperature, oxygen saturation, respiratory end-tidal C0 ₂ , and pulse rate during anesthesia. From the fourth lumbar segment (L4)

A hemiaminectomy was performed. 3-French embolectomy catheter (SORIN Biomedica, Salluggia, Italy) was inserted into the hole of L4. Under fluoroscopic guidance, the balloon catheter is advanced at the cranial margin of the first lumbar segment (L1) and diluted 50:50 with saline (Omnipaque; Amersham Health, Cork, Ireland). ) Inflate the area to 50 / / kg. The balloon catheter was fixed with a Chinese finger trap suture and removed after 12 hours. After spinal cord injury, soft tissues and skin were closed by standard methods.

After the above procedure, the dogs are bandaged and in intensive care unit

Monitoring. Dogs were provided with balanced nutrition twice a day, and if necessary, manual bladder expression was performed three or more times a day until spontaneous urination was performed. Example 6: Transplantation of Recombinant cADMSCs to Injured Sites

After one week from the induction of spinal cord injury of Example 5, recombinant cADMSCs, MSC-HO-1 and MSC-GFP, were injected (grafted) at the injured site. Dogs were anesthetized in the same manner as when inducing spinal cord injury. To describe the transplantation to the injury site in more detail, the L1 spinal cord is exposed through dorsal laminectomy, ⁷ IxlO cells are suspended with PBS 150, and a spinal cord injury site is used using a 30-gauge needle. (3 places: inserted into the middle of the injury site, proximal and distal margins 3 mm deep. Example ₇ Behavioral Evaluation of Transplanted Dogs

In order to evaluate the functional recovery of the hind limbs of the cell transplanted dogs in Example 6, behavioral evaluation was performed before the procedure, during the procedure, and for 8 weeks after the procedure.

Specifically, when the dogs each walked the floor, they were videotaped from both sides and from the back for at least 10 stems. Dogs whose hind legs could not support weight were also recorded with videotape while holding and supporting the tail base. The data obtained were obtained from the Basso, Beattie, and Bresnahan (BBB) score (Barros Filho TE, Molina AE, Analysis of the sensitivity and reproducibility of the Basso, Beattie, Bresnahan (BBB) scale in Wistar rats.Clinics (Sao Paulo), 2008. 63 (1): p. 103-8) and revised Tarlov and modified Tarlov scores (Rabinowitz RS, Eck JC, Harper CM, Jr., Larson DR, Jimenez MA, Parisi JE, et al., Urgent surgical decompression compared to methylprednisolone for the treatment of acute spinal cord injury: a randomized prospective study in beagle dogs. Spine (Phila Pa 1976), 2008. 33 (21): p. 2260-8). Two testers who were unaware of the experimental conditions scored the gait of the dogs separately from the videotape. The mean scores were calculated weekly after spinal cord injury until the end of the 9 week study period.

The obtained BBB score is shown in FIG. 6. The BBB score was 21 before induction of spinal cord injury and 0 after induction of spinal cord injury. BBB scores were obtained weekly until 8 weeks after transplantation. As shown in Figure 6, the index of the MSC-GFP transplant group and MSC-HO-1 transplant group gradually increased during the study period, but the rate of improvement decreased after 5 weeks after transplantation. In the group receiving MSC-HO-1 (n = 4), the BBB score improved significantly 7 weeks after transplantation compared to the MSC-GFP transplant group (n = 4) (*: p <0.05 ).

After induction of spinal cord injury, dogs used in all experiments showed complete pelvic limb paralysis. In the MSC-GFP group, some joint movements were observed to improve hind limb function, but they did not support their own weight. On the other hand, two dogs in the MSC-HO-1 transplant group were found to be able to support their weight.

In order to qualitatively evaluate the observed behavior, the Tarlov score was measured by the method described above, and the results are shown in FIG. 7. In Figure 7 (A) revised

The Tarlov score determined by the Tarlov grade, and (B) represent the Tarlov score determined by the modified Tarlov grade, respectively (X: mean value; +: median value). As shown in FIG. 7. Likewise, it can be seen that the hind limb motor function recovery was remarkable in the MSC-HO-1 transplant group (n = 4) compared to the MSC-GFP transplant group (n = 4).

6 and 7 are stem cells that are not induced with the overexpression of HO-1.

The spinal cord injury of MSC-GFP is also insignificant.

Although recovered, the overexpression of HO-1 induced the spinal cord injury site transplantation of MSC-HO-1 shows that the function of the damaged spinal cord can be restored even more significantly. Especially after 7 weeks of cell injection, significant functional recovery was observed in the MSC-HO-1 injection group. Example 8: Histopathological Evaluation

Eight weeks after transplantation of the eight dog cells used in the experiment, euthanized, and from the eleventh thoracic segment (Tl 1) to the third lumbar segment (third lumbar segment;

Spinal cord up to L3) was excised and extracted. 10% of each sample obtained

Sucrose / PBS and fixed at 4 ^° C for 12 hours in the conditions, to 20% were immersed in a 4 ^° C overnight to condition the sucrose solution. The dura was removed with scissors, buried in an optimal cutting temperature (OCT) compound (Tissue-Tek®, Sakura, Torrance, Calif., USA), shaken, and cut vertically to obtain two sections. Half of each section was immediately driven with liquid nitrogen for Western blot analysis, and the other half was cut into 10 / sized sections using cryomicrotome.

A portion of the 10 mm-sized sections were taken and sampled on silane-coated glass slides, and spinal cord lesions were examined for fibrosis.

Stained with hemafecillin & eosin. Using image analysis software (Image J version 1.47; National Institutes of Health, USA), any four sites in each sample (each section was cut to lOiim thick and 0.5 cm each to the head tail, including the lesion site) the organization carried out a morphometric analysis (Histomorphometric analysis) with respect to hedge marok published and eosin stained tissue sections were added in the form ^■ production).

8 and 9 show histopathological analysis results using the obtained hemafecillin & eosin stain.

8 is a picture of spinal cord lesions stained with haematoxylin & eosin. In Figure 8 (A) is a microscopic picture of the damage site of the MSC-GFP transplant group, fibroblast-like cell proliferation is found. 8B is

The microscopic examination of the injury site of the MSC-HO-1 transplant group showed a limited number of spinal cord lesions in the local area, and a significant decrease in fibrosis compared to the MSC-GFP transplant group, and fibroblast-like cell proliferation. A decrease of was observed. In FIG. 8 the scale bar represents 5 mm. In the MSC-GFP transplant group and the MSC-HO-1 transplant group, the size of the injured site was 1.50 ± 0.22 cm and 1.43 cm 0.28 cm, respectively, and there was no significant difference between them. Using the Hematoxylin & Eosin stains presented above Histopathological results show that pathological changes appear in the parenchyma. In the low magnification results (left photo of Fig. 8 (A) and (B)), a decrease in fibrosis was observed in the MSC-HO-1 transplant group (B) compared to the MSC-GFP transplant group (A). In addition, high magnification results (pictures on the right in FIGS. 8 (A) and (B)) show hemorrhage, fibroblast-like cell proliferation, and

Phenomenon such as infiltration of microglial cells into damaged sites was found to be reduced in the MSC-HO-1 transplant group.

Fibrous tissues were quantified based on the results of haematoxylin & eosin staining obtained in FIG. 8 and shown in FIG. As shown in FIG. 9, a significant decrease in fibrosis was observed in the MSC-HO-1 transplant group compared to the MSC-GFP transplant group (*: p <0.05). Example 9: Immunofluorescence Evaluation

For immunohistochemical measurements, anti-HO-1 antibodies (Abeam, Cambridge, UK), glial fibrillary acidic protein (GFAP), beta 3-tubulin, and neurofilament medium (NF) as neuronal or inflammatory markers -M), neuronal nuclear antigen (NeuN),

phosphorylated-signal transducer and activator of transcription 3 (pSTAT3), and

Immunofluorescence using primary antibodies against galactosylceramidase (GALC) (above, Santa Cruz Biotechnology, Santa Cruz, CA, USA), respectively

Immunofluorescence determination was performed.

In Example 8, the remaining fragments prepared at 10 / im size, which were not used for hemafecillin & eosin staining, were fixed, permeabilized with 0.1% (v / v) Triton X-100 for 10 minutes (permeabilize). After washing, pre-incubate for 30 minutes with 1% bovine serum albumin (BSA; Sigma-Aldrich, St, Louis, MO, USA) dissolved in PBS to prevent binding of nonspecific antibodies It was. Sections were incubated with the primary antibody at 4 ^° C. for 24 hours, incubated with secondary antibody (Abeam, Cambridge, UK) conjugated with fluorescein isothiocyanate (FITC) at room temperature for 60 minutes, washed, Samples were fixed on slides. Nuclei were stained using DAPI (4,6-diamidino-2-penylindole).

Fluorescence images of spinal cord injury sites obtained as a result of immunofluorescence staining performed 8 weeks after cell transplantation are shown in FIGS. 10 to 16. 10 shows antibodies against HO-1 1 shows the results of immunofluorescence staining, FIG. 1 shows the results of immunofluorescence staining with the antibody against GFAP, FIG. 12 shows the results of immunofluorescence staining with the antibody against beta 3-tubulin, and FIG. 13 shows the results for NF-M. Immunofluorescence staining using an antibody, FIG. 14 is an immunofluorescence staining using an antibody against NeuN, FIG. 15 is an immunofluorescence staining using an antibody against GALC, and FIG. 16 is an immunofluorescence staining using an antibody against pSTAT3. The result is. 10-16, HO-1, GFAP, beta 3-tubulin, NF-M, NeuN, GALC, and pSTAT3 are shown in red, transplanted cells are shown in green by GFP, and each cell nucleus is expressed in DAPI. Appears in blue. In Figures 10 to 16, a and b are the results of observing fragments of the MSC-GFP transplant group (a) and the MSC-HO-1 transplant group (b), respectively, and c and d represent the dotted box portions of a and b, respectively. This is an enlarged photo. Scale bar represents 50 um. As seen in Figures 10-16,

The expression levels of HO-1, beta 3-tubulin, NF-M, and NeuN in the MSC-HO-1 transplant group were higher than in the MSC-GFP transplant group, whereas the expression levels of GFAP, GALC, and p-STAT3 were higher. The expression level was inversely lower. In the MSC-HO-1 transplantation group, the factors related to nerve regeneration were high and the expression of factors related to scarring and inflammation of nerve tissue was decreased. It can be said that it can confirm the effective effect on regeneration and maintenance.

Immunofluorescence results of FIGS. 10 to 14 were quantified in FIGS. 17 to 19.

Indicated. The quantification was performed by randomly selecting 5 sites in each fluorescent stained sample image, counting green (GFP), red (expressed markers), and the number of overlapping red and green in 1000 cells. FIG. 17 shows ΗΟ-1 (FIG. 10), GFAP (FIG. 11), beta 3-tubulin (FIG. 12), NF-M (FIG. 13) in the MSC-HO-1 and MSC-GFP transplant groups. And the results of quantification of the expression level of NeuN (FIG. 14) (indicated in red in each corresponding figure), in comparison with the MSC-GFP transplant group, HO-1, beta in the MSC-HO-1 transplant group Expression of 3-tubulin, NF-M, and NeuN was high while expression of GFAP was found to be low, with the difference being significant (*: p <0.05). In the MSC-HO-1 group, the decrease of GFAP and the increase of the neuronal markers, beta 3-tubulin, NF-M, and NeuN, suppressed astrogliosis and scar formation, and regeneration (recovery) of neurons. Will prove. FIG. 18 shows the results of quantifying the expression level of GFP in FIGS. 10 to 14, and there was no significant difference between the MSC-HO-1 transplant group and the MSC-GFP transplant group.

19 shows the number of HO-1 secretory cells and the number of neuronal marker expressing cells in the MSC-HO-1 transplant group and the MSC-GFP transplant group (the HO-1 and various neuronal markers are derived from transplanted cells or endogenous cells, respectively). Is a graph showing the ratio to the total cell number. As shown in Figure 19, HO-1 secretory cell ratio is

The MSC-HO-1 (HO-1 overexpressing stem cell) transplanted group was higher and the percentage of neuronal marker expressing cells was higher in the endogenous cell-derived group than in the transplanted cell-derived group. Figures shown in Figure 19 is the ratio of transplanted cell derived (co-stained cell number of GFP and markers) and endogenous derived (marker alone stained cell number) divided by total cell number. As shown in Figure 19, HO-1 cells double-stained with GFP in the MSC-HO-1 transplant group was significantly higher than HO-1 alone stained cells (p <0.05), MSC-GFP

In the transplant group, the expression of HO-1 double stained with GFP was lower than that of HO-1 alone. In the MSC-HO-1 and MSC-GFP transplantation groups, the expression of the double-stained GFP markers was lower than that of the marker alone staining in all markers except HO-1. As such, the high expression of HO-1 double-stained with GFP in the MSC-HO-1 transplant group means that the cells overexpressing the HO-1 gene survive the transplantation to express HO-1, and neurons The high expression of the marker alone in the expression of the markers may mean that the transplanted HO-1 cells have a significant effect on neuronal regeneration or protection. Example 10 Western Blot Analysis

In Example 8, Western blot analysis was performed on the spinal cord sections isolated after 8 weeks of transplantation. The prepared spinal cord sections were washed twice with PBS and shaken at -150 ^° C. The fragments were then placed in a dissolution buffer (20 mM Tris, pH 7.5, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 1 mg / mL aprotinin, ImM phenylmethylsulfonylfluoride, and 0.5 mM sodium orthovanadate) and sonicated. Homogenized on ice for 30 minutes using a generator (three 20 second bursts; Branson Sonicator 250; Branson Ultrasonic Corp., Danbury, CT, USA). The obtained lysate was centrifuged (10 min at 4,500xg, 4 ^° C). Cleared and measured protein concentration by Bradford method.

The electrophoretic transfer process was performed in the same manner as described in Example 3. The antibodies used were as follows: anti-actin antibody, anti HO-1 antibody, anti NF-M antibody, anti NeuN antibody (Abeam, Cambridge, UK), anti GFP antibody (Thermo Scientific, Waltham, MA, USA), Anti-GFAP antibodies, anti beta 3 tubulin antibodies, anti TNF-alpha antibodies, anti IL6 antibodies, anti COX2 antibodies, anti pSTAT3 antibodies, and anti GALC antibodies (above, Santa Cruz Biotechnology, Texas, USA). The western blot was performed using a chemiluminescence kit (ECL kit, Invitrogen ™, Life Technologies, NY, USA), and the expression was confirmed by ChemiDoc. The obtained Western blot results were quantified by optical density measurement using Image J (version 1.47; National Institutes of Health, USA).

The obtained results are shown in FIGS. 20 to 25.

FIG. 20 is a Western blot showing expression levels of overexpressed proteins HO-1 and GFP in the MSC-HO-1 transplant group and the MSC-GFP transplant group, and FIG. 21 is a graph showing the quantification of the results of FIG. 20. . FIG. 22 is a Western blot showing the expression levels of inflammatory markers TNF-alpha, IL6, COX2, p-STAT3, and GALC in the MSC-HO-1 transplant group and the MSC-GFP transplant group. FIG. Is a graph showing the results of quantification. 24 is a western blot showing the expression levels of GFAP, exclusive 3-tubulin, NF-M, and NeuN, which are neuronal markers in the MSC-HO-1 transplant group and the MSC-GFP transplant group, and FIG. 25. It is a graph which quantified the result of 24. remind

Western blot data are expressed as mean ± standard error of three independent experiments. The quantification graph shows four results obtained for each transplant group (each n = 4) as the mean value ± standard error (*: p <0.05, **: p <0.001). In FIGS. 21, 23 and 25, the y-axis (Relative optical density (% of MSCs)) is obtained when the MSC-GFP transplantation (control) result is 1

The percentage of MSC-HO-1 transplant group outcomes is shown.

As seen in FIGS. 20 and 21, compared to the MSC-GFP transplant group,

The expression level of HO-1 in the MSC-GFP transplant group was significantly higher, and the expression level of GFP was not significantly different between the two groups. As shown in FIGS. 22 and 23, the expression of the inflammatory markers in the MSC-HO-1 transplant group was markedly compared with the MSC-GFP transplant group.

It was reduced, indicating that the inhibitory activity of MSC-HO-1. As shown in Figures 24 and 25, MSC-HO-1, compared to the MSC-GFP transplant group The expression of the neuronal markers beta 3-tubulin, NF-M, and NeuN in the transplant group was significantly increased, whereas the expression of GFAP was significantly reduced (meaning inhibition of astrogliosis and scarring). These results can be said to demonstrate the effect of reducing the regeneration effect of MSC-HO-1 neurons and the risk of neurological disease associated with the increase and / or accumulation of GFAP in the same manner as in Figure 17 described above. Statistical analysis

Data described herein are provided in medians and quartiles. Statistical analysis was performed using a commercially available statistical software program (SPSS Statistics, version 21.0, IBM Corp., NY, USA). In all experiments, the Mann-Whitney U test was used to compare the results between the two transplant groups. If the P value was <0.05, it was considered a significant result.

Claims

[Patent Claims]

[Claim 11

Stem cells overexpressing heme oxygenase-1.

[Claim 2]

The stem cell of claim 1, wherein the pleasant cell overexpressing heme oxygenase-1 further comprises a foreign heme oxygenase-1 gene.

[Claim 3]

The stem cell of claim 1, wherein the stem cell overexpressing ham oxygenase-1 comprises a recombinant vector comprising a foreign heme oxygenase-1 gene.

[Claim 4]

The stem cell of claim 1, wherein the heme oxygenase-1 is derived from a mammal.

[Claim 5]

The stem cell of claim 4, wherein the stem cell is an adult stem cell.

[Claim 6]

The stem cell of claim 5, wherein the adult stem cells are mesenchymal stem cells.

[Claim 7]

The stem cell of claim 2, wherein the foreign heme oxygenase-1 is derived from a mammal.

[Claim 8]

8. The stem cell of claim 7, wherein the stem cell is an adult stem cell.

[Claim 9]

The stem cell of claim 8, wherein the adult stem cells are mesenchymal stem cells.

[Claim 10]

The stem cell of claim 13, wherein the foreign heme oxygenase-1 is derived from a mammal.

[Claim 1 11]

The stem cell of claim 10, wherein the stem cell is an adult stem cell.

[Claim 12]

The stem cell of claim 1, wherein the adult stem cells are mesenchymal stem cells.

【Claim 13】 The composition for nerve regeneration comprising the stem cell of any one of claims 1 to 12.

[Claim 14]

A pharmaceutical composition for preventing or treating a neurological damage or a nerve damage related disease comprising the stem cells of any one of claims U to 12.

[Claim 15]

An anti-inflammatory composition comprising the stem cells of any one of claims 1 to 12.

[Claim 16]

A pharmaceutical composition for preventing or treating inflammation or inflammation-related diseases comprising the stem cells of any one of claims U to 12.

[Claim 17]

^'To 1 to claim 12 for the antioxidant containing any one of the stem cells, wherein the composition of the.

[Claim 18]

Claims 1 to 12, wherein the stem cells of any one comprising the step of administering to a subject in need of nerve regeneration, nerve regeneration method.

[Claim 19]

A method for preventing or treating neuronal or neurological damage related diseases, comprising administering the stem cells of any one of claims 1 to 12 to a subject in need thereof. .

[Claim 20]

13. The method of inhibiting inflammation comprising administering the stem cell of any one of claims 1 to 12 to a subject in need of inhibition of inflammation.

[Claim 21]

A method for preventing or treating an inflammation or inflammation related disease, comprising administering to a subject in need of the prevention or treatment of an inflammation or inflammation related disease comprising the stem cells of any one of claims U to 12.

[Claim 22]

The method of claim 1 to 12, comprising the step of administering the stem cells of any one of the subjects in need of antioxidant.