KR20170098056A

KR20170098056A - Heme Oxygenase-1 Overexpressing Stem Cell and Pharmaceutical Composition Comprising The Same

Info

Publication number: KR20170098056A
Application number: KR1020160019950A
Authority: KR
Inventors: 권오경; 김용선; 이승훈
Original assignee: 서울대학교산학협력단
Priority date: 2016-02-19
Filing date: 2016-02-19
Publication date: 2017-08-29
Also published as: WO2017142165A1; KR101870238B1

Abstract

A stem cell overexpressing heme oxygenase-1, and a pharmaceutical composition, an anti-inflammatory composition and an antioxidative composition for treating nerve damage comprising the same.

Description

Heme Oxygenase-1 Overexpressing Stem Cell and Pharmaceutical Composition Comprising The Same <br> <br> <br> Patents - stay tuned to the technology Heme Oxygenase-1 Overexpressing Stem Cell and Pharmaceutical Composition Comprising The Same

In the case of nerve damage such as spinal cord injury, the peroxide secreted from several hours to several days after the first physical damage further damages the nerve (spinal cord). Antioxidants such as methylprednisolone sodium conchinate have been used for the treatment of these injuries, but they have not been successfully treated.

On the other hand, genetically engineered stem cells (for example, mesenchymal stem cells) contain brain derived neurotrophic factor (BDNF), nerve growth factor (NGF), and neurotrophin -3; NT-3), but most of the transplanted cells die in the first few days due to oxidative stress, hypoxia, and immune responses, and are insufficient to achieve the desired effect .

Thus, the development of more effective treatment techniques for nerve damage such as spinal cord injury is required.

Korea Patent Publication No. 2012-0082377

One example provides stem cells overexpressing heme oxygenase-1 (HO-1).

Another example provides a composition for nerve regeneration comprising stem cells overexpressing the hemoxigenase-1.

Another example provides a method for nerve regeneration comprising the step of administering stem cells overexpressing the hemoxigenase-1 to a subject in need of nerve regeneration.

Another example provides a pharmaceutical composition for preventing and / or treating diseases related to nerve damage or nerve damage comprising stem cells overexpressing hemeoxygenase-1.

Another example is a method for preventing and / or treating nerve damage or diseases related to nerve damage comprising administering stem cells overexpressing hemoxigenase-1 to a subject in need of improvement and / &Lt; / RTI >

Another example provides a anti-inflammatory composition comprising stem cells overexpressing the hemoxigenase-1.

Another example provides a method of inhibiting inflammation comprising the step of administering stem cells overexpressing the hemoxigenase-1 to a subject in need of inflammation inhibition.

Another example provides an antioxidant composition comprising stem cells overexpressing the hemoxigenase-1.

Another example provides an antioxidant method comprising the step of administering stem cells overexpressing the hemoxigenase-1 to a subject in need of antioxidation.

In the present invention, it is more important to prevent spinal cord injury by enhancing antioxidant and anti-inflammatory effect than nerve regeneration promoting factor at the early stage of spinal cord injury, where damage due to oxidation and inflammation is serious. Therefore, stem cells having enhanced antioxidant and / Suggests that neurogenesis and / or neuroregenerative effects can be obtained.

In the present invention, stem cells overexpressing hemoxigenase-1 have excellent antioxidant ability, have a spinal cord function recovery effect, a fibrosis reduction effect, a neuronal cell regeneration effect and an inflammatory factor inhibitory effect. Thus, hemoxigenase- Lt; RTI ID = 0.0 > and / or < / RTI > anti-inflammatory and / or antioxidative effects of stem cells overexpressing < RTI ID = 0.0 >

One example provides stem cells overexpressing hemoxigenase-1.

Hemooxygenase-1 (HO-1 or HMOX-1; EC 1.14.99.3) is an endogenous enzyme that is essential for heme catabolism, And decomposes it into iron, biliverdin, and carbon dioxide. Hemoxigenin-1 may be derived from, but is not limited to, all mammals, such as humans, dogs, and mice. In one example, the hemoxigenase-1 is selected from the group consisting of human hemoxigenase-1 (NCBI Accession No. NP_002124.1 (coding gene (cDNA): NM_002133.2), ADZ76424.1 (coding gene (cDNA): JF323038 (NCBI Accession No. NP_001181898.1 (coding gene (cDNA): NM_001194969.1)), mouse hemoxigenase-1 (NCBI Accession No. NP_034572.1 (Coding gene (cDNA): NM_010442.2)), and the like, but the present invention is not limited thereto.

The stem cells may be selected from the group consisting of embryonic stem cells and adult stem cells, for example adult stem cells.

Adult stem cells are stem cells extracted from umbilical cord blood (umbilical cord blood), adult bone marrow, blood, etc., and refer to primitive cells immediately before they are differentiated into cells of specific organs. The adult stem cells may be at least one selected from the group consisting of hematopoietic stem cells, mesenchymal stem cells, neural stem cells, and the like. The adult stem cells may be adult stem cells of a mammal, such as a human, a dog, or a mouse. Adult stem cells are difficult to proliferate and tend to differentiate easily. Instead of using various kinds of adult stem cells, they can be used for various long-term regeneration needed in actual medicine. In addition, they can differentiate according to the characteristics of each organ And can be advantageously applied to the treatment of incurable diseases / incurable diseases.

In one example, the adult stem cells may be mesenchymal stem cells, such as mammalian mesenchymal stem cells such as human, dog, or mouse. Mesenchymal stem cells (MSCs), also called mesenchymal stromal cells (MSCs), are known as osteoblasts, chondrocytes, myocytes, adipocytes, and the like. It is a multipotent stromal cell capable of differentiating into various types of cells. The mesenchymal stem cells are non-marrow stem cells such as placenta, umbilical cord blood, adipose tissue, adult muscle, corneal stroma, dental pulp, May be selected from pluripotent cells derived from non-marrow tissues.

The stem cell overexpressing hemeoxygenase-1 may be, for example, an intracellular hemoxigenase-1 gene, an exogenous (i. E., Derived from a homologous or heterologous stem cell other than the stem cell) The expression level of hemoxigenase-1 may be higher than that of the stem cell that does not contain the exogenous hemoxigenase-1 gene, However, the expression level of hemoxigenase-1 can be expressed by all conventional gene overexpression techniques, which means all the stem cells whose expression level is higher than that of wild-type stem cells. The exogenous hemoxigenase-1 gene can be incorporated into, for example, a recombinant vector and introduced into a stem cell. That is, the stem cell overexpressing the hemoxigenase-1 may contain a recombinant vector containing an exogenous hemoxigenase-1 gene. The intrinsic hemeoxygenase-1 gene and / or the exogenous hemeoxygenase-1 gene may be of mammalian origin, and may be homologous or heterologous to each other.

The recombinant vector may include a common gene expression control sequence such as a promoter, a transcription terminator and the like in addition to the hemoxigenase-1 gene. In the recombinant vector, a gene expression regulatory sequence such as a promoter, a transcription termination sequence and the like may be operably linked to a foreign gene for insertion of a hemoxigenase-1 gene. The term "operatively linked" means a functional association (cis) between a gene expression control sequence and another nucleotide sequence. The gene expression control sequences may be "operatively linked" to regulate transcription and / or translation of the inserted heme oxidase-1 gene.

The promoter is one of the transcription control sequences that regulate the transcription initiation of a specific gene and is usually a polynucleotide fragment of about 100 to about 2000 bp or about 100 to about 2500 bp in length. In one embodiment, the promoter can be used without limitation, as long as it can regulate transcription initiation in animal cells, such as mammalian cells, particularly stem cells such as adult stem cells. For example, the promoter is the CMV promoter (cytomegalovirus promoter; (e. G., CMV immediate-early promoter), SV40 promoter, adenovirus promoter (major late promoter), ^λ pL Promoter, trp promoter, lac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, HSV tk promoter, SV40E1 promoter, respiratory syncytial virus (RSV) promoter, etc. Promoter, metallothionin promoter,? -Actin promoter, ubiquitin C promoter, EF1 (elongation factor 1) promoter (such as EF1-alpha promoter), human IL-2 (human interleukin- An animal cell promoter such as human lymphotoxin gene promoter, human granulocyte-macrophage colony stimulating factor (GM-CSF) gene promoter, PGK (phosphoglycerate kinase) promoter (for example, PGK1 promoter etc.) But the present invention is not limited thereto.

The transcription terminator may comprise a polyadenylation sequence (pA) or the like.

The term "vector" means any means for expressing a gene of interest in a host cell. The vector includes elements for expression of a target gene (i.e., a hemoxigenase-1 gene) and includes a replication origin, a promoter, an operator, a transcription termination terminator, etc. (E. G., A restriction enzyme site) for introduction into the genome of the host cell and / or a selectable marker for confirming successful introduction into the host cell (e. G. 1). The recombinant vector may further comprise a transcriptional control sequence other than the promoter.

The replication origin may be f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, BBV replication origin, and the like.

In addition, the recombinant vector may further comprise a selection marker. The selectable marker may be one or more selected from the group consisting of a drug resistance gene such as an antibiotic, a metabolism-related gene, a gene amplification gene, etc., as a gene for confirming whether a recombinant vector has been successfully introduced into a host cell, Or more. Since the selectable marker is not a factor that greatly influences the expression efficiency according to the optimal combination of the vector, which is a key technology of the present invention, all of the genes generally used as selection markers (for example, antibiotic resistance gene and / Etc.) may be used without limitation. For example, the selectable marker may be selected from the group consisting of an ampicilin resistance gene, a tetracyclin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a streptomycin resistance gene, a neomycin resistance gene , Blasticidin resistance gene, Zeocin resistance gene, Hygromycin resistance gene, Puromycin resistance gene, Thymidine kinase (TK) gene, Dihydrofolate reductase A dihydrofolate reductase (DHFR) gene, a glutamine synthetase (GS) gene, and the like, but the present invention is not limited thereto.

For example, the vector may be selected from the group consisting of plasmid vectors, cosmid vectors and viral vectors such as bacteriophage vectors, adenovirus vectors, retroviral vectors (e.g., Lentiviral vectors), and adeno-associated viral vectors. The vector that can be used as the recombinant vector may be a plasmid (for example, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1 (e.g., pHV14, pGEX series, pET series, pUC19, etc.), phage (e.g., lambda gt4λB, lambda-Charon, lambda Delta z1, M13 or the like) or viruses (e.g. SV40, Lentiviral vector, etc.) But is not limited thereto.

The transfer (introduction) of the recombinant vector into a host cell can be carried out by a method well known in the art. The delivery method may be, for example, microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, gene bombardment, lentiviral expression system (System Biosciences) It is not.

The method of selecting the recombinant cells (transformant) into which the expression vector has been introduced can be easily carried out by a method widely known in the art using a conventional selection marker. For example, when the selectable marker is a specific antibiotic resistance gene as described above, the recombinant cells into which the recombinant vector has been introduced can be easily selected by culturing the cells in a medium containing the antibiotic.

As described above, the host cell may be a stem cell isolated from a human, a dog, a mouse, etc., such as a hematopoietic stem cell, a mesenchymal stem cell, a neural stem cell, etc. And may be at least one adult stem cell selected from the group consisting of placenta, umbilical cord blood, adipose tissue, adult muscle, corneal stroma (corneal stroma) ), And pluripotent cells derived from non-marrow tissues such as dental pulp and the like.

The hemoxigenase-1 gene contained in the recombinant vector may be a homologous or heterologous strain derived from a host cell into which the recombinant vector is to be introduced. In one example, the hemocytogenase-1 gene may be derived from a homologous species.

Stem cells overexpressing hemoxigenase-1, including recombinant vectors containing hemeoxygenase-1 as described above, are excellent in antioxidant ability (see Example 4 and FIG. 5) (Example 7 and Figs. 6 and 7), fibrosis reduction effect (Example 8 and Figs. 8 and 9), neuronal regeneration effect and inflammatory factor inhibitory effect (Examples 9 and 10, And Figs. 10-25). Thus, another example proposes application as a pharmaceutical composition and / or method having an ameliorative, preventive and / or therapeutic effect on related symptoms of stem cell overexpressing hemoxigenase-1.

One example provides a composition for nerve regeneration comprising stem cells overexpressing hemoxigenase-1. Another example provides a method for nerve regeneration comprising the step of administering stem cells overexpressing the hemoxigenase-1 to a subject in need of nerve regeneration. Such nerve regeneration may mean the action of restoring damaged nerve by promoting regeneration of nerve cells in injured nerve tissue.

Another example provides a pharmaceutical composition for preventing and / or treating diseases related to nerve damage or nerve damage comprising stem cells overexpressing hemeoxygenase-1. Another example is a method for preventing and / or treating nerve damage or diseases related to nerve damage comprising administering stem cells overexpressing hemoxigenase-1 to a subject in need of improvement and / &Lt; / RTI > Such nerve damage may be, for example, a central nervous system injury, such as brain, spinal cord or the like, which may be a chronic injury or an acute injury. In one example, the nerve injury may be acute injury of the central nervous system, but is not limited thereto. The diseases related to the nerve injury include peripheral nervous system damage diseases such as cerebral infarction, brain tumor, meningitis, brain trauma, multiple sclerosis, cerebrovascular disease, muscular dystrophy, spinal cord whiskers, amyotrophic lateral sclerosis, myasthenia gravis, Neurological damage-related diseases, and the like.

Another example provides a anti-inflammatory composition comprising stem cells overexpressing the hemoxigenase-1. Another example provides a method of inhibiting inflammation comprising the step of administering stem cells overexpressing the hemoxigenase-1 to a subject in need of inflammation inhibition. Another example provides a composition for preventing and / or treating inflammation or inflammation related diseases comprising stem cells overexpressing hemeoxygenase-1. Another example is a method for preventing and / or treating an inflammatory or inflammatory-related disease comprising administering to a subject in need of prevention and / or treatment of an inflammatory or inflammatory-related disease a stem cell overexpressing the hemoxigenase-1 &Lt; / RTI > The inflammation related disease may be selected from the group consisting of infectious or noninfectious inflammation, soft tissue injury, fracture, degenerative arthritis, immune mediated inflammation or immune mediated inflammatory disease (such as immuno-mediated arthritis).

Another example provides an antioxidant composition comprising stem cells overexpressing the hemoxigenase-1. Another example provides an antioxidant method comprising the step of administering stem cells overexpressing the hemoxigenase-1 to a subject in need of antioxidation.

The subject to be administered may be an animal selected from a mammal such as a human, a dog, a mouse, or a cell, a tissue, a body fluid (for example, cerebrospinal fluid) derived from the animal or a culture thereof, (Isolated) cells, tissues or fluids derived from or derived from an animal or a subject in need of prevention and / or treatment of neurological damage or nerve damage related diseases, inflammation inhibition, prevention and / or treatment of inflammation or inflammation related diseases, And so on. In one example, the subject to be administered is an animal (for example, a mammal such as a human, a dog, or a mouse) derived from hemoxigenase-1 (for example, exogenous hemoxigenase-1) or stem cells over- Or a cell, tissue, body fluids (such as cerebrospinal fluid) derived from (separated from) the animal, or a culture thereof.

In addition to stem cells overexpressing hemoxigenase-1 as an active ingredient, the pharmaceutical composition may further include a pharmaceutically acceptable carrier, and the carrier may be any of those conventionally used for the formulation of drugs including nucleic acids Examples of the active ingredient include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, But are not limited to, cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like. The pharmaceutical composition may further comprise at least one member selected from the group consisting of a diluent, an excipient, a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent,

In one embodiment, the pharmaceutical composition may be a composition for cell transplantation for transplantation into a lesion.

The administration of stem cells overexpressing hemeoxygenase-1 may be carried out by various routes such as administration to a damaged site (for example, cell transplantation) or intravenous administration (intravenous injection).

INDUSTRIAL APPLICABILITY The present invention provides a stem cell overexpressing hemoxigenase-1 and its use for medicinal purposes, thereby exhibiting excellent antioxidant ability, exhibiting spinal cord function recovery effect, fibrosis reducing effect, neuronal cell regeneration effect and inflammatory factor inhibitory effect Nerve regeneration and / or anti-inflammation and / or antioxidant effects can be obtained.

Figures 1A-1C illustrate cleavage maps of recombinant vectors containing the < RTI ID = 0.0 > hemooxygenase-1 < / RTI > gene.
FIG. 2 is a graph showing the expression of recombinant mesenchymal stem cells (hereinafter, referred to as 'MSC-HO-1') and overexpression of hemoxigenase-1 gene -GFP ').&Lt; / RTI >
FIG. 3 is the Western blot results showing the expression levels of hemoxigenase-1 in MSC-HO-1 and MSC-GFP.
4 is a graph quantifying the results of FIG.
Figure 5 is a graph showing the antioxidant activity of MSC-HO-1 and MSC-GFP as UAE (uric acid equivalents).
FIG. 6 is a graph showing the distribution of MSC-HO-1 transplanted dogs (hereinafter referred to as 'MSC-HO-1 transplantation group') and MSC-GFP transplanted dogs Basso, Beattie, and Bresnahan (BBB) scores.
FIG. 7 is a graph showing the Tarlov scores of the MSC-HO-1 and MSC-GFP transplantation groups in which spinal cord injury was induced, (A) Tarlov score determined by the revised Tarlov grade, (B) Tarlov score determined by Tarlov rating, respectively (X: mean, +: median).
FIG. 8 is a photograph of the spinal cord lesions stained with hematoxylin and eosin, (A) is a photograph of a damaged area of the MSC-GFP transplantation group, and (B) MSC-HO-1 This is a microscopic observation of the injured area of the graft group.
Fig. 9 is a graph showing the quantification of the fibrotic structure based on the results of Fig. 8. Fig.
10 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against hemoxigenase-1.
11 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against GFAP (glial fibrillary acidic protein).
12 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against beta-3-tubulin.
13 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against NF-M (neurofilament medium).
14 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against NeuN (neuronal nuclear antigen).
FIG. 15 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against GALC (galactosylceramidase).
Figure 16 is a fluorescence image obtained as a result of immunofluorescence staining using an antibody against pSTAT3 (phosphorylated-signal transducer and activator of transcription 3).
FIG. 17 is a graph showing the results of quantifying the amounts of hemoxigenin-1 (HO-1), GFAP, beta-3-tubulin, NF-M and NeuN shown in FIGS.
FIG. 18 is a graph showing the results of quantifying the amount of green fluorescent protein (GFP) expressed in FIGS. 10 to 14. FIG.
19 shows the number of HO-1 secretory cells and the number of various neuronal marker-expressing cells in the MSC-HO-1 graft group and the MSC-GFP graft group (the HO-1 and various neuronal cell markers are expressed in transplanted cells or endogenous Of the total number of cells.
FIG. 20 shows Western blot results showing the expression levels of the over-expressed proteins HO-1 and GFP in the MSC-HO-1 transplantation group and the MSC-GFP transplantation group.
FIG. 21 is a graph showing the results of FIG. 20 quantified.
FIG. 22 is a Western blot graph showing the expression levels of TNF-alpha, IL6, COX2, p-STAT3, and GALC as inflammation markers in MSC-HO-1 and MSC-GFP transplantation groups.
23 is a graph showing the results of FIG. 22 quantified.
FIG. 24 is a Western blot showing the expression levels of GFAP, beta-3-tubulin, NF-M, and NeuN as neural cell markers in the MSC-HO-1 and MSC-GFP transplantation groups.
FIG. 25 is a graph showing the results of FIG. 24 quantified. FIG.

Hereinafter, the present invention will be described in more detail with reference to the following examples, which should not be construed as limiting the scope of the present invention. It will be apparent to those skilled in the art that the embodiments described below may be modified without departing from the essential spirit of the invention.

Example 1: Hem Crab Shigenase Overexpression Mesenchymal stem cells making

1.1. Derived from fat tissue Of mesenchymal stem cells Isolation and Culture

(MSCs) were obtained according to the known methods (Lim JH, Byeon YE, Ryu HH, Jeong YH, Lee YW, Kim WH, et al. Transplantation of canine umbilical cord blood-derived mesenchymal stem cells in an experimentally induced spinal cord injured dogs J Vet Sci, 2007. 8 (3): 275-82).

In brief, adipose tissue was aseptically isolated from the gluteal subcutaneous fat after general anesthesia with a 2-year-old beagle dog. All experimental measures for animals were followed by manuals approved by animal protection agencies and by the SNU-Use Committee (SNU-141231-1).

The isolated adipose tissue was washed with phosphate buffered saline (PBS) and then treated with collagenase type I (1 mg / mL; Sigma-Aldrich, St Louis, MO, USA) for 2 hours at 37 ° C. The resulting reaction was then washed with PBS and centrifuged at 300 x g for 10 minutes. The pellet (i.e., the stromal blood vessel portion) was resuspended, filtered through a 100 탆 nylon mesh and then incubated at 37 캜 in a medium containing 10% fetal bovine serum (FBS, Gibco BRL, Grand Island, And cultured under humid CO ₂ conditions. The medium was replaced at 48 hour intervals until the cells were confluent. After confluence of the cells reached 90%, the resulting culture was treated with trypsin, stored in liquid nitrogen, or subcultured. The cells obtained were transformed in passage 1 and cultured to passage 3 before being used in the experiment.

1.2. HEM Geoxinase -1 (HO-1) < / RTI > Cloning

Dogs (beagle; The coding gene (cDNA: NM_001194969.1) of heme auxinase (HO-1; NP_001181898.1) of Canis lupus familiaris was cloned. Lentiviral expression system (System Biosciences, Mountain View, CA, USA) was used for this purpose.

1) (see Table 1). The primer set 1 (Phusion DNA polymerase, Thermo Scientific, Pittsburgh, Pa., USA) and canine HO- ), The 879 bp gene fragment was amplified and cloned into the pEGFP-C1 vector to construct a pEGFP-C1 HMOX1 recombinant vector (5604 bp) (see FIG. 1A). The HO-1 coding gene (867 bp) was amplified using primer set 2 (see Table 1), and the amplified gene (867 bp) was digested with EcoRI and BamHI restriction enzymes into pLenti6.3 / V5-DEST verA vector EG1-MG-BGH-PGK-GFP-T2A-Puro vector (see FIG. 1C) using primer set 3 (see Table 1) To construct a lentiviral expression vector.

The specific base sequences of the primer sets used above are summarized in the following Table 1:

Primer set 1 HO-1 Forward primer GACAGCATGCCCCAGGAT (SEQ ID NO: 1) HO-1 Reverse primer TCACAGCCTAAGGAGCCAGT (SEQ ID NO: 2) Primer set 2 HMOX1 BgIII Forward primer gtccggactcagatct atggagcgccctcagccc gacagcatgccccaggat (SEQ ID NO: 3) HMOX1 BgIII Reverse primer cttgagctcgagatct tcacatgacataaagtcc (SEQ ID NO: 4) Primer set 3 HMOX_FLAG Forward primer CAAGGATGACGATGACAAG atggagcgccctcagccc (SEQ ID NO: 5) HMOX_XhoI Reverse primer Gccctctagactcgag tcacatgacataaagtcc (SEQ ID NO: 6)

1.3. Overexpression of HO-1 Of mesenchymal stem cells making

HEK293T cells (Thermo Scientific Waltham, MA, USA) were cultured in DMEM containing 10% FBS and 1% penicillin / streptomycin at 37 ° C and 5% CO ₂ . Twenty-four hours prior to transfection, 4x10 ⁶ HEK293T cells were inoculated into 100 mm dishes. The following day, 20ul of a lentiviral packaging mix (System Biosciences, San Diego, Calif., USA) encoding the viral proteins Gag-Pol, Rev, and VSV-G was amplified using TurboFect (Thermo Scientific, Waltham, 2 ug of the lentiviral expression vector prepared in Example 1.2 was transfected into the prepared HEK293T cells (cells for lentiviral production).

Viral particles expressing the HO-1 gene labeled with green fluorescent protein (GFP) were collected and transfected into cADMSCs of cell line 1 prepared in Example 1.1 above. Successfully transduced cell sorting was performed using puromycin (3 [mu] g / ml, Gibco-BRL) after cADMSCs reached 90% confluence. Puromycin screening showed that approximately 40% of the cells were successfully transduced. Recombinant cADMSCs (hereinafter referred to as "MSC-HO-1") into which the foreign HO-1 gene was introduced (ie, overexpressing HO-1) was prepared in this manner. The selected recombinant cADMSCs were subcultured and cells of cell passage 3 were used in the following experiments. All procedures in the experimental procedure were performed in accordance with SNUIBC (SNUIBC-R150716-1-1).

Example 2: overexpression of HO-1 Of mesenchymal stem cells Measurement of cell viability

The recombinant cADMSCs (hereinafter, referred to as 'MSC-HO-1') transfected with the HO-1 gene prepared in Example 1.3 was incubated with 90% confluency, treated with trypsin, and stained with AO / PI cell viability kit Cell viability was measured according to the user's manual using a dual fluorescence cell counter (Luna-FL, Logos Biosystems, Annandale, Va. 22003, USA) and F23001, Logos Biosystems, Annandale, VA 22003, For comparison, cADMSCs (hereinafter 'cADMSCs') without transduction and pCDH-EF1-MCS-pA-PGK-copGFP-T2A-Puro vector (System Biosciences) The same test was carried out on cADMSCs (hereinafter 'MSC-GFP') in which overexpression of -1 was not induced.

The results obtained are shown in Fig. In FIG. 2, the y-axis represents the ratio (survival rate;%) of surviving cells to the total number of cells. As shown in Fig. 2, cell viability of cADMSCs, MSC-GFP and MSC-HO-1 was 92.79 + 4.61%, 92.55 + 1.32%, and 91.53 + 3.25%, respectively, There was no significant difference in viability between cells.

Example 3: Analysis of HO-1 expression level

Western blot analysis was performed to analyze the amount of HO-1 expression in cADMSCs, MSC-GFP, and MSC-HO-1 prepared in Example 2 above. PRO-PREP ^TM protein extraction solution (iNtRoN Biotechnology) was used to obtain a transparent cell lysate of each of the above cells. The protein concentration of the cell lysate was determined using the Bradford method (Bradford MM, A rapid and sensitive method for quantitation of microgram quantities of proteins using the principle of protein-dye binding. Anal Biochem, 1976. 72 (1 ): p. 248-54).

Each cell lysate sample was prepared in the same amount (20 μg), separated by electrophoresis on 10% SDS-PAG (sodium dodecyl sulfate polyacrylamide gels), and transferred to PVDF (polyvinylidene fluoride) membrane. Membrane blots were washed with TBST (10 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.05% Tween-20) and blocked for 1 h in 5% skim milk. Primary antibodies were diluted to the following concentrations and incubated together: anti-actin antibody (Sigma-Aldrich, St. Louis, MO, USA): 1: 1000; anti-heme oxygenase 1 antibody (Abcam, Cambridge, UK): 1: 2000; And anti-GFP antibody (Thermo Scientific Waltham, MA, USA): 1: 1000. Membranes were washed and primary antibodies were detected using goat anti-rabbit IgG conjugated with horseradish peroxidase (Abcam, Cambridge, UK) or goat anti-mouse IgG (Abcam, Cambridge, UK). The resulting bands were visualized using enhanced chemiluminescence (Amersham Pharmacia Biotech, Buckinghamshire, UK).

FIG. 3 shows the obtained electrophoresis image, and FIG. 4 shows a graph obtained by quantifying the result of FIG. 3 using the image J program. As can be seen from Western blot analysis of FIGS. 3 and 4, HO-1 expression in MSC-HO-1 was significantly higher than in cADMSCs and MSC-GFP. In addition, in the case of GFP, almost no expression of GFP was detected in cADMSCs, and it was confirmed that the cells could be used as a negative control. MSC-GFP and MSC-HO-1 all showed GFP expression, It can be confirmed that the cells were successfully transformed. (*, #: p < 0.05).

Example 4: All Antioxidant ability Measure

Antioxidant capacity of cell extracts was measured using a total anti-oxidant capacity (TAC) assay kit (Cell Biolabs OxiSelect ^™ San Diego, CA, USA).

Cells prepared in Example 1 were cultured, washed three times with PBS, scraped off the cells attached to the bottom, suspended in a cold PBS solution at a concentration of 1 × 10 ⁷ per ml, disrupted with a sonicator and centrifuged (10,000 × g at 4 ° C. 10 minutes).

The centrifuged supernatant was loaded into a 96-well microtiter plate in an amount of 20 ul per well, and the reaction buffer was added to each well. The reaction was initiated by adding 180 μl of 1 × Reaction buffer, 50 μl of 1 × copper ion reagent, and 50 μl of 1 × stop solution to each well and incubating for 5 minutes at 37 ° C. Finally, stop solution (The Total Anti-oxidant Capacity (TAC) Assay Kit (Cell Biolabs OxiSelect ^™ , San Diego, Calif., USA) was added to terminate the reaction. The absorbance of the obtained reaction product was measured at 490 nm. The absorbance value obtained is proportional to the total reducing ability of the sample.

The results obtained were expressed as uric acid equivalents (UAE). The standard curve was used to determine the UAE (mM) of the sample. Here, 'y = 0.462x + 0.061 (R2 = 0.9938)'. The y-value represents the absorbance and this value was used to obtain UAE (mM) which shows the same OD at 490 nm.

The result of the antioxidant ability obtained is shown in Fig. As shown in Figure 5, the UAE level of MSC-HO-1 was significantly higher compared to cADMSCs and MSC-GFP, whereas there was no significant difference between cADMSCs and MSC-GFP (*, #, **: p &Lt; 0.05).

Example 5: Induction of spinal cord injury

Eight healthy beagle dogs (2 year old female) were used. All dogs were judged to be in good health and neurological status and had a unique admission number from SNU-150209-3. All experiments were conducted in compliance with the Animal Care and Use Guidelines (Institute of Laboratory Animal Resources, Seoul National University, Korea).

The spinal cord injury was detected by balloon compression method (Lim JH, Byeon YE, Ryu HH, Jeong YH, Lee YW, Kim WH, et al., Transplantation of canine umbilical cord blood-derived mesenchymal stem cells in an experimentally induced spinal cord injured dogs. J Vet Sci, 2007. 8 (3): p. 275-82).

In summary, intravenous cefazolin sodium (40 mg / kg) (Cefazoline; Chong Kun Dang, Seoul, Korea), tramadol (4 mg / kg, Toranzin; And atropine sulfate (0.05 mg / kg) (Atropine (Cheil Pharmaceuticals, Seoul, Korea)) was intravenously administered with zolazepam hydrochloride (5 mg / kg) (Zolethyl 50 .

Anesthesia was maintained by inhalation of 2% isoflurane in oxygen (Aerrane; Ilseong, Korea). Anesthetic monitor Rectal temperature, oxygen saturation, end-tidal CO ₂ , and pulse rate during anesthesia were checked using Datex-Ohmeda (Microvitec Display, Bradford, UK). Hemilaminectomy was performed on the fourth lumbar segment (L4). 3-French embolectomy catheter (SORIN Biomedica, Salluggia, Italy) was inserted into the hole of L4. Under fluoroscopic guidance, a balloon catheter was advanced from the cranial margin of the first lumbar segment (L1) and perfused with a 50:50 contrast medium (Omnipaque; Amersham Health, Cork, Ireland ) At 50 < RTI ID = 0.0 > ul / kg. &Lt; / RTI > The balloon catheter was fixed with Chinese finger trap suture and removed after 12 hours. After spinal cord injury, the soft tissues and skin were closed by standard methods.

After such procedures, dogs were bandaged and monitored in an intensive care unit. Dogs were provided with balanced nutritional supplements twice a day and, if necessary, manual bladder expression was performed more than three times a day until spontaneous urination was achieved.

Example 6: Recombination cADMSCs Transplantation to the damaged site

One week after induction of spinal cord injury in Example 5, recombinant cADMSCs, MSC-HO-1 and MSC-GFP, were injected (implanted) into the damaged area. The dogs were anesthetized in the same manner as when inducing spinal cord injury. More detailed description of transplantation into the injured area can be made by exposing the L1 spinal cord through dorsal laminectomy on the back, suspending 1 x 10 ⁷ cells in 150 μl of PBS, and using a 30- (3 mm) to the middle of the injury site (proximal and distal margins).

Example 7: Evaluation of the behavior of transplanted dogs

Behavioral evaluation was performed before, during, and after the procedure to evaluate the functional recovery of the hind legs of cell transplanted dogs in Example 6 above.

Specifically, when the dogs walked on each floor, they were videotaped from both sides and back for at least 10 steps. Dogs whose hind legs were unable to support weight were also videotaped while holding and holding the base of the tail. The data obtained were analyzed by Basso, Beattie, and Bresnahan (BBB) scores (Barros Filho TE, Molina AE, Analysis of the sensitivity and reproducibility of the Basso, Beattie, Bresnahan (BBB) scale in Wistar rats. Clinics (Sao Paulo), 2008. 63 (1): p. 103-8) and revised Tarlov and modified Tarlov scores (Rabinowitz RS, Eck JC, Harper CM, Jr., Larson DR, Jimenez MA, Parisi JE, et al., Urgent surgical decompression compared to methylprednisolone Spine (Phila Pa 1976), 2008. 33 (21): p. 2260-8) was used to record for the treatment of acute spinal cord injury: a randomized prospective study in beagle dogs. Two testers who were unaware of the experimental conditions recorded the walking distance of the dogs separately from the videotape. The average score was calculated every week after spinal cord injury until the end of the 9 week study period.

The obtained BBB score is shown in Fig. The BBB score was 21 before spinal cord injury induction and 0 after spinal cord injury induction. The BBB score was obtained weekly until 8 weeks after transplantation. As shown in FIG. 6, the exponents of the MSC-GFP and MSC-HO-1 graft groups gradually increased during the study period, but the improvement ratio decreased after 5 weeks from the graft. In the MSC-HO-1 transplantation group (n = 4), the BBB score was significantly improved from 7 weeks after transplantation (*: p <0.05 ).

After induction of spinal cord injury, the dogs used in all experiments showed complete pelvic limb paralysis. In the MSC-GFP transplantation group, some joint movements were observed and the hindlimb function was improved, but it was found that they could not sustain their own weight. On the other hand, two dogs in the MSC-HO-1 transplant group were found to be able to sustain their own weight.

In order to qualitatively evaluate the observed behavior, the Tarlov score was measured by the method described above, and the result is shown in FIG. In Fig. 7 (A), the Tarlov score determined by the revised Tarlov grade and (B) the Tarlov score determined by the modified Tarlov grade, respectively (X: mean value; +: median value). As shown in Fig. 7, restoration of hindlimb locomotion was remarkably observed in the MSC-HO-1 graft group (n = 4) compared to the MSC-GFP graft group (n = 4)

The results of FIGS. 6 and 7 show that the spinal cord function of the injured spinal cord is slightly restored by transplantation of the spinal cord injury site of MSC-GFP, which is a stem cell not inducing HO-1 overexpression, This indicates that the function of the spinal cord damaged by the transplantation of the spinal cord injury site of HO-1 can be more significantly restored. In particular, MSC-HO-1 injected group showed significant functional recovery after 7 weeks of cell injection.

Example 8: Histopathological evaluation

Eight dogs used in the experiment were euthanized after 8 weeks of cell transplantation and the spinal cord from the eleventh thoracic segment (T11) to the third lumbar segment (L3) was excised and extracted. Each of the obtained samples was immobilized in 10% sucrose / PBS for 12 hours at 4 ° C and immersed in a 20% sucrose solution overnight at 4 ° C. The dura was removed with scissors and the optimal cutting temperature (OCT) compound (Tissue-Tek

, Sakura, Torrance, CA, USA), frozen and cut vertically to obtain two sections. Half of each section was immediately frozen in liquid nitrogen for Western blot analysis and the other half was cut into sections of 10 μm size using a cryomicrotome.

Some of the prepared fragments with the size of 10 μm were sampled on silane-coated glass slides and stained with hematoxylin and eosin for spinal cord lesion sites for fibrosis. Using the image analysis software (Image J version 1.47; National Institutes of Health, USA), each of the four sections in each sample (each section was cut to a thickness of 10 um, ) Were subjected to histomorphometric analysis on hematoxylin and eosin-stained tissue sections.

The results of the histopathological analysis using the obtained hematoxylin and eosin staining are shown in FIGS. 8 and 9. FIG.

Figure 8 is a photograph of spinal cord lesions stained with hematoxylin and eosin. FIG. 8 (A) is a microscopic observation of the damaged area of the MSC-GFP transplantation group, and fibroblast-like cell proliferation is found. FIG. 8 (B) is a microscopic photograph of the injured area of the MSC-HO-1 transplantation group. The spinal cord lesion was localized in the local area, and the fibrosis was significantly reduced compared to the MSC-GFP transplantation group , And decreased fibroblast-like cell proliferation was observed. In FIG. 8, the scale bar represents 5 mm. In MSC-GFP transplantation and MSC-HO-1 transplantation, the size of the injured area was 1.50 ± 0.22 cm and 1.43 ± 0.28 cm, respectively, and there was no significant difference between them. Histopathologic analysis using the hematoxylin & eosin staining suggested above shows that pathological changes occur in parenchyma. In the low magnification results (left photographs of Figs. 8 (A) and (B)), fibrosis was observed in the MSC-HO-1 transplantation group (B) as compared to the MSC-GFP transplantation group (A). 8 (A) and 8 (B)), phenomena such as hemorrhage, fibroblast-like cell proliferation, and infiltration of damaged microglial cells into MSC-HO-1 grafts In the control group.

The fibrotic structure was quantified based on the result of hematoxylin & eosin staining obtained in FIG. 8, and is shown in FIG. As shown in FIG. 9, significant fibrosis was observed in the MSC-HO-1 transplantation group compared to the MSC-GFP transplantation group (*: p <0.05).

Example 9: Immunofluorescence evaluation

(GFAP), beta 3-tubulin, and neurofilament medium (NF) as neuronal or inflammatory markers, and anti-HO-1 antibodies ), Neuronal nuclear antigen (NeuN), phosphorylated-signal transducer and activator of transcription 3 (pSTAT3), and galactosylceramidase (GALC) (Santa Cruz Biotechnology, Santa Cruz, Immunofluorescence determination was performed using each primary antibody.

The remaining sections not used for hematoxylin & eosin staining were immobilized in 10 μm-sized sections prepared in Example 8, permeabilized with 0.1% (v / v) Triton X-100 for 10 minutes, , Washed and preincubated for 30 min with 1% bovine serum albumin (BSA; Sigma-Aldrich, St. Louis, Mo., USA) dissolved in PBS to prevent binding of nonspecific antibodies . The sections were incubated with the primary antibody for 24 hours at 4 ° C, incubated with secondary antibody (Abcam, Cambridge, UK) conjugated with fluorescein isothiocyanate (FITC) at room temperature for 60 minutes, washed, The sample was fixed from above. Nuclei were stained using DAPI (4,6-diamidino-2-penylindole).

Fluorescence images of spinal cord injury sites obtained as a result of immunofluorescence staining performed at 8 weeks after cell transplantation are shown in FIGS. 10 to 16. FIG. 10 shows the result of immunofluorescence staining using an antibody against HO-1, FIG. 11 shows the result of immunofluorescence staining using an antibody against GFAP, FIG. 12 shows a result of immunofluorescence staining using an antibody against beta 3-tubulin , FIG. 13 shows the result of immunofluorescence staining using an antibody against NF-M, FIG. 14 shows immunofluorescence using an antibody against NeuN, FIG. 15 shows the result of immunofluorescence staining using an antibody against GALC, Immunofluorescent staining with pSTAT3 antibody. In FIG. 10 to FIG. 16, HO-1, GFAP, beta 3-tubulin, NF-M, NeuN, GALC and pSTAT3 appear red and the transplanted cells are green by GFP. It appears blue. 10 to 16, a and b are the results of observing the sections of the MSC-GFP transplantation group (a) and the MSC-HO-1 transplantation group (b), respectively. It is an enlarged photograph. The scale bar represents 50 [mu] m. As seen in Figures 10 to 16, the expression levels of HO-1, beta 3-tubulin, NF-M, and NeuN in the MSC-HO-1 transplantation group were higher compared to the MSC-GFP transplantation group , GFAP, GALC, and p-STAT3 were inversely lowered. In the MSC-HO-1 transplantation group, the expression of the nerve regeneration-related factors was high, and the expression of the nerve tissue scarring and inflammation-related factors was decreased. The result of the early antioxidant and anti- It can be said that it is confirmed that it is possible to show effective effects on reproduction and maintenance.

Immunofluorescence results of Figures 10-14 are quantified and shown in Figures 17-19. The quantification was performed by randomly selecting 5 regions from each fluorescence-stained sample image and counting the number of overlapping of green (GFP), red (expressed marker), and red and green in 1000 cells. FIG. 17 shows the results of analysis of HO-1 (FIG. 10), GFAP (FIG. 11), beta 3-tubulin (FIG. 12), NF- 1 in the MSC-HO-1 transplantation group compared with the MSC-GFP transplantation group. The results are shown in FIG. The expression of 3-tubulin, NF-M, and NeuN was high, whereas the expression of GFAP was low, and the difference was significant (*: p <0.05). In the MSC-HO-1 treated group, the decrease of GFAP and the increase of the neuronal markers beta 3 -tubulin, NF-M, and NeuN inhibited the astrogliosis and scar formation and regeneration .

FIG. 18 shows the results of quantifying the amount of GFP expression in FIGS. 10 to 14, showing no significant difference in the MSC-HO-1 transplantation group and the MSC-GFP transplantation group.

19 shows the number of HO-1 secretory cells and the number of various neuronal marker-expressing cells in the MSC-HO-1 graft group and the MSC-GFP graft group (the HO-1 and various neuronal cell markers are expressed in transplanted cells or endogenous Of the total number of cells. As shown in FIG. 19, the proportion of HO-1 secretory cells was higher in the MSC-HO-1 (HO-1 overexpressing stem cell) transplantation group and the ratio of various neuron marker expression cells was higher in the endogenous cell- . The values shown in Fig. 19 are the ratios obtained by dividing the number of grafted cells (number of co-stained cells of GFP and markers) and the number of endogenous derived cells (number of stained cells of marker only) divided by the total number of cells. As shown in FIG. 19, in the MSC-HO-1 transplantation group, double-stained HO-1 cells were significantly higher than the HO-1 staining cells (p <0.05) Rather, the expression of double-stained HO-1 with GFP was lower than with HO-1 alone. In both MSC-HO-1 and MSC-GFP transplantation groups, expression of double-stained GFP-labeled markers was lower than marker-only staining in all marker expressions except HO-1. Thus, the high expression of double-stained HO-1 in the MSC-HO-1 transplantation group indicates that HO-1-overexpressing cells survive at the transplantation site and express HO-1, The expression of the marker alone in the expression of the markers showed that the transplanted HO-1 cells had a significant effect on neuronal regeneration or protection.

Example 10: Western blot analysis

Western blot analysis was performed on the spinal cord slices separated from the eighth week after transplantation in Example 8. The prepared spinal cord slices were washed twice with PBS and frozen at -150 ° C. The sections were then placed in lysis buffer (20 mM Tris, pH 7.5, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 1 mg / mL aprotinin, 1 mM phenylmethylsulfonylfluoride, and 0.5 mM sodium orthovanadate) Were homogenized for 30 min on ice using a generators (Branson Sonicator 250; Branson Ultrasonic Corp., Danbury, Conn., USA) for 3 times. The resulting lysate was clarified by centrifugation (1,500 xg for 10 minutes at 4 캜), and protein concentration was measured by Bradford method. SDS-PAGE and electrophoretic transfer were performed in the same manner as described in Example 3. Antibodies used were: anti-actin antibody, anti-HO-1 antibody, anti-NF-M antibody, anti-NeuN antibody (Abcam, Cambridge, UK), anti-GFP antibody (Thermo Scientific, Waltham, Anti-GFAP antibody, anti-beta 3 tubulin antibody, anti-TNF-alpha antibody, anti-IL6 antibody, anti-COX2 antibody, anti-pSTAT3 antibody, and anti-GALC antibody (Santa Cruz Biotechnology, Texas, USA). The Western blot was performed using a chemiluminescence kit (ECL kit, Invitrogen ^TM , Life Technologies, NY, USA) and confirmed by ChemiDoc.

The obtained Western blot results were quantified by optical density measurement using Image J (version 1.47; National Institutes of Health, USA).

The results obtained are shown in Figs. 20 to 25. Fig.

20 shows Western blotting results showing the expression amounts of over-expressed proteins HO-1 and GFP in the MSC-HO-1 and MSC-GFP transplantation groups, and FIG. 21 is a graph showing quantitative results of the results of FIG. 20 . FIG. 22 shows Western blotting results showing the expression levels of TNF-alpha, IL6, COX2, p-STAT3, and GALC as inflammation markers in the MSC-HO-1 transplantation group and the MSC-GFP transplantation group, And the results are shown in FIG. 24 shows Western blot results showing the expression levels of GFAP, excretory 3-tubulin, NF-M, and NeuN, which are neural cell markers in the MSC-HO-1 transplantation group and the MSC-GFP transplantation group, 24 are quantified. The western blot data were expressed as means ± standard error of three independent experiments. The quantification graph shows the mean values of the four results obtained for each transplantation group (n = 4, respectively) (*: p <0.05, **: p <0.001). In Figures 21, 23 and 25, the y-axis (Relative optical density (% of MSCs)) represents the ratio of MSC-HO-1 transplant group results when the MSC-GFP transplantation group (control group)

As shown in FIGS. 20 and 21, the expression level of HO-1 was significantly higher in the MSC-GFP transplantation group than in the MSC-GFP transplantation group, and the amount of GFP expression was not significantly different between the two groups. As shown in FIGS. 22 and 23, the expression of the inflammatory markers in the MSC-HO-1 transplantation group was markedly reduced compared to the MSC-GFP transplantation group, indicating that the inhibitory activity of MSC-HO-1 . As shown in Figures 24 and 25, the expression of beta 3-tubulin, NF-M, and NeuN, which are neural cell markers in the MSC-HO-1 transplantation group, is significantly increased compared to the MSC-GFP transplantation group , Indicating that GFAP expression is markedly decreased (indicating astrogliosis and scarring inhibition), and these results are similar to those of FIG. 17 described above, in that MSC-HO-1 neuron regeneration effect and GFAP expression And / or accumulation-related neurological diseases.

Statistical analysis

The data described herein were provided as medians and quartiles. Statistical analysis was performed using a commercially available statistical software program (SPSS Statistics, version 21.0, IBM Corp., NY, USA). In all experiments, the Mann-Whitney U test was used to compare the results between the two graft groups. A P value <0.05 was considered significant.

<110> Seoul National University R & DB Foundation <120> Heme Oxygenase-1 Overexpressing Stem Cell and Pharmaceutical Composition Comprising The Same <130> DPP20154863 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HO-1 Forward primer <400> 1 gacagcatgc cccaggat 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HO-1 Reverse primer <400> 2 tcacagccta aggagccagt 20 <210> 3 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HMOX1 BgIII Forward primer <400> 3 gtccggactc agatctatgg agcgccctca gcccgacagc atgccccagg at 52 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> HMOX1 BgIII reverse primer <400> 4 cttgagctcg agatcttcac atgacataaa gtcc 34 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> HMOX_FLAG Forward primer <400> 5 caaggatgac gatgacaaga tggagcgccc tcagccc 37 <210> 6 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> HMOX_XhoI Reverse primer <400> 6 gccctctaga ctcgagtcac atgacataaa gtcc 34

Claims

Stem cells overexpressing hemoxigenase-1.

The stem cell according to claim 1, wherein the stem cell overexpressing the hemoxigenase-1 further comprises an exogenous hemoxigenase-1 gene.

2. The stem cell according to claim 1, wherein the stem cell overexpressing the hemoxigenase-1 comprises a recombinant vector comprising an exogenous hemoxigenase-1 gene.

2. The stem cell according to claim 1, wherein the hemoxigenase-1 is derived from a mammal.

5. The stem cell according to claim 4, wherein the stem cell is an adult stem cell.

6. The stem cell according to claim 5, wherein the adult stem cell is a mesenchymal stem cell.

3. The stem cell according to claim 2, wherein said exogenous hemoxigenase-1 is derived from a mammal.

8. The stem cell according to claim 7, wherein the stem cell is an adult stem cell.

9. The stem cell according to claim 8, wherein the adult stem cell is a mesenchymal stem cell.

4. The stem cell according to claim 3, wherein said exogenous hemoxigenase-1 is derived from a mammal.

11. The stem cell according to claim 10, wherein the stem cell is an adult stem cell.

12. The stem cell according to claim 11, wherein the adult stem cell is a mesenchymal stem cell.

12. A composition for regenerating nerves comprising stem cells according to any one of claims 1 to 12.

A pharmaceutical composition for preventing or treating a nerve injury or neuronal damage related disease comprising the stem cell according to any one of claims 1 to 12.

12. An anti-inflammatory composition comprising the stem cell according to any one of claims 1 to 12.

A pharmaceutical composition for preventing or treating an inflammatory or inflammatory-related disease comprising the stem cell according to any one of claims 1 to 12.

13. An antioxidant composition comprising the stem cell according to any one of claims 1 to 12.