WO2017132376A1 - Hybrid promoter and uses thereof - Google Patents
Hybrid promoter and uses thereof Download PDFInfo
- Publication number
- WO2017132376A1 WO2017132376A1 PCT/US2017/015130 US2017015130W WO2017132376A1 WO 2017132376 A1 WO2017132376 A1 WO 2017132376A1 US 2017015130 W US2017015130 W US 2017015130W WO 2017132376 A1 WO2017132376 A1 WO 2017132376A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- protein
- seq
- interest
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
- C12N9/2471—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01023—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
- C12N2710/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
- C12N2710/16141—Use of virus, viral particle or viral elements as a vector
- C12N2710/16143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
- C12N2830/003—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/10—Vectors comprising a special translation-regulating system regulates levels of translation
- C12N2840/105—Vectors comprising a special translation-regulating system regulates levels of translation enhancing translation
Definitions
- This invention relates to recombinant production of proteins in mammalian cells.
- Hybrid promoters combining enhancer and promoter elements from different genetic sources have been used to enhance recombinant expression in a variety of host cells.
- E.g., Harvey, Hybrid promoters, WO 2008/020960 Al; US 2008/12492 Al have been used to enhance recombinant expression in a variety of host cells.
- Harvey Hybrid promoters, WO 2008/020960 Al; US 2008/12492 Al.
- Previous studies have shown that the human CMV promoter and murine CMV promoter can drive high level expression of heterologous expression in mammalian cells. (Mizushima & Nagata, pEF-BOS, a powerful mammalian expression vector. Nucl. Acids Res., 18(17):5322 (1990); Masayuki & Tanaka, The CMV Enhancer Stimulates
- TetR Upon binding to tetracycline, TetR undergoes a conformational change that abrogates the binding of TetR to TetO.
- Yao et al. had shown that the human CMV enhancer promoter could be regulated by tetracycline by incorporating a TetO sequence between the TATA box and the transcriptional start site (TSS).
- TATA box TATA box
- TSS transcriptional start site
- the present invention relates to a hybrid promoter for regulating recombinant expression of one or more proteins of interest.
- the hybrid promoter includes: (i) a mCMV enhancer sequence, comprising a mCMV enhancer element (mCMV-E) and a CMV promoter (CMV-P) sequence at its 3' end, operably linked 5' to a rat EF-lalpha intron sequence, operably linked 5' to a rat EF-lalpha intron sequence; (ii) an intervening first leader sequence operably linked, 3' to the CMV promoter sequence of the mCMV enhancer sequence, and 5' to the rat EF-lalpha intron sequence; and (iii) a second leader sequence operably linked 3' to the EF-1 alpha intron sequence.
- mCMV enhancer element mCMV-E
- CMV-P CMV promoter
- This inventive combination of a mCMV enhancer sequence with a rat EF-lalpha intron sequence in the hybrid promoter facilitates recombinant expression of proteins of interest, particularly by CHO cells, with high titers and high specific productivity suitable for industrial production of biologic molecules, such as, but not limited to, an antigen binding protein, an immunoglobulin, an antibody or antibody fragment, (e.g., as human therapeutics to treat disease), and was generally superior to other promoters tested for some cell lines.
- biologic molecules such as, but not limited to, an antigen binding protein, an immunoglobulin, an antibody or antibody fragment, (e.g., as human therapeutics to treat disease), and was generally superior to other promoters tested for some cell lines.
- the present invention also relates to an expression cassette containing the inventive hybrid promoter, operably linked 5' to an open reading frame encoding an exogenous protein of interest; and a polyadenylation site operably linked 3* to the open reading frame.
- Another aspect of the invention is a recombinant expression vector comprising the inventive expression cassette containing the hybrid promoter.
- a mammalian host cell that contains the inventive recombinant expression vector containing the expression cassette with the hybrid promoter, such as a cell derived from a Chinese Hamster Ovary (CHO) cell, e.g., a CHO-K1 cell, a DXB11 cell, or a DG44 cell.
- CHO Chinese Hamster Ovary
- the present invention also relates to a method of producing a protein of interest, in vitro, that involves culturing the mammalian host cell containing the inventive expression vector, in an aqueous medium under physiological conditions permitting expression of the protein of interest; and recovering the protein of interest from the medium.
- the present invention also includes a method of producing a protein of interest involving tetracycline-inducible expression of the protein of interest
- the invention includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations defined by specific paragraphs above.
- certain aspects of the invention that are described as a genus, and it should be understood that every member of a genus is, individually, an aspect of the invention.
- aspects described as a genus or selecting a member of a genus should be understood to embrace combinations of two or more members of the genus.
- Figure 1 shows schematic maps of some exemplary expression constructs.
- Figure 2 shows a schematic map of exemplary Vector D.
- Figure 3 A-B shows DXB 11 cell produced Fc-A protein titer ( Figure 3 A) and specific productivity ( Figure 3B) in ProCHOTM 4 culture medium containing 150 nM methotrexate (MTX) on Day 8. Each error bar is constructed using 1 standard error of the mean.
- Figure 4A-B shows DXB 11 cell produced Fc-A protein titer ( Figure 4 A) and specific productivity (Figure 4B) in PowerCHOTM 2 medium at 500 nM MTX on Day 8. Each error bar is constructed using 1 standard error of the mean.
- Figure 5A-B shows Fc-A protein titer (Figure 5A) and specific productivity (Figure 5B) for DG44 in PowerCHOTM 2 medium at 1 ⁇ MTX and DXB11 in
- Figure 6 shows a schematic map of pJV56 with the inventive mCMV enhancer/rEF-la intron hybrid promoter driving LacZ expression.
- FIG. 7 shows a schematic map of pJV57, which was the same as pJV56, except that part of the mCMV promoter (mCMV-P) was replaced with human CMV promoter (hCMV-P) and TetO sequences.
- mCMV-P part of the mCMV promoter
- hCMV-P human CMV promoter
- Figure 8 shows a schematic map of pJV59, which was the same as pJV56, but with an optimized human CMV promoter ((hCMV-P); after Patwardhan et al., High- resolution analysis ofDNA regulatory elements by synthetic saturation mutagenesis, Nature Biotechnology 27(12):1173-75 (2009)), substituted for part of the mCMV promoter (mCMV-P) sequence.
- hCMV-P human CMV promoter
- Figure 9 shows a schematic map of pJV60, which was the same as pJV57, except for changes to the TetO sequences (maintaining TetR binding) to match the optimized human CMV promoter (hCMV-P) sequence.
- Figure 10 represents a schematic representation of the human CMV promoter-Tet operator (TetO; ' et”) inserted into the mCMV promoter ("mCMVP") sequence, 3' to the mCMV enhancer element (“MCVE”) sequence. This insertion replaced part of the mCMV promoter with a hCMV promoter (hCMVP) sequence.
- mCMVP mCMV promoter
- MCVE mCMV enhancer element
- FIG 11 shows a schematic comparison of the DNA sequences of a segment of pJV56 (SEQ ID NO:16) and a segment of pJV57 (SEQ ID NO:15)
- the segment of pJV57 shown in SEQ ID NO: 15 includes a segment (SEQ ID NO:9) that incorporates a partial hCMV promoter sequence (SEQ ID NO:24) and, 3' to SEQ ID NO:24, a TetO sequence (SEQ ID NO:23, which contains a smaller TetO sequence SEQ ID NO:29). Arrows shown in the TetO sequence (SEQ ID NO:29) indicate palindromic TetR binding sites.
- the mCMV promoter (mCMV-P) sequence and hCMV promoter (hCMV-P) sequence are those sequences from the TATA box through the start site of transcription.
- SEQ ID NO:25 is the 3 ' end of a mCMV-P sequence found in both pJV57 and pJV56, and in pJV57 is found 3' to SEQ ID NO:9.
- the transcription start is the guanine residue in the 3' subsequence taccg of SEQ ID NO:25.
- TetO sequence SEQ ID NO:23
- the relative position of the first leader sequence is also represented by "TPL," and some nucleotide residues at the 5' end of the TPL are shown.
- Figure 12 shows a schematic comparison of segments of the DNA sequences of pJV57 and pJV60.
- segment shown of pJV60 SEQ ID NO: 18
- TetO sequences in the corresponding segment of pJV57 SEQ ID NO: 17
- SEQ ID NO: 17 were changed to match the sequences that increased expression surrounding the transcription start site in the study by Patwardhan et al., High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis, Nature Biotechnology 27(12): 1173-75 (2009).
- Figure 13 shows a schematic comparison of segments of the DNA sequences of pJV56 and pJV59.
- optimized hCMV promoter sequences in the corresponding sequence of pJV56 (SEQ ID NO: 19) replaced part of the mCMV promoter (mCMV-P) sequence in a variation of the mCMV enhancer/rat EF-la intron hybrid promoter of the invention.
- FIG 14 shows regulation of specific ⁇ -galactosidase expression for each of the indicated vectors.
- T-RExTM-CHO cells expressing TetR were transiently transfected with pJV56, pJV57, pJV59, pJV60, or the control plasmid pcDNA5/TO/LacZ. Cell were incubated for 24 hours and then treated with tetracycline (Tet) or left untreated for 24 hours. Cells were lysed and LacZ was analyzed enzymatically. The fold-difference between the (+Tet) compared to (-Tet) is shown above the bars, except for the positive control (pcDNA5/TO/LacZ).
- Figure 15 shows a schematic map of pJV40, including an open reading frame for TetR.
- Figure 16 illustrates expression of LacZ (beta-galactosidase protein) by CHO- Kl/TetR cells (clone 3E7) expressing TetR, which were transiently transfected with pJV56, pJV57, pJV59, pJV60, or the control plasmid pcDNA5/TO/LacZ. Cell were incubated for 24 hours and then treated with tetracycline (Tet) or left untreated for 24 hours. Cells were lysed and LacZ was analyzed enzymatically. The fold-difference between the (+Tet) compared to (-Tet) is shown above the bars.
- LacZ beta-galactosidase protein
- Figure 17 illustrates expression of LacZ (beta-galactosidase protein) by CHO- Kl/TetR cells (clone 3F9) expressing TetR, which were transiently transfected with pJV56, pJV57, pJV59, pJV60, or the control plasmid pcDNA5/TO/LacZ.
- Cell were incubated for 24 hours and then treated with tetracycline (Tet) or left untreated for 24 hours. Cells were lysed and LacZ was analyzed enzymatically. The fold-difference between the (+Tet) compared to (-Tet) is shown above the bars.
- Figure 18 illustrates expression of LacZ (beta-galactosidase protein) by CHO- Kl/TetR cells (clone 4G2) expressing TetR, which were transiently transfected with pJV56, pJV57, pJV59, pJV60, or the control plasmid pcDNA5/TO/LacZ.
- Cell were incubated for 24 hours and then treated with tetracycline (Tet) or left untreated for 24 hours. Cells were lysed and LacZ was analyzed enzymatically. The fold-difference between the (+Tet) compared to (-Tet) is shown above the bars.
- the present invention relates to a hybrid promoter for regulating recombinant expression of one or more proteins of interest.
- the inventive promoter includes a mCMV enhancer sequence operably linked to a rat EF-1 alpha intron sequence.
- mCMV used interchangeably with “muCMV,” refers to murine cytomegalovirus, which is a herpesvirus of the subfamily betaherpesviridae.
- the mCMV is a double- stranded enveloped DNA virus with host specificity for mice.
- hCMV or interchangeably “huCMV,” refers to human cytomegalovirus.
- the "mCMV enhancer sequence,” with respect to the present invention, includes:
- mCMV-E mCMV enhancer element
- CMV-P a CMV promoter sequence
- the CMV promoter sequence can be derived from mCMV, hCMV, simian CMV, rat CMV, or any other variety of CMV, or it can be an optimized version of a CMV-P, which is functional to enable transcription in mammalian cells, such as CHO cells.
- recombinant indicates that the material (e.g., a nucleic acid or a polypeptide) has been artificially or synthetically (i.e., non-naturally) altered by human intervention. The alteration can be performed on the material within, or removed from, its natural environment or state.
- a "recombinant nucleic acid” is one that is made by recombining nucleic acids, e.g., during cloning, DNA shuffling or other well known molecular biological procedures Examples of such molecular biological procedures are found in Maniatis et al., Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982).
- a “recombinant DNA molecule,” is comprised of segments of DNA joined together by means of such molecular biological techniques.
- the term “recombinant protein” or “recombinant polypeptide” as used herein refers to a protein molecule which is expressed using a recombinant DNA molecule.
- a “recombinant host cell” is a cell that contains and/or expresses a recombinant nucleic acid.
- control sequence refers to a polynucleotide sequence that can, in a particular host cell, affect the expression and processing of coding sequences to which it is ligated.
- control sequences for prokaryotes may include a promoter, a ribosomal binding site, and a transcription termination sequence.
- control sequences for eukaryotes may include promoters comprising one or a plurality of recognition sites for transcription factors, transcription enhancer sequences or elements, polyadenylation sites, and transcription termination sequences.
- Control sequences can include leader sequences and/or fusion partner sequences.
- Promoters and enhancers consist of short arrays of DNA that interact specifically with cellular proteins involved in transcription (Maniatis, et al., Science 236:1237 (1987)).
- Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect and mammalian cells and viruses (analogous control elements, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on what cell type is to be used to express the protein of interest. Some eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types (for review see Voss, et al., Trends Biochem. Sci., 11:287 (1986) and Maniatis, et al., Science 236:1237 (1987)).
- a "promoter” is a region of DNA including a site at which RNA polymerase binds to initiate transcription of messenger RNA by one or more downstream structural genes. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5' region of the sense strand). Promoters are typically about 100-1000 bp in length.
- an “enhancer” is a short (50- 1500 bp) region of DNA that can be bound with one or more activator proteins (transcription factors) to activate transcription of a gene.
- a mCMV enhancer sequence useful in the inventive hybrid promoter comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO:2, which contains a CMV promoter (CMV-P) sequence at its 3' end (bold underlined sequence in SEQ ID NO:2) beginning at nucleotide position 588 (including a TATA-box and transcriptional start site, i.e., TATAAGAGG CGCGA C CAGCG TCGG TACCG//SEQ ID NO:28; bold underlined in SEQ ID NO:2 below; SEQ ID NO:28 also comprises SEQ ID NO:26):
- Another exemplary mCMV enhancer sequence useful in the inventive hybrid promoter comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO:33, which contains a CMV promoter sequence at its 3 ' end (bold underlined sequence in SEQ ID NO:33) beginning at position 588, which includes a TATA-box and transcriptional start site, i.e.,
- SEQ ID NO:35 bold underlined sequence in SEQ ID NO:33 below; SEQ ID NO:35 also comprises SEQ ID NO:24):
- the inventive hybrid promoter comprises one or more TetO sequences operably linked 3' to the mCMV enhancer sequence, inserted within the CMV promoter (CMV-P) sequence at the 3' end of the mCMV enhancer sequence.
- a 'TetO" sequence means a nucleotide sequence, which maintains the ability to bind tetracycline repressor protein (TetR).
- the TetO sequence is placed so that, in the presence of TetR protein, there is binding of TetR to the TetO sequence, thereby disrupting transcription to a detectable extent, compared to a control not having TetO in the promoter driving transcription of a gene of interest, or to a control not having TetR.
- TetO sequence include a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:29
- Repression refers to the interference of transcription of a gene of interest (encoding a protein of interest), occurring when TetR protein binds to a TetO binding site in the promoter that drives expression of the gene of interest, resulting in decreased expression of the protein of interest by the cell(s) (which are cell(s) that express TetR)
- Expression of a gene of interest or of a protein of interest is said to be “derepressed,” when, in the presence of tetracycline in the medium, expression of the protein of interest is at least 1.5-fold over the basal levels of expression by the cell(s) in the absence of tetracycline in the medium.
- 'Tetracycline means tetracycline or an analog of tetracycline, such as doxycycline, anhydrotetracycline, minocycline, oxytetracycline, methacycline, chlortetracycline, or COL-3 (Chemically modified tetracycline-3).
- a rat EF- 1 alpha intron sequence useful in the inventive hybrid promoter comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO:4:
- the inventive hybrid promoter also includes an intervening first leader sequence, operably linked 3' to the mCMV enhancer and 5' to the EF-1 alpha intron sequence in an operable orientation.
- the intervening first leader sequence is about 10 to 200 nucleotide residues in length— more preferably about 10 to 60 nucleotide residues in length or even more preferably about 20-50 nucleotide residues in length— and lacks any secondary structure with stability greater than 20 kcal and lacks any ATG translational start sites.
- An example of a useful first leader sequence is an untranslated (5'UTR) leader sequence derived from adenovirus tripartite leader (TPL), i.e., the nucleotide sequence of SEQ ID NO:3:
- the inventive hybrid promoter also includes a second leader sequence operably linked 3' to the EF-1 alpha intron sequence in an operable orientation.
- the second leader sequence is about S to 200 nucleotide residues in length- more preferably about 10 to 200 nucleotide residues in length or even more preferably about 10-150 nucleotide residues in length— and lacks any secondary structure with stability greater than 20 kcal and lacks any ATG translational start sites.
- An example of a useful second leader sequence is another untranslated (5'UTR) leader sequence region derived from adenovirus tripartite leader (TPL), i.e., the nucleotide sequence of SEQ ID NO:5:
- One useful embodiment of the inventive hybrid promoter is a promoter that comprises a nucleotide sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: l, following, which contains mCMV GenBank: L06816.1, nucleotides 4067-4682, Rat EF-lalpha intron Genbank: AC158987.3, nucleotides 22137-21728; and an intervening first leader sequence underlined in lower case letters (SEQ ID NO:3); and a second leader sequence underlined in italic lower case letters (SEQ ID NO:5):
- Examples of additional useful embodiments of the inventive hybrid promoter include (i) SEQ ID NO:30 (hybrid promoter sequence including TetO, as in pJV57), (ii)
- SEQ ID NO:31 hybrid promoter including a mCMV enhancer element with optimized hCMV promoter sequence, as in pJV59
- SEQ ID NO:32 hybrid promoter including mCMV enhancer element with optimized hCMV promoter sequence and optimized TetO sequence, as in pJV60
- in operable combination refers to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced.
- the term also refers to the linkage of amino acid sequences in such a manner so that a functional protein is produced.
- a control sequence in a vector that is "operably linked" to a protein coding sequence is ligated thereto so that expression of the protein coding sequence is achieved under conditions compatible with the transcriptional activity of the control sequences.
- Polypeptide and “protein” are used interchangeably herein and include a molecular chain of two or more amino acids linked covalently through peptide bonds. The terms do not refer to a specific length of the product. Thus, “peptides,” and
- oligopeptides are included within the definition of polypeptide.
- the terms include post- translational modifications of the polypeptide, for example, glycosylate ons, acetylations, phosphorylations and the like.
- protein fragments, analogs, mutated or variant proteins, fusion proteins and the like are included within the meaning of polypeptide.
- the terms also include molecules in which one or more amino acid analogs or non-canonical or unnatural amino acids are included as can be expressed recombinantly using known protein engineering techniques.
- fusion proteins can be derivatized as described herein by well-known organic chemistry techniques.
- a "variant" of a polypeptide comprises an amino acid sequence wherein one or more amino acid residues are inserted into, deleted from and/or substituted into the amino acid sequence relative to another polypeptide sequence.
- Variants include fusion proteins.
- fusion protein indicates that the protein includes polypeptide components derived from more than one parental protein or polypeptide.
- a fusion protein is expressed from a "fusion gene" in which a nucleotide sequence encoding a polypeptide sequence from one protein is appended in frame with, and optionally separated by a linker from, a nucleotide sequence encoding a polypeptide sequence from a different protein.
- the fusion gene can then be expressed by a recombinant host cell as a single protein.
- a "secreted" protein refers to those proteins capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a secretory signal peptide sequence, as well as those proteins released into the extracellular space without necessarily containing a signal sequence. If the secreted protein is released into the extracellular space, the secreted protein can undergo extracellular processing to produce a "mature" protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage. In some other embodiments of the inventive method, the protein of interest can be synthesized by the host cell as a secreted protein, which can then be further purified from the extracellular space and/or medium.
- soluble when in reference to a protein produced by recombinant DNA technology in a host cell is a protein that exists in aqueous solution; if the protein contains a twin-arginine signal amino acid sequence the soluble protein is exported to the periplasmic space in gram negative bacterial hosts, or is secreted into the culture medium by eukaryotic host cells capable of secretion, or by bacterial host possessing the appropriate genes (e.g., the kil gene).
- a soluble protein is a protein which is not found in an inclusion body inside the host cell.
- a soluble protein is a protein which is not found integrated in cellular membranes, or, in vitro, is dissolved, or is capable of being dissolved in an aqueous buffer under physiological conditions without forming significant amounts of insoluble aggregates (i.e., forms aggregates less than 10%, and typically less than about 5%, of total protein) when it is suspended without other proteins in an aqueous buffer of interest under physiological conditions, such buffer not containing a detergent or chaotropic agent, such as urea, guanidinium hydrochloride, or lithium perchlorate.
- a detergent or chaotropic agent such as urea, guanidinium hydrochloride, or lithium perchlorate.
- an insoluble protein is one which exists in denatured form inside cytoplasmic granules (called an inclusion body) in the host cell, or again depending on the context, an insoluble protein is one which is present in cell membranes, including but not limited to, cytoplasmic membranes, mitochondrial membranes, chloroplast membranes, endoplasmic reticulum membranes, etc., or in an in vitro aqueous buffer under physiological conditions forms significant amounts of insoluble aggregates (i.e., forms aggregates equal to or more than about 10% of total protein) when it is suspended without other proteins (at
- an aqueous buffer of interest under physiological conditions, such buffer not containing a detergent or chaotropic agent, such as urea, guanidinium hydrochloride, or lithium perchlorate.
- a detergent or chaotropic agent such as urea, guanidinium hydrochloride, or lithium perchlorate.
- polynucleotide or “nucleic acid” includes both single-stranded and double-stranded nucleotide polymers containing two or more nucleotide residues.
- the nucleotide residues comprising the polynucleotide can be ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide.
- Said modifications include base modifications such as bromouridine and inosine derivatives, ribose modifications such as 2',3'-dideoxyribose, and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate and phosphoroamidate.
- oligonucleotide means a polynucleotide comprising 200 or fewer nucleotide residues. In some embodiments, oligonucleotides are 10 to 60 bases in length. In other embodiments, oligonucleotides are 12, 13, 14, 15, 16, 17, 18, 19, or 20 to 40 nucleotides in length. Oligonucleotides may be single stranded or double stranded, e.g., for use in the construction of a mutant gene. Oligonucleotides may be sense or antisense oligonucleotides.
- An oligonucleotide can include a label, including a radiolabel, a fluorescent label, a hapten or an antigenic label, for detection assays. Oligonucleotides may be used, for example, as PCR primers, cloning primers or hybridization probes.
- a "polynucleotide sequence” or “nucleotide sequence” or “nucleic acid sequence,” as used interchangeably herein, is the primary sequence of nucleotide residues in a polynucleotide, including of an oligonucleotide, a DNA, and RNA, a nucleic acid, or a character string representing the primary sequence of nucleotide residues, depending on context. From any specified polynucleotide sequence, either the given nucleic acid or the complementary polynucleotide sequence can be determined. Included are DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand.
- the left-hand end of any single- stranded polynucleotide sequence discussed herein is the 5' end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5' direction.
- the direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences;" sequence regions on the DNA strand having the same sequence as the RNA transcript that are 3' to the 3' end of the RNA transcript are referred to as "downstream sequences.”
- an "isolated nucleic acid molecule” or “isolated nucleic acid sequence” is a nucleic acid molecule that is either (1) identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the nucleic acid or (2) cloned, amplified, tagged, or otherwise distinguished from background nucleic acids such that the sequence of the nucleic acid of interest can be determined.
- An isolated nucleic acid molecule is other than in the form or setting in which it is found in nature.
- an isolated nucleic acid molecule includes a nucleic acid molecule contained in cells that ordinarily express the immunoglobulin (e.g., antibody) where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
- immunoglobulin e.g., antibody
- nucleic acid molecule encoding refers to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid.
- the order of these deoxyribonucleotides determines the order of ribonucleotides along the mRNA chain, and also determines the order of amino acids along the polypeptide (protein) chain.
- the DNA sequence thus codes for the RNA sequence and for the amino acid sequence.
- Gene is used broadly to refer to any nucleic acid associated with a biological function. Genes typically include coding sequences and/or the regulatory sequences required for expression of such coding sequences. The term “gene” applies to a specific genomic or recombinant sequence, as well as to a cDNA or mRNA encoded by that sequence. Genes also include non-expressed nucleic acid segments that, for example, form recognition sequences for other proteins. Non-expressed regulatory sequences including transcriptional control elements to which regulatory proteins, such as transcription factors, bind, resulting in transcription of adjacent or nearby sequences.
- “Expression of a gene” or “expression of a nucleic acid” means transcription of DNA into RNA (optionally including modification of the RNA, e.g., splicing), translation of RNA into a polypeptide (possibly including subsequent post-translational modification of the polypeptide), or both transcription and translation, as indicated by the context.
- the present invention relates to an expression cassette that includes the inventive hybrid promoter.
- a eukaryotic "expression cassette” refers to the part of an expression vector that enables production of protein in a eukaryotic cell, such as a mammalian cell. It includes a promoter, operable in a eukaryotic cell, for mRNA transcription, one or more gene(s) encoding protein(s) of interest and a mRNA
- An expression cassette can usefully include among the coding sequences, a gene useful as a selective marker.
- the hybrid promoter is operably linked 5' to an open reading frame encoding an exogenous protein of interest; and a polyadenylation site is operably linked 3' to the open reading frame.
- a useful polyadenylation site sequence is a SV40 late polyadenylation site SEQ ID NO: 14: [00087] CACACATCATAAGATACATTGATGAGTTTGGACAAACCACAACTAG AATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTAT TTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCAT TTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCAAGTAAAA CCTCTACAAATGTGGTA//SEQ ID NO: 14.
- control sequences can also be included as long as the expression cassette remains operable.
- the open reading frame can optionally include a coding sequence for more than one protein of interest.
- coding region or "coding sequence” when used in reference to a structural gene refers to the nucleotide sequences which encode the amino acids found in the nascent polypeptide as a result of translation of an mRNA molecule.
- the coding region is bounded, in eukaryotes, on the 5' side by the nucleotide triplet "ATG” which encodes the initiator methionine and on the 3' side by one of the three triplets which specify stop codons (i.e., TAA, TAG, TGA).
- the present invention also encompasses a recombinant expression vector comprising the inventive expression cassette.
- vector means any molecule or entity (e.g., nucleic acid, plasmid, bacteriophage or virus) used to transfer protein coding information into a host cell.
- expression vector refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid control sequences necessary for the expression of the operably linked coding sequence in a particular host cell.
- An expression vector can include, but is not limited to, sequences that affect or control transcription, translation, and, if introns are present, affect RNA splicing of a coding region operably linked thereto.
- Nucleic acid sequences necessary for expression in prokaryotes include a promoter, optionally an operator sequence, a ribosome binding site and possibly other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.
- a secretory signal peptide sequence can also, optionally, be encoded by the expression vector, operably linked to the coding sequence of interest, so that the expressed polypeptide can be secreted by the recombinant host cell, for more facile isolation of the polypeptide of interest from the cell, if desired.
- Such techniques are well known in the art. (E.g., Goodey, Andrew R.; et al., Peptide and DNA sequences, U.S. Pat. No. 5,302,697; Weiner et al., Compositions and methods for protein secretion, U.S. Pat. No. 6,022,952 and U.S. Pat. No. 6,335, 178; Uemura et al Protein expression vector and utilization thereof, U.S. Pat. No. 7,029,909; Ruben et al., 27 human secreted proteins, US
- the present invention also relates to a mammalian host cell comprising the inventive recombinant expression vector.
- the term "host cell” means a cell that has been transformed, or is capable of being transformed, with a nucleic acid and thereby expresses a gene of interest.
- the term includes the progeny of the parent cell, whether or not the progeny is identical in morphology or in genetic make-up to the original parent cell, so long as the gene of interest is present Any of a large number of available and well-known host cells may be used in the practice of this invention. The selection of a particular host is dependent upon a number of factors recognized by the art. These include, for example, compatibility with the chosen expression vector, toxicity of the peptides encoded by the DNA molecule, rate of transformation, ease of recovery of the peptides, expression characteristics, bio-safety and costs.
- useful microbial host cells in culture include bacteria (such as Escherichia coli sp.), yeast (such as Saccharomyces sp.) and other fungal cells, insect cells, plant cells, mammalian (including human) cells, e.g., CHO cells and HEK-293 cells. Modifications can be made at the DNA level, as well.
- the peptide-encoding DNA sequence may be changed to codons more compatible with the chosen host cell. For E. coli, optimized codons are known in the art.
- Codons can be substituted to eliminate restriction sites or to include silent restriction sites, which may aid in processing of the DNA in the selected host cell.
- the transformed host is cultured and purified.
- Host cells may be cultured under conventional fermentation conditions so that the desired compounds are expressed. Such fermentation conditions are well known in the art.
- Examples of useful mammalian host cell lines are Chinese hamster ovary cells, including CHO-K1 cells (e.g., ATCC CCL61), DXB-11, DG-44, and Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al, Proc. Natl. Acad. Sci. USA 77: 4216 (1980)); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, [Graham et al, J. Gen Virol.
- Cell Cell
- cell line cell culture
- all such designations herein include cellular progeny.
- a cell “derived” from a CHO cell is a cellular progeny of a Chinese Hamster Ovary cell, which may be removed from the original primary cell parent by any number of generations, and which can also include a transformant progeny cell.
- Transformants and transformed cells include the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included.
- Host cells are transformed or transfected with the above-described nucleic acids or vectors for production of polypeptides (including antigen binding proteins, such as antibodies) and are cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
- polypeptides including antigen binding proteins, such as antibodies
- novel vectors and transfected cell lines with multiple copies of transcription units separated by a selective marker are particularly useful for the expression of polypeptides, such as antibodies.
- transfection means the uptake of foreign or exogenous DNA by a cell, and a cell has been "transfected" when the exogenous DNA has been introduced inside the cell membrane.
- transfection techniques are well known in the art and are disclosed herein. See, e.g., Graham et al., 1973, Virology 52:456; Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, supra; Davis et al., 1986, Basic Methods in Molecular Biology, Elsevier; Chu et al., 1981 , Gene 13: 197.
- Such techniques can be used to introduce one or more exogenous DNA moieties into suitable host cells.
- transformation refers to a change in a cell's genetic characteristics, and a cell has been transformed when it has been modified to contain new DNA or RNA.
- a cell is transformed where it is genetically modified from its native state by introducing new genetic material via transfection, transduction, or other techniques.
- the transforming DNA may recombine with that of the cell by physically integrating into a chromosome of the cell, or may be maintained transiently as an episomal element without being replicated, or may replicate
- a cell is considered to have been "stably transformed” when the transforming DNA is replicated with the division of the cell.
- the present invention also relates to a method of producing a protein of interest involving culturing the mammalian host cell, in aqueous medium under physiological conditions permitting expression of the protein of interest; and recovering the protein of interest from the medium.
- the host cells used to produce the polypeptides useful in the invention may be cultured in a variety of media.
- Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing the host cells.
- any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as GentamycinTM drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source, such that the physiological conditions of the cell in, or on, the medium promote expression of the protein of interest by the host cell; any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art.
- growth factors such as insulin, transferrin, or epidermal growth factor
- salts such as sodium chloride, calcium, magnesium, and phosphate
- buffers such as HEPES
- nucleotides such as adenosine and thymidine
- antibiotics such as GentamycinTM drug
- the culture conditions such as temperature (typically, but not necessarily, about 37°C), pH (typically, but not necessarily, about pH 6.5-7.5), oxygenation, and the like, are those previously used with the host cell selected for expression of the protein of interest, and will be apparent to the ordinarily skilled artisan.
- the culture medium can include a suitable amount of serum such a fetal bovine serum (FBS), or preferably, the host cells can be adapted for culture in serum-free medium.
- the aqueous medium is liquid, such that the host cells are cultured in a cell suspension within the liquid medium.
- the host cells can be usefully grown in batch culture or in continuous culture systems.
- the mammalian host cells can be cultured on solid or semi-solid aqueous medium, for example, containing agar or agarose, to form a medium or substrate surface to which the cells adhere and form an adhesion layer.
- solid or semi-solid aqueous medium for example, containing agar or agarose
- the recombinant polypeptide Upon culturing the host cells, the recombinant polypeptide can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the polypeptide, such as an antigen binding protein (e.g., an antibody), is produced intracellularly, as a first step, the particulate debris, either host cells or lysed fragments, is removed, for example, by centrifugation or ultrafiltration.
- an antigen binding protein e.g., an antibody
- a protein of interest such as an antibody or antibody fragment can be purified using, for example, hydroxylapatite chromatography, cation or anion exchange chromatography, or preferably affinity chromatography, using the antigen of interest or protein A or protein G as an affinity ligand.
- Protein A can be used to purify proteins that include polypeptides are based on human ⁇ , ⁇ 2, or ⁇ 4 heavy chains (Lindmark et al, J. Immunol. Meth. 62: 1-13 (1983)). Protein G is recommended for all mouse isotypes and for human ⁇ 3 (Guss et al, EMBO J. 5: 15671575 (1986)).
- the matrix to which the affinity ligand is attached is most often agarose, but other matrices are available.
- Mechanically stable matrices such as controlled pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than can be achieved with agarose.
- the Bakerbond ABXTM resin J. T. Baker, Phillipsburg, N.J.
- Other techniques for protein purification such as ethanol precipitation, Reverse Phase HPLC, chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation are also possible depending on the antibody to be recovered.
- Under physiological conditions with respect to incubating buffers and immunoglobulins, or other binding assay reagents means incubation under conditions of temperature, pH, and ionic strength, that permit a biochemical reaction, such as a non- covalent binding reaction, to occur.
- the temperature is at room or ambient temperature up to about 37°C and at pH 6.5-7.5.
- Physiologically acceptable salt of a composition of matter, for example a salt of an immunoglobulin, such as an antibody or other protein of interest, means any salt, or salts, that are known or later discovered to be pharmaceutically acceptable.
- Some non-limiting examples of pharmaceutically acceptable salts are: acetate; trifiuoroacetate; hydrohalides, such as hydrochloride and hydrobromide; sulfate; citrate; maleate; tartrate; glycolate; gluconate; succinate; mesylate; besylate; salts of gallic acid esters (gallic acid is also known as 3,4, 5 trihydroxybenzoic acid) such as PentaGalloylGlucose (PGG) and epigallocatechin gallate (EGCG), salts of cholesteryl sulfate, pamoate, .annate and oxalate salts.
- PPGG PentaGalloylGlucose
- EGCG epigallocatechin gallate
- reaction mixture is an aqueous mixture containing all the reagents and factors necessary, which under physiological conditions of incubation, permit an in vitro biochemical reaction of interest to occur, such as a covalent or non-covalent binding reaction.
- a “domain” or “region” (used interchangeably herein) of a polynucleotide is any portion of the entire polynucleotide, up to and including the complete polynucleotide, but typically comprising less than the complete polynucletide.
- a domain can, but need not, fold independently (e.g., DNA hairpin folding) of the rest of the polynucleotide chain and/or be correlated with a particular biological, biochemical, or structural function or location, such as a coding region or a regulatory region.
- a “domain” or “region” (used interchangeably herein) of a protein is any portion of the entire protein, up to and including the complete protein, but typically comprising less than the complete protein.
- a domain can, but need not, fold
- a particular biological, biochemical, or structural function or location e.g., a ligand binding domain, or a cytosolic, transmembrane or extracellular domain.
- antibody or interchangeably “Ab” is used in the broadest sense and includes fully assembled antibodies, monoclonal antibodies (including human, humanized or chimeric antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments that can bind antigen (e.g., Fab, Fab', F(ab')2, Fv, single chain antibodies, diabodies), comprising complementarity determining regions (CDRs) of the foregoing as long as they exhibit the desired biological activity. Multimers or aggregates of intact molecules and/or fragments, including chemically derivatized antibodies, are contemplated.
- Antibodies of any isotype class or subclass including IgG, IgM, IgD, IgA, and IgE, IgGl, IgG2, IgG3, IgG4, IgAl and IgA2, or any allotype, are contemplated.
- Different isotypes have different effector functions; for example, IgGl and IgG3 isotypes have antibody-dependent cellular cytotoxicity (ADCC) activity.
- ADCC antibody-dependent cellular cytotoxicity
- an "isolated" protein e.g., an immunoglobulin, such as an antibody or antibody fragment
- an immunoglobulin such as an antibody or antibody fragment
- the isolated protein is substantially free from proteins or polypeptides or other contaminants that are found in its natural or culture medium environment that would interfere with its therapeutic, diagnostic, prophylactic, research or other use.
- Contaminant components of its natural environment or medium are materials that would interfere with diagnostic or therapeutic uses for the protein, e.g., an antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous (e.g., polynucleotides, lipids, carbohydrates) solutes.
- an "isolated protein” constitutes at least about 5%, at least about 10%, at least about 25%, or at least about 50% of a given sample.
- the protein of interest e.g., an antibody will be purified (1) to greater than 95% by weight of protein, and most preferably more than 99% by weight, or (2) to homogeneity by SDS-PAGE under reducing or nonreducing conditions, optionally using a stain, e.g., Coomassie blue or silver stain.
- Isolated naturally occurring antibody includes the antibody in situ within recombinant cells since at least one component of the protein's natural environment will not be present.
- the isolated protein of interest e.g., an antibody
- the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies that are antigen binding proteins are highly specific binders, being directed against an individual antigenic site or epitope, in contrast to polyclonal antibody preparations that typically include different antibodies directed against different epitopes.
- Nonlimiting examples of monoclonal antibodies include murine, rabbit, rat, chicken, chimeric, humanized, or human antibodies, fully assembled antibodies, multispecific antibodies (including bispecific antibodies), antibody fragments that can bind an antigen (including, Fab, Fab', F(ab) 2 , Fv, single chain antibodies, diabodies), maxibodies, nanobodies, and recombinant peptides comprising CDRs of the foregoing as long as they exhibit the desired biological activity, or variants or derivatives thereof.
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et al., Nature, 256:495 [1975], or may be made by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567).
- the "monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352:624-628[1991] and Marks et al., J. Mol. Biol., 222:581-597 (1991), for example.
- a "multispecific" binding agent or antigen binding protein or antibody is one that targets more than one antigen or epitope.
- a "bispecific,” “dual-specific” or “bifunctional” binding agent or antigen binding protein or antibody is a hybrid having two different antigen binding sites.
- Biantigen binding proteins, antigen binding proteins and antibodies are a species of multiantigen binding protein, antigen binding protein or multispecific antibody and may be produced by a variety of methods including, but not limited to, fusion of hybridomas or linking of Fab 1 fragments.
- fusion of hybridomas or linking of Fab 1 fragments See, e.g., Songsivilai and Lachmann, 1990, Clin. Exp. Immunol. 79:315-321; Kostelny et al, 1992, J. Immunol. 148:1547-1553; Spiess et al., Alternative molecular formats and therapeutic applications for bispecific antibodies, Mol. Immunol. 67:95-106 (2015)).
- the two binding sites of a bispecific antigen binding protein or antibody will bind to two different epitopes, which may reside on the same or different protein targets.
- immunoglobulin encompasses full antibodies comprising two dimerized heavy chains (HC), each covalently linked to a light chain (LC); a single undimerized immunoglobulin heavy chain and covalently linked light chain (HC+LC), or a chimeric immunoglobulin (light chain+heavy chain)-Fc heterotrimer (a so-called “hemibody”).
- HC dimerized heavy chains
- HC+LC single undimerized immunoglobulin heavy chain and covalently linked light chain
- hemibody chimeric immunoglobulin (light chain+heavy chain)-Fc heterotrimer
- each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” chain of about 220 amino acids (about 25 kDa) and one "heavy” chain of about 440 amino acids (about 50-70 kDa).
- the amino- terminal portion of each chain includes a "variable" ("V") region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
- the carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
- the variable region differs among different antibodies.
- the constant region is the same among different antibodies.
- variable region of each heavy or light chain there are three hypervariable subregions that help determine the antibody's specificity for antigen in the case of an antibody that is an antigen binding protein.
- an embodiment of the immunoglobulin e.g., an antibody
- the variable domain residues between the hypervariable regions are called the framework residues and generally are somewhat homologous among different antibodies.
- Immunoglobulins can be assigned to different classes depending on the amino acid sequence of the constant domain of their heavy chains. Human light chains are classified as kappa (.kappa.) and lambda (.lamda.) light chains.
- variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D” region of about 10 more amino acids.
- J Joint Immunology
- D double-chain region
- an "antibody” also encompasses a
- light chain or "immunoglobulin light chain” includes a full-length light chain and fragments thereof having sufficient variable region sequence to confer binding specificity.
- a full-length light chain includes a variable region domain, VL, and a constant region domain, CL.
- the variable region domain of the light chain is at the amino- terminus of the polypeptide.
- Light chains include kappa chains and lambda chains.
- the term "heavy chain” or “immunoglobulin heavy chain” includes a full- length heavy chain and fragments thereof having sufficient variable region sequence to confer binding specificity.
- a full-length heavy chain includes a variable region domain, VH, and three constant region domains, Cm, Cm, and Cm.
- the VH domain is at the amino-terminus of the polypeptide, and the CH domains are at the carboxyl-terminus, with the Cm being closest to the carboxy-terminus of the polypeptide.
- Heavy chains are classified as mu ( ⁇ ), delta ( ⁇ ), gamma ( ⁇ ), alpha (a), and epsilon ( ⁇ ), and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively.
- heavy chains may be of any isotype, including IgG (including IgGl, IgG2, IgG3 and IgG4 subtypes), IgA (including IgAl and IgA2 subtypes), IgM and IgE.
- IgGl including IgGl, IgG2, IgG3, IgG4, IgAl and IgA2.
- Different IgG isotypes may have different effector functions (mediated by the Fc region), such as antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC).
- ADCC antibody-dependent cellular cytotoxicity
- CDC complement-dependent cytotoxicity
- the Fc region of an antibody binds to Fc receptors (Fc.gamma.Rs) on the surface of immune effector cells such as natural killers and macrophages, leading to the phagocytosis or lysis of the targeted cells.
- Fc receptors Fc.gamma.Rs
- the antibodies kill the targeted cells by triggering the complement cascade at the cell surface.
- immunoglobulin Fc domain contains two heavy chain fragments, which in a full antibody comprise the C H1 and C H2 domains of the antibody.
- the two heavy chain fragments are held together by two or more disulfide bonds and by hydrophobic interactions of the C H3 domains.
- the term "salvage receptor binding epitope” refers to an epitope of the Fc region of an IgG molecule (e.g., IgG 1 , IgG 2 , IgG 3 , or IgG 4 ) that is responsible for increasing the in vivo serum half-life of the IgG molecule.
- the protein of interest is an antigen binding protein, such as but not limited to, an antibody, antibody subunit, or antibody fragment.
- an antigen binding protein such as but not limited to, an antibody, antibody subunit, or antibody fragment.
- V, D, J or only V and J in the case of light chain genes
- V, D, J or only V and J in the case of light chain genes
- This gene segment rearrangement process appears to be sequential.
- heavy chain D-to-J joints are made, followed by heavy chain V-to-DJ joints and light chain V-to-J joints.
- further diversity is generated in the primary repertoire of immunoglobulin heavy and light chains by way of variable recombination at the locations where the V and J segments in the light chain are joined and where the D and J segments of the heavy chain are joined.
- Such variation in the light chain typically occurs within the last codon of the V gene segment and the first codon of the J segment. Similar imprecision in joining occurs on the heavy chain chromosome between the D and J H segments and may extend over as many as 10 nucleotides. Furthermore, several nucleotides may be inserted between the D and JH and between the VH and D gene segments which are not encoded by genomic DNA. The addition of these nucleotides is known as N-region diversity. The net effect of such rearrangements in the variable region gene segments and the variable recombination which may occur during such joining is the production of a primary antibody repertoire.
- hypervariable region refers to the amino acid residues of an antibody which are responsible for antigen-binding.
- the hypervariable region comprises amino acid residues from a complementarity determining region or CDR [i.e., residues 24-34 (LI), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (HI), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain as described by Kabat et al, Sequences of Proteins of Immunological Interest, th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)]. Even a single CDR may recognize and bind antigen, although with a lower affinity than the entire antigen binding site containing all of the CDRs.
- residues from a hypervariable "loop” is described by Chothia et al, J. Mol. Biol. 196: 901-917 (1987) as residues 26-32 (LI), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (HI), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain.
- Antibody fragments comprise a portion of an intact full length antibody, preferably the antigen binding or variable region of the intact antibody.
- antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng.,8(10): 1057-1062 (1995)); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual "Fc” fragment which contains the constant region.
- the Fab fragment contains all of the variable domain, as well as the constant domain of the light chain and the first constant domain (CHI) of the heavy chain.
- the Fc fragment displays carbohydrates and is responsible for many antibody effector functions (such as binding complement and cell receptors), that distinguish one class of antibody from another.
- Pepsin treatment yields an F ab ⁇ fragment that has two "Single-chain Fv” or "scFv” antibody fragments comprising the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain.
- the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains that enables the Fv to form the desired structure for antigen binding.
- a "Fab fragment” is comprised of one light chain and the CHI and variable regions of one heavy chain.
- the heavy chain of a Fab molecule cannot form a disulfide bond with another heavy chain molecule.
- a "Fab 1 fragment” contains one light chain and a portion of one heavy chain that contains the VH domain and the CHI domain and also the region between the Cm and Cm domains, such that an interchain disulfide bond can be formed between the two heavy chains of two Fab' fragments to form an F(ab') 2 molecule.
- a "Fiab ⁇ a fragment” contains two light chains and two heavy chains containing a portion of the constant region between the CHI and Cm domains, such that an interchain disulfide bond is formed between the two heavy chains.
- a F(ab') 2 fragment thus is composed of two Fab 1 fragments that are held together by a disulfide bond between the two heavy chains.
- Fv is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy- and one light- chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the VH VL dimer. A single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
- Single-chain antibodies are Fv molecules in which the heavy and light chain variable regions have been connected by a flexible linker to form a single polypeptide chain, which forms an antigen-binding region. Single chain antibodies are discussed in detail in International Patent Application Publication No. WO 88/01649 and U.S. Pat. No. 4,946,778 and No. 5,260,203, the disclosures of which are incorporated by reference in their entireties.
- Single-chain Fv” or “scFv” antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain, and optionally comprising a polypeptide linker between the VH and Vi.
- An "Fd" fragment consists of the VH and CHI domains.
- diabodies refers to small antibody fragments with two antigen- binding sites, which fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH VL).
- VH heavy-chain variable domain
- VL light-chain variable domain
- VH VL polypeptide chain
- a “domain antibody” is an immunologically functional immunoglobulin fragment containing only the variable region of a heavy chain or the variable region of a light chain.
- two or more VH regions are covalently joined with a peptide linker to create a bivalent domain antibody.
- the two VH regions of a bivalent domain antibody may target the same or different antigens.
- ABSP antigen binding protein
- antibodies or antibody fragments as defined above, and recombinant peptides or other compounds that contain sequences derived from CDRs having the desired antigen-binding properties such that they specifically bind a target antigen of interest.
- an antigen binding protein e.g., an antibody or antibody fragment
- an antigen binding protein "specifically binds" to an antigen of interest when it has a significantly higher binding affinity for, and consequently is capable of distinguishing, that antigen, compared to its affinity for other unrelated proteins, under similar binding assay conditions.
- an antigen binding protein is said to "specifically bind” its target antigen when the dissociation constant (KD) is 10 ⁇ 8 M or lower.
- KD dissociation constant
- the antigen binding protein specifically binds antigen with "high affinity” when the KD is 10 "9 M or lower, and with “very high affinity” when the KD is 10 "10 M or lower.
- Antigen binding region or "antigen binding site” means a portion of a protein that specifically binds a specified antigen. For example, that portion of an antigen binding protein that contains the amino acid residues that interact with an antigen and confer on the antigen binding protein its specificity and affinity for the antigen is referred to as "antigen binding region.”
- An antigen binding region typically includes one or more “complementary binding regions” ("CDRs"). Certain antigen binding regions also include one or more "framework” regions (“FRs").
- CDR is an amino acid sequence that contributes to antigen binding specificity and affinity. "Framework” regions can aid in maintaining the proper conformation of the CDRs to promote binding between the antigen binding region and an antigen.
- variable region of an immunoglobulin antigen binding protein comprises at least three heavy or light chain CDRs, see, supra (Kabat et al, 1991, Sequences of Proteins of Immunological Interest, Public Health Service N.I.H., Bethesda, Md.; see also Chothia and Lesk, 1987, J. Mol. Biol.
- framework region designated framework regions 1-4, FR1, FR2, FR3, and FR4, by Kabat et al., 1991, supra; see also Chothia and Lesk, 1987, supra).
- antigen refers to a molecule or a portion of a molecule capable of being bound by a selective binding agent, such as an antigen binding protein (including, e.g., an antibody or immunological functional fragment thereof), and additionally capable of being used in an animal to produce antibodies capable of binding to that antigen.
- a selective binding agent such as an antigen binding protein (including, e.g., an antibody or immunological functional fragment thereof), and additionally capable of being used in an animal to produce antibodies capable of binding to that antigen.
- An antigen may possess one or more epitopes that are capable of interacting with different antigen binding proteins, e.g., antibodies.
- epitope is the portion of a molecule that is bound by an antigen binding protein (for example, an antibody).
- an antigen binding protein for example, an antibody
- the term includes any determinant capable of specifically binding to an antigen binding protein, such as an antibody or to a T-cell receptor.
- An epitope can be contiguous or non-contiguous (e.g., in a single-chain polypeptide, amino acid residues that are not contiguous to one another in the polypeptide sequence but that within the context of the molecule are bound by the antigen binding protein).
- epitopes may be mimetic in that they comprise a three dimensional structure that is similar to an epitope used to generate the antigen binding protein, yet comprise none or only some of the amino acid residues found in that epitope used to generate the antigen binding protein. Most often, epitopes reside on proteins, but in some instances may reside on other kinds of molecules, such as nucleic acids. Epitope determinants may include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl or sulfonyl groups and may have specific three dimensional structural characteristics, and/or specific charge characteristics.
- antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
- identity refers to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences.
- Percent identity means the percent of identical residues between the amino acids or nucleotides in the compared molecules and is calculated based on the size of the smallest of the molecules being compared. For these calculations, gaps in alignments (if any) must be addressed by a particular mathematical model or computer program (i.e., an "algorithm”). Methods that can be used to calculate the identity of the aligned nucleic acids or polypeptides include those described in Computational Molecular Biology, (Lesk, A. M., ed.), 1988, New York: Oxford
- sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides.
- a computer program such as BLAST or FASTA
- two polypeptide or two polynucleotide sequences are aligned for optimal matching of their respective residues (either along the full length of one or both sequences, or along a pre-determined portion of one or both sequences).
- the programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 2S0 [a standard scoring matrix; see Dayhoff et al., in Atlas of Protein Sequence and Structure, vol. 5, supp. 3 (1978)] can be used in conjunction with the computer program.
- the percent identity can then be calculated as: the total number of identical matches multiplied by 100 and then divided by the sum of the length of the longer sequence within the matched span and the number of gaps introduced into the longer sequences in order to align the two sequences.
- the sequences being compared are aligned in a way that gives the largest match between the sequences.
- the GCG program package is a computer program that can be used to determine percent identity, which package includes GAP (Devereux et al., 1984, Nucl. Acid Res. 12:387; Genetics Computer Group, University of Wisconsin, Madison, Wis.).
- GAP is used to align the two polypeptides or two
- polynucleotides for which the percent sequence identity is to be determined.
- the sequences are aligned for optimal matching of their respective amino acid or nucleotide (the "matched span", as determined by the algorithm).
- a gap opening penalty (which is calculated as 3. times, the average diagonal, wherein the "average diagonal” is the average of the diagonal of the comparison matrix being used; the “diagonal” is the score or number assigned to each perfect amino acid match by the particular comparison matrix)
- a gap extension penalty which is usually 1/10 times the gap opening penalty
- a comparison matrix such as PAM 250 or BLOSUM 62 are used in conjunction with the algorithm.
- a standard comparison matrix (see, Dayhoff et al, 1978, Atlas of Protein Sequence and Structure 5:345-352 for the PAM 250 comparison matrix; Henikoff et al., 1992, Proc. Natl. Acad. Sci. U.S.A. 89:10915-10919 for the BLOSUM 62 comparison matrix) is also used by the algorithm.
- Gap Penalty 12 (but with no penalty for end gaps)
- GAP program can be adjusted if so desired to result in an alignment that spans at least 50 contiguous amino acids of the target polypeptide.
- modified immunoglobulins when used in connection with proteins of interest (e.g., immunoglobulins, including antibodies and antibody fragments), include, but are not limited to, one or more amino acid changes (including substitutions, insertions or deletions); chemical modifications; covalent modification by conjugation to therapeutic or diagnostic agents; labeling (e.g., with radionuclides or various enzymes); covalent polymer attachment such as PEGylation (derivatization with polyethylene glycol) and insertion or substitution by chemical synthesis of non-natural amino acids. Modified immunoglobulins of the invention will retain the binding (or non-binding) properties of unmodified molecules of the invention.
- immunoglobulins such as antibodies, or other proteins
- derivatives when used in connection with proteins of interest, such as immunoglobulins (including antibodies and antibody fragments) refers to proteins that are covalently modified by conjugation to therapeutic or diagnostic agents, labeling (e.g., with radionuclides or various enzymes), covalent polymer attachment such as PEGylation (derivatization with polyethylene glycol) and insertion or substitution by chemical synthesis of non-natural amino acids. Derivatives of the invention will retain the binding properties of un-derivatized molecules.
- proteins of interest can be therapeutic proteins, or "biologies,” for the treatment of disease, including but not limited to human disease or disorder.
- “Treatment” or “treating” is an intervention performed with the intention of preventing the development or altering the pathology of a disorder.
- treatment refers to both therapeutic treatment and prophylactic or preventative measures.
- Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented.
- 'Treatment includes any indications) of success in the amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being.
- the treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination by a physician or other health care provider, self- reporting by a patient, neuropsychiatric exams, and/or a psychiatric evaluation.
- An "effective amount" of a therapeutic is generally an amount sufficient to reduce the severity and/or frequency of symptoms, eliminate the symptoms and/or underlying cause, prevent the occurrence of symptoms and/or their underlying cause, and/or improve or remediate the damage that results from or is associated with migraine headache.
- the effective amount is a therapeutically effective amount or a prophylactically effective amount
- a "therapeutically effective amount” is an amount sufficient to remedy a disease state (e.g., transplant rejection or GVHD, inflammation, multiple sclerosis, cancer, cardiovascular disease, diabetes, neuropathy, pain) or symptom(s), particularly a state or symptom(s) associated with the disease state, or otherwise prevent, hinder, retard or reverse the progression of the disease state or any other undesirable symptom associated with the disease in any way whatsoever (i.e. that provides "therapeutic efficacy").
- a “prophylactically effective amount” is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of migraine headache or multiple sclerosis symptoms, or reducing the likelihood of the onset (or reoccurrence) of migraine headache, migraine headache symptoms, or multiple sclerosis symptoms.
- the full therapeutic or prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses.
- a therapeutically or prophylactically effective amount may be administered in one or more administrations.
- the protein of interest can be any protein, but in in many embodiments the protein is a pharmacologically active protein or peptide.
- the protein of interest can be a mimetic mimetic or agonist peptide.
- mimetic mimetic or agonist peptide refer to a peptide or protein having biological activity comparable to a naturally occurring protein of interest. These terms further include peptides that indirectly mimic the activity of a naturally occurring peptide molecule, such as by potentiating the effects of the naturally occurring molecule.
- the protein of interest can be an antagonist peptide or inhibitor peptide.
- the term "-antagonist peptide,” “peptide antagonist,” and “inhibitor peptide” refer to a peptide that blocks or in some way interferes with the biological activity of a receptor of interest, or has biological activity comparable to a known antagonist or inhibitor of a receptor of interest (such as, but not limited to, an ion channel or a G-Protein Coupled Receptor (GPCR)).
- GPCR G-Protein Coupled Receptor
- Examples of pharmacologically active proteins that can be used within the present invention include, but are not limited to, a toxin peptide, an IL-6 binding peptide, a CD3 binding protein, a CD 19 binding protein, a CD20 binding protein, a CD22 binding protein, a HER2 binding protein, a HER3 binding protein, a VEGF-A binding protein, a TNF-a binding protein, an EGFR binding protein, a RANK ligand binding protein, an IL- la binding protein, an IL- ⁇ binding protein an IL-17A binding protein, an EPCAM (CD326) binding protein, a CGRP peptide antagonist, a bradykinin Bl receptor peptide antagonist, a parathyroid hormone (PTH) agonist peptide, a parathyroid hormone ( ⁇ ) antagonist peptide, an ang-1 binding peptide, an ang-2 binding peptide, a myostatin binding peptide, an erythropoietin
- peptide or protein "analog” refers to a polypeptide having a sequence that differs from a peptide sequence existing in nature by at least one amino acid residue substitution, internal addition, or internal deletion of at least one amino acid, and/or amino- or carboxy-terminal end truncations, or additions).
- An "internal deletion” refers to absence of an amino acid from a sequence existing in nature at a position other than the N- or C -terminus.
- an “internal addition” refers to presence of an amino acid in a sequence existing in nature at a position other than the N- or C-terminus.
- a cDNA library may be constructed by reverse transcription of polyA+ mRNA, preferably membrane-associated mRNA, and the library screened using probes specific for human immunoglobulin polypeptide gene sequences.
- the polymerase chain reaction is used to amplify cDNAs (or portions of full-length cDNAs) encoding an immunoglobulin gene segment of interest (e.g., a light or heavy chain variable segment).
- the amplified sequences can be readily cloned into any suitable vector, e.g., expression vectors, minigene vectors, or phage display vectors. It will be appreciated that the particular method of cloning used is not critical, so long as it is possible to determine the sequence of some portion of the immunoglobulin polypeptide of interest.
- One source for antibody nucleic acids is a hybridoma produced by obtaining a B cell from an animal immunized with the antigen of interest and fusing it to an immortal cell.
- nucleic acid can be isolated from B cells (or whole spleen) of the immunized animal.
- Yet another source of nucleic acids encoding antibodies is a library of such nucleic acids generated, for example, through phage display technology.
- Polynucleotides encoding peptides of interest, e.g., variable region peptides with desired binding characteristics, can be identified by standard techniques such as panning.
- sequence encoding an entire variable region of the immunoglobulin polypeptide may be determined; however, it will sometimes be adequate to sequence only a portion of a variable region, for example, the CDR-encoding portion. Sequencing is carried out using standard techniques (see, e.g., Sambrook et al. (1989) Molecular Cloning: A Laboratory Guide, Vols 1-3, Cold Spring Harbor Press, and Sanger, F. et al. (1977) Proc. Natl. Acad. Sci. USA 74: 5463-5467, which is incorporated herein by reference).
- Isolated DNA can be operably linked to control sequences or placed into expression vectors, which are then transfected into host cells that do not otherwise produce immunoglobulin protein, to direct the synthesis of monoclonal antibodies in the recombinant host cells. Recombinant production of antibodies is well known in the art.
- Nucleic acid is operably linked when it is placed into a functional relationship with another nucleic acid sequence.
- DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
- a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
- a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- operably linked means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase.
- enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
- Vector components may include one or more of the following: a signal sequence (that may, for example, direct secretion of the antibody; e.g.,
- MDMRVPAQLLGLLLLWLRGARC//SEQ ID NO:8 an origin of replication, one or more selective marker genes (that may, for example, confer antibiotic or other drug resistance, complement auxotrophic deficiencies, or supply critical nutrients not available in the media), an enhancer element, a promoter, and a transcription termination sequence, all of which are well known in the art.
- Embodiment 1 A hybrid promoter comprising:
- a mCMV enhancer sequence comprising a mCMV enhancer element
- mCMV-E and a CMV promoter (CMV-P) sequence at its 3' end, operably linked 5' to a rat EF-1 alpha intron sequence;
- Embodiment 2 The hybrid promoter of Embodiment 1, wherein the CMV promoter sequence at the 3' end of the mCMV enhancer sequence comprises a segment having the nucleotide sequence of SEQ ID NO:24 or SEQ ID NO:26.
- Embodiment 3 The hybrid promoter of any of Embodiments 1-2, wherein the rat EF-1 alpha intron sequence comprises the nucleotide sequence of SEQ ID NO:4.
- Embodiment 4 The hybrid promoter of any of Embodiments 1 -3 , wherein the mCMV enhancer sequence comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:33; and the rat EF-1 alpha intron sequence comprises the nucleotide sequence of SEQ ID NO:4.
- Embodiment 5 The hybrid promoter of any of Embodiments 1 -4, wherein the first leader sequence comprises the nucleotide sequence of SEQ ID NO:3.
- Embodiment 6 The hybrid promoter of any of Embodiments 1-5, wherein the second leader sequence comprises the nucleotide sequence of SEQ ID NO:5.
- Embodiment 7 The hybrid promoter of any of Embodiments 1-6, further comprising one or more TetO sequences inserted within the CMV promoter sequence.
- Embodiment 8 The hybrid promoter of any of Embodiments 1-7, comprising a nucleotide sequence having at least 95% sequence identity to the nucleotide sequence of any of SEQ ID NO: 1, SEQ ID NO:30, SEQ ID NO:31, or SEQ ID NO:32.
- Embodiment 9 An expression cassette, comprising:
- the hybrid promoter of any of Embodiments 1-8 operably linked 5' to an open reading frame encoding an exogenous protein of interest; and a polyadenylation site operably linked 3' to the open reading frame.
- Embodiment 10 A recombinant expression vector comprising the expression cassette of Embodiment 9.
- Embodiment 11 A mammalian host cell comprising the recombinant expression vector of Embodiment 10.
- Embodiment 12 The mammalian host cell of Embodiment 11 , further being capable of expressing TetR.
- Embodiment 13 The mammalian host cell of any of Embodiments 11- 12, being derived from a Chinese Hamster Ovary (CHO) cell.
- Embodiment 14 The mammalian host cell of any of Embodiments 11- 13, selected from the group consisting of a CHO-K1 cell, a DXB11 cell, and a DG44 cell.
- Embodiment 15 A method of producing a protein of interest, comprising:
- Embodiment 16 A method of producing a protein of interest, comprising:
- Embodiment 17 The method of any of Embodiments 15-16, wherein the aqueous medium is serum-free.
- Embodiment 18 The method of any of Embodiments 15-16, wherein culturing the mammalian host cell is in a suspension in liquid aqueous medium.
- Embodiment 19 The method of any of Embodiments 15-16, wherein culturing the mammalian host cell is in an adhesion layer on a solid or semisolid substrate.
- Example 1 Materials and Methods.
- All vectors C, D, E, F, and G included a DNA sequence encoding an exogenous protein of interest "Fc-A" (or “FC-A”; an exemplary Fc fusion with a therapeutic anti-inflammatory antibody), an IRES derived from EMCV virus, the murine dihydrofolate reductase gene, and a 221 -bp late polyadenylation derived from SV40 virus as described previously (Kaufman, R.J. et al., Improved vectors for stable expression of foreign genes in mammalian cells by use of the untranslated leader sequence from EMC virus, Nucl. Acids Res.
- Fc-A exogenous protein of interest
- FC-A an exemplary Fc fusion with a therapeutic anti-inflammatory antibody
- Vector C contained the human CMV and human EF-1 alpha intron sequences described previously (Kim, Lee, Shin, Kang, & Kim, 2002).
- Vector F contained sequences flanking the endogenous Chinese hamster ovary (CHO) EF-1 alpha gene as described (Running Deer, J., & Allison, D. S., High-level expression of proteins in mammalian cells using Transcription Regulatory sequences from Chinese Hamster Ovary EF-lalpha Gene, Biotechnology Progress 20:880-889 (2004)) with 4083 bp 5' sequences flanking the ATG and 4174 bp 3' flanking sequences following the polyadenylation site.
- Vector G ( Figure 1) was constructed by deleting a 240bp sequence from the transcription start site of the CHO EF-lalpha gene to the FSEI site and replacing it with a DNA fragment encompassing the murine CMV fragment from position -615 to the
- Vector D ( Figure 1) was constructed by synthesizing the fragment shown in SEQ ID NO:l (containing murine CMV GenBank: L06816.1, nucleotides 4067-4682, Rat EF-lalpha intron Genbank: AC158987.3, nucleotides 22137- 21728) and placing these sequences 5 ' of the Fc-A coding sequence.
- Vector C and Vector D also contained the adenovirus tripartite leader that replaces the endogenous 3' untranslated leader sequence (Kaufman et al, 1991).
- the pUCS7-simple vector is not shown in Figure 1.
- the complete map of Vector D is shown in Figure 2.
- DXB11 and DG44 cells were cultured in either PowerCH02 (Lonza), ProCH04 (Lonza) or Ex-cell 302 (Sigma) according to the manufacturer's instructions. Cells were cultured every 3-4 days and seeded at 4 x 10 5 cells/ml for a 3-day culture or 3 x 10 s cells/ml for a 4-day culture.
- Example 2 Transfection of CHO cells
- CHO cells were transfected with various constructs expressing the Fc-A fusion protein. These constructs are shown in Figure 1 and Figure 2. Transfected pools of cells were compared for their expression of Fc-A fusion protein.
- DXB11 cells The various Fc-A expression plasmids were used to transfect DXB11, a DHFR mutant CHO cell line, using electroporation. These cells were grown in ProCH04 and were first selected for growth in media lacking hypoxanthine and thymidine and then selected at ISO nM methotrexate (MTX). Pools of cells selected with ISO nM MTX were seeded at 1 x 10 6 cells/ml and fed Ex-cell Advanced CHO Feed 1 (SAFC) and glucose on days 2, 4 and 7. Supernatant fluid was harvested on day 8 and analyzed by poros protein A as described above.
- SAFC Ex-cell Advanced CHO Feed 1
- the Fc-A protein titer and specific productivity are shown in Figure 3A and Figure 3B, respectively.
- the protein titers achieved were superior to other constructs and specific productivity was as good or better than that obtained using other constructs.
- Transfected pools of cells were compared for their expression of Fc-A.
- Cells were transfected using electroporation, selected for growth in media lacking hypoxanthine and thymidine, and then amplified to 150nM MTX.
- the DXB11 were further amplified to 500nM MTX and the DG44 cells were further amplified to luM MTX Pools of cells were then seeded by a 1:5 dilution into growth medium supplemented with Ex-cell Advanced CHO Feed 1 , fed on days 3, 6 and 8 with Ex-cell Advanced CHO Feed 1 and glucose. Supernatant fluid was harvested on day 10 and analyzed by poros protein A as described above. The titer and specific productivity are shown in Figure 5A and Figure 5B, respectively.
- DXB11 Pools transfected with Vector D expressed nearly twice as much Fc-A fusion protein as those pools transfected with Vector F. Pools of DG44 cells transfected with Vectors D and F expressed at similar levels. However, the pools transfected with the Vector D had slightly higher specific productivity. The lower specific productivity of DG44 cells compared to DXB11 cells implies that DG44 cells are less sensitive to the MTX than DXBl l cells.
- Vector D also included a 5 ' untranslated (5 'UTR) leader sequence derived from adenovirus tripartite leader (TPL).
- TPL has been shown to enhance expression of proteins under stress conditions (Logan & Shenk, Adenovirus tripartite leader sequence enhances translation of mRNAs late after infection. Proc. Natl. Acad. Sci. USA 81(12): 3655-59 (1984)). Whether the TPL is enhancing expression in these studies is unclear, but other studies have shown that the exact nucleotide sequences of the 5 'UTR that one may use in this position varies as long, as they do not contain extensive secondary structures or initiator codons prior to the authentic initiator codon (Mignone, F. et al., Untranslated regions of mRNAs. Genome Biology, 3(3):reviews0004.1-0004.10 (2002)).
- TetR Tet repressor
- TetR Tet repressor
- TetO Tet operator
- TetO binds to TetO and prevents transcription factors from interacting with the transcription start site or interfere with the transcription initiation complex formation (Yao et al).
- positioning of the TetO sequences is critical in determining if TetR can effectively modulate transcription.
- Tetracycline repressor tetR
- tetR Tetracycline repressor
- transcription factor fusion derivatives regulates inducible gene
- Tetracycline when added to the culture, will bind TetR and inhibit binding to the TetO sequence, thus allowing transcription.
- Tet Tetracycline
- pJV56 JV56jpJV39_pJV10_pUC57S
- JV60_JV56_pJV39jpJV10 (herein abbreviated as "pJV60"; Figure 9)
- the TetO sequences of pJV57 were changed to match the sequences that increased expression surrounding the transcription start site in the study by Patwardhan et al. (see, Figure 9 and Figure 12).
- Figure 11 shows the DNA sequence of hCMV-P/TetO that we used to replace the mCMV promoter (mCMV-P) sequences. Arrows indicate palindromic TetR binding sites.
- the mCMV-P and hCMV-P promoter sequences shown are those sequences from the TATA box through the start site of transcription.
- the transcription start is the g residue in the 3' sequence taccg. Note that the TetO sequence most certainly impacts the transcription start site, since the transcription start site is typically ⁇ 30 bases 3' to the 5' T of the TATA box.
- the construct pJV57 yielded approximately 10-fold as much recombinant protein as a human CMV/TetO control (pcDNA5/TO/LacZ; Thermo Fisher Scientific), when Tet was present in the medium, but about 3.5-fold less beta-galactosidase in the absence of tetracycline, as shown in Figure 14.
- T-RExTM-CHO cells T-REx-CHO cell line (Thermo Fisher Scientific, Product No. R71807) were cultured in Ham's F12 media + glutamine + 10 ⁇ g/ml Blast per manufacturer's protocol. T-REx-CHO cells were electroporated using the long duration electroporation (LDE) method as described by Bodwell et al. (Bodwell et al., Long Duration Electroporation for Achieving High Level Expression of Glucocorticoid Receptors in Mammalian Cell Lines, J. Steroid Biochem. Molec. Biol.
- LDE long duration electroporation
- lysates were diluted 10-fold and 10- ⁇ 1 aliquots were assayed using a BCA protein assay kit (Thermo Fisher Scientific, Product No. 23227) to determine protein concentration of the lysate. Lysates were diluted 100- fold and 10- ⁇ 1 aliquots were assayed for beta-galactosidase activity. All samples were transfected at least in duplicates. Specific beta-galactosidase activity was normalized to the amount of protein assayed and background activity of mock-transfected cells was subtracted from transfected samples. Results were graphed with standard deviation shown ( Figure 14).
- CHO-Kl/TetR cells were routinely cultured in PowerCHOTM 2 Chemically Defined, Serum-free CHO Medium (Lonza, Product No. BE12-771Q), and cells were electroporated using the LDE method, as described above for pJV40.
- Transfected pools were selected for 10 days in PowerCHOTM 2 +600 ⁇ G418 (Gibco, Product No. 10131027). Cells were then serially diluted and plated in 96-well microplates (Corning ® CellBIND ® 96 Well, Product #3340) at 0.75 cell per well in cloning media (EX-CELL ® 302 Serum-Free Medium for CHO Cells; Sigma-Aldrich, Product No. 14326C SIGMA) +15% conditioned media in the presence of G418). Clonal populations were identified after 11-12 days and were transferred to 12-well plates in 50/50 cloning media/ PowerCHOTM 2 medium for an additional 3-4 days. Finally, clones were moved and grown in a 24 deep-well plate (VWR, Product No. P-DW-10ML-24-C-S) with constant shaking (220 rpm) in
- CHO-Kl/TetR clones were transfected with pJV57 using the ExpiFectamineTM CHO transfection kit (Thermo Fisher Scientific, Product No. A29130) per manufacturer's protocol. From those highly expressing TetR + clones, some clones were subsequently chosen to be transfected with vector pJV56, pJV57, pJV59, or pJV60, using the ExpiFectamineTM CHO transfection kit (Thermo Fisher Scientific, Product No. A29130), again transfected per manufacturer's protocol.
- Transfected clones were allowed to recover for 24 hours and men were treated with 1 ⁇ g/ml tetracycline for 24 hours.
- To measure expression of the LacZ protein product cells were lysed, and beta-galactosidase activity was assayed using a ⁇ -Gal Assay Kit per manufacturer's protocol (Thermo Fisher Scientific, Product No. K1455- 01).
- lysates were diluted 10-fold and 10- ⁇ 1 aliquots were assayed using a BCA protein assay kit (Thermo Fisher Scientific, Product No. 23227) to determine protein concentration of the lysate.
- Ten (10) ⁇ of undiluted lysate was assayed for beta- galactosidase activity. All samples were transfected at least in duplicates. Specific beta- galactosidase activity was normalized to the amount of protein assayed and background activity of mock-transfected cells was subtracted from transfected samples. Results were graphed with standard deviation shown (e.g., Figure 16, Figure 17, Figure 18).
- Figure 16 shows representative results from CHO-Kl/TetR clones transfected with various constructs (pJV56, pJV57, pJV59, and pJV60) expressing the beta-galactosidase protein (or transfected with positive control: pcDNA5/TO/LacZ; Thermo Fisher Scientific, Product No. V1033-20).
- pJV56 pJV57
- pJV59 pJV59
- pJV60 expressing the beta-galactosidase protein
- positive control pcDNA5/TO/LacZ
- Thermo Fisher Scientific Product No. V1033-20
- cells were transfected with pJV57 using the ExpiFectamineTM CHO transfection kit (Theno Fisher Scientific, Product No. A29130) per manufacturer's protocol.
- Transfected clones were allowed to recover for 24 hours and then were treated with 1 ⁇ g/ml tetracycline for 24 hours.
- Cells were lysed, and beta- galactosidase activity was assayed using a ⁇ -Gal Assay Kit per manufacturer's protocol (Thermo Fisher Scientific, Product No. Kl 455-01). Briefly, lysates were diluted 10-fold and 10- ⁇ 1 aliquots were assayed using a BCA protein assay kit (Thermo Fisher Scientific, Product No. 23227) to determine protein concentration of the lysate. Ten (10) ⁇ of undiluted lysate was assayed for beta-galactosidase activity. All samples were transfected at least in duplicates.
- beta-galactosidase activity was normalized to the amount of protein assayed and background activity of mock-transfected cells was subtracted from transfected samples.
- Specific beta-galactosidase activity was normalized to the amount of protein assayed and background activity of mock-transfected cells was subtracted from transfected samples. Results were graphed with standard deviation shown.
- T-RExTM CHO cells In experiments using T-RExCHO cells (Thermo Fisher Scientific), a commercial cell line that stably expresses TetR, we measured beta- galactosidase (beta-gal) activity as a readout to test the ability of pJV57 to be regulated by tetracycline (Tet). As shown in Figure 14, pJV57 had equivalent expression to pJV56 when induced by the presence of tetracycline (+Tet). In addition, pJV57 had
- hCMV-P The optimized hCMV promoter (hCMV-P) sequences replaced the mCMV promoter (mCMV-P) sequences in the mCMV enhancer sequence/rat EF-1 a intron hybrid promoter of the invention (see, sequence comparison in Figure 13).
- the changes incorporated into pJV59 did not appear to increase expression relative to pJV56 ( Figure 14).
- Figure 14 we conclude that in the T-REx-CHO cells, the context of the powerful mCMV enhancer/promoter-rat EF-1 a intron, that changes around the transcription start site have little or no impact on expression.
- CHO-K1/TetR cells CHO-K1/TetR cells.
- a CHO-K1 cell line stably expressing TetR was generated by transfection of pJV40 (see, Figure 15) that has TetR gene subcloned into pcDNA3.1+ vector.
- Geneticin-resistant CHO-K1 pools were serially diluted to obtain single-cell colonies and screened to have high expression of TetR, i.e. more than two-fold repression of LacZ in the absence of Tet (data not shown).
- Three clones were selected for further analysis, as shown respectively in Figure 16, Figure 17, and Figure 18, referred to herein as CHO-Kl/TetR clones.
- the clones were transiently transfected with pcDNA5/TO/LacZ as a control, and expression vectors of the present invention, i.e., vectors pJV56, pJV57, pJV59 and pJV60, as described above, to determine the effectiveness of a Tet-regulated promoter element based on the mCM V enhancer sequence/rat EF-1 a intron hybrid promoter sequences using TetR-expressing cells that were generated in-house.
- expression vectors of the present invention i.e., vectors pJV56, pJV57, pJV59 and pJV60, as described above, to determine the effectiveness of a Tet-regulated promoter element based on the mCM V enhancer sequence/rat EF-1 a intron hybrid promoter sequences using TetR-expressing cells that were generated in-house.
- LacZ expression was augmented in all three pJV60-bearing clones compared to pJV57, in the presence of tetracyclin (2.31-, 2.82- and 1.56-fold higher expression compared to its non-Tet-treated control ; Figure 16, Figure 17, Figure 18, respectively). This suggests that mutation of TetO sequences adversely affected TetR binding as observed by higher basal LacZ expression in all clones in the absence of Tet and lower fold-induction upon +Tet addition.
- transfection efficiency may account for differences observed in the overall levels of specific beta- galactosidase activity.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/072,180 US11028410B2 (en) | 2016-01-27 | 2017-01-26 | Hybrid promoter and uses thereof |
| EP17705220.6A EP3408397B1 (en) | 2016-01-27 | 2017-01-26 | Hybrid promoter and uses thereof |
| JP2018536777A JP6937309B2 (ja) | 2016-01-27 | 2017-01-26 | ハイブリッドプロモーターおよびその使用 |
| ES17705220T ES2823173T3 (es) | 2016-01-27 | 2017-01-26 | Promotor híbrido y usos del mismo |
| US16/286,551 US11098310B2 (en) | 2016-01-27 | 2019-02-26 | Expression from transposon-based vectors and uses |
| US16/286,573 US11261462B2 (en) | 2016-01-27 | 2019-02-26 | Inducible expression from transposon-based vectors and uses |
| US17/190,954 US11692193B2 (en) | 2016-01-27 | 2021-03-03 | Expression from transposon-based vectors and uses |
| US17/590,737 US11685933B2 (en) | 2016-01-27 | 2022-02-01 | Inducible expression from transposon-based vectors and uses |
| US18/217,863 US20240035037A1 (en) | 2016-01-27 | 2023-07-03 | Transposon-based vectors and uses |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662388391P | 2016-01-27 | 2016-01-27 | |
| US62/388,391 | 2016-01-27 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/072,180 A-371-Of-International US11028410B2 (en) | 2016-01-27 | 2017-01-26 | Hybrid promoter and uses thereof |
| US16/286,573 Continuation-In-Part US11261462B2 (en) | 2016-01-27 | 2019-02-26 | Inducible expression from transposon-based vectors and uses |
| US16/286,551 Continuation-In-Part US11098310B2 (en) | 2016-01-27 | 2019-02-26 | Expression from transposon-based vectors and uses |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017132376A1 true WO2017132376A1 (en) | 2017-08-03 |
Family
ID=58044162
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/015130 Ceased WO2017132376A1 (en) | 2016-01-27 | 2017-01-26 | Hybrid promoter and uses thereof |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US11028410B2 (enExample) |
| EP (1) | EP3408397B1 (enExample) |
| JP (1) | JP6937309B2 (enExample) |
| ES (1) | ES2823173T3 (enExample) |
| WO (1) | WO2017132376A1 (enExample) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11098310B2 (en) * | 2016-01-27 | 2021-08-24 | Just-Evotec Biologics, Inc. | Expression from transposon-based vectors and uses |
| EP3856910B1 (en) * | 2018-09-24 | 2024-11-20 | Merck Sharp & Dohme LLC | Expression vectors for eukaryotic expression systems |
| PT115073A (pt) | 2018-10-09 | 2020-05-29 | Inst De Biologia Molecular E Celular Ibmc | Ácido nucleico para ativar a expressão e a produção de proteínas |
| WO2022204067A1 (en) * | 2021-03-24 | 2022-09-29 | Dna Twopointo Inc. | Tetracycline-inducible expression systems |
| CA3266599A1 (en) | 2022-09-07 | 2024-11-07 | Quantitative Biosciences Inc | UNIQUE VARIABLE DOMAIN ANTIBODIES SPECIFIC TO FENTANYL AND USE IN A CONTINUOUS AGGLUTINATION TEST |
| WO2025128343A1 (en) | 2023-12-11 | 2025-06-19 | Just-Evotec Biologics, Inc. | Protein expression using trans-splicing and split selectable markers |
Citations (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US30985A (en) | 1860-12-18 | Thomas l | ||
| US4560655A (en) | 1982-12-16 | 1985-12-24 | Immunex Corporation | Serum-free cell culture medium and process for making same |
| WO1987000195A1 (en) | 1985-06-28 | 1987-01-15 | Celltech Limited | Animal cell culture |
| US4657866A (en) | 1982-12-21 | 1987-04-14 | Sudhir Kumar | Serum-free, synthetic, completely chemically defined tissue culture media |
| WO1988001649A1 (en) | 1986-09-02 | 1988-03-10 | Genex Corporation | Single polypeptide chain binding molecules |
| US4767704A (en) | 1983-10-07 | 1988-08-30 | Columbia University In The City Of New York | Protein-free culture medium |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| WO1990003430A1 (en) | 1988-09-23 | 1990-04-05 | Cetus Corporation | Cell culture medium for enhanced cell growth, culture longevity and product expression |
| US4927762A (en) | 1986-04-01 | 1990-05-22 | Cell Enterprises, Inc. | Cell culture medium with antioxidant |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| EP0404097A2 (de) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung |
| US5122469A (en) | 1990-10-03 | 1992-06-16 | Genentech, Inc. | Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins |
| WO1993011161A1 (en) | 1991-11-25 | 1993-06-10 | Enzon, Inc. | Multivalent antigen-binding proteins |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| US5302697A (en) | 1988-07-23 | 1994-04-12 | Delta Biotechnology Limited | Peptide and DNA sequences |
| WO1999000510A1 (en) | 1997-06-26 | 1999-01-07 | Brigham And Women's Hospital | Regulation of transcription in mammalian cells and viral replication by a tetracyclin repressor |
| US6022952A (en) | 1998-04-01 | 2000-02-08 | University Of Alberta | Compositions and methods for protein secretion |
| US6210924B1 (en) | 1998-08-11 | 2001-04-03 | Amgen Inc. | Overexpressing cyclin D 1 in a eukaryotic cell line |
| US20030104400A1 (en) | 1999-03-18 | 2003-06-05 | Human Genome Sciences, Inc. | 27 human secreted proteins |
| US7029909B1 (en) | 1998-11-20 | 2006-04-18 | Fuso Pharmaceutical Industries, Ltd. | Protein expression vector and utilization thereof |
| WO2006058900A1 (en) | 2004-12-02 | 2006-06-08 | Laboratoires Serono S.A. | The lupac bifunctional marker and its use in protein production |
| WO2006063292A1 (en) | 2004-12-08 | 2006-06-15 | Icos Corporation | Recombinant method for making multimeric proteins |
| WO2007092370A2 (en) | 2006-02-03 | 2007-08-16 | Wyeth | Lingo-1 structure |
| US20080012492A1 (en) | 2003-08-26 | 2008-01-17 | Samsung Sdi Co., Ltd. | Plasma display panel bus electrode structure |
| WO2008020960A1 (en) | 2006-08-07 | 2008-02-21 | Avigenics, Inc. | Hybrid promoters |
| WO2008096070A2 (fr) | 2006-12-20 | 2008-08-14 | Lfb Biotechnologies Societe Par Actions Simplifiee Unipersonnelle | Lignee cellulaire a forte activite transcriptionnelle pour la production de proteines, notamment therapeutiques |
| WO2009053368A1 (en) | 2007-10-22 | 2009-04-30 | Merck Serono S.A. | Single ifn-beta fused to a mutated igg fc fragment |
| US7642236B2 (en) | 2003-08-14 | 2010-01-05 | Wyeth | Recombinant lubricin molecules and uses thereof |
| US7824907B2 (en) | 2003-03-11 | 2010-11-02 | Merck Serono Sa | Expression vectors comprising the mCMV IE2 promoter |
| WO2011110864A1 (en) * | 2010-03-12 | 2011-09-15 | Isis Innovation Limited | Promoter sequence for dna and viral vectors |
| US8771988B2 (en) | 2007-10-12 | 2014-07-08 | Hoffmann-La Roche Inc. | Protein expression from multiple nucleic acids |
Family Cites Families (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA1341482C (en) | 1984-10-31 | 2005-05-10 | Paul A. Luciw | Process for preparing fragments of aids-associated retroviruses |
| US20050005310A1 (en) | 1999-07-12 | 2005-01-06 | Genentech, Inc. | Expression vectors and methods |
| GB2355459B (en) | 1999-11-29 | 2001-09-26 | Isis Innovation | A dominant conditional lethal genetic system |
| DK1332222T3 (da) | 2000-11-03 | 2009-07-06 | Genentech Inc | Stofskifteændringer i fermenteringer der udtrykker rekombinante proteiner |
| AU2003298674A1 (en) | 2002-11-14 | 2004-06-15 | Genentech Inc | Intron fusion construct and method of using for selecting high-expressing production cell lines |
| GB2404382B (en) | 2003-07-28 | 2008-01-30 | Oxitec Ltd | Pest control |
| GB2443186A (en) | 2006-10-25 | 2008-04-30 | Oxitec Ltd | Expression system for mediating alternative splicing |
| KR100884214B1 (ko) * | 2007-04-04 | 2009-02-19 | 주식회사 마크로젠 | Caev-계 벡터 시스템 |
| RU2491344C2 (ru) | 2007-06-29 | 2013-08-27 | Ф.Хоффманн-Ля Рош Аг | Промотор |
| AU2008333131B2 (en) | 2007-12-07 | 2013-10-24 | Merck Serono S/A | Humanized antibody molecules specific for IL-31 |
| US8795981B2 (en) | 2008-08-08 | 2014-08-05 | Molecular Devices, Llc | Cell detection |
| US9445581B2 (en) | 2012-03-28 | 2016-09-20 | Kymab Limited | Animal models and therapeutic molecules |
| CN107090040A (zh) | 2011-05-27 | 2017-08-25 | 艾伯维生物技术有限公司 | Dac hyp组合物和方法 |
| US9809652B2 (en) | 2011-08-08 | 2017-11-07 | Abbvie Biotherapeutics Inc. | Methods of treating progressive forms of multiple sclerosis comprising subcutaneously administering daclizumab |
| CA2857298A1 (en) | 2011-11-30 | 2013-06-06 | Abbvie Biotherapeutics Inc. | Vectors and host cells comprising a modified sv40 promoter for protein expression |
| US9253965B2 (en) | 2012-03-28 | 2016-02-09 | Kymab Limited | Animal models and therapeutic molecules |
| CA3149402A1 (en) | 2011-12-22 | 2013-06-27 | F. Hoffman-La Roche Ag | Expression vector element combinations, novel production cell generation methods and their use for the recombinant production of polypeptides |
| KR101494072B1 (ko) | 2012-03-12 | 2015-02-17 | 한화케미칼 주식회사 | 변이된 글루타민 합성효소 유전자를 포함하는 벡터 및 이를 이용한 목적 단백질의 생산방법 |
| CN104884473B (zh) | 2012-05-22 | 2019-12-03 | 百时美施贵宝公司 | Il-17a/f il-23双特异性抗体及其应用 |
| EP2674495A1 (en) | 2012-06-14 | 2013-12-18 | Sanofi | CHO expression system |
| EP2711428A1 (en) | 2012-09-21 | 2014-03-26 | Lonza Biologics plc. | Site-specific integration |
| CN104718291B (zh) * | 2012-10-10 | 2020-12-01 | 中外制药株式会社 | 经修饰的宿主细胞的建立方法 |
| US9290552B2 (en) | 2012-12-21 | 2016-03-22 | Dna Twopointo, Inc. | Fluorescent and colored proteins and methods for using them |
| KR20150125994A (ko) | 2013-03-08 | 2015-11-10 | 뉴클론 바이오로직스 피티와이 엘티디 | 세포 발현 시스템 |
| BR112016007547A2 (pt) | 2013-10-07 | 2018-01-23 | Prestige Biopharma Pte. Ltd. | ?vetor de expressão bicistrônico para expressão de anticorpos e método para a produção de anticorpos usando o mesmo? |
| CA3246595A1 (en) | 2014-04-09 | 2025-07-08 | Dna Twopointo Inc | Enhanced polynucleotide constructs for eukaryotic gene expression |
| US10927384B2 (en) | 2014-04-09 | 2021-02-23 | Dna Twopointo Inc. | DNA vectors, transposons and transposases for eukaryotic genome modification |
| US11280790B2 (en) | 2016-10-04 | 2022-03-22 | Svar Life Science Ab | System and products for improved quantification of ADCC activity |
| US20240076332A1 (en) | 2016-10-04 | 2024-03-07 | Svar Life Science Ab | FGF21 Responsive Reporter Gene Cell Line |
-
2017
- 2017-01-26 EP EP17705220.6A patent/EP3408397B1/en active Active
- 2017-01-26 ES ES17705220T patent/ES2823173T3/es active Active
- 2017-01-26 WO PCT/US2017/015130 patent/WO2017132376A1/en not_active Ceased
- 2017-01-26 US US16/072,180 patent/US11028410B2/en active Active
- 2017-01-26 JP JP2018536777A patent/JP6937309B2/ja active Active
Patent Citations (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US30985A (en) | 1860-12-18 | Thomas l | ||
| US4560655A (en) | 1982-12-16 | 1985-12-24 | Immunex Corporation | Serum-free cell culture medium and process for making same |
| US4657866A (en) | 1982-12-21 | 1987-04-14 | Sudhir Kumar | Serum-free, synthetic, completely chemically defined tissue culture media |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4767704A (en) | 1983-10-07 | 1988-08-30 | Columbia University In The City Of New York | Protein-free culture medium |
| WO1987000195A1 (en) | 1985-06-28 | 1987-01-15 | Celltech Limited | Animal cell culture |
| US4927762A (en) | 1986-04-01 | 1990-05-22 | Cell Enterprises, Inc. | Cell culture medium with antioxidant |
| WO1988001649A1 (en) | 1986-09-02 | 1988-03-10 | Genex Corporation | Single polypeptide chain binding molecules |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5302697A (en) | 1988-07-23 | 1994-04-12 | Delta Biotechnology Limited | Peptide and DNA sequences |
| WO1990003430A1 (en) | 1988-09-23 | 1990-04-05 | Cetus Corporation | Cell culture medium for enhanced cell growth, culture longevity and product expression |
| EP0404097A2 (de) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispezifische und oligospezifische, mono- und oligovalente Rezeptoren, ihre Herstellung und Verwendung |
| US5122469A (en) | 1990-10-03 | 1992-06-16 | Genentech, Inc. | Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins |
| WO1993011161A1 (en) | 1991-11-25 | 1993-06-10 | Enzon, Inc. | Multivalent antigen-binding proteins |
| US5972650A (en) | 1997-06-26 | 1999-10-26 | Brigham And Women's Hospital | Tetracycline repressor regulated mammalian cell transcription and viral replication switch |
| WO1999000510A1 (en) | 1997-06-26 | 1999-01-07 | Brigham And Women's Hospital | Regulation of transcription in mammalian cells and viral replication by a tetracyclin repressor |
| US6022952A (en) | 1998-04-01 | 2000-02-08 | University Of Alberta | Compositions and methods for protein secretion |
| US6335178B1 (en) | 1998-04-01 | 2002-01-01 | University Of Alberta | Compositions and methods for protein secretion |
| US6210924B1 (en) | 1998-08-11 | 2001-04-03 | Amgen Inc. | Overexpressing cyclin D 1 in a eukaryotic cell line |
| US7029909B1 (en) | 1998-11-20 | 2006-04-18 | Fuso Pharmaceutical Industries, Ltd. | Protein expression vector and utilization thereof |
| US20030104400A1 (en) | 1999-03-18 | 2003-06-05 | Human Genome Sciences, Inc. | 27 human secreted proteins |
| US7824907B2 (en) | 2003-03-11 | 2010-11-02 | Merck Serono Sa | Expression vectors comprising the mCMV IE2 promoter |
| US7642236B2 (en) | 2003-08-14 | 2010-01-05 | Wyeth | Recombinant lubricin molecules and uses thereof |
| US20080012492A1 (en) | 2003-08-26 | 2008-01-17 | Samsung Sdi Co., Ltd. | Plasma display panel bus electrode structure |
| WO2006058900A1 (en) | 2004-12-02 | 2006-06-08 | Laboratoires Serono S.A. | The lupac bifunctional marker and its use in protein production |
| WO2006063292A1 (en) | 2004-12-08 | 2006-06-15 | Icos Corporation | Recombinant method for making multimeric proteins |
| WO2007092370A2 (en) | 2006-02-03 | 2007-08-16 | Wyeth | Lingo-1 structure |
| US7693698B2 (en) | 2006-02-03 | 2010-04-06 | Wyeth Llc | Method for identifying or designing a candidate agent that interacts with LINGO-1 polypeptide using a LINGO-1 three-dimensional structure |
| WO2008020960A1 (en) | 2006-08-07 | 2008-02-21 | Avigenics, Inc. | Hybrid promoters |
| WO2008096070A2 (fr) | 2006-12-20 | 2008-08-14 | Lfb Biotechnologies Societe Par Actions Simplifiee Unipersonnelle | Lignee cellulaire a forte activite transcriptionnelle pour la production de proteines, notamment therapeutiques |
| US8771988B2 (en) | 2007-10-12 | 2014-07-08 | Hoffmann-La Roche Inc. | Protein expression from multiple nucleic acids |
| WO2009053368A1 (en) | 2007-10-22 | 2009-04-30 | Merck Serono S.A. | Single ifn-beta fused to a mutated igg fc fragment |
| WO2011110864A1 (en) * | 2010-03-12 | 2011-09-15 | Isis Innovation Limited | Promoter sequence for dna and viral vectors |
Non-Patent Citations (71)
| Title |
|---|
| "Biocomputing Informatics and Genome Projects", 1993, ACADEMIC PRESS |
| "Computational Molecular Biology", 1988, OXFORD UNIVERSITY PRESS |
| "Computer Analysis of Sequence Data", 1994, HUMANA PRESS |
| "Fundamental Immunology", 1989, RAVEN PRESS, article "Ch. 7" |
| "Sequence Analysis Primer", 1991, M. STOCKTON PRESS |
| BARNES ET AL., ANAL. BIOCHEM., vol. 102, 1980, pages 255 |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426 |
| BODWELL ET AL.: "Long Duration Electroporation for Achieving High Level Expression of Glucocorticoid Receptors in Mammalian Cell Lines", J. STEROID BIOCHEM. MOLEC. BIOL, vol. 68, 1999, pages 77 - 82 |
| BRINSTER, R.L. ET AL.: "Introns increase transcriptional efficiency in transgenic mice", PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 836 - 840, XP002033601, DOI: doi:10.1073/pnas.85.3.836 |
| CARILLO ET AL., SIAM J. APPLIED MATH., vol. 48, 1988, pages 1073 |
| CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 - 883 |
| CHOTHIA; LESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| CHU ET AL., GENE, vol. 13, 1981, pages 197 |
| CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628 |
| DAVIS ET AL.: "Basic Methods in Molecular Biology", 1986, ELSEVIER |
| DAYHOFF ET AL.: "Atlas of Protein Sequence and Structure", vol. 5, 1978 |
| DAYHOFF, ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, vol. 5, 1978, pages 345 - 352 |
| DEVEREUX ET AL., NUCL. ACID RES., vol. 12, 1984, pages 387 |
| GRAHAM ET AL., J. GEN VIROL., vol. 36, 1977, pages 59 |
| GRAHAM ET AL., VIROLOGY, vol. 52, 1973, pages 456 |
| GUSS ET AL., EMBO J., vol. 5, 1986, pages 1567 - 1575 |
| HAM ET AL., METH. ENZ., vol. 58, 1979, pages 44 |
| HENIKOFF ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 89, 1992, pages 10915 - 10919 |
| HILLEN; BERENS: "Mechanisms underlying expression of Tn10 encoded tetracycline resistance", ANN. REV. MICRO., vol. 48, 1994, pages 345 - 369 |
| HOLLINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448 |
| HUM. GENE THER., vol. 9, no. 13, 1998, pages 1939 - 1950 |
| HUSTON, PROC. NATI. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883 |
| JIANGUO SU ET AL: "Hybrid Cytomegalovirus-U6 Promoter-based Plasmid Vectors Improve Efficiency of RNA Interference in Zebrafish", MARINE BIOTECHNOLOGY, SPRINGER-VERLAG, NE, vol. 10, no. 5, 6 March 2008 (2008-03-06), pages 511 - 517, XP019595180, ISSN: 1436-2236 * |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, N.I.H. |
| KABAT ET AL.: "Sequences of Proteins of immunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH |
| KAUFMAN, R.J. ET AL.: "Improved vectors for stable expression of foreign genes in mammalian cells by use of the untranslated leader sequence from EMC virus", NUCL. ACIDS RES., vol. 19, no. 16, 1991, pages 4485 - 4490 |
| KIM ET AL.: "Tetracycline repressor-regulated gene repression in recombinant human cytomegalovirus", J. VIROL., vol. 69, 1995, pages 2565 - 257 |
| KIM, S.-Y. ET AL.: "The human elongation factor 1 alpha (EF-1 alpha) first intron highly enhances expression of foreign genes from the murine cytomegalovirus promoter", J. BIOTECHNOL., vol. 93, no. 2, 2002, pages 183 - 187, XP002384369 |
| KOHLER ET AL., NATURE, vol. 256, 1975, pages 495 |
| KOSTELNY ET AL., J. IMMUNOL., vol. 148, 1992, pages 1547 - 1553 |
| LACY-HULBERT, A ET AL.: "Interruption of coding sequences by heterologous introns can enhance the functional expression of recombinant genes", GENE THER., vol. 8, no. 8, 2001, pages 649 - 653 |
| LINDMARK ET AL., J. IMMUNOL. METH., vol. 62, 1983, pages 1 - 13 |
| LOGAN; SHENK: "Adenovirus tripartite leader sequence enhances translation of mRNAs late after infection", PROC. NATL. ACAD. SCI. USA, vol. 81, no. 12, 1984, pages 3655 - 3659 |
| MANIATIS ET AL., SCIENCE, vol. 236, 1987, pages 1237 |
| MANIATIS ET AL.: "Molecular Cloning. A Laboratory Manual", 1982, COLD SPRING HARBOR LABORATORY |
| MARKS ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 - 597 |
| MASAYUKI; TANAKA: "The CMV Enhancer Stimulates Expression of Foreign Genes from the Human EF-1 a Promoter", ANALYTICAL BIOCHEMISTRY, vol. 247, 1997, pages 179 - 181, XP002467577, DOI: doi:10.1006/abio.1997.2066 |
| MATHER ET AL., ANNALS N.Y ACAD. SCI., vol. 383, 1982, pages 44 - 68 |
| MATHER, BIOL. REPROD., vol. 23, 1980, pages 243 - 251 |
| MIGNONE, F. ET AL.: "Untranslated regions of mRNAs", GENOME BIOLOGY, vol. 3, no. 3, 2002, XP002428984, DOI: doi:10.1186/gb-2002-3-3-reviews0004 |
| MIZUSHIMA; NAGATA: "pEF-BOS, a powerful mammalian expression vector", NUCL. ACIDS RES., vol. 18, no. 17, 1990, pages 5322 |
| NEEDLEMAN ET AL., J. MOL. BIOL., vol. 48, 1970, pages 443 - 453 |
| ORLOVA ET AL.: "Improved elongation factor-1 alpha-based vectors for stable high-level expression of heterologous proteins in Chinese hamster ovary cells", BMC BIOTECHNOLOGY, vol. 14, 2014, pages 56, XP021189281, DOI: doi:10.1186/1472-6750-14-56 |
| PATWARDHAN ET AL.: "High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis", NAT BIOTECHNOL., vol. 27, no. 12, 2009, pages 1173 - 1175, XP055144927, DOI: doi:10.1038/nbt.1589 |
| PATWARDHAN ET AL.: "High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis", NATURE BIOTECHNOLOGY, vol. 27, no. 12, 2009, pages 1173 - 1175, XP055144927, DOI: doi:10.1038/nbt.1589 |
| PLUCKTHUN: "The Pharmacology of Monoclonal Antibodies", vol. 1 13, 1994, SPRINGER-VERLAG, pages: 269 - 315 |
| PROC. NATL. ACAD. SCI. USA, vol. 74, 1977, pages 5463 - 5467 |
| ROTH, D. B. ET AL, CELL, vol. 94, 1998, pages 411 - 414 |
| RUNNING DEER, J. ET AL: "High-level expression of proteins in mammalian cells using Transcription Regulatory sequences from Chinese Hamster Ovary EF-1 alpha Gene", BIOTECHNOLOGY PROGRESS, vol. 20, 2004, pages 880 - 889, XP055017662, DOI: doi:10.1021/bp034383r |
| RUNNING DEER, J. ET AL: "High-level expression of proteins in mammalian cells using Transcription Regulatory sequences from Chinese Hamster Ovary EF-1alpha Gene", BIOTECHNOLOGY PROGRESS, vol. 20, 2004, pages 880 - 889, XP002557337, DOI: doi:10.1021/bp034383r |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Guide", 1989, COLD SPRING HARBOR PRESS |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Guide", vol. 1-3, 1989, COLD SPRING HARBOR PRESS |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001 |
| SCHEK ET AL.: "Definition of the upstream efficiency element of the simian virus 40 late polyadenylation signal by using in vitro analyses", MOL. CELL. BIOL., vol. 12, no. 12, 1992, pages 5386 - 5393, XP001053490 |
| SEOW THENG ONG ET AL: "Hybrid Cytomegalovirus Enhancer-H1 Promoter-Based Plasmid and Baculovirus Vectors Mediate Effective RNA Interference", HUMAN GENE THERAPY, vol. 16, no. 12, 1 December 2005 (2005-12-01), US, pages 1404 - 1412, XP055354977, ISSN: 1043-0342, DOI: 10.1089/hum.2005.16.1404 * |
| SIZEMORE ET AL: "Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants", NUCLEIC ACIDS RESEARCH, vol. 18, no. 10, 1990, pages 2875 - 2880, XP002012632 |
| SONGSIVILAI; LACHMANN, CLIN. EXP. IMMUNOL., vol. 79, 1990, pages 315 - 321 |
| SPIESS ET AL.: "Alternative molecular formats and therapeutic applications for bispecific antibodies", MOL. IMMUNOL., vol. 67, 2015, pages 95 - 106, XP029246892, DOI: doi:10.1016/j.molimm.2015.01.003 |
| URLAUB ET AL., PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 4216 |
| VON HEINJE, G.: "Sequence Analysis in Molecular Biology", 1987, ACADEMIC PRESS |
| VOSS ET AL., TRENDS BIOCHEM. SCI., vol. 11, 1986, pages 287 |
| WANG C Y ET AL: "Improved neuronal transgene expression from an AAV-2 vector with a hybrid CMV enhancer/PDGF-.beta. promoter", JOURNAL OF GENE MEDICINE, JOHN WILEY & SONS, INC, US, vol. 7, no. 7, 1 July 2005 (2005-07-01), pages 945 - 955, XP008121243, ISSN: 1099-498X, [retrieved on 20050309], DOI: 10.1002/JGM.742 * |
| WURM, F.M.: "CHO quasispecies- Implications for Manufacturing Processes", PROCESSES, vol. 1, 2013, pages 296 - 311, XP055309513, DOI: doi:10.3390/pr1030296 |
| YAO ET AL.: "Tetracycline repressor. tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells", HUM. GENE THER., vol. 9, no. 13, 1998, pages 1939 - 1950, XP002105115 |
| ZAPATA ET AL., PROTEIN ENG., vol. 8, no. 10, 1995, pages 1057 - 1062 |
Also Published As
| Publication number | Publication date |
|---|---|
| JP6937309B2 (ja) | 2021-09-22 |
| EP3408397A1 (en) | 2018-12-05 |
| EP3408397B1 (en) | 2020-07-15 |
| ES2823173T3 (es) | 2021-05-06 |
| JP2019503179A (ja) | 2019-02-07 |
| US20190055580A1 (en) | 2019-02-21 |
| US11028410B2 (en) | 2021-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11685933B2 (en) | Inducible expression from transposon-based vectors and uses | |
| US11028410B2 (en) | Hybrid promoter and uses thereof | |
| US11692193B2 (en) | Expression from transposon-based vectors and uses | |
| JP2019503179A5 (enExample) | ||
| AU2020306672B2 (en) | Mammalian cell lines with SIRT-1 gene knockout | |
| KR102559149B1 (ko) | 재조합효소 매개 카세트 교환을 이용한 다중특이적 항체 스크리닝 방법 | |
| JP2025134010A (ja) | 所定の構成の複数の発現カセットの標的指向性組込みによって多価二重特異性抗体発現細胞を作製するための方法 | |
| AU2020294880B2 (en) | Method for the generation of a protein expressing cell by targeted integration using Cre mRNA | |
| JP2024026208A (ja) | 所定の構成の複数の発現カセットの標的化組込みによって三価の抗体を発現する細胞を生成するための方法 | |
| CN102812040A (zh) | Sorf构建体和多基因表达 | |
| JP2017530718A (ja) | 宿主細胞における異種由来遺伝子の発現を改善するためのプロモーター及び調節エレメント | |
| WO2014102101A1 (en) | Novel intron sequences | |
| US20240035037A1 (en) | Transposon-based vectors and uses | |
| KR20220010019A (ko) | 정의된 조직에서 다중 발현 카세트의 표적화된 통합에 의해 2가 이중특이성 항체 발현 세포를 생성하는 방법 | |
| US20220281957A1 (en) | Modified human variable domains | |
| WO2025128343A1 (en) | Protein expression using trans-splicing and split selectable markers | |
| HK40052669A (en) | Multispecific antibody screening method using recombinase mediated cassette exchange |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17705220 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2018536777 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017705220 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2017705220 Country of ref document: EP Effective date: 20180827 |