WO2017109039A1 - Endothelium-specific nucleic acid regulatory elements and methods and use thereof - Google Patents

Endothelium-specific nucleic acid regulatory elements and methods and use thereof Download PDF

Info

Publication number
WO2017109039A1
WO2017109039A1 PCT/EP2016/082314 EP2016082314W WO2017109039A1 WO 2017109039 A1 WO2017109039 A1 WO 2017109039A1 EP 2016082314 W EP2016082314 W EP 2016082314W WO 2017109039 A1 WO2017109039 A1 WO 2017109039A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
vector
seq
expression cassette
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/082314
Other languages
English (en)
French (fr)
Inventor
Marinee Chuah
Thierry Vandendriessche
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vrije Universiteit Brussel VUB
Original Assignee
Vrije Universiteit Brussel VUB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vrije Universiteit Brussel VUB filed Critical Vrije Universiteit Brussel VUB
Priority to EP16826729.2A priority Critical patent/EP3393523B9/en
Priority to AU2016378480A priority patent/AU2016378480A1/en
Priority to CA3009264A priority patent/CA3009264A1/en
Priority to US16/065,629 priority patent/US11446375B2/en
Priority to JP2018533200A priority patent/JP2018538003A/ja
Publication of WO2017109039A1 publication Critical patent/WO2017109039A1/en
Anticipated expiration legal-status Critical
Priority to US17/815,136 priority patent/US12558416B2/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/23—Parvoviridae, e.g. feline panleukopenia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to nucleic acid regulatory elements that are able to enhance endothelial-specific expression of genes, methods employing these regulatory elements and use thereof.
  • the invention further encompasses expression cassettes, vectors and pharmaceutical compositions comprising these regulatory elements.
  • the present invention is particularly useful for applications using gene therapy, more particularly endothelial- directed gene therapy, and for vaccination purposes.
  • Endothelial cells form a single cell layer that lines all blood vessels and regulate exchanges between the bloodstream and the surrounding tissues. Signals from endothelial cells organize the growth and development of connective tissue cells that form the surrounding layers of the blood-vessel wall. New blood vessels can develop from the walls of existing small vessels by the outgrowth of endothelial cells, which have the capacity to form hollow capillary tubes even when isolated in culture. Endothelial cells of developing arteries and veins express different cell-surface proteins, which may control the way in which they link up to create a capillary bed. (Molecular Biology of the Cell. 4th Edition). A homeostatic mechanism ensures that blood vessels permeate every region of the body.
  • VEGF hypoxia-inducible factor 1
  • HIF-1 hypoxia-inducible factor 1
  • VEGF vascular endothelial growth factor
  • Endothelial cell phenotypes vary between different organs, between different segments of the vascular loop within the same organ, and between neighbouring endothelial cells of the same organ and blood vessel type. In addition to differences in structure, endothelial cells show remarkable heterogeneity in function.
  • liver sinusoidal endothelial cells form a continuous lining of the liver capillaries, or sinusoids, separating parenchymal cells and fat-storing cells from sinusoidal blood.
  • LSECs represent unique, highly specialized endothelial cells in the body. LSECs differ in fine structure from endothelial cells lining larger blood vessels and from other capillary endothelia in that they lack a distinct basement membrane and also contain open pores, or fenestrae, in the thin cytoplasmic projections which constitute the sinusoidal wall.
  • liver endothelium This distinctive morphology supports the protective role played by liver endothelium, the cells forming a general barrier against pathogenic agents and serving as a selective sieve for substances passing from the blood to parenchymal and fat-storing cells, and vice versa.
  • Sinusoidal endothelial cells furthermore, significantly participate in the metabolic and clearance functions of the liver. They have been shown to be involved in the endocytosis and metabolism of a wide range of macromolecules, including glycoproteins, lipoproteins, extracellular matrix components, and inert colloids, establishing endothelial cells as a vital link in the complex network of cellular interactions and cooperation in the liver.
  • LSECs have long been noted to contribute to liver regeneration after liver injury.
  • HGF hepatocyte growth factor
  • the major cellular source of hepatocyte growth factor (HGF) is the hepatic stellate cell, but after liver injury, HGF expression has been thought to increase markedly in proliferating LSECs (DeLeve et al. Liver sinusoidal endothelial cells and liver regeneration J Clin. Invest. 2013).
  • HGF hepatocyte growth factor
  • Another unexpected function of LSEC was recently reported (Shahani et al., J. Thromb. Hemost 2014), demonstrating that LSECs and not hepatocytes express coagulation factor VIII (FVIII).
  • endothelial cells, including LSECs also express von Willebrand factor (vWF).
  • vWF von Willebrand factor
  • FVIII secreted FVIII would be relatively unstable unless it is associated with vWF. Deficiency of FVIII, a co-factor in the intrinsic coagulation pathway, results in hemophilia A. Liver transplantation in both FVIII- deficient dogs and patients with hemophilia A corrects these disorders. Although the liver is known to be the main site of FVIII production, other organs are probably also important for the regulation of FVIII secretion. Recent studies have shown that lung endothelial cells can synthesize FVIII.
  • endothelial cells from the aorta, umbilical artery and umbilical vein did not constitutively secrete FVIII or release it after treatment with agonists, probably because of a lack of FVIII synthesis.
  • Extrahepatic endothelial cells from certain vascular beds therefore appear to be an important FVIII production and storage site with the potential to regulate FVIII secretion in chronic and acute conditions (Shahani et al. Blood.
  • LSECs have also been reported to induce immunosuppressive IL-10-producing Th1 cells via the Notch pathway (Neumann et al. Eur J Immunol. 2015 Jul;45(7):2008-16) suggesting an important immune-modulatory role. Therefore, LSEC dysfunction has been regarded as a key event in multiple liver disorders. Future studies are likely to disclose more fully the role of LSEC in the regulation of liver hemodynamics, in liver metabolism and blood clearance, in the maintenance of hepatic structure, in the pathogenesis of various liver diseases, and in the aging process in the liver (De Leeuw et al. J Electron Microsc Tech. 1990 Mar;14(3):218-36).
  • the endothelium is involved in many disease states, either as a primary determinant of pathophysiology or as a secondary target.
  • endothelial cell dysfunction can be caused by acquired, complex multifactorial, genetic or infectious diseases.
  • the underlying endothelial cell defect can be life-threatening, for which no effective cure is presently available.
  • Dysfunction of the vascular endothelium is a hallmark of many human diseases.
  • the endothelium is directly involved in many different diseases including peripheral vascular disease, stroke, heart disease, diabetes, insulin resistance, chronic kidney failure, tumor growth, metastasis, venous thrombosis, and severe viral infectious diseases. Consequently, the endothelium has substantial untapped potential as a therapeutic target.
  • endothelial cells are attractive target cells for gene therapy to enable robust and/or sustained expression of the cognate therapeutic genes.
  • endothelial dysfunction is one of the major pathophysiological mechanisms that leads towards coronary artery disease and other atherosclerotic diseases.
  • Atherosclerosis is a progressive vascular disease characterized by the accumulation of lipids, inflammatory cells, and fibrous elements. In Western societies, it is the underlying cause of approximately 50% of all deaths. Dysfunction or injury of vascular endothelial cells is critical for the development of atherosclerosis.
  • the endothelium functions as a selectively permeable barrier between blood and tissues as it can regulate transcytosis and generate effector molecules such us nitric oxide (NO) that regulate thrombosis, inflammation, vascular tone and vascular remodeling.
  • NO nitric oxide
  • Endothelial cells also play a key role in angiogenesis and vasculogenesis.
  • Angiogenesis is the physiological process through which new blood vessels form from pre-existing vessels. This is distinct from vasculogenesis, which is the de novo formation of endothelial cells from mesoderm cell precursors.
  • Angiogenesis and vasculogenesis are normal and vital processes in growth and development. However, they also represent a fundamental step in cancer progression, justifying the use of angiogenesis or vasculogenesis inhibitors in the treatment of cancer. Conversely, promoting angiogenesis and vasculogenesis may benefit the treatment of ischemia which is associated with decrease in blood supply to certain organs or tissues.
  • endothelial cells are also promising targets for gene therapy to express therapeutic proteins that are missing or defective in genetic disorders that result from mutations in the respective genes.
  • this includes FVIII, vWF or ADAMTS13 (a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13).
  • FVIII vWF
  • ADAMTS13 a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13
  • hemophilia A is due to a deficiency in FVIII.
  • deficiency in vWF causes a bleeding diathesis in patients suffering from von Willebrand disease (VWD).
  • VWD von Willebrand disease
  • a deficiency in ADAMTS13 is linked to the development of microvascular thrombosis characteristic of thrombotic thrombocytopenic purpura (TTP).
  • endothelial cells are also ideally suited to express other therapeutic proteins that are normally not expressed by endothelial cells but that can be directly secreted in the blood. This includes, but is not limited to, other coagulation factors (e.g. factor VII, IX, XI etc.), serum proteins (a1 -antitrypsin, AAT, antibodies, growth factors etc.).
  • other coagulation factors e.g. factor VII, IX, XI etc.
  • serum proteins a1 -antitrypsin, AAT, antibodies, growth factors etc.
  • endothelial cells also play a key role in viral infection.
  • the Ebola virus is an aggressive pathogen that causes a highly lethal hemorrhagic fever syndrome in humans and nonhuman primates. The virus infects microvascular endothelial cells and compromises vascular integrity. Infection of endothelial cells also induces a cytopathic effect and damage to the endothelial barrier.
  • Dengue virus causes leakage of the vascular endothelium, resulting in dengue hemorrhagic fever and dengue shock syndrome.
  • the endothelial cell lining of the vasculature regulates capillary permeability and is altered by immune and chemokine responses which affect fluid barrier functions of the endothelium.
  • Human endothelial cells are susceptible to infection by dengue virus Following attachment to human endothelial cell receptors, dengue virus causes a productive infection that has the potential to increase viral dissemination and viremia. This provides the potential for dengue virus-infected endothelial cells to directly alter barrier functions of the endothelium, contribute to enhancement of immune cell activation, and serve as potential targets of immune responses which play a central role in dengue pathogenesis.
  • CREs cis-regulatory elements
  • endothelial specific nucleic acid regulatory elements were identified in silico and subsequently validated in in vitro cell lines and also in vivo in mice.
  • nucleic acid regulatory elements are critically important for the regulation of gene expression in an endothelial cell type-specific manner. They are typically composed of clusters of transcription factor binding site (TFBS) motifs. The types and arrangement of TFBS and epigenetic modification patterns influence gene expression levels and specificity.
  • Conventional methods of vector design relied on haphazard trial-and-error approaches whereby transcriptional enhancers were combined with promoters to boost expression levels. Though this could sometimes be effective, it often resulted in nonproductive combinations that resulted in either modest or no increased expression levels of the gene of interest and/or loss of tissue specificity.
  • these conventional approaches did not take into account the importance of including evolutionary conserved regulatory motifs into the expression modules.
  • the development of nucleic acid regulatory elements that can lead to robust and specific expression in endothelial cells will be very useful for achieving safe and efficient gene delivery to endothelial cells for the treatment of disorders related to endothelial cell dysfunction.
  • the present inventors have relied on a computational approach (cf. Figure 1 ) to identify robust nucleic acid regulatory elements that boost gene expression at the transcriptional level in endothelial cells (designated herein as "EC"). This requires the following computational steps: (1 ) endothelial cell-specific genes were identified that are highly and specifically expressed based on expression data from endothelial cells; (2) publicly available databases (ENSEMBL) were used for extracting the sequences upstream of the Transcriptional Start Site (TSS) of the selected genes. 3) These sequences were then submitted into UCSC Genome Browser Database for locating the transcription start site in human genome.
  • ENSEMBL publicly available databases
  • the sequences were selected based on the following criteria: a) rich TFBS content, b) epigenetic signatures associated with high DNase hypersensitivity or chromatin accessibility (i.e. histone modifications), and c) evolutionary conserved clusters of TFBS associated with highly expressed endothelial cell-specific genes.
  • the inventors identified nucleic acid regulatory elements that will specifically enhance gene expression in endothelial cells.
  • endothelial cell regulatory elements will subsequently be validated in vivo, yielding efficient and tissue-specific gene expression. This approach hence, allows for the use of lower and thus safer vector doses, while maximizing therapeutic efficacy.
  • the invention therefore provides the following aspects:
  • a nucleic acid regulatory element for enhancing endothelial cell-specific gene expression comprising, consisting essentially of, or consisting of the sequence selected from the group consisting of: SEQ ID NO:1 to 33, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, such as 95%, 96%, 97%, 98%, or 99%, identity to any of these sequences.
  • said nucleic acid regulatory element for enhancing endothelial cell-specific gene expression comprises, consists essentially of, or consists of the sequence of SEQ ID NO.22, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, such as 95%, 96%, 97%, 98%, or 99%, identity to any of these sequences.
  • nucleic acid regulatory element according to aspect 1 having a maximal length of 1000 nucleotides, preferably 800 nucleotides, more preferably 700 nucleotides, most preferably of 610 nucleotides, still comprising the regulatory element defined by any one of SEQ ID Nos: 1 to 33.
  • a nucleic acid regulatory element for enhancing gene expression in endothelial cells comprising, consisting essentially of, or consisting of the complement of a sequence as defined by any one of SEQ ID Nos: 1 to 33, or hybridizing under stringent conditions to a sequence as defined by any one of SEQ ID Nos: 1 to 33.
  • Aspect 4 Use of the nucleic acid regulatory element according to any one aspects 1 to 3 in a nucleic acid expression cassette, or a vector, more particularly for enhancing gene expression in endothelial cells of said nucleic acid expression cassette or vector.
  • a nucleic acid expression cassette comprising at least one, such as one, two, three, four, five or more, nucleic acid regulatory elements according to any one of aspects 1 to 3, operably linked to a promoter.
  • Aspect 6 The nucleic acid expression cassette according to aspect 5, wherein the nucleic acid regulatory element is operably linked to a promoter and a transgene.
  • Aspect 7 The nucleic acid expression cassette according any one of aspects 5 or 6, wherein the promoter is an endothelial cell-specific promoter, such as the promotor of any one of the genes selected from the group comprising: IFI27, ICAM2, VWF, EDN1 , ENG, ECSCR, CDH5 (vascular endothelial cadherin promoter, cadherin 5 type 2), PECAM1 , HHIP, TIE1 and HYAL2.
  • the promoter is an endothelial cell-specific promoter, such as the promotor of any one of the genes selected from the group comprising: IFI27, ICAM2, VWF, EDN1 , ENG, ECSCR, CDH5 (vascular endothelial cadherin promoter, cadherin 5 type 2), PECAM1 , HHIP, TIE1 and HYAL2.
  • Aspect 8 The nucleic acid expression cassette according to any one of aspects 5 to 4.
  • transgene encodes a therapeutic protein or an immunogenic protein.
  • Aspect 9 The nucleic acid expression cassette according to any one of aspects 5 to
  • transgene encodes a secretable protein or a structural protein.
  • Aspect 10 The nucleic acid expression cassette according to aspect 8 or 9, wherein said transgene is selected from the group comprising: hepatocyte growth factor (HGF), coagulation factor VIII (FVIII), coagulation factor VII (FVII), tissue factor (TF), tissue factor pathway inhibitor (TFPI), coagulation factor IX (FIX), coagulation factor XI (FXI), von Willebrand factor (vWF), ADAMTS13, VEGF, PLGF, FGF, sFLT1 , a1 -antitrypsin, AAT, apolipoprotein A-l (apoA-l), matrix metalloproteinases including but not limited to matrix metalloproteinase-3 (TIMP-3), nitric oxide synthase (NOS), antibodies, growth factors, cytokines, chemokines and antibodies, including but not limited to antibodies directed against any one of said transgenes, factors and their cognate receptors or against any secreted protein or viral protein, small interfering
  • Aspect 1 1 The nucleic acid expression cassette according to any one of aspects 5 to 10, further comprising a polyadenylation signal, preferably the Simian Virus 40 (SV40) polyadenylation signal, a synthetic polyadenylation signal or a bovine growth hormone polyadenylation signal.
  • a polyadenylation signal preferably the Simian Virus 40 (SV40) polyadenylation signal, a synthetic polyadenylation signal or a bovine growth hormone polyadenylation signal.
  • SV40 Simian Virus 40
  • a vector comprising the nucleic acid regulatory element according to any one of aspects 1 to 3, or the nucleic acid expression cassette according to any one of aspects 5 to 1 1 .
  • the vector according to aspect 12, which is a viral vector, preferably a lentiviral vector (LV), an adeno-associated viral (AAV) vector, or an adenoviral vector (AV).
  • the vector is a self- or non-self inactivating lentiviral vector, preferably a self inactivating lentiviral vector.
  • the LV has the following components: EC-CRE-PM-TG, with EC- CRE being one of the newly identified regulatory sequences as defined in SEQ ID Nos 1 - 33; PM being an endothelial cell-specific promotor such as, but not limited to, those referred to in aspect 7, and TG being a transgene such as, but not limited to, the transgenes identified herein and in particular those defined in aspect 10.
  • the vector can be:
  • telomere pCDH-HYAL2-EC-CRE1f-ICAM2-TG, such as wherein the TG is any one of those identified in aspect 10,
  • pCDH-ECSCR-EC-CRE1 b-ICAM2-TG such as wherein the TG is any one of those identified in aspect 10
  • pCDH-EDN1 -EC-CRE1 a-ICAM2-TG such as wherein the TG is any one of those identified in aspect 10
  • pCDH-PECAM1 -EC-CRE1 a-ICAM2-TG such as wherein the TG is any one of those identified in aspect 10
  • pCDH-TIE1 -EC-CRE1 a-ICAM2-TG such as wherein the TG is any one of those identified in aspect 10
  • telomere pCDH-VWF-EC-CRE1 a-ICAM2-TG, such as wherein the TG is any one of those identified in aspect 10, or
  • TG is any one of those identified in aspect 10.
  • the ICAM2-promotor can be replaced by another endothelial cell specific promotor, such as, but not limited to those exemplified in aspect 7.
  • the vector backbone can be exchanged by another suitable backbone such as those known to the person skilled in the art.
  • the vector according to aspect 12, which is a non-viral vector, preferably a plasmid, a minicircle, an episomal vector, or a transposon-based vector, such as a PiggyBac-based vector or a Sleeping Beauty-based vector.
  • a pharmaceutical composition comprising the nucleic acid expression cassette according to any one of aspects 5 to 1 1 , or the vector according to any one of aspects 12 to 14, and a pharmaceutically acceptable carrier.
  • Aspect 16 The nucleic acid regulatory element according to any one of aspects 1 to 3, the nucleic acid expression cassette according to any one of aspects 5 to 1 1 , the vector according to any one of aspects 12 to 14, or the pharmaceutical composition according to aspect 15 for use in medicine, more preferably for use in gene therapy, in particular for use in treating endothelial cell dysfunction, preferably such as any one of the diseases or disorders selected from the group comprising: liver diseases, hemophilia A, von Willebrand disease, microvascular thrombosis, thrombotic thrombocytopenic purpura, peripheral vascular disease, coronary artery diseases, atherosclerotic diseases, stroke, heart disease, diabetes, insulin resistance, chronic kidney failure, tumor growth, metastasis, venous thrombosis, ischemia, tumour growth, tumour vascularisation, cancer and viral infectious diseases such as Ebola, Dengue and Dengue hemorrhagic fever.
  • diseases or disorders selected from the group comprising: liver diseases, hemophilia A, von Willebrand disease, micro
  • nucleic acid regulatory element according to any one of aspects 1 to 3, the nucleic acid expression cassette according to any one of aspects 4 to 1 1 , the vector according to any one of aspects 12 to 14, or the pharmaceutical composition according to aspect 15 for use as a vaccine, preferably a prophylactic vaccine, or for use in vaccination therapy, preferably prophylactic vaccination.
  • said nucleic acid regulatory element according to any one of aspects 1 to 3, the nucleic acid expression cassette according to any one of aspects 4 to 1 1 , the vector according to any one of aspects 12 to 14, or the pharmaceutical composition according to aspect 15 can be for use in induction of immunotolerance to the transgene.
  • a method for expressing a transgene product in endothelial cells, comprising:
  • nucleic acid expression cassette according to any one of aspects 4 to 1 1 , or the vector according to any one of aspects 12 to 14, comprising the nucleic acid regulatory element according to any one of aspects 1 to 3, into the cells;
  • a method for expressing a transgene product in endothelial cells, comprising:
  • nucleic acid expression cassette according to any one of aspects 4 to 1 1 , or the vector according to any one of aspects 12 to 14, comprising the nucleic acid regulatory element according to any one of aspects 1 to 3, into the cells;
  • Aspect 20 A method for treating an endothelial cell-related disease or disorder comprising the administration of a therapeutically effective amount of the nucleic acid expression cassette according to any one of aspects 5 to 1 1 , the vector according to any one of aspects 12 to 14, or the pharmaceutical composition according to aspect 15, each comprising the nucleic acid regulatory element according to any one of aspects 1 to 3, to a subject in need thereof.
  • Aspect 21 The method according to aspect 20, wherein said endothelial cell-related disease or disorder is selected from the group comprising: endothelial cell dysfunction, preferably such as any one of the diseases or disorders selected from the group comprising: liver diseases, hemophilia A, von Willebrand disease, microvascular thrombosis, thrombotic thrombocytopenic purpura, peripheral vascular disease, coronary artery diseases, atherosclerotic diseases, stroke, heart disease, diabetes, insulin resistance, chronic kidney failure, tumor growth, metastasis, venous thrombosis, ischemia, tumour growth, tumour vascularisation, cancer and viral infectious diseases such as Ebola Dengue and Dengue hemorrhagic fever.
  • endothelial cell dysfunction preferably such as any one of the diseases or disorders selected from the group comprising: liver diseases, hemophilia A, von Willebrand disease, microvascular thrombosis, thrombotic thrombocytopenic purpura, peripheral vascular disease, coronary artery diseases,
  • FIG. 1 The selection strategies of endothelial-specific CREs
  • Example 1 the inventors identified nucleic acid regulatory elements that will specifically enhance gene expression in endothelial cells.
  • the endothelial specific regulatory elements were subsequently be validated in vitro and in vivo assays in mice. The details of the in vitro and in vivo validation are described in Example 2 to 6 below.
  • the successful use of the endothelial CREs will hence, allows for the use of lower and thus safer vector doses, while maximizing therapeutic efficacy.
  • FIG. 2 Lentiviral vector design
  • Lentiviral vectors were produced as described previously (VandenDriessche et al., Blood 2002). Briefly, the lentiviral vector-containing plasmids were cotransfected with a VSV-G expression plasmid, a gag-pol and Rev expression plasmid. Lentiviruses were produced by transient co-transfection of HEK293T (293T) cells using supplemented Dulbecco modified Eagle medium (Invitrogen) with 10% heat-inactivated fetal bovine serum (Invitrogen) and 1 % penicillin/streptomycin.
  • Invitrogen Dulbecco modified Eagle medium
  • Invitrogen heat-inactivated fetal bovine serum
  • penicillin/streptomycin 1 % penicillin/streptomycin.
  • a total of 60 ⁇ g lentiviral plasmid was used for transfection of one double-tray culture chamber: 60 ⁇ g lentiviral plasmid, 30 ⁇ g pRSV- REV, 30 ⁇ g pMDLg/pRRE and 30 ⁇ g pCMV-VSV-G. Plasmid was pre-complexed with calcium phosphate (Calcium phosphate transfection kit, Invitrogen) for 30 minutes at room temperature. Transfection media was added to the cells for 16 hours and then replaced by fresh medium containing NU-serum (Invitrogen) and Sodium Butyrate (Sigma).
  • Viral supernatant was harvested 48 and 72 hours after transfection and concentrated using a Centricon concentrator (Millipore) (2000 rpm for 1 hours at 4°C). Aliquots of viruses were stored at - 80°C. The physical titer in nanograms per microliter of all LVs was determined using a p24 colorimetric enzyme-linked immunosorbent assay (ELISA) kit (Cell Biolabs) according to the manufacturer's instructions. This value was then used to calculate an estimated vector titer equivalent in transducing units (TU) per milliliter. Polybrene (8 ⁇ g mL) was added to the concentrated vectors to enhance transduction.
  • ELISA enzyme-linked immunosorbent assay
  • FIG. 3 Flow cytometry analysis of HUVECs and LSECs transduced with LV CMV- GFP vector (MOI 50) at 72 hr timepoint post transduction.
  • FIG. 4 FVIII antigen expression expressed in ng/ml in HUVECs and LSECS transduced with different lentiviral vector designs. FVIII antigen expression levels were determined. at 24, 48 and 72 hrs after transduction.
  • FIG. 6 FVIII expression after lentiviral in vivo transduction.
  • FVIII protein expression was determined using a human FVIII-specific ELISA on the plasma samples collected 5 weeks after lentiviral vector injection.
  • FIG. 7 mRNA analysis of the CD146-positive endothelial cells isolated from liver and spleen.
  • the human FVIII expression encoded by the lentiviral vector was normalized to endogenous mouse GAPDH expression.
  • FIG. 8 plasmid maps of lentiviral vectors
  • pCDH endothelial CRE's were cloned, in a self inactivating the lentiviral vectors called pCDH as shown in the map.
  • one or more or “at least one”, such as one or more members or at least one member of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members.
  • “one or more” or “at least one” may refer to 1 , 2, 3, 4, 5, 6, 7 or more.
  • the invention relates to a nucleic acid regulatory element for enhancing gene expression in endothelial cells or tissue comprising, consisting essentially of (i.e., the regulatory element may for instance additionally comprise sequences used for cloning purposes, but the indicated sequences make up the essential part of the regulatory element, e.g.
  • a sequence selected from the group consisting of: SEQ ID NO:1 to 33 a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, such as 95%, 96%, 97%, 98%, or 99%, identity to any of these sequences, or a functional fragment of a sequence selected from the group consisting of: SEQ ID NO:1 to 33.
  • Tables 2 and 3 below depict the core nucleotide sequence of the different nucleic acid regulatory elements for enhancing gene expression in endothelial cells or tissue.
  • Table 1 lists the corresponding genes and lengths.
  • a 'nucleic acid regulatory element', 'cis-acting regulatory element', RE' or 'regulatory element' as used herein refers to a transcriptional control element, in particular a non- coding cis-acting transcriptional control element, capable of regulating and/or controlling transcription of a gene, in particular tissue-specific transcription of a gene.
  • Regulatory elements comprise at least one transcription factor binding site (TFBS), more in particular at least one binding site for a tissue-specific transcription factor, most particularly at least one binding site for an endothelial cell-specific transcription factor.
  • TFBS transcription factor binding site
  • regulatory elements as used herein increase or enhance promoter-driven gene expression when compared to the transcription of the gene from the promoter alone, without the regulatory elements.
  • regulatory elements particularly comprise enhancer sequences, although it is to be understood that the regulatory elements enhancing transcription are not limited to typical far upstream enhancer sequences, but may occur at any distance of the gene they regulate. Indeed, it is known in the art that sequences regulating transcription may be situated either upstream (e.g. in the promoter region) or downstream (e.g. in the 3'UTR) of the gene they regulate in vivo, and may be located in the immediate vicinity of the gene or further away.
  • regulatory elements as disclosed herein typically comprise naturally occurring sequences, combinations of (parts of) such regulatory elements or several copies of a regulatory element, i.e. regulatory elements comprising non-naturally occurring sequences, are themselves also envisaged as regulatory element.
  • regulatory elements as used herein may comprise part of a larger sequence involved in transcriptional control, e.g. part of a promoter sequence. However, regulatory elements alone are typically not sufficient to initiate transcription, but require a promoter to this end.
  • the regulatory elements disclosed herein are provided as nucleic acid molecules, i.e. isolated nucleic acids, or isolated nucleic acid molecules. Said nucleic acid regulatory elements hence have a sequence which is only a small part of the naturally occurring genomic sequence and hence is not naturally occurring as such, but is isolated therefrom.
  • nucleic acid typically refers to an oligomer or polymer (preferably a linear polymer) of any length composed essentially of nucleotides.
  • a nucleotide unit commonly includes a heterocyclic base, a sugar group, and at least one, e.g. one, two, or three, phosphate groups, including modified or substituted phosphate groups.
  • Heterocyclic bases may include inter alia purine and pyrimidine bases such as adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) which are widespread in naturally-occurring nucleic acids, other naturally-occurring bases (e.g., xanthine, inosine, hypoxanthine) as well as chemically or biochemically modified (e.g., methylated), non- natural or derivatised bases.
  • A adenine
  • G guanine
  • C cytosine
  • T thymine
  • U uracil
  • other naturally-occurring bases e.g., xanthine, inosine, hypoxanthine
  • chemically or biochemically modified e.g., methylated
  • Sugar groups may include inter alia pentose (pentofuranose) groups such as preferably ribose and/or 2-deoxyribose common in naturally-occurring nucleic acids, or arabinose, 2-deoxyarabinose, threose or hexose sugar groups, as well as modified or substituted sugar groups.
  • Nucleic acids as intended herein may include naturally occurring nucleotides, modified nucleotides or mixtures thereof.
  • a modified nucleotide may include a modified heterocyclic base, a modified sugar moiety, a modified phosphate group or a combination thereof. Modifications of phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or some other useful property.
  • nucleic acid further preferably encompasses DNA, RNA and DNA RNA hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesised) DNA, RNA or DNA RNA hybrids.
  • a nucleic acid can be naturally occurring, e.g., present in or isolated from nature; or can be non-naturally occurring, e.g., recombinant, i.e., produced by recombinant DNA technology, and/or partly or entirely, chemically or biochemically synthesised.
  • nucleic acid can be double-stranded, partly double stranded, or single-stranded. Where single-stranded, the nucleic acid can be the sense strand or the antisense strand. In addition, nucleic acid can be circular or linear.
  • transcription factor binding site “transcription factor binding sequence” or “TFBS” refers to a sequence of a nucleic acid region to which transcription factors bind.
  • Non-limiting examples of TFBS include binding sites for or such as: POLR2A, Pol2(b), GATA2, GATA-2, FOS, c-Fos, NR3C1, Freac-2, MAX, FOX2P, MYC, SRY, SOX9, SRF, JUN, TEAD4, EZH2, TBP, TCF7L2, SPI1, RELA, JUND, MXI1, JUNB, BHLHE40, RCOR1, TCF12, TAL1, EP300, HDAC2, GTF2F1, SIN3AK20, FOSL2, ETS1, CTBP2, GAT A3, CEBPB, FOXA1, YY1, RFX5, TAF1, REST, ELF1, CTCF, SMC3, FOXP2, RUNX3, NRF1, HDAC6, IRF4, PAX5, RAD21, WRNIP1, ERalpha_a, PU.1, TCF4, TAL1, HDAC2, GAT A3, Mxi1, GTF2F1, ELF1, NR
  • Sequences disclosed herein may be part of sequences of regulatory elements capable of controlling transcription of endothelial cell-specific genes in vivo.
  • Particular examples for endothelial-specific regulatory elements may in particular be controlling the following genes: IFI27, ICAM2, VWF, EDN1, ENG, ECSCR, CDH5, PECAM1, HHIP, TIE1 or HYAL2.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from CDH5 regulatory elements, i.e. regulatory elements that control expression of the CDH5 gene (Cadherin 5 or VE-cadherin gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 1 to 6, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from ECSCR regulatory elements, i.e. regulatory elements that control expression of the ECSCR gene (Endothelial Cell-Specific Chemotaxis Regulator gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 7 or 8, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from EDN1 regulatory elements, i.e. regulatory elements that control expression of the EDN 1 gene (Endothelin 1 gene) in vivo, e.g. regulatory elements comprising SEQ ID NO: 9, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from ENG regulatory elements, i.e. regulatory elements that control expression of the ENG gene (Endoglin gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 10 to 12, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from HHIP regulatory elements, i.e.
  • nucleic acid regulatory elements that control expression of the HHIP gene (Hedgehog Interacting Protein gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 13 or 14, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from HYAL2 regulatory elements, i.e. regulatory elements that control expression of the HYAL2 gene (Hyaluronoglucosaminidase 2 gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 15 to 17, or functional fragments thereof.
  • nucleic acid regulatory elements disclosed herein comprise a sequence from ICAM2 regulatory elements, i.e.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from IFI27 regulatory elements, i.e. regulatory elements that control expression of the IFI27 gene (Interferon, Alpha-lnducible Protein 27 gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 21 to 23, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from PECAM1 regulatory elements, i.e.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from TIE1 regulatory elements, i.e. regulatory elements that control expression of the TIE1 gene (Tyrosine Kinase With Immunoglobulin-Like And EGF-Like Domains 1 gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 25 or 26, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence from VWF regulatory elements, i.e. regulatory elements that control expression of the VWF gene (Von Willebrand Factor gene) in vivo, e.g. regulatory elements comprising any one or more of SEQ ID NOs: 27 or 28, or functional fragments thereof.
  • the nucleic acid regulatory elements disclosed herein comprise a sequence comprising any one or more of SEQ ID NOs: 29 to 33, or functional fragments thereof.
  • identity refers to the sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, e.g., two DNA molecules. Sequence alignments and determination of sequence identity can be done, e.g., using the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), such as the "Blast 2 sequences” algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250). Typically, the percentage sequence identity is calculated over the entire length of the sequence.
  • BLAST Basic Local Alignment Search Tool
  • the term "substantially identical” denotes at least 90%, preferably at least 95%, such as 95%, 96%, 97%, 98% or 99%, sequence identity.
  • the term 'functional fragment' as used in the application refers to fragments of the regulatory element sequences disclosed herein that retain the capability of regulating endothelial cell-specific expression, i.e. they can still confer tissue specificity and they are capable of regulating expression of a (trans)gene in the same way (although possibly not to the same extent) as the sequence from which they are derived.
  • Functional fragments may preferably comprise at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 150, at least 200, at least 250, at least 300, at least 350, or at least 400 contiguous nucleotides from the sequence from which they are derived. Also preferably, functional fragments may comprise at least 1 , more preferably at least 2, at least 3, or at least 4, even more preferably at least 5, at least 10, or at least 15, of the transcription factor binding sites (TFBS) that are present in the sequence from which they are derived.
  • TFBS transcription factor binding sites
  • endothelial cell-specific expression refers to the preferential or predominant expression of a (trans)gene (as RNA and/or polypeptide) in endothelial cells and tissue comprising or built from endothelial cells, as compared to other (i.e. non- endothelial) cells or tissues.
  • a (trans)gene as RNA and/or polypeptide
  • at least 50%, more particularly at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% of the (trans)gene expression occurs within endothelial cells or endothelial tissue.
  • endothelial cell encompasses all endothelial cell types, such as the cells forming a single cell layer that lines all blood vessels and regulates exchanges between the bloodstream and the surrounding tissues. Many endothelial cell types exist and their phenotypes vary between different organs, between different segments of the vascular loop within the same organ, and between neighbouring endothelial cells of the same organ and blood vessel type. Non-limiting examples of such endothelial cells are: liver sinusoidal endothelial cells (LSEC), (micro)vascular endothelial cells from e.g.
  • LSEC liver sinusoidal endothelial cells
  • micro microvascular endothelial cells from e.g.
  • arterial endothelial cells such as endothelial cells from pulmonary artery, the aorta, umbilical artery and umbilical vein, extrahepatic endothelial cells from certain vascular beds, blood-brain barrier ECs, bone marrow ECs, and high endothelial venule cells (HEVs).
  • endothelial cells such as endothelial cells from pulmonary artery, the aorta, umbilical artery and umbilical vein, extrahepatic endothelial cells from certain vascular beds, blood-brain barrier ECs, bone marrow ECs, and high endothelial venule cells (HEVs).
  • endothelial cells such as endothelial cells from pulmonary artery, the aorta, umbilical artery and umbilical vein, extrahepatic endothelial cells from certain vascular beds, blood-brain barrier ECs, bone marrow ECs, and high
  • endothelial cell specific expression entails that there is less than 10%, less than 5%, less than 2% or even less than 1 % 'leakage' of expressed gene product to other organs or tissue than those comprising or built by endothelial cells, such as muscle, heart, lung, liver, brain, kidney and/or spleen.
  • EPC endothelial progenitor cell
  • the invention relates to a nucleic acid regulatory element for enhancing gene expression in endothelial cells or tissue derived therefrom comprising, consisting essentially of, or consisting of a sequence selected from the group consisting of: SEQ ID NO:1 to 33; a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, such as 95%, 96%, 97%, 98%, or 99%, identity to any of the sequences selected from the group consisting of SEQ ID NO: 1 to 33; or a functional fragment thereof, wherein said functional fragment comprises at least 20, preferably at least 25, more preferably at least 50, at least 100, at least 200 or at least 250, contiguous nucleotides from the sequence from which it is derived, and wherein said functional fragment comprises at least 1 , preferably at least 2, 3, 4, or 5, more preferably at least 10 or at least 15 transcription factor binding sites (TFBS) such as those TFBS that are present in the sequence from which it is derived, and
  • nucleic acid regulatory elements that comprise an artificial sequence by combining two or more identical or different sequences disclosed herein or functional fragments thereof. Accordingly, in certain embodiments a nucleic acid regulatory element for enhancing gene expression in endothelial cells is provided comprising at least two sequences selected from the group consisting of: SEQ ID NO:1 - 33.
  • nucleic acid regulatory element comprising, consisting essentially of, or consisting of 2, 3, 4, or 5 repeats, e.g. tandem repeats, of any one of SEQ ID NOs:1 to 33, or combinations thereof.
  • TFBS transcription factor binding sites
  • a nucleic acid regulatory element for enhancing endothelial cell-specific gene expression in particular endothelial cell-specific gene expression, comprising binding sites for e.g. Sp1 , EGR-1 , ETS and GATA.
  • nucleic acid regulatory element for enhancing endothelial cell-specific gene expression, in particular comprising binding sites for one or more of: Sp1 , EGR-1 , ETS and GATA and combinations thereof.
  • these nucleic acid regulatory elements comprise at least two, such as 2, 3, 4, or more copies of any one or more of the recited TFBSs.
  • the vector used is a lentiviral vector. In other embodiments, the vector used is an adeno-associated viral vector. In yet other embodiment, the vector used is an adenoviral vector. In case a lentiviral vector is used, it can be a self inactivating or a non self-inactivating lentiviral vector. A self inactivating lentiviral vector is sometimes preferred for clinical use since it is considered safer.
  • nucleic acid regulatory element for enhancing endothelial cell-specific gene expression comprising, consisting essentially of, or consisting of the complement of a sequence described herein, in particular a sequence selected from the group consisting of: SEQ ID NOs:1 to 33; a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, such as 95%, 96%, 97%, 98%, or 99%, identity to any of these sequences; or a functional fragment thereof as defined herein.
  • nucleic acid regulatory element for enhancing endothelial cell- specific gene expression hybridizing under stringent conditions to a nucleic acid regulatory element described herein, in particular to the nucleic acid regulatory element comprising, consisting essentially of, or consisting of a sequence selected from the group consisting of: SEQ ID NOs:1 to 33; a sequence having at least 90%, preferably at least 95%, such as 95%, 96%, 97%, 98%, or 99%, identity to any of these sequences; a functional fragment thereof as defined herein; or to its complement.
  • Said nucleic acid regulatory elements do not need to be of equal length as the sequence they hybridize to.
  • the size of said hybridizing nucleic acid regulatory element does not differ more than 25% in length, in particular 20% in length, more in particular 15% in length, most in particular 10% in length from the sequence it hybridizes to.
  • the expression 'hybridize under stringent conditions' refers to the ability of a nucleic acid molecule to hybridize to a target nucleic acid molecule under defined conditions of temperature and salt concentration.
  • stringent hybridization conditions are no more than 25°C to 30°C (for example, 20°C, 15°C, 10°C or 5°C) below the melting temperature (Tm) of the native duplex. Methods of calculating Tm are well known in the art.
  • representative salt and temperature conditions for achieving stringent hybridization are: 1x SSC, 0.5% SDS at 65°C.
  • the abbreviation SSC refers to a buffer used in nucleic acid hybridization solutions.
  • One liter of the 20x (twenty times concentrate) stock SSC buffer solution (pH 7.0) contains 175.3 g sodium chloride and 88.2 g sodium citrate.
  • a representative time period for achieving hybridization is 12 hours.
  • the regulatory elements as described herein are fully functional while being only of limited length. This allows their use in vectors or nucleic acid expression cassettes without unduly restricting their payload capacity.
  • the regulatory element disclosed herein is a nucleic acid of 1500 nucleotides or less, 1000 nucleotides or less, 900 nucleotides or less, 800 nucleotides or less, 700 nucleotides or less, more preferably 610 nucleotides or less, such as 550 nucleotides or less, 500 nucleotides or less, 450 nucleotides or less, 400 nucleotides or less, 350 nucleotides or less, or 300 nucleotides or less (i.e.
  • the nucleic acid regulatory element has a maximal length of 1500 nucleotides, 1000 nucleotides, 900 nucleotides, 800 nucleotides, 700 nucleotides, preferably 610 nucleotides, such as 550 nucleotides, 500 nucleotides, 450 nucleotides, 400 nucleotides, 350 nucleotides, or 300 nucleotides).
  • the disclosed nucleic acid regulatory elements retain regulatory activity (i.e.
  • nucleotides with regard to specificity and/or activity of transcription) and thus they particularly have a minimum length of 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 100 nucleotides, 150 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 350 nucleotides or 400 nucleotides.
  • the invention provides for a nucleic acid regulatory element of 1000 nucleotides or less, preferably 900 nucleotides or less, preferably 800 nucleotides or less, preferably 700 nucleotides or less of a sequence selected from the group consisting of: SEQ ID NOs:1 to 33; a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, such as 95%, 96%, 97%, 98%, or 99%, identity to any of said sequences; or a functional fragment thereof as defined herein.
  • nucleic acid regulatory elements disclosed herein may be used in a nucleic acid expression cassette. Accordingly, in an aspect the invention provides for the use of the nucleic acid regulatory elements as described herein in a nucleic acid expression cassette.
  • the invention provides a nucleic acid expression cassette comprising a nucleic acid regulatory element as described herein, operably linked to a promoter.
  • the nucleic acid expression cassette does not contain a transgene.
  • Such nucleic acid expression cassette may be used to drive expression of an endogenous gene.
  • the nucleic acid expression cassette comprises a nucleic acid regulatory element as described herein, operably linked to a promoter and a transgene.
  • nucleic acid expression cassette refers to nucleic acid molecules that include one or more transcriptional control elements (such as, but not limited to promoters, enhancers and/or regulatory elements, polyadenylation sequences, and introns) that direct (trans)gene expression in one or more desired cell types, tissues or organs. Typically, they will also contain a transgene, although it is also envisaged that a nucleic acid expression cassette directs expression of an endogenous gene in a cell into which the nucleic acid cassette is inserted.
  • transcriptional control elements such as, but not limited to promoters, enhancers and/or regulatory elements, polyadenylation sequences, and introns
  • the term 'operably linked' as used herein refers to the arrangement of various nucleic acid molecule elements relative to each other such that the elements are functionally connected and are able to interact with each other.
  • Such elements may include, without limitation, a promoter, an enhancer and/or a regulatory element, a polyadenylation sequence, one or more introns and/or exons, and a coding sequence of a gene of interest to be expressed (i.e., the transgene).
  • the nucleic acid sequence elements when properly oriented or operably linked, act together to modulate the activity of one another, and ultimately may affect the level of expression of the transgene.
  • modulate is meant increasing, decreasing, or maintaining the level of activity of a particular element.
  • each element relative to other elements may be expressed in terms of the 5' terminus and the 3' terminus of each element, and the distance between any particular elements may be referenced by the number of intervening nucleotides, or base pairs, between the elements.
  • operably linked implies functional activity, and is not necessarily related to a natural positional link. Indeed, when used in nucleic acid expression cassettes, the regulatory elements will typically be located immediately upstream of the promoter (although this is generally the case, it should definitely not be interpreted as a limitation or exclusion of positions within the nucleic acid expression cassette), but this need not be the case in vivo.
  • the regulatory or enhancing effect of the regulatory element is position-independent.
  • the nucleic acid expression cassette comprises one nucleic acid regulatory element as described herein.
  • the nucleic acid expression cassette comprises two or more, such as, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10, nucleic acid regulatory elements as described herein, i.e. they are combined modularly to enhance their regulatory (and/or enhancing) effect.
  • at least two of the two or more nucleic acid regulatory elements are identical or substantially identical.
  • all of the two or more regulatory elements are identical or substantially identical. The copies of the identical or substantially identical nucleic acid regulatory elements may be provided as tandem repeats in the nucleic acid expression cassette.
  • nucleic acid expression cassette may also comprise a combination of identical and substantially identical nucleic acid regulatory elements and non-identical nucleic acid regulatory elements.
  • the nucleic acid expression cassette may comprise a nucleic acid regulatory element comprising SEQ ID NO:1 , and a nucleic acid regulatory element comprising any one or more of SEQ ID Nos: 2 to 33.
  • this can be done for remaining regulatory elements defined by SEQ ID NOs:2 to 33, which can be combine with any one or more of the other regulatory elements.
  • promoter refers to nucleic acid sequences that regulate, either directly or indirectly, the transcription of corresponding nucleic acid coding sequences to which they are operably linked (e.g. a transgene or endogenous gene).
  • a promoter may function alone to regulate transcription or may act in concert with one or more other regulatory sequences (e.g. enhancers or silencers, or regulatory elements).
  • a promoter is typically operably linked to a regulatory element as disclosed herein to regulate transcription of a (trans)gene.
  • the regulatory element when operably linked to both a promoter and a transgene, the regulatory element can (1 ) confer a significant degree of endothelial cell- specific expression in vivo (and/or in vitro in cell lines derived from endothelial cell- or tissue) of the transgene, and/or (2) can increase the level of expression of the transgene in endothelial cells (and/or in vitro in cell lines derived from endothelial cells or tissue).
  • the promoter may be homologous (i.e. from the same species as the animal, in particular mammal, to be transfected with the nucleic acid expression cassette) or heterologous (i.e. from a source other than the species of the animal, in particular mammal, to be transfected with the expression cassette).
  • the source of the promoter may be any virus, any unicellular prokaryotic or eukaryotic organism, any vertebrate or invertebrate organism, or any plant, or may even be a synthetic promoter (i.e. having a non-naturally occurring sequence), provided that the promoter is functional in combination with the regulatory elements described herein.
  • the promoter is a mammalian promoter, in particular a murine or human promoter.
  • the promoter may be an inducible or constitutive promoter.
  • Non-limiting exemplary endothelial cell-specific promoters are: the promotors of the genes depicted in Table 1 below, more preferably the
  • the promoter is a mammalian promoter, in particular a murine or human promoter.
  • the promoter is from the vascular-endothelial cadherin gene, in particular the murine or human cadherin-5 gene, such as the promoter as defined in SEQ ID NO: 34 (cf. Table 4).
  • the promoter is from the endothelin-1 gene, in particular the murine or human endothelin-1 gene, such as the promoter as defined in SEQ ID NO: 35 (cf. Table 4).
  • the promoter is from the endoglin gene, in particular the murine or human endoglin gene, such as the promoter as defined in SEQ ID NO: 36 (cf. Table 4).
  • the promoter is from the Fms-Related Tyrosine Kinase 1 gene, in particular the murine or human Fms-Related Tyrosine Kinase 1 gene, such as the promoter as defined in SEQ ID NO: 37 (cf. Table 4).
  • the promoter is from the Intercellular Adhesion Molecule 2 gene, in particular the murine or Intercellular Adhesion Molecule 2 gene (ICAM2), such as the promoter as defined in SEQ ID NO: 38 (cf. Table 4).
  • IAM2 Intercellular Adhesion Molecule 2 gene
  • the promoter does not need to be the promoter of the transgene in the nucleic acid expression cassette, although it is possible that the transgene is transcribed from its own promoter.
  • the regulatory elements may be linked to minimal promoters, or shortened versions of the promoters described herein.
  • a 'minimal promoter' also referred to as basal promoter or core promoter
  • basal promoter or core promoter is part of a full-size promoter still capable of driving expression, but lacking at least part of the sequence that contributes to regulating (e.g. tissue-specific) expression.
  • This definition covers both promoters from which (tissue-specific) regulatory elements have been deleted- that are capable of driving expression of a gene but have lost their ability to express that gene in a tissue-specific fashion and promoters from which (tissue-specific) regulatory elements have been deleted that are capable of driving (possibly decreased) expression of a gene but have not necessarily lost their ability to express that gene in a tissue-specific fashion.
  • the promoter contained in the nucleic acid expression cassette disclosed herein is 1000 nucleotides or less in length, 900 nucleotides or less, 800 nucleotides or less, 700 nucleotides or less, 600 nucleotides or less, 500 nucleotides or less, 400 nucleotides or less, 300 nucleotides or less, or 250 nucleotides or less.
  • a minimal promotor is the EDNI mini promoter (cf. Table 4).
  • transgene' refers to particular nucleic acid sequences encoding a polypeptide or a portion of a polypeptide to be expressed in a cell into which the nucleic acid sequence is introduced. However, it is also possible that transgenes are expressed as RNA, typically to control (e.g. lower) the amount of a particular polypeptide in a cell into which the nucleic acid sequence is inserted.
  • RNA molecules include but are not limited to molecules that exert their function through RNA interference (shRNA, RNAi), micro-RNA regulation (miR) (which can be used to control expression of specific genes), catalytic RNA, antisense RNA, RNA aptamers, ZFN, TALEN, CRISPR/Cas9 or similar DNA or RNA cutters, etc..
  • shRNA RNA interference
  • miR micro-RNA regulation
  • catalytic RNA antisense RNA
  • RNA aptamers ZFN, TALEN, CRISPR/Cas9 or similar DNA or RNA cutters, etc.
  • nucleic acid sequence is introduced into a cell is not essential to the invention, it may for instance be through integration in the genome or as an episomal plasmid.
  • expression of the transgene may be restricted to a subset of the cells into which the nucleic acid sequence is introduced.
  • transgene' is meant to include (1 ) a nucleic acid sequence that is not naturally found in the cell (i.e., a heterologous nucleic acid sequence); (2) a nucleic acid sequence that is a mutant form of a nucleic acid sequence naturally found in the cell into which it has been introduced; (3) a nucleic acid sequence that serves to add additional copies of the same (i.e., homologous) or a similar nucleic acid sequence naturally occurring in the cell into which it has been introduced; or (4) a silent naturally occurring or homologous nucleic acid sequence whose expression is induced in the cell into which it has been introduced.
  • the transgene may be homologous or heterologous to the promoter (and/or to the animal, in particular mammal, in which it is introduced, e.g. in cases where the nucleic acid expression cassette is used for gene therapy).
  • the transgene may be a full length cDNA or genomic DNA sequence, or any fragment, subunit or mutant thereof that has at least some biological activity.
  • the transgene may be a minigene, i.e. a gene sequence lacking part, most or all of its intronic sequences.
  • the transgene thus optionally may contain intron sequences.
  • the transgene may be a hybrid nucleic acid sequence, i.e., one constructed from homologous and/or heterologous cDNA and/or genomic DNA fragments.
  • mutant nucleic acid sequence contains one or more nucleotides that are different from the wild-type or naturally occurring sequence, i.e., the mutant nucleic acid sequence contains one or more nucleotide substitutions, deletions, and/or insertions.
  • the nucleotide substitution, deletion, and/or insertion can give rise to a gene product (i.e. e., protein or nucleic acid) that is different in its amino acid/nucleic acid sequence from the wild type amino acid/nucleic acid sequence. Preparation of such mutants is well known in the art.
  • the transgene may also include a sequence encoding a leader peptide or signal sequence such that the transgene product will be secreted from the cell.
  • the transgene that may be contained in the nucleic acid expression cassettes described herein typically encodes a gene product such as RNA or a polypeptide (protein).
  • the transgene encodes a therapeutic protein.
  • the therapeutic protein may be a secretable protein.
  • secretable proteins include hepatocyte growth factor (HGF), coagulation factor VIII (FVIII), coagulation factor VII (FVII), coagulation factor IX (FIX), coagulation factor XI (FXI), tissue factor (TF), tissue factor pathway inhibitor (TFPI), von Willebrand factor (vWF), ADAMTS13, VEGF, PLGF, FGF, sFLT1 , a1 -antitrypsin, AAT,, apolipoprotein A-l (apoA-l), matrix metalloproteinases including but not limited to matrix metalloproteinase-3 (TIMP-3), insulin, erythropoietin, lipoprotein lipase, nitric oxide synthase (NOS), antibodies or nanobodies, including but not limited to antibodies directed against any one of said transgenes, factors
  • HGF hepatocyte growth factor
  • the therapeutic protein may also be a structural protein.
  • structural proteins in particular structural therapeutic proteins, include proteins modulating vascular relaxation and vasoconstriction, atherosclerosis.
  • the transgene comprises the nitric oxide synthase (NOS).
  • the transgene encodes an immunogenic protein.
  • immunogenic proteins include epitopes and antigens derived from a pathogen.
  • immunogenic refers to a substance or composition capable of eliciting an immune response.
  • sequences may be incorporated in the nucleic acid expression cassette disclosed herein as well, typically to further increase or stabilize the expression of the transgene product (e.g. introns and/or polyadenylation sequences).
  • any intron can be utilized in the expression cassettes described herein, but may not be necessary.
  • the term "intron” encompasses any portion of a whole intron that is large enough to be recognized and spliced by the nuclear splicing apparatus. Typically, short, functional, intron sequences are preferred in order to keep the size of the expression cassette as small as possible which facilitates the construction and manipulation of the expression cassette.
  • the intron is obtained from a gene that encodes the protein that is encoded by the coding sequence within the expression cassette. The intron can be located 5' to the coding sequence, 3' to the coding sequence, or within the coding sequence.
  • the nucleic acid expression cassette disclosed herein further comprises an intron.
  • suitable introns are Minute Virus of Mice (MVM) intron, beta-globin intron (betalVS-ll), factor IX (FIX) intron A, Simian virus 40 (SV40) small-t intron, and beta-actin intron.
  • the intron is MVM intron.
  • polyadenylation signal that directs the synthesis of a polyA tail is useful in the expression cassettes described herein, examples of those are well known to one of skill in the art.
  • exemplary polyadenylation signals include, but are not limited to, polyA sequences derived from the Simian virus 40 (SV40) late gene, the bovine growth hormone (BGH) polyadenylation signal, the minimal rabbit ⁇ -globin (mRBG) gene, and the synthetic polyA s(SPA) site as described in Levitt et al. (1989, Genes Dev 3:1019-1025).
  • the polyadenylation signal is derived from SV40 (i.e. SV40 pA).
  • the invention provides a nucleic acid expression cassette comprising, consisting essentially of, or consisting of a nucleic acid regulatory element selected from the group consisting of SEQ ID NO: 1 to 33 or a sequence having 95% identity to said sequence, operably linked to a promoter, preferably a promoter selected from the group consisting of the promoter from the cadherin-5, endothelin-1 , endoglin, Fms-Related Tyrosine Kinase 1 , or Intercellular Adhesion Molecule 1 gene or the promoter, and a transgene, preferably a transgene encoding a luciferase.
  • the nucleic acid expression cassette further comprises a polyadenylation signal, preferably a polyadenylation signal derived from SV40.
  • the invention provides a nucleic acid expression cassette comprising, consisting essentially of, or consisting of a nucleic acid regulatory element selected from the group consisting of SEQ ID NO: 1 to 33 or a sequence having 95% identity to said sequence, operably linked to a promoter, preferably the promoter from the cadherin-5, endothelin-1 , endoglin, Fms-Related Tyrosine Kinase 1 , or Intercellular Adhesion Molecule 1 gene, and a transgene, preferably a transgene encoding a therapeutic or structural protein as defined herein.
  • the nucleic acid expression cassette further comprises a polyadenylation signal.
  • any one of the following transgenes can introduced: secretable proteins, in particular secretable therapeutic proteins, including hepatocyte growth factor (HGF), coagulation factor VIII (FVIII), coagulation factor VII (FVII), coagulation factor IX (FIX), coagulation factor XI (FXI), tissue factor (TF), tissue factor pathway inhibitor (TFPI), von Willebrand factor (vWF), ADAMTS13, VEGF, PLGF, FGF, sFLT1 , a1 -antitrypsin (AAT), matrix metalloproteinases including but not limited to matrix metalloproteinase-3 (TIMP-3) (TIMP-3), insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors etc.
  • HGF hepatocyte growth factor
  • FVIII coagulation factor VIII
  • FVII coagulation factor VII
  • FIX coagulation factor IX
  • the therapeutic protein may also be a structural protein.
  • structural proteins in particular structural therapeutic proteins, modulating vascular relaxation and vasoconstriction, atherosclerosis.
  • the transgene comprises the nitric oxide synthase (NOS).
  • nucleic acid regulatory element and the nucleic acid expression cassette disclosed herein may be used as such, or typically, they may be part of a nucleic acid vector. Accordingly, a further aspect relates to the use of a nucleic acid regulatory element as described herein or a nucleic acid expression cassette as described herein in a vector, in particular a nucleic acid vector.
  • the invention also provides a vector comprising a nucleic acid regulatory element as disclosed herein.
  • the vector comprises a nucleic acid expression cassette as disclosed herein.
  • the term 'vector' as used in the application refers to nucleic acid molecules, e.g. double- stranded DNA, which may have inserted into it another nucleic acid molecule (the insert nucleic acid molecule) such as, but not limited to, a cDNA molecule.
  • the vector is used to transport the insert nucleic acid molecule into a suitable host cell.
  • a vector may contain the necessary elements that permit transcribing the insert nucleic acid molecule, and, optionally, translating the transcript into a polypeptide.
  • the insert nucleic acid molecule may be derived from the host cell, or may be derived from a different cell or organism.
  • the vector can replicate independently of, or coincidental with, the host chromosomal DNA, and several copies of the vector and its inserted nucleic acid molecule may be generated.
  • the vectors can be episomal vectors (i.e., that do not integrate into the genome of a host cell), or can be vectors that integrate into the host cell genome.
  • the term 'vector' may thus also be defined as a gene delivery vehicle that facilitates gene transfer into a target cell. This definition includes both non-viral and viral vectors.
  • Non-viral vectors include but are not limited to cationic lipids, liposomes, nanoparticles, PEG, PEI, plasmid vectors (e.g.
  • Viral vectors are derived from viruses and include but are not limited to retroviral, lentiviral, adeno-associated viral, adenoviral, herpes viral, hepatitis viral vectors or the like. Typically, but not necessarily, viral vectors are replication-deficient as they have lost the ability to propagate in a given cell since viral genes essential for replication have been eliminated from the viral vector.
  • viral vectors can also be adapted to replicate specifically in a given cell, such as e.g. a cancer cell, and are typically used to trigger the (cancer) cell-specific (onco)lysis.
  • Virosomes are a non-limiting example of a vector that comprises both viral and non-viral elements, in particular they combine liposomes with an inactivated HIV or influenza virus (Yamada et al., 2003).
  • Another example encompasses viral vectors mixed with cationic lipids.
  • the vector is a viral vector, such as a retroviral, lentiviral, adenoviral, or adeno-associated viral (AAV) vector, more preferably a lentiviral vector.
  • Lentiviral vectors are preferably derived from the human immune deficiency virus (HIV) though other lentiviral vectors based on other lentiviruses could also be used (including but not limited to Equine infectious anemia virus).
  • Lentiviral vectors can transduce endothelial cells. Production of lentiviral vectors can be achieved by (VandenDriessche et al. J.
  • a heterologous envelope such as the vesicular stomatitis virus G glycoprotein (VSV-G) or an endotheliotropic envelope including but not limited to envelopes that confer antibody or nanobody (i.e. single chain antibody)-mediated endothelial retargeting targeting specific endothelial cell surface markers (VandenDriessche & Chuah, Blood. 2013 Sep 19;122(12):1993-4; Abel et al., Blood.
  • VSV-G vesicular stomatitis virus G glycoprotein
  • an endotheliotropic envelope including but not limited to envelopes that confer antibody or nanobody (i.e. single chain antibody)-mediated endothelial retargeting targeting specific endothelial cell surface markers
  • the vector is an adeno-associated viral (AAV) vector.
  • AAV vectors are preferably used as self-complementary, double-stranded AAV vectors (scAAV) in order to overcome one of the limiting steps in AAV transduction (i.e. single-stranded to double-stranded AAV conversion) (McCarty, 2001 , 2003; Nathwani et al, 2002, 2006, 201 1 ; Wu et al., 2008), although the use of single-stranded AAV vectors (ssAAV) are also encompassed herein.
  • AAV vector particles can e.g. be achieved by transient co-transfection of AAV-vector and AAV helper constructs, encoding AAV capsids into HEK293 cells, followed by a purification step based on cesium chloride (CsCI) density gradient ultracentrifugation, as described (Vanden Driessche et al., 2007).
  • Capsids can also be derived from different serotypes or are specifically modified to enhance endothelial cell transduction either by evolution or selection, antibody (nanobody engineering) or the use of DARPin (Work et al., Mol Ther. 2006 Apr;13(4):683-93; Munch et al., Nat Commun. 2015 Feb 10;6:6246; Buchholz et al..Trends Biotechnol. 2015 Dec;33(12):777-90; White et al. Circulation. 2004 Feb 3;109(4):513-9.)
  • the vector is an adenoviral vector.
  • Adenoviral vectors are preferably derived from the human adenovirus 5 serotype or from other serotypes that display increased tropism to endothelial cells, including but not limited to Ad5T * F35++ (White et al., J Cardiothorac Surg. 2013 Aug 9;8:183. doi: 10.1 186/1749-8090-8-183).
  • the capsid can be engineered to enhance the endotheliotropic properties of the adenoviral vectors including but not limited to the references below (Nicol et al., FEBS Lett. 2009 Jun 18;583(12):2100-7; Nicklin and Baker, Mol Ther.
  • nucleic acid regulatory elements are de facto modular, also combinations of the best endothelial cell-specific nucleic acid regulatory elements with any other endothelial cell-specific nucleic acid regulatory elements to maximize expression in the desired target tissue are tested. Consequently, this can lead to the generation of a versatile endothelial cell-specific nucleic acid regulatory element platform tailor-made for diseases that affect endothelial cells and tissues encompassing those. Furthermore, the endothelial cell- specific nucleic acid regulatory elements can also be combined with other promoters or nucleic acid regulatory elements active in other target tissues.
  • the vector is a non-viral vector, preferably a plasmid, a minicircle, or a transposon-based vector, such as a Sleeping Beauty(SB)-based vector or piggyBac(PB)-based vector.
  • a non-viral vector preferably a plasmid, a minicircle, or a transposon-based vector, such as a Sleeping Beauty(SB)-based vector or piggyBac(PB)-based vector.
  • the vector comprises viral and non-viral elements.
  • the invention provides a vector comprising a nucleic acid expression cassette comprising a nucleic acid regulatory element comprising, consisting essentially of, or consisting of a nucleic acid regulatory element selected from the group consisting of SEQ ID NO:1 to 33, a promoter, preferably the promoter from the cadherin-5, endothelin-1 , endoglin, Fms-Related Tyrosine Kinase 1 , or Intercellular Adhesion Molecule 1 gene, a transgene, preferably a transgene encoding a therapeutic structural or secretable protein, and a polyadenylation signal.
  • a nucleic acid expression cassette comprising a nucleic acid regulatory element comprising, consisting essentially of, or consisting of a nucleic acid regulatory element selected from the group consisting of SEQ ID NO:1 to 33, a promoter, preferably the promoter from the cadherin-5, endothelin-1 , endoglin, Fms-Related
  • any one of the following transgenes can introduced: secretable proteins, in particular secretable therapeutic proteins, including hepatocyte growth factor (HGF), coagulation factor VIII (FVIII), coagulation factor VII (FVII), coagulation factor IX (FIX), coagulation factor XI (FXI), tissue factor (TF), tissue factor pathway inhibitor (TFPI),von Willebrand factor (vWF), ADAMTS13, VEGF, PLGF, FGF, sFLT1 , a1 -antitrypsin (AAT), apolipoprotein A-l (apoA-l), matrix metalloproteinases including but not limited to matrix metalloproteinase-3 (TIMP-3) (TIMP-3), insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors etc.
  • HGF hepatocyte growth factor
  • FVIII coagulation factor VIII
  • FVII coagulation
  • the therapeutic protein may also be a structural protein.
  • structural proteins in particular structural therapeutic proteins, including proteins modulating vascular relaxation, vasoconstriction or atherosclerosis.
  • the transgene comprises the nitric oxide synthase (NOS).
  • the invention provides a vector comprising a nucleic acid expression cassette comprising a nucleic acid regulatory element comprising, consisting essentially of, or consisting of a nucleic acid regulatory element selected from the group consisting of SEQ ID NO:1 to 33, a promoter, preferably the promoter from the cadherin-5, endothelin-1 , endoglin, Fms-Related Tyrosine Kinase 1 , or Intercellular Adhesion Molecule 1 gene, , a transgene, preferably a transgene encoding secretable proteins, in particular secretable therapeutic proteins, including hepatocyte growth factor (HGF), coagulation factor VIII (FVIII), coagulation factor VII (FVII), coagulation factor IX (FIX), coagulation factor XI (FXI), tissue factor (TF), tissue factor pathway inhibitor (TFPI),von Willebrand factor (vWF), ADAMTS13, VEGF, PLGF, FGF, sFLT
  • the therapeutic protein may also be a structural protein.
  • structural proteins in particular structural therapeutic proteins, including proteins modulating vascular relaxation, vasoconstriction or atherosclerosis.
  • the transgene comprises the nitric oxide synthase (NOS).
  • the nucleic acid expression cassettes and vectors disclosed herein may be used, for example, to express proteins that are normally expressed and utilized in endothelial cells (i.e. structural proteins), or to express proteins that are expressed in endothelial cells and that are then exported to the blood stream for transport to other portions of the body (i.e. secretable proteins).
  • the expression cassettes and vectors disclosed herein may be used to express a therapeutic amount of a gene product (such as a polypeptide, in particular a therapeutic protein, or RNA) for therapeutic purposes, in particular for gene therapy.
  • the gene product is encoded by the transgene within the expression cassette or vector, although in principle it is also possible to increase expression of an endogenous gene for therapeutic purposes.
  • the expression cassettes and vectors disclosed herein may be used to express an immunological amount of a gene product (such as a polypeptide, in particular an immunogenic protein, or RNA) for vaccination purposes.
  • nucleic acid expression cassettes and vectors as taught herein may be formulated in a pharmaceutical composition with a pharmaceutically acceptable excipient, i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
  • a pharmaceutically acceptable excipient i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
  • the pharmaceutical composition may be provided in the form of a kit.
  • pharmaceutically acceptable is consistent with the art and means compatible with the other ingredients of the pharmaceutical composition and not deleterious to the recipient thereof.
  • a further aspect of the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a nucleic acid expression cassette or a vector described herein.
  • nucleic acid regulatory elements described herein for the manufacture of these pharmaceutical compositions is also disclosed herein.
  • the pharmaceutical composition may be a vaccine.
  • the vaccine may further comprise one or more adjuvants for enhancing the immune response.
  • Suitable adjuvants include, for example, but without limitation, saponin, mineral gels such as aluminium hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, bacilli Calmette-Guerin (BCG), Corynebacterium parvum, and the synthetic adjuvant QS-21 .
  • the vaccine may further comprise one or more immunostimulatory molecules.
  • Non-limiting examples of immunostimulatory molecules include various cytokines, lymphokines and chemokines with immunostimulatory, immunopotentiating, and pro-inflammatory activities, such as interleukins (e.g., IL-1 , IL-2, IL-3, IL-4, IL-12, IL-13); growth factors (e.g., granulocyte- macrophage (GM)-colony stimulating factor (CSF)); and other immunostimulatory molecules, such as macrophage inflammatory factor, Flt3 ligand, B7.1 ; B7.2, etc.
  • interleukins e.g., IL-1 , IL-2, IL-3, IL-4, IL-12, IL-13
  • growth factors e.g., granulocyte- macrophage (GM)-colony stimulating factor (CSF)
  • CSF colony stimulating factor
  • other immunostimulatory molecules such as macrophage inflammatory factor, Flt3 ligand, B7.1 ; B7.2, etc.
  • the invention relates to the nucleic acid regulatory elements, the nucleic acid expression cassettes, the vectors, or the pharmaceutical compositions described herein for use in medicine.
  • the terms “treat” or “treatment” refer to both therapeutic treatment and prophylactic or preventative measures.
  • Beneficial or desired clinical results include, but are not limited to, prevention of an undesired clinical state or disorder, reducing the incidence of a disorder, alleviation of symptoms associated with a disorder, diminishment of extent of a disorder, stabilized (i.e., not worsening) state of a disorder, delay or slowing of progression of a disorder, amelioration or palliation of the state of a disorder, remission (whether partial or total), whether detectable or undetectable, or combinations thereof.
  • Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
  • the terms "therapeutic treatment” or “therapy” and the like refer to treatments wherein the object is to bring a subjects body or an element thereof from an undesired physiological change or disorder to a desired state, such as a less severe or unpleasant state (e.g., amelioration or palliation), or back to its normal, healthy state (e.g., restoring the health, the physical integrity and the physical well-being of a subject), to keep it at said undesired physiological change or disorder (e.g., stabilization, or not worsening), or to prevent or slow down progression to a more severe or worse state compared to said undesired physiological change or disorder such as a disease or disorder related to endothelial cells.
  • a desired state such as a less severe or unpleasant state (e.g., amelioration or palliation), or back to its normal, healthy state (e.g., restoring the health, the physical integrity and the physical well-being of a subject), to keep it at said undesired physiological change or disorder (e.g
  • prevention encompass preventing the onset of a disease or disorder, including reducing the severity of a disease or disorder or symptoms associated therewith prior to affliction with said disease or disorder.
  • prevention or reduction prior to affliction refers to administration of the nucleic acid regulatory elements, the nucleic acid expression cassettes, the vectors, or the pharmaceutical compositions described herein to a patient that is not at the time of administration afflicted with clear symptoms of the disease or disorder.
  • Preventing also encompasses preventing the recurrence or relapse-prevention of a disease or disorder for instance after a period of improvement.
  • nucleic acid regulatory elements according to any one of SEQ ID Nos: 1 -33, the nucleic acid expression cassettes, the vectors, or the pharmaceutical compositions described herein may be for use in gene therapy, in particular endothelial cell-directed gene therapy.
  • nucleic acid regulatory elements according to any one of SEQ ID Nos: 1 -33, the nucleic acid expression cassettes, the vectors, or the pharmaceutical compositions described herein for the manufacture of a medicament for gene therapy, in particular endothelial cell-directed gene therapy.
  • a method for gene therapy, in particular endothelial cell-directed gene therapy in a subject in need of said gene therapy comprising:
  • nucleic acid expression cassette introducing in the subject, in particular in endothelial cells or tissue of the subject, a nucleic acid expression cassette, a vector or a pharmaceutical composition described herein, wherein the nucleic acid expression cassette, the vector or the pharmaceutical composition comprises a nucleic acid regulatory element according to any one of SEQ ID Nos: 1 -33, operably linked to a promoter and a transgene; and
  • transgene product in the subject, in particular in endothelial tissue or cells of the subject.
  • the transgene product may be any one of the following transgenes can introduced: secretable proteins, in particular secretable therapeutic proteins, including hepatocyte growth factor (HGF), coagulation factor VIII (FVIII), coagulation factor VII (FVII), coagulation factor IX (FIX), coagulation factor XI (FXI), tissue factor (TF), tissue factor pathway inhibitor (TFPI),von Willebrand factor (vWF), ADAMTS13, VEGF, PLGF, FGF, sFLT1 , a1 -antitrypsin (AAT), apolipoprotein A-l (apoA-l), insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors etc.
  • secretable proteins in particular secretable therapeutic proteins, including hepatocyte growth factor (HGF), coagulation factor VIII (FVIII), coagulation factor VII (FVII), coagulation factor IX (FIX
  • the therapeutic protein may also be a structural protein.
  • structural proteins in particular structural therapeutic proteins, including proteins modulating vascular relaxation, vasoconstriction or atherosclerosis
  • the transgene comprises the nitric oxide synthase (NOS).
  • the transgene product may be RNA, such as siRNA., or a nuclease such as ZFN, TALEN, CRISPR/Cas9 or similar DNA or RNA editing systems.
  • Exemplary diseases and disorders that may benefit from gene therapy using the nucleic acid regulatory elements, the nucleic acid expression cassettes, the vectors, or the pharmaceutical compositions described herein include: liver diseases, hemophilia A, von Willebrand disease, microvascular thrombosis, thrombotic thrombocytopenic purpura, peripheral vascular disease, coronary artery diseases, atherosclerotic diseases, stroke, heart disease, diabetes, insulin resistance, chronic kidney failure, tumor growth, metastasis, venous thrombosis, ischemia, tumour growth, tumour vascularisation, cancer and viral infectious diseases such as Ebola, Dengue fever and dengue hemorrhagic fever.
  • Gene therapy protocols have been extensively described in the art. These include, but are not limited to, intramuscular injection of plasmid (naked or in liposomes), hydrodynamic gene delivery in various tissues, including muscle, interstitial injection, instillation in airways, application to endothelium, intra-hepatic parenchyme, and intravenous or intraarterial administration.
  • Various devices have been developed for enhancing the availability of DNA to the target cell. A simple approach is to contact the target cell physically with catheters or implantable materials containing DNA. Another approach is to utilize needle- free, jet injection devices which project a column of liquid directly into the target tissue under high pressure. These delivery paradigms can also be used to deliver vectors.
  • nucleic acid regulatory elements consist of protein or synthetic ligands to which a nucleic acid-or DNA-binding agent has been attached for the specific targeting of nucleic acids to cells (Cristiano et al., 1993).
  • nucleic acid regulatory elements consist of protein or synthetic ligands to which a nucleic acid-or DNA-binding agent has been attached for the specific targeting of nucleic acids to cells (Cristiano et al., 1993).
  • the nucleic acid regulatory elements, the nucleic acid expression cassettes, the vectors, or the pharmaceutical compositions described herein may be for use as a vaccine, more particularly for use as a prophylactic vaccine.
  • nucleic acid regulatory elements for the manufacture of medicament or a vaccine, in particular for the manufacture of a prophylactic vaccine.
  • Also disclosed herein is a method of vaccination, in particular prophylactic vaccination, of a subject in need of said vaccination comprising:
  • nucleic acid expression cassette introducing in the subject, in particular in endothelial tissue or cells of the subject, a nucleic acid expression cassette, a vector or a pharmaceutical composition described herein, wherein the nucleic acid expression cassette, the vector or the pharmaceutical composition comprises a nucleic acid regulatory element according to any one of SEQ ID Nos: 1 to 33, operably linked to a promoter and a transgene; and
  • transgene product in the subject, in particular in endothelial cells or tissue of the subject.
  • a phrase such as "a subject in need of treatment” includes subjects that would benefit from treatment of a recited disease or disorder. Such subjects may include, without limitation, those that have been diagnosed with said disease or disorder, those prone to contract or develop said disease or disorder and/or those in whom said disease or disorder is to be prevented.
  • subject and “patient” are used interchangeably herein and refer to animals, preferably vertebrates, more preferably mammals, and specifically include human patients and non-human mammals.
  • “Mammalian” subjects include, but are not limited to, humans, domestic animals, commercial animals, farm animals, zoo animals, sport animals, pet and experimental animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows; primates such as apes, monkeys, orang-utans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and so on.
  • Preferred patients or subjects are human subjects.
  • a 'therapeutic amount' or 'therapeutically effective amount' as used herein refers to the amount of gene product effective to treat a disease or disorder in a subject, i.e., to obtain a desired local or systemic effect.
  • the term thus refers to the quantity of gene product that elicits the biological or medicinal response in a tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor or other clinician. Such amount will typically depend on the gene product and the severity of the disease, but can be decided by the skilled person, possibly through routine experimentation.
  • an "immunologically effective amount” as used herein refers to the amount of (trans)gene product effective to enhance the immune response of a subject against a subsequent exposure to the immunogen encoded by the (trans)gene.
  • Levels of induced immunity can be determined, e.g. by measuring amounts of neutralizing secretory and/or serum antibodies, e.g., by plaque neutralization, complement fixation, enzyme-linked immunosorbent, or microneutralization assay.
  • the amount of (trans)gene product expressed when using an expression cassette or vector as described herein are higher than when an identical expression cassette or vector is used but without a nucleic acid regulatory element therein. More particularly, the expression is at least double as high, at least five times as high, at least ten times as high, at least 20 times as high, at least 30 times as high, at least 40 times as high, at least 50 times as high, or even at least 60 times as high as when compared to the same nucleic acid expression cassette or vector without nucleic acid regulatory element.
  • the higher expression remains specific to endothelial tissues or cells.
  • the expression cassettes and vectors described herein direct the expression of a therapeutic amount of the gene product for an extended period.
  • therapeutic expression is envisaged to last at least 20 days, at least 50 days, at least 100 days, at least 200 days, and in some instances 300 days or more.
  • Expression of the gene product e.g. polypeptide
  • expression of the gene product can be measured by any art-recognized means, such as by antibody-based assays, e.g. a Western Blot or an ELISA assay, for instance to evaluate whether therapeutic expression of the gene product is achieved.
  • Expression of the gene product may also be measured in a bioassay that detects an enzymatic or biological activity of the gene product.
  • nucleic acid regulatory elements according to SEQ ID Nos: 1 to 33, or the nucleic acid expression cassettes, or the vectors disclosed herein comprising said nucleic acid regulatory elements, for transfecting or transducing endothelial cells.
  • nucleic acid expression cassettes or the vectors disclosed herein comprising the nucleic acid regulatory elements according to SEQ ID Nos: 1 to 33, for expressing a transgene product in endothelial cells, wherein the nucleic acid expression cassette or the vector comprises said nucleic acid regulatory element disclosed herein operably linked to a promoter and a transgene.
  • a method for expressing a transgene product in endothelial cells comprising:
  • nucleic acid expression cassette or a vector disclosed herein wherein the nucleic acid expression cassette or the vector comprises a nucleic acid regulatory element according to any one of SEQ ID Nos: 1 to 33, operably linked to a promoter and a transgene;
  • Non-viral transfection or viral vector-mediated transduction of endothelial cells may be performed by in vitro, ex vivo or in vivo procedures.
  • the in vitro approach requires the in vitro transfection or transduction of endothelial cells, e.g. cells previously harvested from a subject, cell lines or cells differentiated from e.g. induced pluripotent stem cells or embryonic cells.
  • the ex vivo approach requires harvesting of the endothelial cells from a subject, in vitro transfection or transduction, and optionally re-introduction of the transfected cells into the subject.
  • the in vivo approach requires the administration of the nucleic acid expression cassette or the vector disclosed herein into a subject.
  • the transfection of the endothelial cells is performed in vitro or ex vivo.
  • nucleic acid regulatory elements e.g. coaxed differentiation of stem cells into endothelial cell precursors or endothelial cells, transgenic models for over-expression of proteins in endothelial cells or their precursors, etc.
  • the invention is further explained by the following non-limiting examples EXAMPLES
  • Example 1 Identification of endothelial cell-specific nucleic acid regulatory elements
  • LSEC Liver Sinusoid Endothelial cells
  • HCAEC Coronary Artery Endothelial cells
  • HMVEC Dermal Microvascular Endothelial cells
  • HUVEC Human Umblilical Vein Endothelial cells
  • lEn Iliac Artery Endothelial cells
  • RE Retinal Endothelial cells
  • HYAL2 ENSG00000068001 Candidate CREs were selected using the University of California Santa Cruz (UCSC) Genome Browser database based on i) high DNase hypersensitivity sites; ii) high content of epigenetic markers associated with open chromatin (acetylation, methylation); iii) high content of transcription factor binding sites; iv) strong evolutionary conservation.
  • the ideal CREs were expected to exhibit co-existence of predicted motifs together with DNase clusters, high conservation level in vertebrates, and explicit histone modification patterns. Therefore, 28 potential CRE sequences were selected based on those criteria ( Figure 1 and Table 2). Table 2 The EC-CREs sequence for highly expression in endothelial cells.
  • CDH5 EC-CRE1 a 76 G C C CTC AC AAAG G AAC AATAAC AG G AAAC C ATC C C A
  • CTGCAGCCAGCCCAGCCCTCACAAAGGAACAATAAC AGGAAACCATCCCAGGGGGAAGTGGGCCAGGGCCA GCTGGAAAACCTGAAGGGGAGGCAGCCAGGCCTCC CTCGCCAGCGGGGTGTGGCTCCTCCAAAGACGGT CGGCTGACAGGCTCCACAGAGCTCCACTCACGCTCA G C C CTG G AC G G AC AG G C AGTC C AAC G G AAC AG AAAC ATCCCTCAGCCCACAGGCACGGTGAGTG (SEQ ID NO: 2)
  • CDH5 EC-CRE1f 450 AGGTATCCACCAAGGGGCCCAAGAGCTGCTGAGCCC
  • ECSCR EC-CRE1 a 123 AGGGCCCCTGGAGCTGGTCCCAATGTGTTTCCTTCTA
  • HHIP EC-CRE1 a 136 AGCGGTGACGTCAAGGGGCGCGCTGTGGCAGCACC
  • HYAL2 EC-CRE1 a 170 AGGGAACTCCCTGTGCTGGGCCTACCCAGCTGACCC
  • HYAL2 EC-CREI b 470 GACAGGCTTCTGAGTGTAGGGAGCTGGTCTGCCAGT
  • HYAL2 EC-CRE1 C 602 CAGTGGAAAAAAACGGACTCAGCTACTGGAAGTCCC
  • ICAM2 EC-CRE1 a 265 CTTGCATAGATGGCCAGCGTTCATACTTTCTGCTTGT
  • CAGAGAGAAAGCATCTCTCCTCCGCAGAGACCCTCC CACGCTCTCCCTCAAATTAGTGCATCTACATAG ACCGCCCTCCTTATAAACAGTCTCTCAGGGGATCCTA GCCCATTCCAAATCTACCTGTGATTGCAGAATCGCAA GGAATGTGA I I I ACCGCAGATCGCGGGGCGTCGTGT CTTTTAGG G G ACCTG CTCACTTTG G CCACTAG GTG G CGGGCAGTGCAGCCCCTGCTCCTGTCGACCCTGAGC GTTCAGCG I I I I CCGCCGCCTCCGCCCCACTCCGTAG G GG G AG CTG ATG AGATG AG GTTGAGGTCCAG GAAG A CGTCAAGGGCTTGG I I I I I I I I CCGCCGCCTCCGCCCCACTCCGTAG G GG G AG CTG ATG AGATG AG GTTGAGGTCCAG GAAG A CGTCAAGGGCTTGG I I I I I I I I I I I CCGCCGCCTCCGCCCC
  • IFI27 EC-CRE1 a 450 AGACTTTTTTTGAAAAACGGAACATCTGCCTATCGCA
  • PECA EC-CRE1 a 217 ACCTCACTCAATG CATG G AAGTTG ACACAATGG CTCA M1 ACATTAGCGTTGGGCTGATTCATCA I I I GGCTGTTGA
  • the VISTA enhancer browser http://enhancer.lbl.gov
  • VISTA enhancer browser http://enhancer.lbl.gov
  • This also provided the predicted DNA elements associated with high expression in blood vessels.
  • the predicted sequences from VISTA were selected based on the validated data using mouse embryonic staining. Up to 3 VISTA sequences were selected from these validated data. However, since the DNA fragment sizes were too large to be accommodated into a viral vector, the selected sequences were further trimmed down or separated into sub-fragments using the UCSC genome browser using the aforementioned criteria. This resulted in 5 CREs derived from the 3 selected VISTA sequences (Table 3).
  • Hs217 EC-CRE- 390 TCCTACAGTTATGGGTCTGTCTTTCCTGCTAGAT 9 V3 CAGAAGCTCCAGGGACCTGTCTGTCTTATTAACC
  • Hs188 EC-CRE- 441 GGGGAGAGGGTGTGGGGTGGGGTGGGGAGAG 2 V5 GGTGTGGGGTGGGGTGGGGAGAGGGGATGGGA
  • Example 2 Lentiviral transduction of human endothelial cells in vitro
  • endothelial promoters that are commercially available (Invivogen, USA) such as the as ENG promoter (888 bp), FLT1 promoter (1 ,037 bp), and I CAM 2 promoter (399 bp).
  • the sequences of these promoters are provided in Table 4.
  • the endothelial-specific promoters were cloned into the lentiviral vector plasmid upstream of the FVIII or GFP reporter gene ( Figure 2).
  • Nine different lentiviral constructs were generated (designated as:
  • pLVX-EC-CRE-h(uman)ICAM2-Kozak-FVIII (SEQ ID NO:48), by conventional cloning.
  • pLVX can also be a pCDH backbone or another (lenti)viral backbone.
  • Table 4 Endothelial-specific promoter sequences
  • CDH5 Human 1303 GCTTGCCCAGCTATATAATAAAACAAGTTTGGGACTTCC Genecopo
  • AGCCCGTGGAGACTGCCAGTC (SEQ ID NO: 38)
  • the Kozak consensus sequence is present in eukaryotic mRNA and is known to improve expression by enhancing translation initiation. Consequently, we introduce the Kozak consensus sequence (i.e. GCCACC, SEQ ID NO:39) upstream of the FVIII or LUC2 gene within the lentiviral vector plasmids.
  • Culture medium was collected at 24, 48, and 72 hrs and FVIII levels were subsequently measured in the conditioned medium using a human FVII l-specific ELISA, according to the manufacturer's instructions (Asserachrome).
  • FVIII levels were subsequently measured in the conditioned medium using a human FVII l-specific ELISA, according to the manufacturer's instructions (Asserachrome).
  • flow cytometry the results showed that more than nearly 90 % of HUVEC and LSEC cells were transduced compared to non- transduced HUVECs (Figure 3).
  • Relatively robust FVIII expression could be achieved in transduced HUVECs and LSECs with CMV, ICAM2 and EDNI mini.
  • the Kozak translational consensus sequence significantly enhanced FVIII expression levels ( Figure 4).
  • the Kozak consensus optimized ICAM2 construct yielded the highest F
  • FIG. 8 shows 4 examples of such expression cassettes comprising HYAL2-EC-CRE1 a ( Figure 8a - SEQ ID NO.
  • HUVECs were seeded at 1.5x10 5 cells/well of 6-well plate transfected 24 hr later with cationic lipid-based Lipofectamine 3000 (Invitrogen, USA).
  • 2.5 microgram of each plasmid were mixed with 3.75 microliter of Lipofectamine reagents.
  • the P3000 reagent was mixed with each plasmid at 2 microliter per 1 microgram of plasmid and incubated at room temperature for 5 mins before adding to the HUVECs. Sixteen hours after transfection, the cell culture medium was removed and then replaced with fresh medium.
  • Example 4 In vivo validation of endothelial-specific (EC) CREs following lentiviral transduction in mice
  • Said expression cassettes comprise respectively the EC-CRE's HYAL2-EC-CRE1 a, HYAL2-EC-CRE1 b and IFI27-EC-CRE1 b.
  • the person skilled in the art would be capable of cloning the other EC-CRE's in a similar manner in an expression vector backbone.
  • the pCDH- ICAM2-FVIII backbone is used.
  • a lentiviral vector identical in design but without any upstream EC-CRE was used as control (SEQ ID NO. 49) to compare FVIII expression levels.
  • Lentiviral vector particles were manufactured by transient cotransfection of HEK293 packaging cells with lentiviral vector and helper plasmids (Cyagen, USA). Vector titer was determined and expressed in Transducing Units per ml (TU/ml). Lentiviral vectors were retro-orbital ly injected in 2 day-old neonatal CB17-SCID mice (Taconic). The vector preparation was supplemented with 40 microgram/ml polybrene in a total volume of 80 microliter. A total vector dose of 1X10 8 TU was used. Plasma was collected 5 weeks post- injection and FVIII was measured using a human FVIII-specific ELISA.
  • Example 5 Confirmation of increased gene expression by EC-CRE in organ-derived endothelial cells isolated from lentivirally transduced mice
  • mice were injected with the lentiviral vectors containing the ICAM2-FVIII (no CRE control - SEQ ID NO. 49) or IFI27-EC-CRE1 b-ICAM2-FVIII (SEQ ID NO. 52) expression cassette.
  • the liver and spleen were processed to obtain their respective endothelial populations (i.e. liver sinusoidal endothelial cells, splenic endothelial cells).
  • a single cell suspension was obtained from the liver and spleen tissue using the GentleMACS dissociator (Product no- 130-093-235, Miltenyi Biotec) according to the manufacturer's protocol (Liver Dissociation Kit: Product code: 130-105- 807; Miltenyi Biotec.
  • the single cell suspension from each organ was subjected to MACS cell separation technology (Miltenyi Biotec) to sort out the respective endothelial populations.
  • the single cell suspension obtained from liver and spleen were therefore tagged with CD146 microbeads, according to the manufacturer's instructions (Product code: 130-092- 007; Miltenyi Biotec. -http://www. miltenyibiotec. com/en/products-and-services/macs-cell- separation/cell-separation-reaqents/endothelial-cells/cd146-lsec-microbeads- mouse.aspx), allowing positive selection of the respective liver-derived and splenic endothelial cells.
  • CD146-positive endothelial cells were obtained from the liver and 6.9-8.1 x10 5 CD146-positive endothelial cells were obtained from the spleen.
  • the isolated cells were plated at a density of 25000 cells/well of 48 well plates in 200 microliterof Endothelial Basal Medium supplemented with growth factors.
  • GATAGGGCTGATTTCCAGGC-3' 5'- GATAGGGCTGATTTCCAGGC-3'
  • the expression levels were normalized to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNA expression, obtained by using the forward primer 5'- GAAGGTGAAGGTCGGAGTC-3' (SEQ ID NO. 55) and reverse primer 5'- GAAGATGGTGATGGGATTTC-3' (SEQ ID NO. 56).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Urology & Nephrology (AREA)
  • Oncology (AREA)
  • Diabetes (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Vascular Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
PCT/EP2016/082314 2015-12-22 2016-12-22 Endothelium-specific nucleic acid regulatory elements and methods and use thereof Ceased WO2017109039A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP16826729.2A EP3393523B9 (en) 2015-12-22 2016-12-22 Endothelium-specific nucleic acid regulatory elements and methods and use thereof
AU2016378480A AU2016378480A1 (en) 2015-12-22 2016-12-22 Endothelium-specific nucleic acid regulatory elements and methods and use thereof
CA3009264A CA3009264A1 (en) 2015-12-22 2016-12-22 Endothelium-specific nucleic acid regulatory elements and methods and use thereof
US16/065,629 US11446375B2 (en) 2015-12-22 2016-12-22 Endothelium-specific nucleic acid regulatory elements and methods and use thereof
JP2018533200A JP2018538003A (ja) 2015-12-22 2016-12-22 内皮特異的核酸調節エレメントならびにその方法および使用
US17/815,136 US12558416B2 (en) 2015-12-22 2022-07-26 Endothelium-specific nucleic acid regulatory elements and methods and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP2015081075 2015-12-22
EPPCT/EP2015/081075 2015-12-22

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/065,629 A-371-Of-International US11446375B2 (en) 2015-12-22 2016-12-22 Endothelium-specific nucleic acid regulatory elements and methods and use thereof
US17/815,136 Division US12558416B2 (en) 2015-12-22 2022-07-26 Endothelium-specific nucleic acid regulatory elements and methods and use thereof

Publications (1)

Publication Number Publication Date
WO2017109039A1 true WO2017109039A1 (en) 2017-06-29

Family

ID=57821918

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/082314 Ceased WO2017109039A1 (en) 2015-12-22 2016-12-22 Endothelium-specific nucleic acid regulatory elements and methods and use thereof

Country Status (6)

Country Link
US (2) US11446375B2 (OSRAM)
EP (1) EP3393523B9 (OSRAM)
JP (2) JP2018538003A (OSRAM)
AU (1) AU2016378480A1 (OSRAM)
CA (1) CA3009264A1 (OSRAM)
WO (1) WO2017109039A1 (OSRAM)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT201700086403A1 (it) * 2017-07-27 2019-01-27 Univ Del Piemonte Orientale Endothelial-specific promoter sequences and uses thereof
WO2020084161A1 (en) 2018-10-26 2020-04-30 Vrije Universiteit Brussel New tools for improving gene therapy and use thereof
CN114651005A (zh) * 2019-01-24 2022-06-21 艾克赛尔吉恩公司 生产和使用重组α1-抗胰蛋白酶(AAT)及其组合物的方法
US20220233714A1 (en) * 2021-01-27 2022-07-28 Vanderbilt University Nanogold-dna bioconjugates and methods of use thereof
CN117925624A (zh) * 2024-03-22 2024-04-26 上海凌医生物科技有限公司 一种金属响应调控元件
EP4368209A1 (en) 2022-11-09 2024-05-15 Vrije Universiteit Brussel Cardiac vascular endothelial cell-derived nucleic acid regulatory elements and methods and use thereof
US12016932B2 (en) 2019-02-15 2024-06-25 Crispr Therapeutics Ag Gene editing for hemophilia A with improved factor VIII expression

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113710284A (zh) * 2019-06-05 2021-11-26 克里斯珀医疗股份公司 具有改善的因子viii表达的血友病a基因编辑
CN111534541A (zh) * 2020-05-07 2020-08-14 西南大学 一种真核生物CRISPR-Cas9双gRNA载体及构建方法
JP7853952B2 (ja) * 2020-08-05 2026-04-30 スペースクラフト セブン リミテッド ライアビリティ カンパニー Glut1発現のためのアデノ随伴ウイルスベクターおよびその使用
CN114032239B (zh) * 2021-10-28 2024-06-21 北京美康基免生物科技有限公司 一种组织特异启动子及其应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5656454A (en) * 1994-10-04 1997-08-12 President And Fellows Of Harvard College Endothelial cell-specific enhancer
EP1264892A2 (en) * 2001-05-29 2002-12-11 Universita' Degli Studi di Torino Lentiviral vectors comprising endothelial cell specific promoters
US20050112110A1 (en) * 2000-11-17 2005-05-26 Dror Harats Promoters exhibiting endothelial cell specificity and methods of using same
US20110065100A1 (en) * 2009-09-16 2011-03-17 SwitchGear Genomics, Inc., a Delaware Corporation Transcription biomarkers of biological responses and methods
US20140017215A1 (en) * 2011-02-14 2014-01-16 David Ayares Genetically Modified Pigs for Xenotransplantation of Vascularized Xenografts and Derivatives Thereof

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2756570B1 (fr) * 1996-12-03 2002-09-27 Commissariat Energie Atomique Promoteur de la ve-cadherine et ses utilisations
JP2005204549A (ja) 2004-01-21 2005-08-04 Hubit Genomix Inc C型肝炎ウイルス感染者の経過に関する遺伝子およびその利用
US20070161031A1 (en) 2005-12-16 2007-07-12 The Board Of Trustees Of The Leland Stanford Junior University Functional arrays for high throughput characterization of gene expression regulatory elements
US20090018031A1 (en) * 2006-12-07 2009-01-15 Switchgear Genomics Transcriptional regulatory elements of biological pathways tools, and methods
CA2785677C (en) * 2009-12-29 2019-06-25 Cornell University Methods for developing endothelial cells from pluripotent cells and endothelial cells derived therefrom
JP2015109833A (ja) * 2013-11-08 2015-06-18 学校法人慶應義塾 線維芽細胞から血管内皮細胞を製造する方法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5656454A (en) * 1994-10-04 1997-08-12 President And Fellows Of Harvard College Endothelial cell-specific enhancer
US20050112110A1 (en) * 2000-11-17 2005-05-26 Dror Harats Promoters exhibiting endothelial cell specificity and methods of using same
EP1264892A2 (en) * 2001-05-29 2002-12-11 Universita' Degli Studi di Torino Lentiviral vectors comprising endothelial cell specific promoters
US20110065100A1 (en) * 2009-09-16 2011-03-17 SwitchGear Genomics, Inc., a Delaware Corporation Transcription biomarkers of biological responses and methods
US20140017215A1 (en) * 2011-02-14 2014-01-16 David Ayares Genetically Modified Pigs for Xenotransplantation of Vascularized Xenografts and Derivatives Thereof

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
.: "Molecular Biology of the Cell, 4th ed.", .
ABEL ET AL., BLOOD, vol. 122, no. 12, 19 September 2013 (2013-09-19), pages 2030 - 8
ALTSCHUL ET AL., J MOL BIOL, vol. 215, 1990, pages 403 - 10
ANLIKER ET AL., NAT METHODS., vol. 7, no. 11, November 2010 (2010-11-01), pages 929 - 35
AUSUBEL ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 1987
BHASIN ET AL., GENOMICS, vol. 11, 2010, pages 342
BHASIN ET AL.: "Bioinformatic identification and characterization of human endothelial cell-restricted genes", BMC GENOMICS, vol. 11, 342, 28 May 2010 (2010-05-28), pages 1 - 18, XP021072660 *
BUCHHOLZ ET AL., TRENDS BIOTECHNOL., vol. 33, no. 12, December 2015 (2015-12-01), pages 777 - 90
DAI CHRISTINE ET AL: "Identification of synthetic endothelial cell-specific promoters by use of a high-throughput screen", JOURNAL OF VIROLOGY, vol. 78, no. 12, 1 June 2004 (2004-06-01), THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, pages 6209 - 6221, XP002465449, ISSN: 0022-538X, DOI: 10.1128/JVI.78.12.6209-6221.2004 *
DATABASE GSS [online] 25 September 2003 (2003-09-25), KIRKNESS E F: "tigr-gss-dog-17000372777183 Dog Library Canis lupus familiaris genomic, genomic survey sequence", XP002767799, Database accession no. CE213087 *
DE LEEUW ET AL., J ELECTRON MICROSC TECH., vol. 14, no. 3, March 1990 (1990-03-01), pages 218 - 36
DELEVE ET AL.: "Liver sinusoidal endothelial cells and liver regeneration", J CLIN. INVEST., 2013
G MAVRIA, U JÄGER AND C D PORTER: "Generation of a high titre retroviral vector for endothelial cell-specific gene expression in vivo", GENE THERAPY, vol. 7, no. 5, 1 March 2000 (2000-03-01), pages 368 - 376, XP002767800, ISSN: 0968-7128 *
HEART INT., vol. 7, no. 2, 5 June 2012 (2012-06-05), pages E12
JAMES W. GODWIN ET AL: "Towards endothelial cell-specific transgene expression in pigs: characterization of the pig ICAM-2 promoter", XENOTRANSPLANTATION, vol. 13, no. 6, 1 November 2006 (2006-11-01), pages 514 - 521, XP055026916, ISSN: 0908-665X, DOI: 10.1111/j.1399-3089.2006.00341.x *
LEVITT ET AL., GENES DEV, vol. 3, 1989, pages 1019 - 1025
MODICH U ET AL: "INCREASING ENDOTHELIAL CELL SPECIFIC EXPRESSION BY THE USE OF HETEROLOGOUS HYPOXIC AND CYTOKINE-INDUCIBLE ENHANCERS", GENE THERAPY, vol. 7, no. 10, 1 May 2000 (2000-05-01), NATURE PUBLISHING GROUP, GB, pages 896 - 902, XP001027826, ISSN: 0969-7128, DOI: 10.1038/SJ.GT.3301177 *
MOL THER., vol. 18, no. 12, December 2010 (2010-12-01), pages 2121 - 9
MUNCH ET AL., MOL THER., vol. 19, no. 4, April 2011 (2011-04-01), pages 686 - 93
MUNCH ET AL., NAT COMMUN., vol. 6, 10 February 2015 (2015-02-10), pages 6246
NEUMANN ET AL., EUR J IMMUNOL., vol. 45, no. 7, July 2015 (2015-07-01), pages 2008 - 16
NICKLIN; BAKER, MOL THER, vol. 16, no. 12, December 2008 (2008-12-01), pages 1904 - 5
NICOL ET AL., FEBS LETT., vol. 583, no. 12, 18 June 2009 (2009-06-18), pages 2100 - 7
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed.", 1989
SHAHANI ET AL., BLOOD, vol. 115, no. 23, 10 June 2010 (2010-06-10), pages 4902 - 9
SHAHANI ET AL., J. THROMB. HEMOST, 2014
TATUSOVA; MADDEN, FEMS MICROBIOL LETT, vol. 174, 1999, pages 247 - 250
VANDENDRIESSCHE ET AL., J. THROMB HEMOSTASIS, 2007
VANDENDRIESSCHE; CHUAH, BLOOD, vol. 122, no. 12, 19 September 2013 (2013-09-19), pages 1993 - 4
WHITE ET AL., CIRCULATION, vol. 109, no. 4, 3 February 2004 (2004-02-03), pages 513 - 9
WHITE ET AL., J CARDIOTHORAC SURG., vol. 8, 9 August 2013 (2013-08-09), pages 183
WORK ET AL., GENET VACCINES THER., vol. 2, no. 1, 8 October 2004 (2004-10-08), pages 14
WORK ET AL., METHODS MOL MED., vol. 108, 2005, pages 395 - 413
WORK ET AL., MOL THER., vol. 13, no. 4, April 2006 (2006-04-01), pages 683 - 93

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT201700086403A1 (it) * 2017-07-27 2019-01-27 Univ Del Piemonte Orientale Endothelial-specific promoter sequences and uses thereof
WO2019021238A1 (en) * 2017-07-27 2019-01-31 Universita' Del Piemonte Orientale SPECIFIC PROMOTER SEQUENCES OF ENDOTHELIAL CELLS AND USES THEREOF
US20200165631A1 (en) * 2017-07-27 2020-05-28 Universita' Del Piemonte Orientale Endothelial-specific promoter sequences and uses thereof
US12460225B2 (en) 2017-07-27 2025-11-04 Universita' Del Piemonte Orientale Vector with an endothelial-specific promoter for treating factor V, VII, VIII, or IX deficiency
WO2020084161A1 (en) 2018-10-26 2020-04-30 Vrije Universiteit Brussel New tools for improving gene therapy and use thereof
CN114651005A (zh) * 2019-01-24 2022-06-21 艾克赛尔吉恩公司 生产和使用重组α1-抗胰蛋白酶(AAT)及其组合物的方法
US12016932B2 (en) 2019-02-15 2024-06-25 Crispr Therapeutics Ag Gene editing for hemophilia A with improved factor VIII expression
US20220233714A1 (en) * 2021-01-27 2022-07-28 Vanderbilt University Nanogold-dna bioconjugates and methods of use thereof
EP4368209A1 (en) 2022-11-09 2024-05-15 Vrije Universiteit Brussel Cardiac vascular endothelial cell-derived nucleic acid regulatory elements and methods and use thereof
CN117925624A (zh) * 2024-03-22 2024-04-26 上海凌医生物科技有限公司 一种金属响应调控元件
CN117925624B (zh) * 2024-03-22 2024-05-31 上海凌医生物科技有限公司 一种金属响应调控元件

Also Published As

Publication number Publication date
JP2021097701A (ja) 2021-07-01
US20230051499A1 (en) 2023-02-16
US20200237900A1 (en) 2020-07-30
AU2016378480A1 (en) 2018-07-12
EP3393523B9 (en) 2023-10-04
EP3393523B1 (en) 2023-06-07
JP7376018B2 (ja) 2023-11-08
JP2018538003A (ja) 2018-12-27
EP3393523A1 (en) 2018-10-31
US11446375B2 (en) 2022-09-20
CA3009264A1 (en) 2017-06-29
US12558416B2 (en) 2026-02-24

Similar Documents

Publication Publication Date Title
US12558416B2 (en) Endothelium-specific nucleic acid regulatory elements and methods and use thereof
JP7248760B2 (ja) 肝特異的核酸調節要素ならびにその方法および用途
JP7624691B2 (ja) 横隔膜特異的核酸調節エレメントならびにその方法および使用
EP4368209A1 (en) Cardiac vascular endothelial cell-derived nucleic acid regulatory elements and methods and use thereof
KR20240055835A (ko) 치료용 단백질의 발현을 위한 간 특이적 발현 카세트, 벡터 및 이들의 용도
JP2024502257A (ja) 心筋細胞由来核酸調節エレメント並びにその方法及び使用
HK40082999A (en) Liver-specific nucleic acid regulatory elements and methods and use thereof
HK40014510A (en) Liver-specific nucleic acid regulatory elements and methods and use thereof
HK40014510B (en) Liver-specific nucleic acid regulatory elements and methods and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16826729

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3009264

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2018533200

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016378480

Country of ref document: AU

Date of ref document: 20161222

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2016826729

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016826729

Country of ref document: EP

Effective date: 20180723