WO2017106189A1 - Compositions et procédés pour traiter le cancer du poumon à mutation dans ras/mapk - Google Patents

Compositions et procédés pour traiter le cancer du poumon à mutation dans ras/mapk Download PDF

Info

Publication number
WO2017106189A1
WO2017106189A1 PCT/US2016/066378 US2016066378W WO2017106189A1 WO 2017106189 A1 WO2017106189 A1 WO 2017106189A1 US 2016066378 W US2016066378 W US 2016066378W WO 2017106189 A1 WO2017106189 A1 WO 2017106189A1
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
braf
alk
polynucleotide
egfr
Prior art date
Application number
PCT/US2016/066378
Other languages
English (en)
Inventor
William C. Hahn
Elsa Beyer KRALL
Belinda WANG
Andrew Aguirre
Original Assignee
Dana-Farber Cancer Institute, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dana-Farber Cancer Institute, Inc. filed Critical Dana-Farber Cancer Institute, Inc.
Publication of WO2017106189A1 publication Critical patent/WO2017106189A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/415—1,2-Diazoles
    • A61K31/416—1,2-Diazoles condensed with carbocyclic ring systems, e.g. indazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • RTK receptor tyrosine kinase
  • MAPK mitogen-activated protein kinase pathway
  • EGFR inhibitors can elicit dramatic responses in EGFR-mutant lung cancer, but resistance inevitably occurs.
  • BRAF inhibitors have shown promising results in BRAF- mutant lung cancer in recent trials, resistance will likely occur, as is seen in BRAF-mutant melanoma.
  • ALK inhibitors can elicit dramatic responses in ALK-mutant lung cancer, but resistance often occurs. In addition to this acquired resistance, intrinsic resistance may explain why single-agent MEK inhibition has had limited success in lung cancer.
  • the present invention features compositions and methods for typing an ALK-, BRAF-, EGFR-, NRAS-, or KRAS- or mutant lung cancer in a subject as a cancer sensitive or resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, and related methods of treating such cancers.
  • the invention features a method of treating a selected subject having lung cancer, the method involving increasing KEAP1 level or activity or decreasing activity of a MAP kinase pathway in the subject, where the subject is selected by (i) detecting a mutation in a MAP kinase pathway protein and resistance to an inhibitor of MAP kinase pathway signaling and (ii) detecting decreased KEAP1 levels and/or increased activity of NRF2 in a biological sample of the subject relative to a reference sequence or level.
  • the invention features a method of treating a subject having lung cancer, the method involving characterizing the lung cancer by detecting in a biological sample of the subject (i) a mutation in a MAP kinase pathway protein and resistance to an inhibitor of MAP kinase pathway signaling and (ii) detecting decreased KEAP1 levels and/or increased activity of NRF2 in a biological sample of the subject relative to a reference sequence or level; and increasing KEAP1 levels or activity or decreasing activity of a MAP kinase pathway in the subject.
  • the activity of the MAP kinase pathway is decreased by administering to the subject an effective amount of a MAP kinase pathway inhibitor (e.g., an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor).
  • a MAP kinase pathway inhibitor e.g., an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the MEK inhibitor is trametinib, selumetinib, or MEK 162;
  • the BRAF inhibitor is vemurafenib or dabrafenib;
  • the EGFR inhibitor is erlotinib, afatinib, or cetuximab;
  • the ALK inhibitor is ASP-3026, alectinib, brigatinib, ceritinib, CEP-28122, CEP-37440, crizotinib, entrectinib, PF-06463922, TSR-011, X-376, or X-396.
  • the invention features a method of treating a subject having an
  • ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer the method involving detecting a wild-type KEAPl polynucleotide, or detecting wild-type copy number or wild- type level of NRF2 polynucleotide in a biological sample of the subject relative to a reference sequence or level; and administering to the subject an effective amount of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the invention features a method of treating a subject having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer, the method involving administering to a selected subject an effective amount of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, where the subject is selected by detecting a wild-type KEAPl polynucleotide, or detecting wild-type copy number or wild-type level of NRF2 polynucleotide in a biological sample of the subject relative to a reference sequence or level.
  • the invention features a method for typing lung cancer in a subject as sensitive or resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, the method involving detecting a level or sequence of KEAPl polynucleotide or a level or copy number of NRF2 polynucleotide in a biological sample obtained from a subject characterized as having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer relative to a reference level or sequence, where the cancer is typed as resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor if a decrease in the level of or a mutation in KEAPl polynucleotide or an increase in level or copy number of NRF2 polynucleotide is detected.
  • the invention features a method for determining whether a subject having lung cancer is eligible for entry into a clinical trial for treating lung cancer with an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, the method involving detecting a level or sequence of KEAPl or a level or copy number of NRF2 polynucleotide in a biological sample obtained from the subject characterized as having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer relative to a reference level or sequence, where failure to detect a mutation in KEAPl polynucleotide or failure to detect an increase in copy number or level of NRF2 polynucleotide indicates the subject is eligible for entry.
  • the subject is entered into the clinical trial.
  • the invention features a method of identifying a subject with lung cancer that would benefit from treatment with an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, the method involving detecting a level or sequence of KEAPl polynucleotide or a level or copy number of NRF2 polynucleotide in a biological sample obtained from a subject characterized as having an ALK-, BRAF-, EGFR-, NRAS-, or
  • KRAS-mutant relative to a reference level or sequence, where the subject is identified as a subject that would benefit from treatment with a an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor if a mutation in KEAPl polynucleotide or an increase in copy number or level of NRF2 polynucleotide is not detected.
  • the invention further includes the step of administering an effective amount of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor to the subject if a mutation in KEAPl polynucleotide or an increase in level or copy number of NRF2 polynucleotide is not detected.
  • the invention features a method of monitoring effectiveness of lung cancer treatment in a subject, the method involving administering to the subject an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor; and detecting a level or sequence of KEAPl or NRF2 polynucleotide in a biological sample obtained from the subject relative to a reference level or sequence, where detection of a mutation in the sequence of a KEAPl polynucleotide or an increase in copy number or level of NRF2 polynucleotide indicates the lung cancer is resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the invention features a method of increasing sensitivity of a subject having an ALK-, BRAF-, NRAS-, or KRAS-mutant lung cancer to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, the method involving administering to the subject an effective amount of a KEAPl polynucleotide or aNRF2 inhibitor and an effective amount of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, thereby increasing sensitivity of the subject to the inhibitor.
  • the invention features a method of treating a subject having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer, the method involving administering to a subject an effective amount of a KEAPl polynucleotide or aNRF2 inhibitor and an effective amount of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the invention features a therapeutic composition for increasing sensitivity of a subject having an ALK-, BRAF-, NRAS-, or KRAS-mutant lung cancer to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, the composition involving a KEAPl polynucleotide in a pharmaceutically acceptable carrier.
  • the composition contains a NRF2 inhibitor, an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the invention features a kit for typing lung cancer, the kit containing a capture reagent that specifically binds to a KEAPl polynucleotide and a capture reagent that specifically binds a polynucleotide that is any one or more of ALK, BRAF, EGFR, NRAS, and KRAS.
  • the invention features a kit for treating an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer, the kit containing a capture reagent that specifically binds to a KEAPl polynucleotide and an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the capture reagent specifically binds to a NRF2 polynucleotide.
  • the capture reagent is a primer or hybridization probe that specifically binds to a KEAPl polynucleotide.
  • the capture reagent is a primer or hybridization probe that specifically binds to a NRF2 polynucleotide. In one embodiment, the capture reagent detects a mutation in a KEAPl polynucleotide.
  • an effective amount of KEAPl polynucleotide, aNRF2 inhibitor and an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor is administered.
  • the MEK inhibitor is trametinib, selumetinib, or MEK 162.
  • the BRAF inhibitor is vemurafenib or dabrafenib.
  • the EGFR inhibitor is erlotinib, afatinib, or cetuximab.
  • the ALK inhibitor is ASP-3026, alectinib, brigatinib, ceritinib, CEP-28122, CEP-37440, crizotinib, entrectinib, PF-06463922, TSR-011, X-376, or X-396.
  • the NRF2 inhibitor is an inhibitory polynucleotide that reduces expression of NRF2, retinoic acid, 6-hydroxy-l-methylindole-3-acetonitrile (6-HMA), luteolin, bleomycin, brusatol, or AEM1.
  • the subject is identified as having a decrease in KEAPl polynucleotide, or a mutation in KEAPl polynucleotide in a biological sample of the subject relative to a reference sequence or level.
  • the subject is identified as having an increase in copy number or level of NRF2 polynucleotide in a biological sample of the subject relative to a reference sequence or level.
  • the mutation in KEAPl polynucleotide is a loss-of-function mutation.
  • the mutation in KEAPl polynucleotide or the increase in copy number of level NRF2 polynucleotide does not re-activate a MAPK pathway.
  • the biological sample is blood.
  • the subject is human.
  • agent any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
  • ameliorate decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.
  • alteration is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein.
  • an alteration includes a 10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels.
  • Amplification refers to any means by which a polynucleotide sequence is copied and thus expanded into a larger number of polynucleotide sequences.
  • Amplification of a gene refers to any means by which copy number of the gene in a genome of an organism is increased, e.g., by gene duplication.
  • amplification of NRF2 or “amplification of a NRF2 polynucleotide” refers to an increase in copy number of polynucleotide sequences encoding a NRF2 polypeptide in a genome of an organism.
  • an analog is meant a molecule that is not identical, but has analogous functional or structural features.
  • a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding.
  • An analog may include an unnatural amino acid.
  • MAP Kinase Pathway is meant a conserved signal transduction pathway in which activated Ras induces a kinase cascade that activates MAP kinase. Proteins within the MAP kinase pathway include, for example, ALK, RAF, EGFR, RAS, and MEK.
  • the MAP Kinase Pathway is described, for example, by Lodish et al, Molecular Cell Biology, 4 edition, New York; W.HI. Freeman, 2000, at section 20.5 Map Kinase Pathways, which is incorporated herin by reference.
  • MAPK Pathway Inhibitor any agent that inhibits the activity of the Map kinase pathway.
  • exemplary MAPK pathway inhibitors include ALK inhibitors, MEK inhibitors, BRAF inhibitors, or EGFR inhibitors, as specified herein.
  • ALK inhibitor an agent that reduces or eliminate a biological function or activity of an ALK polypeptide (e.g., anaplastic lymphoma kinase).
  • ALK polypeptide e.g., anaplastic lymphoma kinase
  • Exemplary biological activities or functions of an ALK polypeptide include receptor tyrosine protein kinase activity.
  • Examples of an ALK inhibitor include, without limitation ASP-3026, alectinib (ALECENSA), brigatinib (AP26113), ceritinib (ZYKADIA), CEP-28122, CEP-37440, crizotinib (XALKORI), entrectinib (e.g., NMS-E628, RXDX-101), PF-06463922, TSR-011, X-376 and X-396.
  • ASP-3026 alectinib
  • AP26113 brigatinib
  • ZYKADIA ceritinib
  • CEP-28122 CEP-37440
  • crizotinib XALKORI
  • entrectinib e.g., NMS-E628, RXDX-101
  • PF-06463922 e.g., TSR-011, X-376 and X-396.
  • ALK anaplastic lymphoma kinase polypeptide
  • an “ALK-mutant lung cancer” is meant a lung cancer characterized by or associated with a mutation in an ALK polynucleotide or polypeptide.
  • the ALK mutation results in an alteration in receptor tyrosine kinase activity in a cell.
  • BRAF inhibitor an agent that reduces or eliminates a biological function or activity of a BRAF polypeptide (e.g., B-Raf proto-oncogene).
  • BRAF polypeptide e.g., B-Raf proto-oncogene
  • Exemplary biological activities or functions of a BRAF polypeptide include serine/threonine protein kinase activity and regulation of MAP kinase/ERKs (extracellular signal-regulated kinases) signaling pathways.
  • BRAF inhibitor include, without limitation, vemurafenib and dabrafenib. In particular embodiments, the BRAF inhibitor is vemurafenib.
  • BRAF polypeptide is meant a polypeptide or fragment thereof having at least about 85% amino acid identity to NCBI Accession No. NP_004324.2 and having serine/threonine protein kinase activity. The sequence at NCBI Accession No.
  • NP_004324.2 is shown below:
  • BRAF polynucleotide is meant a polynucleotide encoding a BRAF
  • BRAF polypeptide An exemplary BRAF polynucleotide sequence is provided at NCBI Accession No. NM_004333.4. The sequence is provided below:
  • BRAF-mutant lung cancer a lung cancer characterized by or associated with a mutation in a BRAF polynucleotide or polypeptide.
  • the BRAF mutation results in an alteration in a tyrosine kinase (RTK)/ mitogen-activated protein kinase (MAPK) pathway in a cell.
  • RTK tyrosine kinase
  • MAPK mitogen-activated protein kinase
  • Detect refers to identifying the presence, absence or amount of the analyte to be detected.
  • detectable label is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
  • useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens.
  • disease is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.
  • diseases include lung cancer, such as an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer.
  • EGFR inhibitor an agent that reduces or eliminates a biological function or activity of an EGFR polypeptide (e.g., epidermal growth factor receptor).
  • Exemplary biological activities or functions of an EGFR polypeptide include ligand binding activity, tyrosine autophosphorylation, and regulation or activation of various downstream signaling cascades, such as the RAS-RAF-MEK-ERK and PI3 kinase- AKT modules.
  • Examples of an EGFR inhibitor include, without limitation, erlotinib, afatinib, and cetuximab.
  • EGFR Extra Growth Factor Receptor polypeptide
  • EGFR Extra Growth Factor Receptor
  • exemplary biological activities or functions of a EGFR polypeptide include ligand binding activity, tyrosine
  • EGFR polynucleotide is meant a polynucleotide encoding an EGFR polypeptide.
  • An exemplary EGFR polynucleotide sequence is provided at NCBI Accession No.
  • fragment is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide.
  • a fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.
  • Hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.
  • inhibitory nucleic acid or “inhibitory polynucleotide” is meant a double-stranded RNA, siRNA, shRNA, or antisense RNA, or a portion thereof, or a mimetic thereof, that when administered to a mammalian cell results in a decrease (e.g., by 10%, 25%, 50%, 75%, or even 90-100%) in the expression of a target gene.
  • a nucleic acid inhibitor comprises at least a portion of a target nucleic acid molecule, or an ortholog thereof, or comprises at least a portion of the complementary strand of a target nucleic acid molecule.
  • an inhibitory nucleic acid molecule comprises at least a portion of any or all of the nucleic acids delineated herein.
  • isolated denotes a degree of separation from original source or surroundings.
  • Purify denotes a degree of separation that is higher than isolation.
  • a “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences.
  • nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high performance liquid chromatography. The term "purified" can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
  • isolated polynucleotide is meant a nucleic acid (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene.
  • the term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences.
  • the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.
  • an “isolated polypeptide” is meant a polypeptide of the invention that has been separated from components that naturally accompany it.
  • the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
  • the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention.
  • An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.
  • KEAPl polypeptide is meant a polypeptide or fragment thereof having at least about 85% amino acid identity to NCBI Accession No. NP_987096.1 and having a biological activity or function of a KEAPl polypeptide.
  • Biological activities or functions of KEAPl include, without limitation, targeting NRF2/NFE2L2 for ubiquitination and proteasomal degradation.
  • the sequence at NCBI Accession No. NP_987096.1 is shown below:
  • KEAPl polynucleotide is meant a polynucleotide encoding a KEAPl polypeptide.
  • An exemplary KEAPl polynucleotide sequence is provided at NCBI
  • KRAS polypeptide is meant a polypeptide or fragment thereof having at least about 85% amino acid identity to NCBI Accession No. NP_203524.1 or NP_004976.2 (different isoforms) and having GTPase activity.
  • NCBI Accession No. NP_203524.1 The sequence at NCBI Accession No. NP_203524.1 is shown below:
  • KRAS polynucleotide is meant a polynucleotide encoding a KRAS
  • NRAS polypeptide An exemplary NRAS polynucleotide sequence is provided at NCBI Accession No. NM_033360.3. The sequence is provided below:
  • gaggattcct acaggaagca agtagtaatt gatggagaaa cctgtctctt ggatattctc
  • KRAS-mutant lung cancer a lung cancer characterized by or associated with a mutation in a KRAS polynucleotide or polypeptide.
  • the KRAS mutation results in an alteration in a tyrosine kinase (RTK)/ mitogen-activated protein kinase (MAPK) pathway in cells.
  • RTK tyrosine kinase
  • MAPK mitogen-activated protein kinase
  • marker any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder.
  • MEK inhibitor an agent that reduces or eliminate a biological function or activity of a MEK polypeptide.
  • MEK polypeptides include a MEKl (Mitogen- Activated Protein Kinase Kinase 1) polypeptide and a MEK2 (Mitogen- Activated Protein Kinase Kinase 2).
  • MEKl Mitogen- Activated Protein Kinase Kinase 1
  • MEK2 Mitogen- Activated Protein Kinase Kinase 2
  • Exemplary biological activities of MEKl and MEK2 include
  • MEK polypeptides are involved in many cellular processes such as proliferation, differentiation, transcription regulation, and development.
  • Examples of a MEK inhibitor include, without limitation, trametinib, selumetinib, and MEKl 62. In particular embodiments, the MEK inhibitor is trametinib.
  • mutation is meant a change in a polypeptide or polynucleotide sequence relative to a wild-type reference sequence.
  • exemplary mutations include point mutations, missense mutations, amino acid substitutions, and frameshift mutations.
  • a mutation in KEAPl is a loss-of-function mutation, which confers resistance to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, in ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer.
  • a “loss-of-function mutation” is a mutation that decreases or abolishes an activity or function of a polypeptide.
  • a “gain-of-function mutation” is a mutation that enhances or increases an activity or function of a polypeptide.
  • NRAS polypeptide is meant a polypeptide or fragment thereof having at least about 85% amino acid identity to NCBI Accession No. NP_002515.1 and having GTPase activity.
  • the sequence at NCBI Accession No. NP_002515.1 is shown below: 1 mteyklvvvg aggvgksalt iqliqnhfvd eydptiedsy rkqvvidget clldildtag 61 qeeysamrdq ymrtgegflc vfainnsksf adinlyreqi krvkdsddvp mvlvgnkcdl 121 ptrtvdtkqa helaksygip fietsaktrq gvedafytlv reirqyrmkk lnssddgtqg 181 cmglpcvvm
  • NRAS polynucleotide is meant a polynucleotide encoding a NRAS
  • NRAS polypeptide An exemplary NRAS polynucleotide sequence is provided at NCBI Accession No. NM_002524.4. The sequence is provided below:
  • NRAS-mutant lung cancer a lung cancer characterized by or associated with a mutation in a NRAS polynucleotide or polypeptide.
  • the NRAS mutation results in an alteration in a tyrosine kinase (RTK)/ mitogen-activated protein kinase (MAPK) pathway in cells.
  • RTK tyrosine kinase
  • MAPK mitogen-activated protein kinase
  • NRF2 inhibitor is meant an agent that reduces or eliminate a biological function or activity of a NRF2 polypeptide. Exemplary biological activities or functions of NRF2 include transcription factor activity.
  • the NRF2 inhibitor is an inhibitory polynucleotide that reduces expression of NRF2.
  • the NRF2 inhibitor is a small molecule that reduces expression or activity of NRF2.
  • exemplary NRF2 inhibitors include, without limitation, retinoic acid, 6-hydroxy-l-methylindole-3- acetonitrile (6-HMA), luteolin, bleomycin, and brusatol.
  • Another exemplary NRF2 inhibitor is AEM1, described in Bollong, M. J., Yun, H., Sherwood, L., Woods, A. K., Lairson, L. L. et al. A Small Molecule Inhibits Deregulated NRF2 Transcriptional Activity in Cancer. ACS chemical biology 10, 2193-2198, doi: 10.1021/acschembio.5b00448 (2015).
  • NFE2 polypeptide or “NFE2L2 polypeptide” is meant a polypeptide or fragment thereof having at least about 85% amino acid identity to NCBI Accession No. NP_006155.2, NP_001138884.1 , NP_001 138885.1, NP_001300831.1, NP_001300832.1 , or
  • NP_001300833.1 different isoforms and having transcription factor activity.
  • NFE2L2 The sequence at NCBI Accession No.
  • NP_006155.2 is shown below:
  • NRF2 polynucleotide or “NFE2L2 poynucleotide” is meant a polynucleotide encoding a NRF2 polypeptide.
  • An exemplary NRF2 polynucleotide sequence is provided at NCBI Accession No. NM_006164.4. The sequence is provided below:
  • obtaining as in “obtaining an agent” includes synthesizing, purchasing, or otherwise acquiring the agent.
  • reference is meant a standard or control condition.
  • a “reference sequence” is a defined sequence used as a basis for sequence comparison.
  • a reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
  • the length of the reference polypeptide sequence will generally be at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, and even more preferably about 35 amino acids, about 50 amino acids, or about 100 amino acids.
  • the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 nucleotides or any integer thereabout or therebetween.
  • resistance to an inhibitor or “resistance to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor” is meant that a cell or subject having a disease has acquired an alteration that allows it to escape an anti-disease effect of the inhibitor (e.g., ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor).
  • a cell resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor may be a neoplastic cell (e.g., a lung cancer cell having a mutation in ALK, BRAF, EGFR, KRAS, or NRAS) that has acquired an alteration that allows it to escape an anti-neoplastic effect of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • exemplary anti-neoplastic effects include, but are not limited to, any effect that reduces proliferation, reduces survival, and/or increases cell death (e.g., increases apoptosis).
  • sensitivity to an inhibitor e.g. “sensitivity to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor”
  • sensitivity to an ALK inhibitor e.g. “sensitivity to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor”
  • at least one symptom of a disease or condition e.g., ALK-, BRAF-, EGFR-, KRAS-, or NRAS-mutant lung cancer
  • the inhibitor e.g., ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor
  • sample or “biological sample” as used herein means a biological material isolated from a subject, including any tissue, cell, fluid, or other material obtained or derived from the subject (e.g., a human).
  • the biological sample may contain any biological material suitable for detecting the desired analytes, and may comprise cellular and/or non-cellular material obtained from the subject.
  • siRNA is meant a double stranded RNA.
  • a siRNA is 18, 19, 20, 21,
  • dsRNAs can be introduced to an individual cell or to a whole animal; for example, they may be introduced systemically via the bloodstream.
  • siRNAs are used to downregulate mRNA levels or promoter activity.
  • telomere binding By “specifically binds” is meant a compound or antibody that recognizes and binds a polypeptide of the invention, but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample, which naturally includes a polypeptide of the invention.
  • Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity.
  • Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule.
  • hybridize is meant pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency.
  • complementary polynucleotide sequences e.g., a gene described herein
  • stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate.
  • Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide.
  • Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, more preferably of at least about 37° C, and most preferably of at least about 42° C.
  • Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those of ordinary skill in the art.
  • Various levels of stringency are accomplished by combining these various conditions as needed.
  • hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS.
  • hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 ⁇ g/ml denatured salmon sperm DNA (ssDNA).
  • hybridization will occur at 42° C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 ⁇ g/ml ssDNA. Useful variations on these conditions will be readily apparent to those of ordinary skill in the art.
  • wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature.
  • stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate.
  • Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C.
  • wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42 C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS.
  • Hybridization techniques are well known to those of ordinary skill and are described, for example, in Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
  • substantially identical is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein).
  • a reference amino acid sequence for example, any one of the amino acid sequences described herein
  • nucleic acid sequence for example, any one of the nucleic acid sequences described herein.
  • such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
  • Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine;
  • BLAST program may be used, with a probability score between e "3 and e "100 indicating a closely related sequence.
  • subject is meant a mammal, including, but not limited to, a human or non-human mammal, such as a bovine, equine, canine, ovine, or feline.
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.
  • treat refers to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.
  • the term "about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.
  • compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
  • FIGS. 1A-1F provides a set of graphs and schematics showing CRISPR-Cas9 genome-scale drug resistance screens and validation that KEAP1 K0 confers resistance.
  • FIG. 1 A shows a pathway schematic and screening timeline.
  • FIG. IB provides a graph showing enrichment of the top 4 KEAP1 single guide (sg)RNAs compared to all sgRNAs in the library. Error bars represent the standard deviation of the mean.
  • FIGS. 1C-1F provide graphs showing quantification of Crystal violet colony formation assays. Cells were seeded in 24- well plates. In FIG. 1C, 5000 CALU1 cells were treated with 50 nM trametinib for 17 days.
  • 2000 HCC364 cells were treated with 25 nM trametinib or 6.25 uM vemurafenib for 21 days.
  • 5000 HCC827 cells were treated with 100 nM erlotinib for 10 days.
  • 1000 H1975 cells were treated with 100 nM afatinib for 10 days.
  • 1000 H3122 cells were treated with 300 nm Crizotinib for 14 days. Error bars represent the standard deviation of the mean of triplicate wells.
  • FIG. IE shows expression of wildtype KEAP1 resensitized A549 cells to trametinib.
  • FIG. IF provides a graph showing that KEAP1 K0 confers resistance to ALK inhibition in ALK- mutant lung cancer.
  • FIGS. 2A-2C provide a sereis of graphs and images showing data indicating
  • FIG. 2A provides a graph showing whole cell ly sates of HCC364-Cas9 cells with the indicated sgRNAs treated with DMSO or trametinib for 48 hours.
  • FIG. 2B a series of images showing immuno blots of nuclear and cytoplasmic fractions of HCC364 cells.
  • FIG. 2C provides a series of graphs showing Crystal violet colony formation assays. 10,000 CALUl cells expressing the indicated ORFs were seeded in 24-well plates and treated with DMSO for 8 days or trametinib for 10 Days. 10,000 HCC364 cells expressing the indicated ORFs were seeded in 12-well plates and treated with DMSO for 10 days or
  • FIGS. 3A-3B provide a series of graphs and images showing trametinib treatment and KEAP1 K0 increase NRF2 activity.
  • FIG. 3A provides a graph showing the expression of
  • FIG. 3B provides a graph showing HCC364 cells treated with DMSO or trametinib for 72 hours. "TRAM” refers to trametinib.
  • FIGS. 4A-4E provide a series of graphs showing KEAP1 K0 reduces trametinib- induced ROS and alters expression of metabolic genes.
  • FIG. 4A provides a graph showing HCC364 or CALUl cells treated with DMSO or trametinib for 72 hr. ROS was measured by DCFDA fluorescence. Error bars represent the standard deviation of the mean of two replicates.
  • FIG. 4B provides a graph showing CALUl cells treated with DMSO or 50 nM trametinib and the indicated concentration of NAC for 16 days. Population doublings of trametinib-treated cells compared to DMSO-treated cells are shown. Error bars represent the standard deviation of the mean of two replicates. In FIG.
  • FIG. 4C 20,000 CALUl cells were seeded in 24-well plates and treated with DMSO and BSO for 7 days or 10 nM trametinib and BSO for 12 days. Error bars represent the standard deviation of the mean of triplicate wells.
  • FIG. 4D and FIG. 4E provide a series of graphs showing expression of NRF2 metabolic target genes in CALUl treated with DMSO or trametinib for 72 hours. Error bars represent the standard deviation of the mean of three biological replicates.
  • FIG. 5 provides a series of graphs and images showing optimization of screening conditions.
  • Cells were treated with the indicated concentration of drug.
  • Cells were passaged or fresh media containing drug was added every 3-4 days. Cells were counted at each passage, and the number of population doublings is shown.
  • cells were treated with the indicated concentrations of drug for 90 min.
  • Cell lysates were blotted with p-ERK antibody as a marker of BRAF/MEK inhibition.
  • HCC364 cells were treated with 24 nM trametinib or 6.25 ⁇ vemurafenib, H1299 cells were treated with 1.5 ⁇ trametinib, and CALUl cells were treated with 50 nM trametinib.
  • FIGS. 6A-6E provide a series of graphs immunoblots showing confirmation of KEAP1 knockout, KEAP1 overexpression, and NRF2 overexpression.
  • FIG. 6A provides an immunoblot showing deletion of KEAP1 by sgRNAs in HCC364.
  • FIG. 6B provides an immunoblot showing deletion of KEAP1 and increase in NRF2 in CALUl .
  • FIG. 6C provides an immunoblot showing deletion of KEAP1 by sgRNAs in HCC827 and HI 975.
  • FIG. 6D is an immunoblot showing KEAP1 expression in A549 cells.
  • FIG. 6E provides an immunoblot showing NRF2 expression in CALUl and HCC364.
  • FIG. 7 provides a series of graphs showing KEAP1 K0 also confers resistance to some chemotherapeutics.
  • 5,000 CALUl cells were seeded in 24-well plates and treated with DMSO, 5-FU, or cisplatin for 12 days and etoposide, paclitaxel or trametinib for 18 days. Error bars represent the standard deviation of triplicate wells.
  • FIGS. 8A-8C provide graphs showing that Trametinib treatment increases NRF2 activity in CALUl cells, which is further increased by KEAP1 K0 .
  • FIG. 8A provides a graph showing the expression of NFE2L2/NRF2 mRNA.
  • FIG. 8B provides a graph showing the expression of NRF2 target genes in CALUl cells treated with DMSO or trametinib for 72 hours. Error bars represent the standard deviation of biological triplicates.
  • FIG. 8C provides a graph showing CALUl cells treated with DMSO or trametinib for 72 hours. "D” is DMSO; "T” is Trametinib.
  • FIGS. 9A-9H provide graphs showing KEAP1 K0 reduces ROS and increases viability in the presence of BSO.
  • FIG. 9A provides a graph showing trametinib does not affect GSH/GSSG ratio.
  • CALUl cells were treated for 72 hr. Error bars represent standard deviation of three replicates.
  • FIG. 9B provides a graph showing NADPH and NADP+ levels in CALUl treated with DMSO or trametinib for 72 hours. Error bars represent the standard deviation of the mean of six wells.
  • FIG. 9C provides a graph showing showing NRF2 overexpression reduces trametinib-induced ROS.
  • CALUl cells were treated for 72 hr. Error bars represent the standard deviation of two replicates.
  • FIG 9D provides a graph showing N- acetyl cysteine (NAC) treatment reduces ROS in CALUl cells.
  • CALUl cells were treated for 16 days. Error bars represent standard deviation of two replicates.
  • FIG. 9E provides a graph showing trametinib and BSO induce ROS in KEAPl-intact cells. KEAP1 K0 reduces ROS. CALUl cells were treated for 72 hr.
  • FIGS. 9F- 9G show KEAP1 K0 reduces trametinib- and BSO-induced ROS and increases cell viability.
  • FIG. 9F provides a graph showing cells were treated for 72 hr. Error bars represent the standard deviation of two replicates.
  • FIG. 9G provides a graph showing cells were treated with DMSO plus BSO for 6 days or trametinib plus BSO for 10 days. Error bars represent the standard deviation of triplicate wells.
  • FIG. 9H provides a graph showing expression of WT KEAP1 but not G333C in KEAPl-null A549 cells increases trametinib- and BSO-induced ROS. Cells were treated for 72 hr. Error bars represent the standard deviation of two replicates.
  • FIGS. 10A-10B provides a series of graphs showing KEAP1 K0 alters cell metabolism in HCC364 cells and the expression of NRF2 metabolic target genes in HCC364 treated with DMSO or trametinib for 72 hours. Error bars represent the standard deviation of the mean of three biological replicates.
  • FIG 11. provides a schematic showng a model of how KEAP1 loss confers resistance.
  • the schematic on the left shows trametinib treatment inhibits MAPK signaling and induces ROS, which activates NRF2 to low levels.
  • Theschematic on the right shows loss of KEAP1 leads to increased NRF2 activity, which reduces ROS levels and alters cellular metabolism, allowing cells to proliferate in the absence of MAPK signaling.
  • the invention features compositions and methods that are useful for identifying a subject with an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer that would benefit from treatment with an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, or other RTK inhibitor (such as a MET inhibitor).
  • the methods comprise measuring a level, copy number, or sequence of KEAPl and/or NRF2 polynucleotide in a biological sample obtained from the subject relative to a reference level or sequence.
  • the invention is based, at least in part, on the discovery that loss of KEAPl, which targets NFE2L2/NRF2 for ubiquitination and proteasomal degradation, conferred resistance to ALK, MEK, BRAF, and EGFR inhibition in ALK-, BRAF-, EGFR-, NRAS-, and KRAS- mutant lung cancer.
  • RTK receptor tyrosine kinase
  • MAPK mitogen-activated protein kinase pathway
  • Genome-scale gain-of-function and loss-of-function screens have previously been used to identify mechanisms of resistance to targeted therapeutics (Johannessen et al. (2013), Nature, 504(7478), 138-42; Whittaker et al. (2013), Cancer Discov, 3(3), 350-62; Berns et al. (2007), Cancer Cell, 12(4), 395-402), and CRISPR-Cas9 knockout screens have also recently been used to identify mechanisms of resistance (Shalem et al. (2014), Science, 343(6166), 84-7; Wang et al. (2014), Science, 343(6166), 80-4). Each of these studies has focused on therapeutics targeting a single alteration.
  • genome-scale CRISPR drug resistance screens in multiple lung cancer cell lines with different alterations in the Ras/MAPK pathway to identify novel genes whose deletion promotes resistance to two targeted therapeutics in different genetic contexts were performed.
  • Four genome-scale CRISPR-Cas9 screens to identify mechanisms of resistance to inhibition of MEK or BRAF in lung cancer NCIH1299 (NRAS Q61K ) and CALU1 (KRAS G12C ) cells treated with the MEK inhibitor trametinib, and HCC364 (BRAF V600E ) cells treated with trametinib or with the BRAF inhibitor vemurafenib were performed.
  • NCIH1299 NRAS Q61K
  • CALU1 KRAS G12C
  • BRAF V600E HCC364
  • KEAPl loss confers resistance to inhibition of ALK, BRAF, MEK, or EGFR in lung cancer cell lines with ALK, BRAF, KRAS, NRAS, or EGFR mutations. Importantly, unlike previously reported mechanisms of resistance, the mechanism described here does not involve reactivation of the MAPK pathway. KEAPl loss or NRF2
  • NRF2 has recently been found to be a transforming oncogene. The results herein indicate that increased expression of NRF2 upon KEAPl loss can confer resistance to MAPK pathway inhibition by reducing ROS and altering cell metabolism.
  • KEAP1/NRF2 pathway is genetically altered in approximately 30% of lung squamous cell carcinomas and approximately 20% of lung adenocarcinomas (Cerami, et al, Cancer discovery 2, 401-404, (2012); Gao et al., Science signaling 6, pll, (2013)). Loss of KEAPl or gain of NRF2 may therefore be a clinically relevant mechanism of acquired and intrinsic resistance to RTK/Ras/MAPK-targeted therapies in lung cancer.
  • Stratifying patients for treatment based on these findings is important for evaluating the efficacy of these inhibitors in clinical trials.
  • loss of KEAP1 may be a clinically relevant mechanism of acquired and intrinsic resistance to trametinib, vemurafenib, erlotinib, and afatinib in lung cancer.
  • Stratifying patients for treatment based on these findings will be important for evaluating the efficacy of ALK, MEK, EGFR, and BRAF inhibitors in clinical trials.
  • the invention provides a method of identifying a subject with an ALK-, BRAF-, EGFR-, NRAS-, or KRAS- mutant lung cancer that would benefit from treatment with an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, or other RTK inhibitor (such as a MET inhibitor).
  • ALK inhibitor MEK inhibitor
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a BRAF inhibitor
  • ERK inhibitor e.g., a BRAF inhibitor
  • EGFR inhibitor e.g., a MET inhibitor
  • RTK inhibitor such as a MET inhibitor
  • the invention provides a method for determining whether a subject is eligible for entry into a clinical trial for treating a lung cancer with an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, or other RTK inhibitor (such as a MET inhibitor), as well as methods for monitoring effectiveness of treatment of an ALK-, BRAF-, NRAS-, EGFR-, or KRAS-mutant lung cancer in a subject with a MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, ALK inhibitor, or other RTK inhibitor (such as a MET inhibitor).
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a BRAF inhibitor
  • EGFR inhibitor e.g., a MET inhibitor
  • the methods comprise measuring a level or sequence of KEAPl and/or NRF2 polynucleotide in a biological sample obtained from the subject relative to a reference level or sequence.
  • detection of a mutation in the sequence of KEAPl polynucleotide or an increase in copy number or level of NRF2 polynucleotide indicates the lung cancer is resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • failure to detect a mutation in the sequence of KEAPl polynucleotide or failure to detect an increase in the copy number or level of NRF2 polynucleotide indicates the lung cancer is sensitive to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • Targeting the KEAP1/NRF2 axis may also be a promising therapeutic strategy.
  • findings described herein suggest that combination of a Ras/Raf/RTK inhibitor and a NRF2/KEAPl therapeutic would benefit patients with alterations in the NRF2/KEAP1 pathway.
  • the invention provides a method of treating a subject having an ALK-, BRAF-, EGFR-, NRAS-, KRAS-mutant lung cancer, the method comprising administering to a selected subject an effective amount of a KEAPl polynucleotide and an effective amount of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, wherein the subject is selected by detecting a decrease in KEAPl polynucleotide, a mutation in KEAPl polynucleotide, or an increase in NRF2 polynucleotide in a biological sample of the subject relative to a reference sequence or level.
  • Methods of treatment comprising administering to a selected subject an effective amount of a KEAPl polynucleotide and an effective amount of an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, wherein the subject is selected by detecting a decrease in KEAPl polynucleotide, a mutation in KEAPl poly
  • the present invention provides methods of treating a lung cancer (in particular, an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer) and/or disorders or symptoms thereof which comprise administering a therapeutically effective amount of a pharmaceutical composition comprising a therapeutic agent (e.g., an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor), a KEAPl polynucleotide, or a NRF2 inhibitor, or any combination thereof) to a subject (e.g., a mammal such as a human).
  • a therapeutic agent e.g., an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor), a KEAPl polynucleotide, or a N
  • one embodiment is a method of treating a subject suffering from or susceptible to an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer or disorder or symptom thereof.
  • the method includes the step of administering to the mammal a therapeutic amount of an amount of a therapeutic agent described herein sufficient to treat the ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer or symptom thereof, under conditions such that the lung cancer is treated.
  • the methods herein include administering to the subject (including a subject identified as in need of such treatment) an effective amount of a therapeutic agent described herein (e.g., an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor), a KEAPl polynucleotide, or a NRF2 inhibitor, or any combination thereof), or a composition described herein to produce such effect.
  • a therapeutic agent described herein e.g., an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor), a KEAPl polynucleotide, or a NRF2 inhibitor, or any combination thereof
  • a therapeutic agent described herein e.g., an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a B
  • treat refers to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.
  • the terms "prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.
  • the therapeutic methods of the invention in general comprise administration of a therapeutically effective amount of the therapeutic agents herein, such as an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., a MET or EGFR inhibitor), a KEAPl polynucleotide, or a NRF2 inhibitor, or any combination thereof, to a subject (e.g., animal, human) in need thereof, including a mammal, particularly a human.
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a BRAF inhibitor
  • ERK inhibitor e.g., a MET or EGFR inhibitor
  • a KEAPl polynucleotide e.g., a MET or EGFR inhibitor
  • NRF2 inhibitor e.g., NRF2 inhibitor
  • Such treatment will be suitably administered to subjects, particularly humans, suffering from, having, susceptible to, or at risk for lung cancer (particularly, ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer), or a disorder, or symptom thereof. Determination of those subjects "at risk” can be made by any objective or subjective determination by a diagnostic test or opinion of a subject or health care provider (e.g., genetic test, enzyme or protein marker, marker such as a KEAPl and/or NRF2 polynucleotide or polypeptide, family history, and the like).
  • the compounds herein may be also used in the treatment of any other disorders in which ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer may be implicated.
  • the invention provides a method of monitoring treatment progress.
  • the method includes the step of determining a level of diagnostic marker (e.g., a level, sequence, or copy number of a polynucleotide or polypeptide of KEAPl and/or NRF2) or diagnostic measurement (e.g., screen, assay) in a subject suffering from or susceptible to a lung cancer associated with mutations in Ras/MAPK pathway (e.g., mutations in ALK-,
  • a level of diagnostic marker e.g., a level, sequence, or copy number of a polynucleotide or polypeptide of KEAPl and/or NRF2
  • diagnostic measurement e.g., screen, assay
  • BRAF-, EGFR-, NRAS-, or KRAS BRAF-, EGFR-, NRAS-, or KRAS
  • the level, sequence, or copy number of a polynucleotide or polypeptide of KEAPl and/or NRF2 determined in the method can be compared to known levels, sequences, or copy numbers of a polynucleotide or polypeptide of KEAPl and/or NRF2 in either healthy normal controls or in other afflicted patients to establish the subject's disease status.
  • a second level, sequence, or copy number of a polynucleotide or polypeptide of KEAPl and/or NRF2 in the subject is determined at a time point later than the determination of the first level, sequence, or copy number, and the two levels, sequences, or copy numbers are compared to monitor the course of disease or the efficacy of the therapy.
  • a pre- treatment level, sequence, or copy number of a polynucleotide or polypeptide of KEAPl and/or NRF2 in the subject is determined prior to beginning treatment according to this invention; this pre-treatment level, sequence, or copy number of a polynucleotide or polypeptide of KEAPl and/or NRF2 can then be compared to the level, sequence, or copy number of a polynucleotide or polypeptide of KEAPl and/or NRF2 in the subject after the treatment commences, to determine the efficacy of the treatment.
  • compositions useful for treating a lung cancer particularly ALK-, BRAF-, EGFR-, NRAS-, or KRAS -mutant lung cancer, in a subject.
  • the composition comprises one or more of a therapeutic agent as described herein (e.g., ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., a MET or EGFR inhibitor), a therapeutic agent as described herein (e.g., ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., a MET or EGFR inhibitor), a therapeutic agent as described herein (e.g., ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., a MET or EGFR inhibitor), a therapeutic agent as described
  • composition further comprises a vehicle for intracellular delivery of a polypeptide or polynucleotide (e.g., a liposome).
  • compositions comprising a therapeutic agent herein for the treatment of an ALK-, BRAF-, EGFR-, NRAS-, or KRAS -mutant lung cancer may be by any suitable means that results in a concentration of the therapeutic that, combined with other components, is effective in ameliorating, reducing, or stabilizing a lung cancer in a subject.
  • the composition may be administered systemically, for example, formulated in a
  • Preferable routes of administration include, for example, subcutaneous, intravenous, interperitoneally, intramuscular, or intradermal injections that provide continuous, sustained levels of the agent in the patient.
  • the amount of the therapeutic agent to be administered varies depending upon the manner of administration, the age and body weight of the patient, and with the clinical symptoms of the cancer. Generally, amounts will be in the range of those used for other agents used in the treatment of cancers such as ALK-, BRAF-, EGFR-, NRAS-, or KRAS- mutant lung cancer, although in certain instances lower amounts will be needed because of the increased specificity of the agent.
  • a composition is administered at a dosage that decreases effects or symptoms of lung cancer as determined by a method known to one of ordinary skill in the art.
  • the therapeutic agent e.g., ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., a MET or EGFR inhibitor), polynucleotide encoding a KEAPl polypeptide, or a NRF2 inhibitor, or any combination thereof
  • ALK inhibitor e.g., MEK inhibitor
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a BRAF inhibitor
  • ERK inhibitor e.g., a MET or EGFR inhibitor
  • the composition may be provided in a dosage form that is suitable for parenteral (e.g., subcutaneously, intravenously, intramuscularly, or intraperitoneally) administration route.
  • the pharmaceutical compositions may be formulated according to conventional pharmaceutical practice
  • compositions according to the invention may be formulated to release the active agent substantially immediately upon administration or at any predetermined time or time period after administration.
  • controlled release formulations which include (i) formulations that create a substantially constant concentration of the drug within the body over an extended period of time; (ii) formulations that after a predetermined lag time create a substantially constant concentration of the drug within the body over an extended period of time; (iii) formulations that sustain action during a predetermined time period by maintaining a relatively, constant, effective level in the body with concomitant minimization of undesirable side effects associated with fluctuations in the plasma level of the active substance (sawtooth kinetic pattern); (iv) formulations that localize action by, e.g., spatial placement of a controlled release composition adj acent to or in contact with an organ, such as the liver; (v) formulations that allow for convenient dosing, such that doses are administered, for example, once every one or two weeks; and (vi) formulations that target a cancer using carriers or
  • controlled release is obtained by appropriate selection of various formulation parameters and ingredients, including, e.g., various types of controlled release compositions and coatings.
  • the therapeutic is formulated with appropriate excipients into a pharmaceutical composition that, upon administration, releases the therapeutic in a controlled manner. Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, molecular complexes, nanoparticles, patches, and liposomes.
  • the pharmaceutical composition may be administered parenterally by injection, infusion or implantation (subcutaneous, intravenous, intramuscular, intraperitoneal, or the like) in dosage forms, formulations, or via suitable delivery devices or implants containing conventional, non-toxic pharmaceutically acceptable carriers and adjuvants.
  • injection, infusion or implantation subcutaneous, intravenous, intramuscular, intraperitoneal, or the like
  • suitable delivery devices or implants containing conventional, non-toxic pharmaceutically acceptable carriers and adjuvants.
  • compositions for parenteral use may be provided in unit dosage forms (e.g., in single- dose ampoules), or in vials containing several doses and in which a suitable preservative may be added (see below).
  • the composition may be in the form of a solution, a suspension, an emulsion, an infusion device, or a delivery device for implantation, or it may be presented as a dry powder to be reconstituted with water or another suitable vehicle before use.
  • the composition may include suitable parenterally acceptable carriers and/or excipients.
  • the active therapeutic agent(s) may be incorporated into microspheres, microcapsules, nanoparticles, liposomes, or the like for controlled release.
  • the composition may include suspending, solubilizing, stabilizing, pH-adjusting agents, tonicity adjusting agents, and/or dispersing, agents.
  • the composition comprising the active therapeutic (e.g., ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., a MET or EGFR inhibitor), polynucleotide encoding a KEAP l polypeptide, or a NRF2 inhibitor, or any combination thereof, as described herein) is formulated for intravenous delivery.
  • the pharmaceutical compositions according to the invention may be in the form suitable for sterile injection. To prepare such a composition, the suitable therapeutic(s) are dissolved or suspended in a parenterally acceptable liquid vehicle.
  • acceptable vehicles and solvents that may be employed are water, water adjusted to a suitable pH by addition of an appropriate amount of hydrochloric acid, sodium hydroxide or a suitable buffer, 1,3-butanediol, Ringer's solution, and isotonic sodium chloride solution and dextrose solution.
  • the aqueous formulation may also contain one or more preservatives (e.g., methyl, ethyl or n-propyl p-hydroxybenzoate).
  • a dissolution enhancing or solubilizing agent can be added, or the solvent may include 10-60% w/w of propylene glycol or the like.
  • Another therapeutic approach for treating an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-, mutant lung cancer is polynucleotide therapy using a polynucleotide encoding a KEAP1 polypeptide, or fragment thereof, or a NRF2 inhibitor, such as an inhibitory polynucleotides that reduces NRF2 expression.
  • a NRF2 inhibitor such as an inhibitory polynucleotides that reduces NRF2 expression.
  • the invention provides a therapeutic composition comprising a KEAP1 polynucleotide and/or a NRF2 inhibitor.
  • the invention provides a method of increasing sensitivity of a subject having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-, mutant lung cancer to an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, or RTK inhibitor (e.g., a MET or EGFR inhibitor), the method comprising administering to the subject a KEAPl
  • the invention provides a method of treating an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer in a subject comprising administering to the subject a KEAPl polynucleotide and/or a NRF2 inhibitor, in combination with an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, or RTK inhibitor (e.g., a MET or EGFR inhibitor).
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a MET or EGFR inhibitor
  • RTK inhibitor e.g., a MET or EGFR inhibitor
  • isolated polynucleotides encoding a KEAP polypeptide of the invention, or a fragment thereof.
  • inhibitory polynucleotides that reduce NRF2 expression. Delivery or expression of such polynucleotides or nucleic acid molecules in a cell or organism is expected to increase sensitivity to inhibition of ALK, MEK, BRAF, or EGFR to treat cancer (particularly, ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer) in the subject.
  • Such polynucleotides are also expected to increase sensitivity of the subject to other inhibitors of MAPK/RTK pathway components (e.g., RAF, RAS, ERK, or other RTK inhibitors (such as MET inhibitors).
  • Such nucleic acid molecules can be delivered to cells of a subject having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS- mutant lung cancer (in particular, subjects additionally having a KEAPl mutation and/or NRF2 amplification or overexpression).
  • the nucleic acid molecules must be delivered to the cells of a subject in a form in which they can be taken up so that therapeutically effective levels of the KEAPl polypeptide, or fragment thereof, can be produced, and/or expression levels of NRF2 in the cells are effectively reduced.
  • Transducing viral e.g., retroviral, adenoviral, and adeno-associated viral
  • Transducing viral can be used for somatic cell gene therapy, especially because of their high efficiency of infection and stable integration and expression (see, e.g., Cayouette et al, Human Gene Therapy 8:423-430, 1997; Kido et al, Current Eye Research 15:833-844, 1996; Bloomer et al, Journal of Virology 71 :6641-6649, 1997; Naldini et al, Science 272:263-267, 1996; and
  • a polynucleotide encoding a KEAP1 polypeptide of the invention, or a fragment thereof, or an inhibitory polynucleotide that reduces NRF2 expression can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a target cell type of interest.
  • viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus (also see, for example, the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244: 1275-1281, 1989; Eglitis et al, BioTechniques 6:608-614, 1988; Tolstoshev et al, Current Opinion in Biotechnology 1 :55-61, 1990; Sharp, The Lancet 337: 1277-1278, 1991 ; Cornetta et al, Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991 ; Miller et al., Biotechnology 7:980-990, 1989; Le Gal La Salle et al, Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995).
  • Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al, N. Engl. J. Med 323:370, 1990; Anderson et al, U.S. Pat. No. 5,399,346).
  • a viral vector is used to administer an inhibitory polynucleotide that reduces NRF2 expression or a polynucleotide encoding a KEAP1 polypeptide (or fragment thereof) systemically.
  • Non-viral approaches can also be employed for the introduction of the therapeutic to a cell of a patient requiring treatment of a cancer (particularly, an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer).
  • a nucleic acid molecule can be introduced into a cell by administering the nucleic acid in the presence of lipofection (Feigner et al, Proc. Natl. Acad. Sci. U.S.A. 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al, Am. J. Med. Sci. 298:278, 1989; Staubinger et al, Methods in
  • nucleic acids are administered in combination with a liposome and protamine.
  • Gene transfer can also be achieved using non-viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell.
  • Transplantation of genes encoding KEAP1 polypeptides into the affected tissues of a patient can also be accomplished by transferring a nucleic acid encoding KEAP1 polypeptide into a cultivatable cell type ex vivo (e.g., an autologous or heterologous primary cell or progeny thereof), after which the cell (or its descendants) are injected into a targeted tissue.
  • a cultivatable cell type ex vivo e.g., an autologous or heterologous primary cell or progeny thereof
  • cDNA expression for use in polynucleotide therapy methods can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element.
  • CMV human cytomegalovirus
  • SV40 simian virus 40
  • metallothionein promoters regulated by any appropriate mammalian regulatory
  • enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid.
  • the enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers.
  • regulation can be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.
  • Delivery of polynucleotides of the invention may also include or be performed in combination with gene or genome editing methods, such as CRISPR-Cas systems, to introduce polynucleotides encoding KEAP1 polypeptides or to introduce or restore wild-type KEAP1 expression in cells.
  • Gene or genome editing methods such as CRISPR-Cas systems are further described in for example, Sander et al. (2014), Nature Biotechnology 32, 347-355; Hsu et al. (2014), Cell 157(6): 1262-1278. Stratifying Patient Population and Monitoring Effectiveness of MEK/BRAF/EGFR Inhibitor Therapies
  • loss of KEAP1 or amplification of NFE2L2/NRF2 was found to confer resistance to treatment with the BRAF inhibitor vemurafenib in BRAF- mutant lung cancer, the MEK inhibitor trametinib in BRAF-, NRAS-, or KRAS-mutant lung cancer, the ALK inhibitor Crizotinib in lung cancers that had lost KEAP1, and the EGFR inhibitors afatinib and erlotinib in EGFR-mutant lung cancer.
  • RTK Receptor Tyrosine Kinase
  • information on KEAPl and/or NRF2 status in an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer may predict clinical response of the cancer to inhibitors of components of the MAPK/RTK signaling pathway (e.g., ALK, MEK, RAF, BRAF, RAS, ERK, EGFR, or MET).
  • the invention provides a method of identifying a subject with an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer that would benefit from treatment with an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the invention provides a method of typing an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer as a cancer that is resistant to or sensitive to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • the invention provides a method for determining whether a subject is eligible for entry into a clinical trial for treating a lung cancer with an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • Subjects identified as having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer that is sensitive to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor are eligible for entry.
  • KEAPl and NRF2 status should be performed in lung cancer patients with ALK-, NRAS-, KRAS-, BRAF-, or EGFR-mutations who are candidates for ALK, BRAF, MEK, or EGFR inhibitors, as well as other Raf inhibitors and future Ras inhibitors.
  • the anaylsis includes all types of diagnostics, including nucleic acid, antibody, and protein.
  • alterations in a polynucleotide or polypeptide of KEAPl and/or NRF2 e.g., sequence, copy number, level, post-transcriptional modification, biological activity
  • the method includes the step of measuring or detecting a level, copy number, or sequence of KEAPl and/or NRF2 polynucleotide in a biological sample obtained from the subject relative to a reference level, copy number, or sequence.
  • DNA sequencing and copy number analysis are performed on KEAPl and NFE2L2 in lung cancer patients with ALK-, EGFR-, NRAS-, KRAS-, or BRAF-mutations who are candidates for trametinib or vemurafenib treatment.
  • the detection of a mutation in the sequence of KEAPl polynucleotide, a decrease in the level or activity of KEAPl polynucleotide or polypeptide, or an increase in copy number, level, or activity of NRF2 polynucleotide or polypeptide indicates the lung cancer is resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor. Failure to detect a mutation in the sequence of KEAPl polynucleotide or failure to detect an increase in the copy number or level of NRF2 polynucleotide indicates the lung cancer is sensitive to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • a subject is identified as sensitive to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor or as having a lung cancer sensitive to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor if a mutation in the sequence of KEAPl polynucleotide or an increase in the copy number or level of NRF2 polynucleotide is not detected in the biological sample obtained from the subject, relative to a reference level, copy number, or sequence.
  • a subject is identified as resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor if a decrease in the level of KEAPl polynucleotide, a mutation in the sequence of KEAPl polynucleotide or an increase in the copy number or level of NRF2 polynucleotide detected in the biological sample obtained from the subject, relative to a reference level, copy number, or sequence.
  • the mutation in KEAPl is a loss-of-function mutation.
  • the mutation in KEAPl is KEAPl G333C.
  • a mutation in the sequence of KEAPl polynucleotide and/or an increase in the copy number or level of NRF2 polynucleotide is not detected, a sequence, level, or activity of one or more RTK/Ras/MAPK pathway genes (e.g., an ALK polypeptide, BRAF polypeptide, KRAS polypeptide, or NRAS polypeptide) is further measured.
  • RTK/Ras/MAPK pathway genes e.g., an ALK polypeptide, BRAF polypeptide, KRAS polypeptide, or NRAS polypeptide
  • the invention provides a method of monitoring effectiveness of treatment of an ALK-, BRAF-, EGFR-, NRAS-, or KRAS -mutant lung cancer in a subject with an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, or other RTK inhibitor (such as a MET inhibitor).
  • an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor, or any combination thereof is administered to a subject having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS -mutant lung cancer. Over time, many patients treated with any one or more of these inhibitors acquire resistance to the therapeutic effects of the inhibitor.
  • ALK inhibitor e.g., MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, or RTK inhibitor (such as a MET or EGFR inhibitor) in a lung cancer patient is important to patient survival because it allows for the selection of alternate therapies.
  • Subjects identified as having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer resistant to any one or more of these inhibitors are identified as in need of alternative treatment.
  • Subjects identified as having an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer resistant to one or more of these inhibitors may be treated for example, with a therapeutic composition comprising a KEAPl polynucleotide and/or a NRF2 inhibitor, in combination with an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor).
  • a therapeutic composition comprising a KEAPl polynucleotide and/or a NRF2 inhibitor, in combination with an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor).
  • administering a KEAPl polynucleotide and/or a NRF2 inhibitor to a subject resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor may increase sensitivity to one or more of these inhibitors.
  • Methods of monitoring the sensitivity to an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, or RTK inhibitor (such as a MET or EGFR inhibitor) of a subject having a lung cancer are useful in managing subject treatment.
  • alterations in a polynucleotide or polypeptide of KEAPl and/or NRF2 are analyzed before and again after subject management or treatment.
  • the methods are used to monitor the status of sensitivity to an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, or MET inhibitor (e.g., response to treatment with the inhibitors, resistance to the inhibitors, amelioration of the disease, or progression of the disease).
  • polypeptides or polynucleotides of KEAPl and/or NRF2 be used to monitor a subject's response to certain treatments of a disease (e.g., an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor) for treating an ALK-, BRAF-, EGFR-, NRAS-, or KRAS-mutant lung cancer).
  • the level, copy number, biological activity, sequence, post- transcriptional modification of a polypeptide or polynucleotide of KEAPl and/or NRF2 may be assayed before treatment, during treatment, or following the conclusion of a treatment regimen.
  • multiple assays e.g., 2, 3, 4, and 5 are made at one or more of those times to assay resistance to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor.
  • Alterations in polynucleotides or polypeptides of KEAPl and/or NRF2 are detected in a biological sample obtained from a patient that has or has a propensity to develop a cancer, such as an ALK-, NRAS-, EGFR-, KRAS-, or BRAF-mutant lung cancer.
  • Biological samples include tissue samples (e.g., cell samples, biopsy samples), such as lung tissue.
  • tissue samples e.g., cell samples, biopsy samples
  • Biological samples that are used to evaluate the herein disclosed markers include without limitation tumor cells, blood, serum, plasma, urine.
  • the biological sample is blood.
  • the sequence, level, or copy number of a polypeptide or polynucleotide of KEAP1 and/or NRF2 detected in the method can be compared to a reference sequence.
  • the reference sequence, level, or copy number may be a known sequence, level, or copy number of the gene in healthy normal controls.
  • the sequence of KEAP1 and/or NRF2 in the subject is determined at a time point later than the initial determination of the sequence, and the sequences are compared to monitor the efficacy of the therapy.
  • a pre-treatment sequence of a polypeptide or polynucleotide of KEAP1 and/or NRF2 in the subject is determined prior to beginning treatment according to this invention; this pre-treatment sequence of a polypeptide or polynucleotide of KEAP1 and/or NRF2 can then be compared to the sequence of the polypeptide or polynucleotide of KEAP1 and/or NRF2 in the subject after the treatment commences, to determine the efficacy of the treatment.
  • biomarkers of this invention can be detected or quantified by any suitable method.
  • methods include, but are not limited to real-time PCR, Southem blot, PCR, mass spectroscopy, and/or antibody binding.
  • Methods for detecting a mutation or amplification of the invention include immunoassay, direct sequencing, and probe hybridization to a polynucleotide encoding the mutant polypeptide.
  • a sequence and/or copy number of the markers is detected by DNA sequencing and/or copy number analysis.
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a BRAF inhibitor
  • ERK inhibitor e.g., a RAF inhibitor
  • EGFR inhibitor e.g., EGFR inhibitor
  • RTK inhibitor such as a MET inhibitor
  • a KEAP1 polypeptide or polynucleotide and/or a NRF2 inhibitor increases sensitivity to an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, or other RTK inhibitor (such as a MET inhibitor), particularly in a subject having loss of KEAPl and/or overexpression or amplification of NRF2.
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a BRAF inhibitor
  • ERK inhibitor e.g., ERK inhibitor
  • EGFR inhibitor e.g., EGFR inhibitor
  • RTK inhibitor such as a MET inhibitor
  • a therapeutic composition comprising an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor may be administered to a subject having an ALK-, BRAF-, EGFR-, KRAS-, or NRAS- mutant lung cancer, in combination with a composition comprising a KEAPl polypeptide or polynucleotide and/or a NRF2 inhibitor.
  • the subject is identified as resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor (e.g., the subject has an alteration in a level, copy number, sequence, or activity of a polynucleotide or polypeptide of KEAPl and/or NRF2).
  • a KEAPl polynucleotide and/or NRF2 inhibitor (e.g., an inhibitory polynucleotide that reduces NRF2 expression or small molecule that reduces expression or activity of NRF2) is administered to a subject identified as resistant to an ALK inhibitor, MEK inhibitor, BRAF inhibitor, or EGFR inhibitor to increase sensitivity of the subject to any one of these inhibitors.
  • an EGFR inhibitor is administered to a subject having an EGFR inhibitor
  • EGFR-mutant lung cancer in combination with a composition comprising a KEAPl polypeptide or polynucleotide and/or a NRF2 inhibitor.
  • a MEK inhibitor is administered to a subject having a MEK-mutant lung cancer in combination with a composition comprising a KEAPl polypeptide or polynucleotide and/or a NRF2 inhibitor.
  • a BRAF inhibitor is administered to a subject having a BRAF- mutant lung cancer in combination with a composition comprising a KEAPl polypeptide or polynucleotide and/or a NRF2 inhibitor.
  • an ALK inhibitor is administered to a subject having an ALK-mutant lung cancer in combination with a composition comprising a KEAPl polypeptide or polynucleotide and/or a NRF2 inhibitor.
  • a combination of trametinib or vemurafenib plus BSO/NRF2 inhibitor may be beneficial in patients with RAS/BRAF/EGFR mutations and intact KEAPl .
  • BSO buthionine sulfoximine
  • a combination of buthionine sulfoximine (BSO) and/or a NRF inhibitor and an ALK inhibitor, MEK inhibitor, EGFR inhibitor, or BRAF inhibitor is administered to a subject having a RAS/BRAF/EGFR mutation and intact KEAP 1.
  • the MEK inhibitor is trametinib.
  • the BRAF inhibitor is vemurafenib.
  • the EGFR inhibitor is erlotinib, afatinib, or cetuximab.
  • the ALK inhibitor can be ASP-3026, alectinib (ALECENSA), brigatinib (AP26113), ceritinib
  • the therapeutic agents described herein e.g., an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (such as a MET or EGFR inhibitor), KEAPl polynucleotide, NRF2 inhibitor (such as an inhibitory
  • polynucleotide that reduces NRF2 expression may be administered to a subject in further combination with standard therapies for cancer
  • Such standard therapies include, without limitation, surgery, radiation therapy, or administering chemotherapeutic agent(s) to the subject.
  • Chemotherapeutic agents suitable for treating lung cancer include, without limitation, gemcitabine, 5-fluorouracil, irinotecan, oxaliplatin, paclitaxel, capecitabine, cisplatin, and docetaxel.
  • RAF inhibitor e.g., a BRAF inhibitor
  • RAS inhibitor e.g., a BRAF inhibitor
  • ERK inhibitor e.g., ERK inhibitor
  • EGFR inhibitor e.g., a MET inhibitor
  • a kit of the invention provides a capture reagent (e.g., a primer or hybridization probe specifically binding to a KEAPl or NRF2 polynucleotide) for measuring relative expression level, copy number, activity, and/or a sequence of a marker (e.g., KEAP 1 or NRF2).
  • a capture reagent e.g., a primer or hybridization probe specifically binding to a KEAPl or NRF2 polynucleotide
  • the kit further includes reagents suitable for DNA sequencing or copy number analysis of KEAPl and/or NRF2.
  • the kit includes a diagnostic composition comprising a capture reagent detecting at least one marker selected from the group consisting of a KEAPl polynucleotide or polypeptide and a NRF2 polynucleotide or polypeptide.
  • the capture reagent detecting a polynucleotide of KEAP 1 or NRF2 is a primer or hybridization probe that specifically binds to a KEAP 1 or NRF2 polynucleotide.
  • the kit further comprises a capture reagent detecting at least one gene selected from the group consisting of ALK, BRAF, EGFR, NRAS, or KRAS.
  • kits may further comprise a therapeutic composition comprising an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, EGFR inhibitor, or other RTK inhibitor (such as a MET inhibitor).
  • the MEK inhibitor is trametinib, selumetinib, or MEK 162.
  • the BRAF inhibitor is vemurafenib or dabrafenib.
  • the EGFR inhibitor is erlotinib, afatinib, or cetuximab.
  • the RAF inhibitor is RAF265, XL281/BMS -908662, or sorafenib.
  • the ALK inhibitor can be ASP-3026, alectinib (ALECENSA), brigatinib (AP26113), ceritinib
  • kits may also further comprise a therapeutic composition comprising a polynucleotide encoding a KEAPl polypeptide and/or a NRF2 inhibitor (e.g., an inhibitory polynucleotide that reduces NRF2 expression).
  • a therapeutic composition comprising a polynucleotide encoding a KEAPl polypeptide and/or a NRF2 inhibitor (e.g., an inhibitory polynucleotide that reduces NRF2 expression).
  • the kits may be in combination with a chemotherapeutic agent suitable for treating lung cancer.
  • the kit includes a diagnostic composition (e.g., a capture reagent detecting a polynucleotide of ALK, KEAPl, NRF2, BRAF, EGFR, NRAS, or KRAS) and a therapeutic composition comprising an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., EGFR inhibitor, MET inhibitor), a KEAPl
  • a diagnostic composition e.g., a capture reagent detecting a polynucleotide of ALK, KEAPl, NRF2, BRAF, EGFR, NRAS, or KRAS
  • a therapeutic composition comprising an ALK inhibitor, MEK inhibitor, RAF inhibitor (e.g., a BRAF inhibitor), RAS inhibitor, ERK inhibitor, RTK inhibitor (e.g., EGFR inhibitor, MET inhibitor), a KEAPl
  • NRF2 inhibitor e.g., an inhibitory polynucleotide that reduces NRF2 expression
  • other chemotherapeutic agent(s) e.g., a chemotherapeutic agent that reduces NRF2 expression
  • the kit comprises a sterile container which contains a therapeutic composition; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art.
  • a sterile container which contains a therapeutic composition
  • Such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art.
  • Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments.
  • the kit further comprises instructions for administering the therapeutic combinations of the invention.
  • the instructions include at least one of the following: description of the therapeutic agent; dosage schedule and administration for enhancing anti-tumor activity; precautions; warnings; indications; counter-indications; over dosage information; adverse reactions; animal pharmacology; clinical studies; and/or references.
  • the instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.
  • Example 1 Genome-scale CRISPR loss-of-function screens to identify mechanisms of resistance to BRAF and MEK inhibition
  • FIG. 1 A Three screens with the MEK inhibitor trametinib in the NRAS -mutant lung cancer cell line H1299 (NRAS Q61K ), the BRAF-mutant lung cancer cell line HCC364 (BRAF V600E ), and the
  • KRAS-mutant lung cancer cell line CALU1 KRAS-mutant lung cancer cell line CALU1
  • One additional screen was performed in HCC364 cells treated with the BRAF inhibitor vemurafenib. The lowest concentration of drug that inhibited ERK phosphorylation and resulted in proliferative arrest or death was used (FIG. 5).
  • the GeCKO v2 library (Shalem et al, Science 343, 84-87 (2014)) was introduced into Cas9-expressing cells, selected cells that incorporated the sgRNAs and allowed genome editing to occur over one week. Cells were then harvested for the Day 0 time point or passaged in the presence of trametinib or vemurafenib (FIG. 1A).
  • NFl a negative regulator of Ras/MAPK signaling
  • DUSP1 a dual-specificity phosphatase that inhibits ERK.
  • PTEN a negative regulator of PI3K/AKT signaling
  • TSC1 and TSC2 negative regulators of mTOR signaling
  • HAT histone acety transferase
  • mediator complex a complex of E3 ubiquitin ligase complexes.
  • E3 ubiquitin ligase complexes multiple transcription factors scored, as well as general transcription machinery genes.
  • Other functional categories for which multiple genes scored include Rho signaling and histidine post-translational modifications (Table 1).
  • Rho signaling and histidine post-translational modifications Table 1.
  • KEAPl a substrate adaptor protein that targets NFE2L2/NRF2 for ubiquitination and proteasomal degradation, scored in all four screens (Table 1 and FIG. IB). Experiments described herein below focused on KEAPl .
  • Example 2 Loss of KEAPl conferred resistance to ALK, MEK, EGFR or BRAF inhibition in lung cancer with NRAS, BRAF, or KRAS mutation
  • HCC364 (BRAF V600E ) and CALU1 (KRAS G12C ) cells were infected with sgRNAs targeting KEAPl or GFP (FIGS. 6A-6B). Cells were then seeded at low density in 24-well plates and treated with DMSO, trametinib, or vemurafenib. Cell viability was assessed by crystal violet staining (FIG. 1C). Deletion of KEAPl (KEAP1 K0 ) conferred resistance to trametinib in both cell lines and to vemurafenib in HCC364 cells (FIG. 1C).
  • KEAPl K0 conferred resistance to erlotinib treatment in HCC827 (EGFR A746"750 ) cells and to afatinib treatment in NCI-H1975 (EGFR L858R/T790M ) cells (FIG. ID and FIG. 6C). It was also found that restoring wildtype KEAPl expression in A549 cells, which are KRAS mutant and KEAPl-null, increased their sensitivity to trametinib. In contrast, expression of the KEAPl mutant, which does not regulate NRF2, failed to alter trametinib sensitivity (FIG. IE and FIG. 6D).
  • KEAPl loss confers resistance to anaplastic lymphoma kinase (ALK) inhibition was also tested.
  • the loss of KEAPl (sgKEAPl-1 and sgKEAPl-2) confers resistance to ALK inhibition by 300 nM crizotinib in comparison to control (sgGFP) in ALK- mutant lung cancer (FIG. IF).
  • Example 3 KEAP1 did not activate the MAPK pathway and conferred resistance via increased NRF2 levels.
  • KEAP1 serves as a substrate adaptor protein that recruits the CUL3 ubiquitin ligase to NRF2, targeting it for proteasomal degradation.
  • NRF2 protein levels FIG. 2B
  • overexpression of wildtype NRF2 or NRF2 G 1R which contains a mutation in the KEAP1 binding domain, also conferred resistance to trametinib and vemurafenib (FIG. 2C and FIG. 6E), suggesting that elevated NRF2 levels in KEAP1 K0 cells mediates resistance.
  • CALU1 cells have a KEAP1 P128L mutation
  • this mutation has not been reported in cBioPortal or COSMIC (Cerami et al, Cancer discovery 2, 401-404, (2012); Gao et al, Science signaling 6, pll, doi: 10.1126/scisignal.2004088 (2013); Forbes, et al., Nucleic acids research 43, D805-811, (2015)) and NRF2 levels increased upon KEAPl knockout (FIG. 6B), suggesting that the regulation of NRF2 by KEAPl is intact in these cells.
  • KEAP1 K0 also conferred resistance to several chemotherapeutics (FIG. 7), as has been previously reported (Ohta, et al, Cancer research 68, 1303-1309, (2008); Shibata et al, Gastroenterology 135, 1358-1368, 1368 el351-1354, (2008); Wang, et al , Carcinogenesis 29, 1235-1243, (2008); Zhang, et al., Molecular cancer therapeutics 9, 336-346, (2010).
  • KEAP1 K0 also increased NRF2 target gene expression.
  • Trametinib treatment also increased NRF2 protein levels and caused a shift in the migration of NRF2 protein on SDS-PAGE, whereas KEAP1 K0 maintained the higher molecular weight form of NRF2 (FIG. 3B and FIG. 8C).
  • the KEAP1/NRF2 axis responds to oxidative and electrophilic stress by scavenging reactive oxygen species (ROS), by regulating expression of drug efflux pumps, and by altering cell metabolism (Hayes et al, Trends in biochemical sciences 39, 199-218, (2014)). It was investigated whether each of these functions was involved in resistance to trametinib treatment. Since MAPK pathway inhibition was maintained in KEAP1 K0 cells (FIG. 2A), drug efflux likely does not explain resistance.
  • ROS reactive oxygen species
  • NRF2 Loss of KEAPl led to further activation of NRF2, which conferred resistance in part by reducing ROS.
  • NRF2 has been reported to regulate the expression of metabolic genes (DeNicola et al. Nature genetics, (2015); Mitsuishi et al, Cancer cell 22, 66-79, (2012)). It was found that trametinib induced expression of genes involved in the pentose phosphate pathway, de novo nucleotide synthesis, and NADPH synthesis.
  • KEAP1 K0 also increased expression of some of these genes, similar to what was seen with other NRF2 targets (FIG. 4D and FIG. 10A).
  • Trametinib, vemurafenib, erlotinib, afatinib, cisplatin, 5-FU, etoposide, and paclitaxel were purchased from Selleck Chemicals.
  • Blasticidin and puromycin concentrations were optimized for each cell line by treating with different concentrations of drug for 3 days (puromycin) or 7 days (blasticidin). The lowest concentration of drug that killed all cells was used in the screens.
  • Cas9-expressing cell lines 200,000-400,000 cells were seeded in one well of a 6- well plate. The following day, cells were infected with 3 mL of pLX311-Cas9 virus with a final concentration of 4 ⁇ g/mL polybrene. Cells were spun for 2 hrs at 2000 rpm at 30 degrees. 24 hours after infection, cells were selected with blasticidin for 7 days.
  • Cas9 activity reporter which expresses eGFP as well as a guide RNA targeting eGFP (Doench et al, Nature biotechnology 32, 1262-1267, (2014)).
  • 200,000- 400,000 cells were seeded in six wells of a 6-well plate and were infected with 25-100 virus with a final concentration of 4 ⁇ g/mL polybrene. Cells were spun 2 hrs at 2000 rpm at 30 degrees. 24 hours after infection, each well was split into 2 wells, one of which was selected with puromycin.
  • Cas9-expressing cells were infected with different amounts of empty T virus (to mimic sgRNA infection) and were selected with puromycin. After 3 days of puromycin selection, cells were counted and those with 30-40% infection efficiency were used to optimize inhibitor concentration. Cells were kept in puromycin selection for one week prior to optimizing inhibitor concentration.
  • cells expressing Cas9 and empty T virus were treated with different concentrations of drug for 3 weeks. Cells were passaged or fresh drug-containing media was added every 3-4 days. Cells were counted at each passage. The lowest concentration of drug that resulted in death or proliferative arrest was used in the screen (FIG. 5). In parallel, cells were treated with different concentrations of inhibitor for 24 hours and then lysed in RIPA buffer. Immunoblots were performed with total and phospho-ERK antibodies to determine the concentration of inhibitor that blocked ERK phosphorylation.
  • 3x10 6 cells were seeded per well in a 12-well plate and were infected with different amounts of virus (0, 50, 100, 150, 200, 400 ⁇ ), with a final concentration of 4 ug/mL polybrene. Cells were spun for 2 hrs at 2000 rpm at 30 degrees. Approximately 6 hours after infection, cells were split into 6-well plates. For each amount of virus, 100,000 cells per well were plated in two wells. 24 hours after infection, one well was treated with puromycin and one with media alone. After 2-3 days of selection, cells were counted to determine the amount of virus that resulted in 30-40% infection efficiency, and this amount of virus was used in the screen.
  • HCC364 cells were treated with 24 nM trametinib or 6.25 ⁇
  • vemurafenib H1299 cells were treated with 1.5 ⁇ trametinib
  • CALU1 cells were treated with 50 nM trametinib.
  • Cells were passaged or fresh drug-containing media was added every 3-4 days. Drug-treated cells were harvested on Day 14 and Day 21 of drug treatment. To harvest cells, cells were trypsinized, spun down, washed with PBS, and the cell pellets were frozen at -80 degrees.
  • Cas9 in the pLX311 backbone (pXPR BRDl 11) and sgRNAs in the pXPR_BRD003 backbone were obtained from the Genetic Perturbation Platform at the Broad Institute. sgKEAPl arrayed infection
  • 500,000 cells per well were seeded in 48-well plates in 250 media with 4 ⁇ g/mL polybrene. 25 ⁇ virus (sgKEAPl or sgEGFP) was added per well and plates were spun 2 hrs at 2000 rpm at 30 degrees C. 6 hours later, each well was split into a 6cm dish. 24 hours after infection, cells were selected with puromycin for one week.
  • sgKEAPl or sgEGFP 25 ⁇ virus
  • 2,000-10,000 cells were seeded in 12-well or 24-well plates in the indicated drug conditions. Media containing fresh drug was replaced every 3-4 days. After the indicated number of days, cells were washed in PBS, fixed in 10% formalin for 15 minutes, and stained with 0.1% crystal violet in 10% ethanol for 20 minutes. After acquiring images, crystal violet was extracted in 10% acetic acid for 20 minutes. The absorbance at 565 nm was determined using a Spectramax plate reader. qRT-PCR RNA was harvested using a Qiagen RNeasy Kit and was reverse transcribed into cDNA using SuperScriptlll according to the manufacturer's recommendations.
  • 5x10 ⁇ 5 cells were seeded in 10 cm dishes. The following day, cells were treated with trametinib (25 nM for HCC364 or 50 nM for CALU1) or DMSO. After 72 hours of drug treatment, cells were lysed and fractionated using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce Biotechnology) according to the manufacturer's
  • Membranes were washed three times in TBST-T then incubated 1 hour at room temperature with secondary antibodies in 5% BSA in TBS-T. Membranes were washed in TBS-T and imaged on a Li-Cor Odyssey Infrared Imaging System. Primary antibodies were total ERK (Cell Signaling #9102), phospho-ERK (Cell Signaling #4370), total AKT (Cell Signaling #9272), phospho-AKT (Cell Signaling #4060), GAPDH (Cell Signaling #5174), LAMIN A/C (Cell Signaling #4777), KEAP1 (Proteintech 10503-2-AP), and NRF2 (Santa Cruz).
  • Primary antibodies were total ERK (Cell Signaling #9102), phospho-ERK (Cell Signaling #4370), total AKT (Cell Signaling #9272), phospho-AKT (Cell Signaling #4060), GAPDH (Cell Signaling #5174), LAMIN A/C (Cell Signaling #4777),
  • 293T cells were seeded in DMEM + 10% FBS + 0.1% Pen/Strep in 6 cm dishes. 24 hours later, cells were transfected with 100 ng VSVG, 900 ng delta8.9, and 1 ⁇ g pLX317- ORF plasmid using OptiMEM and Mirus TransIT. 16 hours after transfection, media was changed to DMEM + 30% FBS + 1% Pen/Strep. Virus was harvested 24 hours later. Cell lines were seeded in 6-well plates and were infected the following day with 1 :5 dilution of virus containing 4 ⁇ g/mL polybrene. 24 hours after infection, cells were selected with puromycin. DCFDA assays to measure ROS
  • cells were treated with drug for 3 days. Cells were trypsinized and resuspended in media with 10 ⁇ DCFDA (Sigma D6883) and incubated at 37°C for 90 minutes in the dark. For a positive control, parental cells were treated with 20 ⁇ tert-butyl hydroperoxide (Sigma Aldrich 458139) during incubation. For a negative control, parental cells were incubated in media without DCFDA. DCFDA fluorescence was detected by flow cytometry, using the FITC channel on an LSRII flow cytometer (BD Biosciences). GSH/GSSG assays
  • NADPH and NADP+ levels were determined using the NADP/NADPH-Glo Assay (Promega G9082) according to the manufacturer's protocol for measuring NADPH and NADP+ individually.
  • NFE2L2 TCCAGTCAGAAACCAGTGGAT GAATGTCTGCGCCAAAAGCTG
  • sgLACZ-1 AACGGCGGATTGACCGTAAT sgLACZ-2 CTAACGCCTGGGTCGAACGC

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des compositions et des procédés de typage de cancers du poumon à mutation dans ALK, BRAF, EGFR, NRAS ou KRAS chez un sujet en tant que cancer sensible ou résistant à un inhibiteur d'ALK, un inhibiteur de MEK, un inhibiteur de BRAF ou un inhibiteur d'EGFR, ainsi que des procédés associés de traitement de ces cancers. Dans des modes de réalisation particuliers, la présente invention concerne des compositions et des procédés pour typer des cancers du poumon à mutation dans ALK, BRAF, EGFR, NRAS ou KRAS, déterminer si un sujet ayant un cancer du poumon à mutation dans ALK, BRAF, EGFR, NRAS ou KRAS est éligible pour entrer dans un essai clinique pour un inhibiteur d'ALK, un inhibiteur de MEK, un inhibiteur de BRAF ou un inhibiteur d'EGFR, et suivre l'efficacité du traitement d'un cancer du poumon à mutation dans ALK, BRAF, EGFR, NRAS ou KRAS. Dans certains modes de réalisation, les procédés comprennent la mesure d'un niveau, du nombre de copies ou d'une séquence d'un polynucléotide de KEAP1 ou NRF2 dans un échantillon biologique prélevé sur le sujet par rapport à un niveau ou une séquence de référence. La présente invention concerne également des compositions et des procédés permettant d'augmenter la sensibilité à un inhibiteur d'ALK, un inhibiteur de MEK, un inhibiteur de BRAF ou un inhibiteur d'EGFR et de traiter un cancer du poumon à mutation dans ALK, BRAF, EGFR, NRAS ou KRAS.
PCT/US2016/066378 2015-12-14 2016-12-13 Compositions et procédés pour traiter le cancer du poumon à mutation dans ras/mapk WO2017106189A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562267017P 2015-12-14 2015-12-14
US62/267,017 2015-12-14

Publications (1)

Publication Number Publication Date
WO2017106189A1 true WO2017106189A1 (fr) 2017-06-22

Family

ID=59057848

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/066378 WO2017106189A1 (fr) 2015-12-14 2016-12-13 Compositions et procédés pour traiter le cancer du poumon à mutation dans ras/mapk

Country Status (1)

Country Link
WO (1) WO2017106189A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11040027B2 (en) 2017-01-17 2021-06-22 Heparegenix Gmbh Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death
WO2021183691A1 (fr) * 2020-03-11 2021-09-16 United States Government As Represented By The Department Of Veterans Affairs Inhibition combinée de egfr et de nrf2 dans le traitement du gliome malin
CN113521043A (zh) * 2020-04-16 2021-10-22 昆明医科大学 一种鸦胆子苦醇的应用
WO2021228834A1 (fr) * 2020-05-12 2021-11-18 Institut Curie Kindline-1 en tant que marqueur de la sensibilité aux inhibiteurs de la voie egfr/ras
US11285154B2 (en) 2017-03-29 2022-03-29 United States Government As Represented By The Department Of Veterans Affairs Methods and compositions for treating cancer
US11672801B2 (en) 2016-10-19 2023-06-13 United States Government As Represented By The Department Of Veterans Affairs Compositions and methods for treating cancer

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130309323A1 (en) * 2005-05-26 2013-11-21 The Johns Hopkins University Compositions and methods for the treatment or prevention of chemoresistant neoplasia
WO2014150671A1 (fr) * 2013-03-15 2014-09-25 The Broad Institute, Inc. Procédé d'identification de réponses à une thérapie d'inhibition des mapkinases
US20150057486A1 (en) * 2013-08-22 2015-02-26 The Broad Institute, Inc. Compositions and methods for sensitizing a neoplastic cell to radiation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130309323A1 (en) * 2005-05-26 2013-11-21 The Johns Hopkins University Compositions and methods for the treatment or prevention of chemoresistant neoplasia
WO2014150671A1 (fr) * 2013-03-15 2014-09-25 The Broad Institute, Inc. Procédé d'identification de réponses à une thérapie d'inhibition des mapkinases
US20150057486A1 (en) * 2013-08-22 2015-02-26 The Broad Institute, Inc. Compositions and methods for sensitizing a neoplastic cell to radiation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YAMADORI ET AL.: "Molecular Mechanisms For The Regulation Of Nrf2-Mediated Cell Proliferation In Non-Small- Cell Lung Cancers.", ONCOGENE, vol. 31, no. 45, 2012, pages 4768 - 4777, XP055393523 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11672801B2 (en) 2016-10-19 2023-06-13 United States Government As Represented By The Department Of Veterans Affairs Compositions and methods for treating cancer
US11040027B2 (en) 2017-01-17 2021-06-22 Heparegenix Gmbh Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death
US11285154B2 (en) 2017-03-29 2022-03-29 United States Government As Represented By The Department Of Veterans Affairs Methods and compositions for treating cancer
WO2021183691A1 (fr) * 2020-03-11 2021-09-16 United States Government As Represented By The Department Of Veterans Affairs Inhibition combinée de egfr et de nrf2 dans le traitement du gliome malin
CN113521043A (zh) * 2020-04-16 2021-10-22 昆明医科大学 一种鸦胆子苦醇的应用
WO2021228834A1 (fr) * 2020-05-12 2021-11-18 Institut Curie Kindline-1 en tant que marqueur de la sensibilité aux inhibiteurs de la voie egfr/ras

Similar Documents

Publication Publication Date Title
WO2017106189A1 (fr) Compositions et procédés pour traiter le cancer du poumon à mutation dans ras/mapk
US10421820B2 (en) Bruton's tyrosine kinase as anti-cancer drug target
US20210189342A1 (en) Compositions and methods for modulating monocyte and macrophage inflammatory phenotypes and immunotherapy uses thereof
KR20230025941A (ko) 비-erk mapk 경로 억제제-내성 암을 치료하기 위한 방법 및 조성물
EP2116553A1 (fr) Gène de fusion EML4-ALK
WO2015066452A2 (fr) Méthodes de traitement de cancers pédiatriques
EP2681330B1 (fr) Utilisation de la protéine olfactomédine-4 (olfm4) dans le diagnostic du cancer colorectal
CN110799245A (zh) 用于治疗具有非典型braf突变的癌症的组合物和方法
KR20160061424A (ko) 유방암으로부터 기원하는 골의 전이성 암의 예후 및 치료 방법
KR20170096056A (ko) 세포사 유도제, 세포 증식 억제제 및 세포의 증식 이상에서 기인하는 질환의 치료용 의약 조성물
KR20210133227A (ko) 뉴런 세포 흥분성을 정상화하고 드라베 증후군을 치료하기 위한 개재뉴런-특이적 치료제
US20220362228A1 (en) Compositions and methods for treating chemotherapy resistant cancer
CN114634984A (zh) 一种脑胶质瘤生物标记物mlkl基因及其应用
US20160074428A1 (en) Compositions and methods for the treatment of human immunodeficiency virus infection
US11384126B2 (en) Compositions and methods for inhibiting DHHC-type palmitoyltransferases for cancer treatment
AU2015246625A1 (en) Compositions and methods for the treatment or prevention of neurodegenerative disorders
US20210324478A1 (en) Compositions and methods for identification assessment, prevention, and treatment of ewing sarcoma using tp53 dependency biomarkers and modulators
CN116802312A (zh) 基于pde4d7相关基因来预测前列腺癌对象对放疗的反应
KR20100037639A (ko) Ｅｇｆｒ 억제제를 이용한 치료에 대한 예측 마커
JP6839707B2 (ja) Ｇｐｒ１６０を過剰発現する癌の予防、診断および治療
Pandey et al. WT1 regulates cyclin A1 expression in K562 cells
WO2020104762A1 (fr) Biomarqueurs et utilisations d'inhibiteurs de pnp
US20200289513A1 (en) Treating Cancer with Drug Combinations
WO2016098873A1 (fr) Procédé pour déterminer le risque de développement d'un lymphome primaire du système nerveux central et composition pour le traitement d'un lymphome primaire du système nerveux central
US20240124610A1 (en) Methods for treating her2-negative or her2-low cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16876488

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16876488

Country of ref document: EP

Kind code of ref document: A1