WO2016098873A1 - Procédé pour déterminer le risque de développement d'un lymphome primaire du système nerveux central et composition pour le traitement d'un lymphome primaire du système nerveux central - Google Patents

Procédé pour déterminer le risque de développement d'un lymphome primaire du système nerveux central et composition pour le traitement d'un lymphome primaire du système nerveux central Download PDF

Info

Publication number
WO2016098873A1
WO2016098873A1 PCT/JP2015/085435 JP2015085435W WO2016098873A1 WO 2016098873 A1 WO2016098873 A1 WO 2016098873A1 JP 2015085435 W JP2015085435 W JP 2015085435W WO 2016098873 A1 WO2016098873 A1 WO 2016098873A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nervous system
central nervous
mutant
substitution
Prior art date
Application number
PCT/JP2015/085435
Other languages
English (en)
Japanese (ja)
Inventor
博行 間野
敏秀 上野
知隆 福村
晃丈 武笠
亮 西川
一彦 三島
充章 白畑
基雄 永根
善孝 成田
幸一 市村
Original Assignee
国立大学法人東京大学
学校法人埼玉医科大学
学校法人杏林学園
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人東京大学, 学校法人埼玉医科大学, 学校法人杏林学園 filed Critical 国立大学法人東京大学
Priority to JP2016564910A priority Critical patent/JPWO2016098873A1/ja
Publication of WO2016098873A1 publication Critical patent/WO2016098873A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology

Definitions

  • the present invention relates to a method for determining the onset risk of primary malignant lymphoma of the central nervous system and a composition for treating primary malignant lymphoma of the central nervous system.
  • PCNSL Central nervous system primary malignant lymphoma
  • central nervous system malignant lymphoma is a malignant lymphoma that first occurs in the central nervous system such as the brain.
  • central nervous system malignant lymphoma rarely metastasizes throughout the body, the prognosis of affected patients is generally poor, with a median survival of 2 to 4 years (Non-patent Document 1).
  • Non-patent Document 1 Despite such diseases that cause serious symptoms, little is known about gene mutations involved in the pathogenicity of primary malignant lymphoma of the central nervous system, and no genetic markers that enable early detection thereof.
  • Non-Patent Document 2 discloses that there is no effect.
  • mutants of the GRB2 and / or MYD88 gene are found in samples derived from subjects having primary malignant lymphoma of the central nervous system, and the gene mutation
  • an activity inhibitor of GRB2 and / or a downstream signaling factor in the MAPK pathway or a B cell depleting agent such as rituximab can be a therapeutic agent for primary malignant lymphoma of the central nervous system.
  • the present invention includes the following aspects.
  • a method for determining the risk of developing a central nervous system primary malignant lymphoma in a human subject comprising a mutant of a protein comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 from a sample derived from the subject, Detecting the nucleic acid encoding it, and determining that the mutant or the nucleic acid encoding it has a high risk of developing a primary central nervous system lymphoma when the mutant or the nucleic acid encoding it is detected.
  • a composition for treating malignant lymphoma of the central nervous system in a human subject comprising a protein comprising the amino acid sequence of SEQ ID NO: 2 in the MAPK pathway and / or an activity inhibitor of a downstream signaling factor.
  • the composition according to claim 1 wherein the primary malignant lymphoma of the central nervous system is caused by L17R, S96P, V140G, L148R, Q153 *, A163T, and / or V213G in the amino acid sequence of SEQ ID NO: 2.
  • the activity inhibitor is a low molecular compound or an aptamer.
  • the activity inhibitor is trametinib (GSK1120212), pimaceltib (AST03026), selumetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC-0973, AZD8330 9.
  • compositions for treating a central nervous system primary lymphoma of a human subject comprising rituximab, wherein the central nervous system primary lymphoma is Q133R, G159A, M233T and / or in the amino acid sequence of SEQ ID NO: 4 Said composition due to L265P.
  • the central nervous system of a subject comprising means for detecting a mutant of a protein consisting of the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 or a nucleic acid encoding the same from a sample derived from a human subject
  • a kit for determining the risk of developing primary malignant lymphoma comprising means for detecting a mutant of a protein consisting of the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 or a nucleic acid encoding the same from a sample derived from a human subject.
  • a method for determining the effectiveness of a drug against primary malignant lymphoma of the central nervous system in a human subject wherein a mutation of a protein comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 is obtained from a sample derived from the subject Detecting the body or a nucleic acid encoding the same, and determining that the drug is highly effective against the primary malignant lymphoma of the subject when the mutant or the nucleic acid encoding the same is detected. , Said method. (17) The method according to 16 above, wherein the mutant is a constitutively active mutant.
  • the mutant has L17R, V140G, L148R, and / or A163T.
  • the drug is an activity inhibitor of a protein consisting of the amino acid sequence of SEQ ID NO: 2 in the MAPK pathway and / or a downstream signaling factor.
  • the activity inhibitor is a low molecular compound or an aptamer.
  • the signaling factor is Sos, Ras, Raf, MAP2K, and / or ERK.
  • the activity inhibitor is trametinib (GSK1120212), pimaceltib (AST03026), selmetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC-0973, AZD8330 24.
  • the present invention makes it possible to easily determine the risk of developing central nervous system malignant lymphoma.
  • the present invention makes it possible to effectively treat central nervous system primary malignant lymphoma.
  • FIG. 1 shows the site and type of GRB2 mutations found in subjects with primary central nervous system malignant lymphoma.
  • SH2 represents the Src homology 2 domain
  • SH3 represents the Src homology 3 domain.
  • FIG. 2 shows a proliferation assay of 3T3 cells infected with a retrovirus encoding wild type or mutant GRB2, or an empty retrovirus (Mock) as a control.
  • the scale bar in each figure is 0.4mm.
  • the broken line part in a figure shows the part in which the layered cell mass was recognized notably. Normal cells stop proliferating when they become confluent, but cells with abnormal proliferative activity continue to grow in layers, even when confluent.
  • FIG. 3A shows an immunoblot of 3T3 cells infected with a retrovirus encoding wild type or mutant GRB2 or an empty retrovirus (Mock) for control. This figure shows the activation state of each signal molecule located downstream of GRB2 in the classical RAS / MAPK signal cascade.
  • FIG. 3B shows a schematic diagram downstream of GRB2 of the classical RAS / MAPK signal cascade. Sos, which is a GDP-GTP exchange reaction promoter bound to GRB2, induces Ras activation. Activated Ras activates Raf, thereby activating MAP2K and ERK.
  • the present invention relates to a method for determining the risk of developing a central nervous system primary lymphoma of a subject, wherein a protein comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 is obtained from a sample derived from the subject. Detecting a mutant or a nucleic acid encoding the same, and determining the risk of developing a central nervous system primary malignant lymphoma in a subject when the mutant is detected.
  • primary central nervous system lymphoma means a malignant lymphoma that first occurs in the central nervous system.
  • the central nerve includes the optic nerve and olfactory nerve.
  • the central nervous system primary malignant lymphoma in the present invention is particularly a primary brain malignant lymphoma.
  • the term “risk of onset” refers to the probability that a subject will develop a disease, particularly a primary malignant lymphoma of the central nervous system.
  • “the risk of developing primary CNS lymphoma is high” means that the incidence of primary CNS lymphoma in a subject population having a mutation of GRB2 and / or MYD88 is GRB2 and / or MYD88. It means higher than the incidence of primary malignant lymphoma of the central nervous system in the population without mutation.
  • the term “subject” means an individual subjected to the present method.
  • individuals subjected to the method include, for example, animals, particularly mammals, primates such as humans and chimpanzees, laboratory animals such as rats and mice, livestock animals such as pigs, cows, horses, sheep, and goats, And pets such as dogs and cats, preferably humans.
  • sample means a biological sample used in the determination method of the present invention.
  • Samples that can be used in the present invention include, but are not limited to, biopsy samples of lymphoid tissue, particularly lymphoma tissue surgically excised from the brain, or peripheral blood mononuclear cells.
  • PBMC peripheral blood mononuclear cells
  • Peripheral blood mononuclear cells means cells in the bloodstream having one nucleus, and examples thereof include lymphocytes and macrophages.
  • Peripheral blood mononuclear cells are obtained from peripheral whole blood or blood cell components after plasma separation using density gradient centrifugation using Ficoll-Hypaque or Ficoll-Conray as the specific gravity liquid be able to.
  • peripheral blood mononuclear cells may be isolated and used, or a sample containing peripheral blood mononuclear cells may be used.
  • mutation means having a trait that is different from the majority (wild type) of the population, and the term “mutant” refers to nucleic acids and proteins having such a trait. Means the substance. In general, mutations are identified by comparing the base sequence of a gene in a subject or the amino acid sequence of a protein with their sequence in a healthy subject that is wild type.
  • Mutations in the present invention may be identified by comparison of a gene or protein in a subject with central nervous system primary malignant lymphoma and a healthy subject, or in a subject with central nervous system primary malignant lymphoma, lymphoma tissue and normal tissue May be identified by gene or protein comparison.
  • mutations at the gene level i.e., mutations in the base sequence, nonsense mutations in which an amino acid codon is changed to a stop codon, missense mutations in which an amino acid substitution is caused by a change or substitution of a base in the codon, and bases
  • a frameshift mutation in which the reading frame of the codon is shifted due to insertion or deletion of.
  • Silent mutations in which the nucleotide sequence is mutated but the amino acid is not altered are also included in the mutations herein.
  • the gene mutant of the present invention may have any of the above mutations, or may have a plurality of the above mutations.
  • mutations at the protein level that is, mutations in the amino acid sequence include substitutions in which amino acids are replaced with other amino acids, additions or insertions in which amino acids are added, and deletions in which amino acids are deleted.
  • the protein mutant of the present invention may have any of the above mutations, or may have a plurality of the above mutations.
  • the above mutation can be detected by any method known to those skilled in the art.
  • mutation detection at the gene level has mutations by PCR, Northern hybridization, quantitative PCR, RT-PCR, in-situ hybridization, FISH, or digital PCR. It can be detected by qualitatively or quantitatively measuring the presence of DNA or RNA of the target gene in each tissue.
  • Digital PCR is convenient for accurate quantification of mutations.
  • Digital PCR is a PCR method that is configured to provide amplification products or signals from a single nucleic acid molecule by diluting the nucleic acid to the limit, dividing it into multiple compartments, and performing PCR in each compartment. Point to. Digital PCR methods can also detect mutations that are present at relatively low levels.
  • the detection of the mutation at the amino acid level can be performed, for example, by measuring the molecular weight of the (poly) peptide and using an antibody that can recognize the amino acid mutation.
  • the mutation detected by the present invention is particularly a mutation of GRB2 or MYD88 or a gene thereof (GRB2 gene or MYD88 gene).
  • GRB2 (GRB2 protein) is a type of adapter protein that binds to tyrosine kinases and other docking proteins via the Src homology 2 domain, thereby activating downstream signaling factors such as RAS in the MAPK pathway (Downward , J. FEBS Lett. 1994, 338, pp. 113-117, and Cully, M., You, H., Levine, AJ & Mak, TW, Nat. Rev. Cancer, 2006, 6, pp. 184-92 See).
  • the human GRB2 gene consists of the base sequence shown in SEQ ID NO: 1, and the human GRB2 protein consists of the amino acid sequence shown in SEQ ID NO: 2.
  • MYD88 (MYD88 protein) is an adapter protein that plays a central role in the innate and acquired immune systems and is known to act as an important signaling factor in the interleukin 1 receptor signaling pathway (Warner N And Nunez G., J. Immunol. 2013, 190, pp.3-4).
  • the human MYD88 gene consists of the base sequence shown in SEQ ID NO: 3, and the human MYD88 protein consists of the amino acid sequence shown in SEQ ID NO: 4.
  • the mutation of the present invention is preferably a constitutively active (constitutively active) mutation.
  • the term “constitutively active mutation” refers to a gain-of-function mutation that renders a protein constitutively (constitutive) activated. In this specification, it means a mutation that activates a downstream signal regardless of the presence or absence of a signal from the upstream.
  • a constitutively active mutation of GRB2 constitutively activates a signaling factor downstream of GRB2 in the MAPK pathway.
  • Signaling factors downstream of GRB2 in the MAPK pathway include Sos, Ras, Raf, MAP2K (MAPKK, MEK), and ERK.
  • the human Sos gene consists of the base sequence shown in SEQ ID NO: 5, and the human Sos consists of the amino acid sequence shown in SEQ ID NO: 6.
  • Ras includes Kras, Hras, and Nras.
  • the human Kras gene consists of the base sequence shown in SEQ ID NO: 7, the human Kras consists of the amino acid sequence shown in SEQ ID NO: 8, the human Hras gene consists of the base sequence shown in SEQ ID NO: 9, and the human Hras is the amino acid shown in SEQ ID NO: 10.
  • the human Nras gene consists of a base sequence shown in SEQ ID NO: 11, and human Nras consists of an amino acid sequence shown in SEQ ID NO: 12.
  • Raf includes RAF1, ARAF1, and BRAF.
  • the human RAF1 gene consists of the base sequence shown in SEQ ID NO: 13, the human RAF1 consists of the amino acid sequence shown in SEQ ID NO: 14, the human ARAF1 gene consists of the base sequence shown in SEQ ID NO: 15, and the human ARAF1 is the amino acid shown in SEQ ID NO: 16.
  • the human BRAF gene consists of a base sequence shown in SEQ ID NO: 17, and human BRAF consists of an amino acid sequence shown in SEQ ID NO: 18.
  • MAP2K includes MAP2K1, MAP2K2, MAP2K3, MAP2K4, MAP2K5, MAP2K6, and MAP2K7.
  • the human MAP2K1 gene consists of the base sequence shown in SEQ ID NO: 19, the human MAP2K1 consists of the amino acid sequence shown in SEQ ID NO: 20, the human MAP2K2 gene consists of the base sequence shown in SEQ ID NO: 21, and the human MAP2K2 is the amino acid shown in SEQ ID NO: 22.
  • the human MAP2K3 gene consists of the base sequence shown in SEQ ID NO: 23
  • the human MAP2K3 consists of the amino acid sequence shown in SEQ ID NO: 24
  • the human MAP2K4 gene consists of the base sequence shown in SEQ ID NO: 25
  • the human MAP2K4 is SEQ ID NO:
  • the human MAP2K5 gene consists of the base sequence shown in SEQ ID NO: 27,
  • the human MAP2K5 consists of the amino acid sequence shown in SEQ ID NO: 28
  • the human MAP2K6 gene consists of the base sequence shown in SEQ ID NO: 29
  • human MAP2K6 consists of the amino acid sequence shown in SEQ ID NO: 30
  • human MAP2K7 gene consists of the base sequence shown in SEQ ID NO: 31
  • human MAP2K7 is the amino acid sequence shown in SEQ ID NO: 32 Consists of.
  • ERK includes ERK1 (MAPK3) and ERK2 (MAPK1).
  • the human ERK1 gene consists of the base sequence shown in SEQ ID NO: 33
  • the human ERK1 consists of the amino acid sequence shown in SEQ ID NO: 34
  • the human ERK2 gene consists of the base sequence shown in SEQ ID NO: 35
  • the human ERK2 is the amino acid shown in SEQ ID NO: 36. Consists of an array. Signal transduction factors are not limited to those having the above sequences, but also include transcription variants of these genes.
  • a constitutively active mutation of MYD88 constitutively activates a signal transduction factor downstream of MYD88 in the NF-kB pathway.
  • IRAK, TRAF6, TAB1, TAK1, IKK ⁇ , IKK ⁇ , Ik ⁇ , NF-k ⁇ , and the like can be mentioned as signal transduction factors downstream of MYD88 in the interleukin 1 receptor signaling pathway.
  • the mutation of GRB2 is not limited, but substitution of leucine at position 17 with arginine (L17R) and serine at position 96 when the starting methionine is position 1 in the amino acid sequence shown in SEQ ID NO: 2 Substitution to proline (S96P), substitution of valine to glycine at position 140 (V140G), substitution of leucine to arginine at position 148 (L148R), substitution of glutamine at position 153 to a stop codon (Q153 *), 163 Substitution of alanine to threonine at position (A163T) and substitution of valine at position 213 to glycine (V213G).
  • Preferred mutations include L17R, V140G, L148R, and A163T. In the present invention, the above mutations may be detected alone or a plurality may be detected simultaneously.
  • the mutation of GRB2 gene includes, but is not limited to, substitution of GRB2 gene corresponding to the above amino acid substitution.
  • the gene substitution corresponding to L17R includes substitution of thymine (t) at position 50 in the base sequence of SEQ ID NO: 1 with guanine (g) (t50g).
  • the present invention provides a MAPK pathway for treating central malignant primary lymphoma of a human subject caused by L17R, S96P, V140G, L148R, Q153 *, A163T, and / or V213G in GRB2.
  • the present invention relates to a composition comprising an activity inhibitor of GRB2 and / or a signal transduction factor downstream thereof as an active ingredient.
  • the invention also relates to a method for treating primary central nervous system lymphoma of a human subject. This method comprises the step of administering to the subject an activity inhibitor of GRB2 and / or a downstream signaling factor in the MAPK pathway.
  • the primary malignant lymphoma of the central nervous system is caused by L17R, S96P, V140G, L148R, Q153 *, A163T, and / or V213G in GRB2.
  • the activity inhibitor of the signal transduction factor is not particularly limited as long as it inhibits the activity of the signal transduction factor, but this inhibitor is particularly useful for the treatment of primary malignant lymphoma of the central nervous system of the brain. Since it can be used, it is preferably a low molecular compound or an aptamer that can cross the blood brain barrier.
  • the “low molecular compound capable of passing through the brain barrier” means a natural or chemically synthesized compound having a molecular weight of 10,000 or less, preferably a molecular weight of 1,000 or less, particularly preferably a molecular weight of 500 or less.
  • trametinib (GSK1120212), pimaceltib (AST03026), selumetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC-0973, AZD8330, and Cobimethinib (For details of each compound, see, for example, Akinley et al., Journal of Hematology & Oncology 6:27, 2013).
  • “Aptamers that can cross the brain barrier” mainly correspond to nucleic acid aptamers.
  • Nucleic acid aptamer is an aptamer composed of nucleic acids, which is solid with a target substance by a three-dimensional structure formed on the basis of the secondary structure and tertiary structure of a single-stranded nucleic acid molecule through hydrogen bonding, etc.
  • the nucleic acid aptamer is generally known as an RNA aptamer composed only of RNA and a DNA aptamer composed only of DNA, but is not particularly limited herein.
  • the activity inhibitor of the signaling factor in the present invention is not particularly limited as long as it inhibits any of the signaling factors, but is preferably an inhibitor of MAP2K, particularly MAP2K1 / 2.
  • the MAP2K inhibitor include, for example, the aforementioned trametinib (GSK1120212), pimaceltib (AST03026), selmetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC- 0973, AZD8330, kobimetinib, CI-1040, and the like, and preferable MAP2K inhibitors include trametinib and selmethinib.
  • composition of the present invention may contain other active ingredients, particularly anticancer agents such as methotrexate, in addition to the above active ingredients.
  • anticancer agents such as methotrexate
  • composition of the present invention can be formulated by a method known in the art.
  • the method described in Remington's Pharmaceutical Sciences May be used.
  • the specific formulation method varies depending on the administration method.
  • the administration method is roughly classified into oral administration and parenteral administration, but parenteral administration is more preferable in the case of the composition of the present invention.
  • composition of the present invention When the composition of the present invention is administered parenterally, specific examples thereof include administration by injection.
  • the composition of the present invention when administered by injection, it can be prepared as a suspension mixed with a pharmaceutically acceptable solvent and, if necessary, a pharmaceutically acceptable carrier.
  • the “pharmaceutically acceptable solvent” may be either water, a pharmaceutically acceptable aqueous solution other than that, or an oily liquid.
  • the aqueous solution include isotonic solutions containing physiological saline, glucose and other adjuvants.
  • Adjuvants include, for example, D-sorbitol, D-mannose, D-mannitol, sodium chloride, and other non-ionic surfactants at low concentrations (eg, polysorbate 80 (TM), HCO-60), polyoxy And ethylene sorbitan fatty acid esters.
  • the oily liquid include sesame oil and soybean oil, which can be used in combination with benzyl benzoate or benzyl alcohol as a solubilizing agent.
  • blend with buffer for example, phosphate buffer, sodium acetate buffer, soothing agent, for example, procaine hydrochloride, stabilizer, for example, benzyl alcohol, phenol, antioxidant.
  • Injectables are combined in a pharmaceutically acceptable excipient, emulsifier, suspending agent, surfactant, stabilizer, pH adjuster, etc., in appropriate combinations in unit dosage forms generally required for pharmaceutical practice. It is sufficient to formulate by doing so.
  • Injection includes, for example, intravascular injection, intralymphatic injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, etc., and intravascular administration such as intravascular injection or intralymphatic injection, which is systemic administration, is preferable. It may be a local administration that is administered directly.
  • a pharmaceutically acceptable carrier may be added.
  • “Pharmaceutically acceptable carrier” refers to a substance that is added within a range that facilitates the formulation of a drug and application to a living body and does not inhibit or suppress the action of its active ingredients.
  • an excipient a binder, a disintegrant, a filler, an emulsifier, a fluid addition modifier, or a lubricant can be used.
  • excipient examples include sugars such as monosaccharides, disaccharides, cyclodextrins and polysaccharides (specifically, but not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, Including dextrin, maltodextrin, starch and cellulose), metal salts (eg, sodium phosphate or calcium phosphate, calcium sulfate, magnesium sulfate), citric acid, tartaric acid, glycine, low, medium, high molecular weight polyethylene glycol (PEG), Pluronic or a combination thereof.
  • sugars such as monosaccharides, disaccharides, cyclodextrins and polysaccharides (specifically, but not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, Including dextrin, mal
  • binder examples include starch paste using corn, wheat, rice, or potato starch, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone.
  • disintegrant examples include the starch, carboxymethyl starch, cross-linked polyvinyl pyrrolidone, agar, alginic acid, sodium alginate or salts thereof.
  • filler examples include the sugar and / or calcium phosphate (for example, tricalcium phosphate or calcium hydrogen phosphate).
  • emulsifier examples include sorbitan fatty acid ester, glycerin fatty acid ester, sucrose fatty acid ester, and propylene glycol fatty acid ester.
  • Examples of the “flow additive modifier” and “lubricant” include silicate, talc, stearate or polyethylene glycol.
  • oral dosage forms examples include solid preparations (including tablets, pills, sublingual tablets, capsules, and drop preparations), granules, powders, powders, and liquids.
  • the solid preparation can be made into a dosage form known in the art, for example, a sugar-coated tablet, a gelatin-encapsulated tablet, an enteric tablet, a film-coated tablet, a double tablet, or a multilayer tablet, if necessary.
  • the specific shape and size of the dosage form are not particularly limited as long as each dosage form is within the range of dosage forms known in the art.
  • the content of the active ingredient in the composition of the present invention is, in principle, an amount that allows the active ingredient to reach lymphoma in a single administration, and an amount that causes little or no harmful side effects to the subject to which it is applied. I just need it.
  • Such content varies depending on the type of anticancer agent, the degree of lymphoma progression, the size of the lymphoma, the dosage form of the composition, and the administration method, but is appropriately determined by those skilled in the art.
  • Mutations in MYD88 include, but are not limited to, substitution of glutamine at position 133 with arginine (Q133R) and substitution of glycine at position 159 with alanine when the starting methionine is position 1 in SEQ ID NO: 4 (G159A), substitution of methionine at position 233 with threonine (M233T), and substitution of leucine with proline at position 265 (L265P), with preferred mutations in particular L265P.
  • the above mutations may be detected alone or a plurality may be detected simultaneously.
  • lymphocytes with L265P are first generated in peripheral blood, etc., and then these cells migrate to the central nervous system such as the brain, thereby causing the central nervous system to This suggests the possibility of causing primary malignant lymphoma. Therefore, by using it as a peripheral blood mononuclear cell as a sample, it is possible not only to easily determine the risk of developing central nervous system malignant lymphoma, but also to enable early detection of primary central nervous system malignant lymphoma.
  • the subject When using L265P of MYD88 for early detection of primary malignant lymphoma of the central nervous system, it is particularly preferable that the subject has no history of systemic lymphoma, particularly that the subject is not currently suffering from systemic lymphoma. Whether or not the patient has systemic lymphoma can be easily determined by those skilled in the art by using, for example, nuclear magnetic resonance (MRI).
  • MRI nuclear magnetic resonance
  • MYD88 gene mutations include, but are not limited to, MYD88 gene substitution corresponding to the above amino acid substitutions.
  • a substitution (a398g) of adenine (a) at position 398 in the base sequence of SEQ ID NO: 3 with guanine (g) can be mentioned.
  • lymphocytes having L265P were first generated in peripheral blood, etc., and it was suggested that this cell may cause the pathogenesis of primary malignant lymphoma of the central nervous system.
  • lymphocytes having L265P were first generated in peripheral blood, etc., and it was suggested that this cell may cause the pathogenesis of primary malignant lymphoma of the central nervous system.
  • the development of primary malignant lymphoma of the central nervous system can be suppressed by depleting B cells with a B cell depleting agent.
  • the invention provides a method for treating primary malignant lymphoma of a central nervous system in a human subject caused by a mutation selected from the group consisting of Q133R, G159A, M233T, and / or L265P in MYD88.
  • the present invention relates to a composition containing a B cell depleting agent as an active ingredient.
  • the present invention also provides a method for treating central nervous system primary malignant lymphoma in a human subject comprising administering a B cell depleting agent to the subject, wherein the central nervous system primary malignant lymphoma is Q133R in MYD88,
  • the method also relates to a method caused by a mutation selected from the group consisting of G159A, M233T, and L265P.
  • the B cell depleting agent is not limited as long as it can kill B cells and partially or totally deplete B cells, but in particular, an agent that can totally deplete B cells,
  • an agent that can totally deplete B cells For example, rituximab (Rituxan (registered trademark)) is preferred.
  • composition of the present invention may contain other active ingredients, particularly anticancer agents such as methotrexate, in addition to the above active ingredients.
  • anticancer agents such as methotrexate
  • composition for the treatment of primary malignant lymphoma of the central nervous system in the subject having the mutation of MYD88 is the same as the above-mentioned “the composition for the treatment of primary malignant lymphoma of the central nervous system in the subject having the mutation of GRB2” except for the active ingredient. is there.
  • a composition for the treatment of primary malignant lymphoma of the central nervous system in a subject having a MYD88 mutation comprises an auxiliary component as described above, such as a pharmaceutically acceptable solvent, a pharmaceutically acceptable carrier, an excipient. Agents, binders, disintegrants, fillers, emulsifiers and fillers may be included.
  • the invention relates to a method of determining the efficacy of a drug against primary central nervous system lymphoma in a human subject, comprising a GRB2 and / or MYD88 mutant or a coding thereof from a sample from the subject. And a method of determining that the drug is highly effective against primary malignant lymphoma of a subject when the mutation is detected. Since the mutants of GRB2 and / or MYD88 or the nucleic acid encoding them, and the steps for detecting them are as described above, description thereof is omitted here.
  • This method makes it possible to select or identify a drug having high efficacy for primary malignant lymphoma of the central nervous system.
  • the method also allows selection or identification of subject groups for which the drug is highly effective. “High drug efficacy” for primary malignant lymphoma of the central nervous system indicates that the drug is effective for the treatment and / or prevention of primary malignant lymphoma of the central nervous system of the subject.
  • the “agent” is not particularly limited, but an anticancer agent, for example, an agent that inhibits the activity of GRB2 and / or a downstream signaling factor in the MAPK pathway such as a MAP2K inhibitor, and B cell depleting agents such as rituximab are mentioned.
  • an anticancer agent for example, an agent that inhibits the activity of GRB2 and / or a downstream signaling factor in the MAPK pathway such as a MAP2K inhibitor, and B cell depleting agents such as rituximab are mentioned.
  • the effectiveness of a drug that inhibits the activity of GRB2 and / or downstream signaling factors in the MAPK pathway can be determined by detecting a mutant of GRB2 or a nucleic acid that encodes it in a subject. By detecting a mutant of MYD88 or a nucleic acid encoding the same, the effectiveness of a drug of a B cell depleting agent such as rituximab can be determined. Since the agent
  • the present invention provides for the development of a central nervous system primary malignant lymphoma of a subject comprising a means for detecting a mutant of GRB2 and / or MYD88 or a nucleic acid encoding it from a sample from a human subject. It relates to a kit for determining a risk.
  • the kit of the present invention includes a means for detecting a mutant of GRB2 and / or MYD88 or a nucleic acid encoding it as an essential component.
  • the kit of the present invention may contain a buffer, an enzyme, instructions for use, and the like in addition to the above means.
  • the means for detecting a mutant of GRB2 and / or MYD88 or a nucleic acid encoding the same is not particularly limited as long as it can detect a mutant of the protein or a gene encoding the same.
  • Examples of the means for detecting a protein mutation include an antibody capable of recognizing an amino acid mutation, and examples of the means for detecting a gene mutation include a primer set capable of detecting a gene mutation. It is done.
  • Detection of mutation in a subject having PCNSL> Informed consent was obtained from 44 subjects with primary malignant lymphoma of the central nervous system, and surgically excised brain lymphoma tissue and peripheral blood mononuclear cells were collected. Genomic DNA is extracted from each sample, and exon sequences are enriched using the SureSelect Human All Exon Kit (Agilent) according to the procedure described in Genome Biology 12: R94, 2011. HiSeq2000 (Illumina) next-generation sequencer (NGS) The gene sequence was analyzed by The specific method followed the protocol attached to the kit and the instructions for the sequencer.
  • Example 2 Functional study of GRB2 mutation> Method 1) Preparation of expression vector and virus Using cDNA derived from Glioblastoma cell line LN-18 cell line (American Type Culture Collection: ATCC) as a template, sense primer: aggagggttattgctgcttcggc (SEQ ID NO: 69) and antisense primer: caaccaaagtgagagggtcac (SEQ ID NO: 70) was used to amplify the wild-type GRB2 (NM_002086) gene (from the 35th base to the 1155th base) by PCR.
  • sense primer aggagggttattgctgcttcggc
  • caaccaaagtgagagggtcac SEQ ID NO: 70
  • the amplified sequence was inserted into pT7Blue-2 T-Vector (Novagen), the sequence was confirmed using a capillary sequencer (Life Technologies). Thereafter, the GRB2 gene sequence was taken out using BamHI and NotI (both New England Biolabs) and incorporated into a pMXS retroviral vector.
  • primers that add an EcoRI restriction enzyme site to the sense strand and an XhoI restriction enzyme site to the antisense strand (sense primer: TTTGAATTCgaagccatcgccaaatatgac (SEQ ID NO: 71), antisense primer: TTTCTCGAGcaaccaaagtgagagggtcac (SEQ ID NO: 72) PCR was performed to amplify the wild type GRB2 gene from the 361st base to the 1155th base, treated with restriction enzymes EcoRI and XhoI (both New England Biolabs), and then incorporated into the pcDNA3-N-FLAG vector.
  • the -N-FLAG vector was prepared by incorporating TTTCTCGAGcaaccaaagtgagagggtcac (SEQ ID NO: 73) (uppercase represents FLAG sequence) between the BamHI and EcoRI restriction enzyme sites of pcDNA3 (Addgene).
  • the pMXS retrovirus vector and pcDNA3-N-FLAG vector containing the GRB2 gene of each mutant are the QuickChange site-specific, using the pMXS retrovirus vector or the pcDNA3-N-FLAG vector incorporating the wild type GRB2 gene as a template, respectively.
  • a mutagenesis kit (Agilent Technologies) was used according to the manufacturer's instructions, and the base sequence was confirmed by capillary sequencing. The primers used are shown below (S; sense primer, AS; antisense primer).
  • L17R S; ccccttttgaagctccgctcgtcgtcgtctgcag (SEQ ID NO: 74), AS; ctgcagacgacgagcggagcttcaaagggg (SEQ ID NO: 75) S96P: S; ctcctggggacttcccctctctgtcaag (SEQ ID NO: 76), AS; cttgacagagagggggaagtccccaggag (SEQ ID NO: 77) V140G: S; tcacagatctacatctggctccagaaaccagcaga (SEQ ID NO: 78), AS; tctgctggtttctggagccagatgtagatctgtga (SEQ ID NO: 79) L148R: S; gaaaccagcagatattccggcgggacat
  • Preparation of recombinant retrovirus was performed according to the following procedure. pGPS, pE-eco packaging plasmid (both Takara Bio), and pMXS retrovirus vector (Cell BioBios) incorporating the wild-type or mutant GRB2 gene prepared as described above, and 293T cells using Lipofectamine (Life Technologies) (ATCC) was transfected. After 48 hours, the supernatant containing the retrovirus was collected.
  • Primary antibodies include sc-8014 for anti-IKBKB antibody, sc-6216 for anti-LMNB1 / 2 antibody (both SantaSCruz Biotechnology), # 4694 for anti-MAP2K1 / 2 antibody, and anti-phosphorylated MAP2K1 / 2 antibody # 9154, # 4695 for anti-ERK1 / 2 antibody, # 4370 for anti-phosphorylated ERK1 / 2 antibody, # 4691 for anti-AKT antibody, # 4060 for anti-phosphorylated AKT antibody, # 9242 for anti-NFKBIA antibody # 9246 for anti-phosphorylated NFKBIA antibody, # 8242 for anti-RELA antibody, # 3036 for anti-phosphorylated RELA antibody, # 2217 for anti-RPS6 antibody, # 4858 for anti-phosphorylated RPS6 antibody, and anti-ACTB # 4970 (all Cell Signaling Technology) was used as the antibody, and M2 (Sigma-Aldrich) was used as the anti-FLAG antibody.
  • # 7076 was used as the secondary antibody for the mouse antibody, and # 7074 (both Cell Signaling Technology) was used as the secondary antibody for the rabbit antibody.
  • trametinib (Selleck Chemicals) 0.1 nM, 1 nM, or 10 nM, inhibitors of MAP2K1 / 2, selmethinib (Selleck Chemicals) 1 nM, 10 nM, and or 100 nM, or dimethyl sulfoxide (DMSO) for control with the inhibitor solvent.
  • the medium was replaced with a DMEM-F12 medium supplemented with 5% fetal bovine serum supplemented with vehicle, and cultured for 12 days while changing the medium every 3 days. Thereafter, the cells were stained with Giemsa solution and the number of cells was evaluated. The darker the color of the medium, the more the cells grew.
  • NGS data corresponding to MYD88 gene mutation (L265P) was also detected in peripheral blood mononuclear cells (PBMNC) .
  • PBMNC peripheral blood mononuclear cells
  • the amount of DNA encoding MYD88 mutation (L265P) and wild-type MYD88 is determined for PBMNC in subjects in which MYD88 gene mutation (L265P) was detected in the tumor tissue.
  • MYD88 gene mutation (L265P) was detected in PBMNC of 7 subjects in addition to the above 5 subjects.
  • the detection of the MYD88 gene mutation (L265P) in 12 subjects with PBMNC suggests that B cells carrying this gene mutation are clonally expanded in peripheral blood.
  • the MYD88 gene mutation (L265P) and the gene that was detected in the tumor at high frequency were tested in triplicate by digital PCR analysis, and the occurrence of a mutation in the MYD88 gene. The average value of the frequency was obtained. The results are shown in Table 2.
  • MYD88 gene mutation (L265P) Despite detection of MYD88 gene mutation (L265P) in PBMNC, PBMNC detected more frequent mutations in the tumor than MYD88 gene mutation (L265P) (eg, MTMR8, COL4A6, and BEND2) Then, it was not detected at all. This is not because MYD88 gene mutation (L265P) -positive B cells have infiltrated the central nervous system from the central nervous system, but MYD88 gene mutation-positive “prelymphoma” cells develop outside the central nervous system and then Suggests circulating to peripheral blood and lymphatic vessels. These cells then invade the central nervous system and are thought to accumulate further genetic and epigenetic mutations that favor growth.
  • L265P MYD88 gene mutation
  • the present invention makes it possible to easily determine the risk of developing central nervous system malignant lymphoma.
  • the present invention makes it possible to provide a composition for effectively treating primary central nervous system malignant lymphoma.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Zoology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

La présente invention concerne un procédé pour déterminer facilement le risque de développer un lymphome primaire du système nerveux central, et une composition pour traiter un lymphome primaire du système nerveux central. La présente invention concerne un procédé pour déterminer le risque pour un sujet humain de développer un lymphome primaire du système nerveux central, lequel procédé comprend une étape de détection de variants mutants de GRB2 et/ou MYD88, ou des acides nucléiques qui codent ces variants mutants, dans un échantillon provenant du sujet, et une étape de détermination de l'existence d'un risque élevé pour le sujet de développer un lymphome primaire du système nerveux central lorsque les variants mutants susmentionnés ou des acides nucléiques codant les variants mutants sont détectés ; et une composition pour le traitement d'un lymphome primaire du système nerveux central chez un sujet humain, laquelle composition comprend du rituximab, ou un agent destiné à inhiber l'activité de GRB2 et/ou d'un facteur de signalisation en aval de celui-ci, dans la voie MAPK, en considérant les variants mutants susmentionnés comme la cause du lymphome primaire du système nerveux central.
PCT/JP2015/085435 2014-12-19 2015-12-18 Procédé pour déterminer le risque de développement d'un lymphome primaire du système nerveux central et composition pour le traitement d'un lymphome primaire du système nerveux central WO2016098873A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2016564910A JPWO2016098873A1 (ja) 2014-12-19 2015-12-18 中枢神経原発悪性リンパ腫の発症リスクを判定する方法及び中枢神経原発悪性リンパ腫の治療用組成物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2014257615 2014-12-19
JP2014-257615 2014-12-19

Publications (1)

Publication Number Publication Date
WO2016098873A1 true WO2016098873A1 (fr) 2016-06-23

Family

ID=56126753

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2015/085435 WO2016098873A1 (fr) 2014-12-19 2015-12-18 Procédé pour déterminer le risque de développement d'un lymphome primaire du système nerveux central et composition pour le traitement d'un lymphome primaire du système nerveux central

Country Status (2)

Country Link
JP (1) JPWO2016098873A1 (fr)
WO (1) WO2016098873A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018131705A1 (fr) * 2017-01-16 2018-07-19 凸版印刷株式会社 Procédé de détection de mutations somatiques dans des gènes marqueurs tumoraux et procédé d'évaluation d'état tumoral

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BRAGGIO E. ET AL.: "The Genomic Landscape of Primary Central Nervous System Lymphoma", HEMATOL ONCOL, vol. 31, no. Suppl.1, 2013, pages 153, 168, ISSN: 0278-0232 *
GAUDIO E. ET AL.: "The MEK-inhibitor pimasertib in B- cell lymphomas: Evaluation of the pre- clinical activity as single agent or in combination and identification of biomarkers of response.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 55, April 2014 (2014-04-01), pages 176, ISSN: 0197-016X *
KOJI IZUTSU: "Rituximab - B Saibo Lymph-shu Chiryo ni Motarashita Impact", JOURNAL OF CLINICAL AND EXPERIMENTAL MEDICINE ZOKETSUKI SHUYO NO BUNSHI HYOTEKI RYOHO, 25 January 2008 (2008-01-25), pages 29 - 35 *
TAISHI NAKAMURA ET AL.: "Chusu Shinkeikei Genpatsu Akusei Rinpa-shu wa CD 79B to MYD88 ni Okeru Idenshi Hen'i o sono Tokucho to suru", THE JAPAN SOCIETY FOR NEURO-ONCOLOGY PROGRAM · SHOROKUSHU, vol. 32, November 2014 (2014-11-01), pages 145, O-36 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018131705A1 (fr) * 2017-01-16 2018-07-19 凸版印刷株式会社 Procédé de détection de mutations somatiques dans des gènes marqueurs tumoraux et procédé d'évaluation d'état tumoral
JPWO2018131705A1 (ja) * 2017-01-16 2019-11-07 凸版印刷株式会社 腫瘍マーカー遺伝子の体細胞変異の検出方法及び腫瘍状態の評価方法
JP7215675B2 (ja) 2017-01-16 2023-01-31 凸版印刷株式会社 腫瘍状態の評価方法
US11746382B2 (en) 2017-01-16 2023-09-05 Toppan Printing Co., Ltd. Method of detecting somatic mutations in tumor marker genes, and tumor status evaluation method

Also Published As

Publication number Publication date
JPWO2016098873A1 (ja) 2017-09-28

Similar Documents

Publication Publication Date Title
US11806555B2 (en) Methods for treating hair loss disorders
Mancini et al. Disruption of the β1L isoform of GABP reverses glioblastoma replicative immortality in a TERT promoter mutation-dependent manner
Man et al. Critical role for the DNA sensor AIM2 in stem cell proliferation and cancer
Bouchekioua et al. JAK3 deregulation by activating mutations confers invasive growth advantage in extranodal nasal-type natural killer cell lymphoma
Yiakouvaki et al. Myeloid cell expression of the RNA-binding protein HuR protects mice from pathologic inflammation and colorectal carcinogenesis
KR101913293B1 (ko) 탈모 질환의 치료 방법
ES2797533T3 (es) Selección de pacientes con cáncer para la administración de inhibidores de la señalización Wnt utilizando el estado mutacional de Rnf43
KR20160091920A (ko) 트랜스포존 조성물 및 이의 이용 방법
Osorio et al. Loss of the proteostasis factor AIRAPL causes myeloid transformation by deregulating IGF-1 signaling
WO2012166722A1 (fr) Traitement du cancer colorectal, pancréatique et pulmonaire
KR102194746B1 (ko) Wnt 억제제와 연관된 마커
JP2020143123A (ja) マクロファージ活性化の主要制御因子としてのｐａｒｐ９およびｐａｒｐ１４
EP2454372B1 (fr) Gérer le traitement de troubles inflammatoires ou auto-immuns en utilisant l'expression de hom-1
KR102221013B1 (ko) Th-gm 세포 기능 조절 방법 및 조성물
Fischer et al. Clinical, molecular, metabolic, and immune features associated with oxidative phosphorylation in melanoma brain metastases
Chen et al. Elp3‐mediated codon‐dependent translation promotes mTORC2 activation and regulates macrophage polarization
Ren et al. Targeting P2X7 receptor inhibits the metastasis of murine P388D1 lymphoid neoplasm cells to lymph nodes
Bohlen et al. Human MCTS1-dependent translation of JAK2 is essential for IFN-γ immunity to mycobacteria
US20230149507A1 (en) Treatment of alt cancers
WO2016098873A1 (fr) Procédé pour déterminer le risque de développement d'un lymphome primaire du système nerveux central et composition pour le traitement d'un lymphome primaire du système nerveux central
Wasko et al. Tumor-selective effects of active RAS inhibition in pancreatic ductal adenocarcinoma
Dressel et al. Activation of the cGAS/STING axis in genome-damaged hematopoietic cells does not impact blood cell formation or leukemogenesis
WO2011129371A1 (fr) GROUPE DE GÈNES POUVANT AMPLIFIER L'EFFET ANTITUMORAL DU 5-FU SEUL OU EN COMBINAISON DE TYPE IFN-α/5-FU
WO2023127012A1 (fr) Composition médicinale pour le traitement et/ou la prévention d'un anévrisme, procédé d'aide au diagnostic d'un anévrisme et procédé d'évaluation d'un médicament thérapeutique d'un anévrisme
WO2023080157A1 (fr) Agent thérapeutique ou prophylactique pour myélopathie associée à htlv-1 (ham), procédé de détermination d'efficacité thérapeutique, et procédé d'évaluation d'activité ou procédé de diagnostic

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15870072

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2016564910

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15870072

Country of ref document: EP

Kind code of ref document: A1