WO2016098873A1 - Method for determining risk of developing primary central nervous system lymphoma, and composition for treating primary central nervous system lymphoma - Google Patents

Abstract

The purpose of the present invention is to provide a method for easily determining the risk of developing primary central nervous system lymphoma, and a composition for treating primary central nervous system lymphoma. The present invention solves the above problem through: a method for determining the risk of a human subject developing primary central nervous system lymphoma, wherein the method includes a step for detecting mutant variants of GRB2 and/or MYD88, or nucleic acids that encode these mutant variants, from a sample derived from the subject, and a step for determining that there is a high risk of the subject developing primary central nervous system lymphoma when the abovementioned mutant variants or nucleic acids encoding the mutant variants are detected; and a composition for treating primary central nervous system lymphoma in a human subject, wherein the composition includes rituximab, or an agent for inhibiting the activity of GRB2 and/or a downstream signaling factor thereof, in the MAPK pathway, taking the abovementioned mutant variants to be the cause of primary central nervous system lymphoma.

Description

Method for determining the onset risk of primary malignant lymphoma of central nervous system and composition for treatment of primary malignant lymphoma of central nervous system

The present invention relates to a method for determining the onset risk of primary malignant lymphoma of the central nervous system and a composition for treating primary malignant lymphoma of the central nervous system.

Central nervous system primary malignant lymphoma (PCNSL) is a malignant lymphoma that first occurs in the central nervous system such as the brain. Although central nervous system malignant lymphoma rarely metastasizes throughout the body, the prognosis of affected patients is generally poor, with a median survival of 2 to 4 years (Non-patent Document 1). Despite such diseases that cause serious symptoms, little is known about gene mutations involved in the pathogenicity of primary malignant lymphoma of the central nervous system, and no genetic markers that enable early detection thereof.

In addition, there are limited treatments for primary CNS malignant lymphoma, and current standard chemotherapy for systemic diffuse large B-cell lymphoma (DLBCL) is not available for patients with primary CNS lymphoma. It is known that there is no effect (Non-Patent Document 2).

An object of the present invention is to provide a method for easily determining the risk of developing primary malignant lymphoma of the central nervous system. Another object of the present invention is to provide a composition for the treatment of primary malignant lymphoma of the central nervous system.

As a result of intensive studies to solve the above problems, the present inventor has found that mutants of the GRB2 and / or MYD88 gene are found in samples derived from subjects having primary malignant lymphoma of the central nervous system, and the gene mutation In a subject having a body, it has been found that an activity inhibitor of GRB2 and / or a downstream signaling factor in the MAPK pathway or a B cell depleting agent such as rituximab can be a therapeutic agent for primary malignant lymphoma of the central nervous system. Completed.

That is, the present invention includes the following aspects.
(1) A method for determining the risk of developing a central nervous system primary malignant lymphoma in a human subject, comprising a mutant of a protein comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 from a sample derived from the subject, Detecting the nucleic acid encoding it, and determining that the mutant or the nucleic acid encoding it has a high risk of developing a primary central nervous system lymphoma when the mutant or the nucleic acid encoding it is detected.
(2) The method according to 1 above, wherein the mutant is a constitutively active mutant.
(3) Substitution of leucine at position 17 to arginine (L17R), substitution of serine at position 96 to proline (S96P) when the mutant has the starting methionine at position 1 in SEQ ID NO: 2, 140 Substitution of valine at position glycine (V140G), substitution of leucine at position 148 (L148R), substitution of glutamine at position 153 (Q153 *), substitution of alanine at position 163 at threonine ( A163T) and / or the method according to 1 or 2 above, wherein valine at position 213 is substituted with glycine (V213G).
(4) The method according to 3 above, wherein the mutant has L17R, V140G, L148R, and / or A163T.
(5) A composition for treating malignant lymphoma of the central nervous system in a human subject, comprising a protein comprising the amino acid sequence of SEQ ID NO: 2 in the MAPK pathway and / or an activity inhibitor of a downstream signaling factor. The composition according to claim 1, wherein the primary malignant lymphoma of the central nervous system is caused by L17R, S96P, V140G, L148R, Q153 *, A163T, and / or V213G in the amino acid sequence of SEQ ID NO: 2.
(6) The composition according to 5 above, wherein the activity inhibitor is a low molecular compound or an aptamer.
(7) The composition according to 5 or 6 above, wherein the signaling factor is Sos, Ras, Raf, MAP2K, and / or ERK.
(8) The composition according to 7 above, wherein the signaling factor is MAP2K.
(9) The activity inhibitor is trametinib (GSK1120212), pimaceltib (AST03026), selumetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC-0973, AZD8330 9. The composition according to 8 above, which is cobimetinib or CI-1040.
(10) Substitution of glutamine at position 133 to arginine (Q133R), substitution of glycine at position 159 to alanine (G159A), when the mutant has the first methionine as position 1 in SEQ ID NO: 4. 3. The method according to 1 or 2 above, comprising substitution of methionine at position threonine (M233T) and / or substitution of leucine at position 265 to proline (L265P).
(11) The method according to (10) above, wherein the mutant has L265P in SEQ ID NO: 4.
(12) The method according to 10 or 11 above, wherein the sample is a peripheral blood mononuclear cell.
(13) The method according to any one of the above 10 to 12, wherein the subject has no history of systemic lymphoma.
(14) A composition for treating a central nervous system primary lymphoma of a human subject, comprising rituximab, wherein the central nervous system primary lymphoma is Q133R, G159A, M233T and / or in the amino acid sequence of SEQ ID NO: 4 Said composition due to L265P.
(15) The central nervous system of a subject, comprising means for detecting a mutant of a protein consisting of the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 or a nucleic acid encoding the same from a sample derived from a human subject A kit for determining the risk of developing primary malignant lymphoma.
(16) A method for determining the effectiveness of a drug against primary malignant lymphoma of the central nervous system in a human subject, wherein a mutation of a protein comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 is obtained from a sample derived from the subject Detecting the body or a nucleic acid encoding the same, and determining that the drug is highly effective against the primary malignant lymphoma of the subject when the mutant or the nucleic acid encoding the same is detected. , Said method.
(17) The method according to 16 above, wherein the mutant is a constitutively active mutant.
(18) Substitution of leucine at position 17 to arginine (L17R), substitution of serine at position 96 to proline (S96P) when the mutant has the starting methionine at position 1 in SEQ ID NO: 2, 140 Substitution of valine at position glycine (V140G), substitution of leucine at position 148 (L148R), substitution of glutamine at position 153 (Q153 *), substitution of alanine at position 163 at threonine ( A163T) and / or the method according to 16 or 17 above, wherein the valine is substituted with glycine (V213G) at position 213.
(19) The method according to (18) above, wherein the mutant has L17R, V140G, L148R, and / or A163T.
(20) The method according to any one of 16 to 19 above, wherein the drug is an activity inhibitor of a protein consisting of the amino acid sequence of SEQ ID NO: 2 in the MAPK pathway and / or a downstream signaling factor.
(21) The method according to 20 above, wherein the activity inhibitor is a low molecular compound or an aptamer.
(22) The method according to the above 20 or 21, wherein the signaling factor is Sos, Ras, Raf, MAP2K, and / or ERK.
(23) The method according to 22 above, wherein the signaling factor is MAP2K.
(24) The activity inhibitor is trametinib (GSK1120212), pimaceltib (AST03026), selmetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC-0973, AZD8330 24. The method according to 23 above, which is cobimetinib or CI-1040.
(25) Substitution of glutamine at position 133 to arginine (Q133R), substitution of glycine at position 159 to alanine (G159A), 233 when the mutant has the starting methionine as position 1 in SEQ ID NO: 4 18. The method according to 16 or 17 above, which has substitution of methionine at position threonine (M233T) and / or substitution of leucine at position 265 to proline (L265P).
(26) The method according to 25 above, wherein the mutant has L265P in SEQ ID NO: 4.
(27) The method according to the above 25 or 26, wherein the sample is a peripheral blood mononuclear cell.
(28) The method according to any one of 25 to 27 above, wherein the subject has no history of systemic lymphoma.
(29) The method according to any one of 25 to 28 above, wherein the drug is rituximab.

This specification includes the disclosure of Japanese Patent Application No. 2014-257615, which is the basis of the priority of the present application.

The present invention makes it possible to easily determine the risk of developing central nervous system malignant lymphoma. In addition, the present invention makes it possible to effectively treat central nervous system primary malignant lymphoma.

FIG. 1 shows the site and type of GRB2 mutations found in subjects with primary central nervous system malignant lymphoma. In the figure, SH2 represents the Src homology 2 domain, and SH3 represents the Src homology 3 domain. FIG. 2 shows a proliferation assay of 3T3 cells infected with a retrovirus encoding wild type or mutant GRB2, or an empty retrovirus (Mock) as a control. The scale bar in each figure is 0.4mm. The broken line part in a figure shows the part in which the layered cell mass was recognized notably. Normal cells stop proliferating when they become confluent, but cells with abnormal proliferative activity continue to grow in layers, even when confluent. It was shown that two of V140G and L148R contributed to remarkable proliferative activity (carcinogenic activity), and two of L17R and A163T also contributed to proliferative activity (carcinogenic activity). FIG. 3A shows an immunoblot of 3T3 cells infected with a retrovirus encoding wild type or mutant GRB2 or an empty retrovirus (Mock) for control. This figure shows the activation state of each signal molecule located downstream of GRB2 in the classical RAS / MAPK signal cascade. As shown in the antibody lane specific for phosphorylated MAP2K1 / 2 (p-MAP2K1 / 2) and phosphorylated ERK (p-ERK), MAP2K1 / 2 and ERK are phosphorylated and active in many GRB2 mutants. It was shown that FIG. 3B shows a schematic diagram downstream of GRB2 of the classical RAS / MAPK signal cascade. Sos, which is a GDP-GTP exchange reaction promoter bound to GRB2, induces Ras activation. Activated Ras activates Raf, thereby activating MAP2K and ERK. FIG. 4 shows that 3T3 cells infected with a retrovirus encoding wild-type GRB2 or GRB2 mutant (V140G) were treated with the MAP2K inhibitor trametinib or selmethinib at the concentrations shown in the figure, or the solvent of the inhibitor 2 days after the infection. The results of culturing in the presence of a control dimethyl sulfoxide (DMSO) vehicle and then staining with crystal violet are shown. The darker the color of the medium, the more the cells grew. It was shown that excessive cell proliferation by the GRB2 mutant (V140G) was suppressed in a concentration-dependent manner by trametinib and selmethinib. The site and type of MYD88 mutations found in subjects with primary CNS lymphoma. In the figure, Death represents a Death domain, and TIR represents a Toll / interleukin 1 receptor homology domain.

<Determination of the risk of developing central nervous system malignant lymphoma>
In one aspect, the present invention relates to a method for determining the risk of developing a central nervous system primary lymphoma of a subject, wherein a protein comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 is obtained from a sample derived from the subject. Detecting a mutant or a nucleic acid encoding the same, and determining the risk of developing a central nervous system primary malignant lymphoma in a subject when the mutant is detected.

In this specification, the term “primary central nervous system lymphoma (PCNSL)” means a malignant lymphoma that first occurs in the central nervous system. In addition to the brain and spinal cord, the central nerve includes the optic nerve and olfactory nerve. The central nervous system primary malignant lymphoma in the present invention is particularly a primary brain malignant lymphoma.

As used herein, the term “risk of onset” refers to the probability that a subject will develop a disease, particularly a primary malignant lymphoma of the central nervous system. In the present specification, “the risk of developing primary CNS lymphoma is high” means that the incidence of primary CNS lymphoma in a subject population having a mutation of GRB2 and / or MYD88 is GRB2 and / or MYD88. It means higher than the incidence of primary malignant lymphoma of the central nervous system in the population without mutation. By determining the risk of developing central nervous system malignant lymphoma using the method of the present invention, early detection of primary central nervous system malignant lymphoma in a subject, or after surgical operation of a subject suffering from the disease, The possibility of recurrence of the disease can be expected.

In the present specification, the term “subject” means an individual subjected to the present method. Examples of individuals subjected to the method include, for example, animals, particularly mammals, primates such as humans and chimpanzees, laboratory animals such as rats and mice, livestock animals such as pigs, cows, horses, sheep, and goats, And pets such as dogs and cats, preferably humans.

In the present specification, the “sample” means a biological sample used in the determination method of the present invention. Samples that can be used in the present invention include, but are not limited to, biopsy samples of lymphoid tissue, particularly lymphoma tissue surgically excised from the brain, or peripheral blood mononuclear cells. “Peripheral blood mononuclear cells (PBMC)” means cells in the bloodstream having one nucleus, and examples thereof include lymphocytes and macrophages. Peripheral blood mononuclear cells are obtained from peripheral whole blood or blood cell components after plasma separation using density gradient centrifugation using Ficoll-Hypaque or Ficoll-Conray as the specific gravity liquid be able to. For these specific gravity liquids, it is convenient to use a commercially available separation liquid or the like. For example, Ficoll-Paque PLUS (GE healthcare) or LYMPHOPREP (AXIS-SHIELD) can be used. For the method of separating PBMCs, the protocol attached to the kit may be followed. In the present invention, peripheral blood mononuclear cells may be isolated and used, or a sample containing peripheral blood mononuclear cells may be used.

<Mutation>
In this specification, the term “mutation” means having a trait that is different from the majority (wild type) of the population, and the term “mutant” refers to nucleic acids and proteins having such a trait. Means the substance. In general, mutations are identified by comparing the base sequence of a gene in a subject or the amino acid sequence of a protein with their sequence in a healthy subject that is wild type.

Mutations in the present invention may be identified by comparison of a gene or protein in a subject with central nervous system primary malignant lymphoma and a healthy subject, or in a subject with central nervous system primary malignant lymphoma, lymphoma tissue and normal tissue May be identified by gene or protein comparison.

Examples of mutations at the gene level, i.e., mutations in the base sequence, nonsense mutations in which an amino acid codon is changed to a stop codon, missense mutations in which an amino acid substitution is caused by a change or substitution of a base in the codon, and bases For example, a frameshift mutation in which the reading frame of the codon is shifted due to insertion or deletion of. Silent mutations in which the nucleotide sequence is mutated but the amino acid is not altered are also included in the mutations herein. The gene mutant of the present invention may have any of the above mutations, or may have a plurality of the above mutations.

Examples of mutations at the protein level, that is, mutations in the amino acid sequence include substitutions in which amino acids are replaced with other amino acids, additions or insertions in which amino acids are added, and deletions in which amino acids are deleted. The protein mutant of the present invention may have any of the above mutations, or may have a plurality of the above mutations.

The above mutation can be detected by any method known to those skilled in the art. For example, mutation detection at the gene level has mutations by PCR, Northern hybridization, quantitative PCR, RT-PCR, in-situ hybridization, FISH, or digital PCR. It can be detected by qualitatively or quantitatively measuring the presence of DNA or RNA of the target gene in each tissue. Digital PCR is convenient for accurate quantification of mutations. Digital PCR is a PCR method that is configured to provide amplification products or signals from a single nucleic acid molecule by diluting the nucleic acid to the limit, dividing it into multiple compartments, and performing PCR in each compartment. Point to. Digital PCR methods can also detect mutations that are present at relatively low levels. For details of digital PCR, see, for example, Vogelstein B. and Kinzler K. W., (1999), Proc. Natl. Acad. Sci. USA, Vol. 96, pp. 9236-9241, and Zhi Zhu et al., Analytical and Bioanalytical Chemistry, Vol. 403, 8, pp. 2127-2143. Moreover, the detection of the mutation at the amino acid level can be performed, for example, by measuring the molecular weight of the (poly) peptide and using an antibody that can recognize the amino acid mutation.

The mutation detected by the present invention is particularly a mutation of GRB2 or MYD88 or a gene thereof (GRB2 gene or MYD88 gene).

GRB2 (GRB2 protein) is a type of adapter protein that binds to tyrosine kinases and other docking proteins via the Src homology 2 domain, thereby activating downstream signaling factors such as RAS in the MAPK pathway (Downward , J. FEBS Lett. 1994, 338, pp. 113-117, and Cully, M., You, H., Levine, AJ & Mak, TW, Nat. Rev. Cancer, 2006, 6, pp. 184-92 See). The human GRB2 gene consists of the base sequence shown in SEQ ID NO: 1, and the human GRB2 protein consists of the amino acid sequence shown in SEQ ID NO: 2.

MYD88 (MYD88 protein) is an adapter protein that plays a central role in the innate and acquired immune systems and is known to act as an important signaling factor in the interleukin 1 receptor signaling pathway (Warner N And Nunez G., J. Immunol. 2013, 190, pp.3-4). The human MYD88 gene consists of the base sequence shown in SEQ ID NO: 3, and the human MYD88 protein consists of the amino acid sequence shown in SEQ ID NO: 4.

The mutation of the present invention is preferably a constitutively active (constitutively active) mutation. The term “constitutively active mutation” refers to a gain-of-function mutation that renders a protein constitutively (constitutive) activated. In this specification, it means a mutation that activates a downstream signal regardless of the presence or absence of a signal from the upstream. For example, a constitutively active mutation of GRB2 constitutively activates a signaling factor downstream of GRB2 in the MAPK pathway. Signaling factors downstream of GRB2 in the MAPK pathway include Sos, Ras, Raf, MAP2K (MAPKK, MEK), and ERK.

The human Sos gene consists of the base sequence shown in SEQ ID NO: 5, and the human Sos consists of the amino acid sequence shown in SEQ ID NO: 6.

Ras includes Kras, Hras, and Nras. The human Kras gene consists of the base sequence shown in SEQ ID NO: 7, the human Kras consists of the amino acid sequence shown in SEQ ID NO: 8, the human Hras gene consists of the base sequence shown in SEQ ID NO: 9, and the human Hras is the amino acid shown in SEQ ID NO: 10. The human Nras gene consists of a base sequence shown in SEQ ID NO: 11, and human Nras consists of an amino acid sequence shown in SEQ ID NO: 12.

Furthermore, Raf includes RAF1, ARAF1, and BRAF. The human RAF1 gene consists of the base sequence shown in SEQ ID NO: 13, the human RAF1 consists of the amino acid sequence shown in SEQ ID NO: 14, the human ARAF1 gene consists of the base sequence shown in SEQ ID NO: 15, and the human ARAF1 is the amino acid shown in SEQ ID NO: 16. The human BRAF gene consists of a base sequence shown in SEQ ID NO: 17, and human BRAF consists of an amino acid sequence shown in SEQ ID NO: 18.

MAP2K includes MAP2K1, MAP2K2, MAP2K3, MAP2K4, MAP2K5, MAP2K6, and MAP2K7. The human MAP2K1 gene consists of the base sequence shown in SEQ ID NO: 19, the human MAP2K1 consists of the amino acid sequence shown in SEQ ID NO: 20, the human MAP2K2 gene consists of the base sequence shown in SEQ ID NO: 21, and the human MAP2K2 is the amino acid shown in SEQ ID NO: 22. Consisting of a sequence, the human MAP2K3 gene consists of the base sequence shown in SEQ ID NO: 23, the human MAP2K3 consists of the amino acid sequence shown in SEQ ID NO: 24, the human MAP2K4 gene consists of the base sequence shown in SEQ ID NO: 25, and the human MAP2K4 is SEQ ID NO: The human MAP2K5 gene consists of the base sequence shown in SEQ ID NO: 27, the human MAP2K5 consists of the amino acid sequence shown in SEQ ID NO: 28, the human MAP2K6 gene consists of the base sequence shown in SEQ ID NO: 29, human MAP2K6 consists of the amino acid sequence shown in SEQ ID NO: 30, the human MAP2K7 gene consists of the base sequence shown in SEQ ID NO: 31, and human MAP2K7 is the amino acid sequence shown in SEQ ID NO: 32 Consists of.

And ERK includes ERK1 (MAPK3) and ERK2 (MAPK1). The human ERK1 gene consists of the base sequence shown in SEQ ID NO: 33, the human ERK1 consists of the amino acid sequence shown in SEQ ID NO: 34, the human ERK2 gene consists of the base sequence shown in SEQ ID NO: 35, and the human ERK2 is the amino acid shown in SEQ ID NO: 36. Consists of an array. Signal transduction factors are not limited to those having the above sequences, but also include transcription variants of these genes.

A constitutively active mutation of MYD88 constitutively activates a signal transduction factor downstream of MYD88 in the NF-kB pathway. Moreover, IRAK, TRAF6, TAB1, TAK1, IKKα, IKKβ, Ikβ, NF-kβ, and the like can be mentioned as signal transduction factors downstream of MYD88 in the interleukin 1 receptor signaling pathway.

<Mutation of GRB2>
The mutation of GRB2 is not limited, but substitution of leucine at position 17 with arginine (L17R) and serine at position 96 when the starting methionine is position 1 in the amino acid sequence shown in SEQ ID NO: 2 Substitution to proline (S96P), substitution of valine to glycine at position 140 (V140G), substitution of leucine to arginine at position 148 (L148R), substitution of glutamine at position 153 to a stop codon (Q153 *), 163 Substitution of alanine to threonine at position (A163T) and substitution of valine at position 213 to glycine (V213G). Preferred mutations include L17R, V140G, L148R, and A163T. In the present invention, the above mutations may be detected alone or a plurality may be detected simultaneously.

The mutation of GRB2 gene includes, but is not limited to, substitution of GRB2 gene corresponding to the above amino acid substitution. For example, the gene substitution corresponding to L17R includes substitution of thymine (t) at position 50 in the base sequence of SEQ ID NO: 1 with guanine (g) (t50g).

<Composition for the treatment of primary malignant lymphoma of the central nervous system in a subject having a GRB2 mutation>
In the examples described below, it is shown that the above-mentioned mutation of GRB2 can cause the pathogenesis of primary malignant lymphoma of the central nervous system, and an inhibitor of GRB2 in the MAPK pathway and / or a signal downstream thereof in a subject having the above mutation It has been shown that activity inhibitors of transfer factors can be effective therapeutic agents. Accordingly, in one aspect, the present invention provides a MAPK pathway for treating central malignant primary lymphoma of a human subject caused by L17R, S96P, V140G, L148R, Q153 *, A163T, and / or V213G in GRB2. The present invention relates to a composition comprising an activity inhibitor of GRB2 and / or a signal transduction factor downstream thereof as an active ingredient. The invention also relates to a method for treating primary central nervous system lymphoma of a human subject. This method comprises the step of administering to the subject an activity inhibitor of GRB2 and / or a downstream signaling factor in the MAPK pathway. The primary malignant lymphoma of the central nervous system is caused by L17R, S96P, V140G, L148R, Q153 *, A163T, and / or V213G in GRB2.

In the present invention, the activity inhibitor of the signal transduction factor is not particularly limited as long as it inhibits the activity of the signal transduction factor, but this inhibitor is particularly useful for the treatment of primary malignant lymphoma of the central nervous system of the brain. Since it can be used, it is preferably a low molecular compound or an aptamer that can cross the blood brain barrier.

The “low molecular compound capable of passing through the brain barrier” means a natural or chemically synthesized compound having a molecular weight of 10,000 or less, preferably a molecular weight of 1,000 or less, particularly preferably a molecular weight of 500 or less. For example, trametinib (GSK1120212), pimaceltib (AST03026), selumetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC-0973, AZD8330, and Cobimethinib (For details of each compound, see, for example, Akinley et al., Journal of Hematology & Oncology 6:27, 2013).

“Aptamers that can cross the brain barrier” mainly correspond to nucleic acid aptamers. “Nucleic acid aptamer” is an aptamer composed of nucleic acids, which is solid with a target substance by a three-dimensional structure formed on the basis of the secondary structure and tertiary structure of a single-stranded nucleic acid molecule through hydrogen bonding, etc. A ligand molecule that specifically binds and has the ability to specifically inhibit or suppress functions such as physiological activity of a target substance. The nucleic acid aptamer is generally known as an RNA aptamer composed only of RNA and a DNA aptamer composed only of DNA, but is not particularly limited herein.

The activity inhibitor of the signaling factor in the present invention is not particularly limited as long as it inhibits any of the signaling factors, but is preferably an inhibitor of MAP2K, particularly MAP2K1 / 2. Examples of the MAP2K inhibitor include, for example, the aforementioned trametinib (GSK1120212), pimaceltib (AST03026), selmetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC- 0973, AZD8330, kobimetinib, CI-1040, and the like, and preferable MAP2K inhibitors include trametinib and selmethinib.

The composition of the present invention may contain other active ingredients, particularly anticancer agents such as methotrexate, in addition to the above active ingredients.

In principle, the composition of the present invention can be formulated by a method known in the art. For example, the method described in Remington's Pharmaceutical Sciences (Merck Publishing Co., Easton, Pa.) May be used. The specific formulation method varies depending on the administration method. The administration method is roughly classified into oral administration and parenteral administration, but parenteral administration is more preferable in the case of the composition of the present invention.

When the composition of the present invention is administered parenterally, specific examples thereof include administration by injection. When the composition of the present invention is administered by injection, it can be prepared as a suspension mixed with a pharmaceutically acceptable solvent and, if necessary, a pharmaceutically acceptable carrier.

The “pharmaceutically acceptable solvent” may be either water, a pharmaceutically acceptable aqueous solution other than that, or an oily liquid. Examples of the aqueous solution include isotonic solutions containing physiological saline, glucose and other adjuvants. Adjuvants include, for example, D-sorbitol, D-mannose, D-mannitol, sodium chloride, and other non-ionic surfactants at low concentrations (eg, polysorbate 80 (TM), HCO-60), polyoxy And ethylene sorbitan fatty acid esters. Examples of the oily liquid include sesame oil and soybean oil, which can be used in combination with benzyl benzoate or benzyl alcohol as a solubilizing agent. Moreover, you may mix | blend with buffer, for example, phosphate buffer, sodium acetate buffer, soothing agent, for example, procaine hydrochloride, stabilizer, for example, benzyl alcohol, phenol, antioxidant.

Injectables are combined in a pharmaceutically acceptable excipient, emulsifier, suspending agent, surfactant, stabilizer, pH adjuster, etc., in appropriate combinations in unit dosage forms generally required for pharmaceutical practice. It is sufficient to formulate by doing so.

Injection includes, for example, intravascular injection, intralymphatic injection, intramuscular injection, intraperitoneal injection, subcutaneous injection, etc., and intravascular administration such as intravascular injection or intralymphatic injection, which is systemic administration, is preferable. It may be a local administration that is administered directly.

In the case of oral administration of the composition of the present invention, a pharmaceutically acceptable carrier may be added.

“Pharmaceutically acceptable carrier” refers to a substance that is added within a range that facilitates the formulation of a drug and application to a living body and does not inhibit or suppress the action of its active ingredients. For example, an excipient, a binder, a disintegrant, a filler, an emulsifier, a fluid addition modifier, or a lubricant can be used.

Examples of the “excipient” include sugars such as monosaccharides, disaccharides, cyclodextrins and polysaccharides (specifically, but not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, Including dextrin, maltodextrin, starch and cellulose), metal salts (eg, sodium phosphate or calcium phosphate, calcium sulfate, magnesium sulfate), citric acid, tartaric acid, glycine, low, medium, high molecular weight polyethylene glycol (PEG), Pluronic or a combination thereof.

Examples of the “binder” include starch paste using corn, wheat, rice, or potato starch, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone.

Examples of the “disintegrant” include the starch, carboxymethyl starch, cross-linked polyvinyl pyrrolidone, agar, alginic acid, sodium alginate or salts thereof.

Examples of the “filler” include the sugar and / or calcium phosphate (for example, tricalcium phosphate or calcium hydrogen phosphate).

Examples of the “emulsifier” include sorbitan fatty acid ester, glycerin fatty acid ester, sucrose fatty acid ester, and propylene glycol fatty acid ester.

Examples of the “flow additive modifier” and “lubricant” include silicate, talc, stearate or polyethylene glycol.

Examples of oral dosage forms include solid preparations (including tablets, pills, sublingual tablets, capsules, and drop preparations), granules, powders, powders, and liquids. Furthermore, the solid preparation can be made into a dosage form known in the art, for example, a sugar-coated tablet, a gelatin-encapsulated tablet, an enteric tablet, a film-coated tablet, a double tablet, or a multilayer tablet, if necessary. . The specific shape and size of the dosage form are not particularly limited as long as each dosage form is within the range of dosage forms known in the art.

The content of the active ingredient in the composition of the present invention is, in principle, an amount that allows the active ingredient to reach lymphoma in a single administration, and an amount that causes little or no harmful side effects to the subject to which it is applied. I just need it. Such content varies depending on the type of anticancer agent, the degree of lymphoma progression, the size of the lymphoma, the dosage form of the composition, and the administration method, but is appropriately determined by those skilled in the art.

<Mutation of MYD88>
Mutations in MYD88 include, but are not limited to, substitution of glutamine at position 133 with arginine (Q133R) and substitution of glycine at position 159 with alanine when the starting methionine is position 1 in SEQ ID NO: 4 (G159A), substitution of methionine at position 233 with threonine (M233T), and substitution of leucine with proline at position 265 (L265P), with preferred mutations in particular L265P. In the present invention, the above mutations may be detected alone or a plurality may be detected simultaneously.

It was first found by the present inventor that the above mutation, in particular L265P, can also be detected in peripheral blood mononuclear cells of a subject having primary central nervous system malignant lymphoma. Without being bound by theory, as described in the examples below, lymphocytes with L265P are first generated in peripheral blood, etc., and then these cells migrate to the central nervous system such as the brain, thereby causing the central nervous system to This suggests the possibility of causing primary malignant lymphoma. Therefore, by using it as a peripheral blood mononuclear cell as a sample, it is possible not only to easily determine the risk of developing central nervous system malignant lymphoma, but also to enable early detection of primary central nervous system malignant lymphoma. When using L265P of MYD88 for early detection of primary malignant lymphoma of the central nervous system, it is particularly preferable that the subject has no history of systemic lymphoma, particularly that the subject is not currently suffering from systemic lymphoma. Whether or not the patient has systemic lymphoma can be easily determined by those skilled in the art by using, for example, nuclear magnetic resonance (MRI).

MYD88 gene mutations include, but are not limited to, MYD88 gene substitution corresponding to the above amino acid substitutions. For example, as a gene substitution corresponding to Q133R, a substitution (a398g) of adenine (a) at position 398 in the base sequence of SEQ ID NO: 3 with guanine (g) can be mentioned.

<Composition for treatment of primary malignant lymphoma of central nervous system in subject having MYD88 mutation>
In the examples described below, lymphocytes having L265P were first generated in peripheral blood, etc., and it was suggested that this cell may cause the pathogenesis of primary malignant lymphoma of the central nervous system. When detected in nuclear cells, it is considered that the development of primary malignant lymphoma of the central nervous system can be suppressed by depleting B cells with a B cell depleting agent.

Accordingly, in one aspect, the invention provides a method for treating primary malignant lymphoma of a central nervous system in a human subject caused by a mutation selected from the group consisting of Q133R, G159A, M233T, and / or L265P in MYD88. The present invention relates to a composition containing a B cell depleting agent as an active ingredient. The present invention also provides a method for treating central nervous system primary malignant lymphoma in a human subject comprising administering a B cell depleting agent to the subject, wherein the central nervous system primary malignant lymphoma is Q133R in MYD88, The method also relates to a method caused by a mutation selected from the group consisting of G159A, M233T, and L265P.

In the present invention, the B cell depleting agent is not limited as long as it can kill B cells and partially or totally deplete B cells, but in particular, an agent that can totally deplete B cells, For example, rituximab (Rituxan (registered trademark)) is preferred.

The composition of the present invention may contain other active ingredients, particularly anticancer agents such as methotrexate, in addition to the above active ingredients.

The composition for the treatment of primary malignant lymphoma of the central nervous system in the subject having the mutation of MYD88 is the same as the above-mentioned “the composition for the treatment of primary malignant lymphoma of the central nervous system in the subject having the mutation of GRB2” except for the active ingredient. is there. Thus, for example, a composition for the treatment of primary malignant lymphoma of the central nervous system in a subject having a MYD88 mutation comprises an auxiliary component as described above, such as a pharmaceutically acceptable solvent, a pharmaceutically acceptable carrier, an excipient. Agents, binders, disintegrants, fillers, emulsifiers and fillers may be included.

<Determination method of drug effectiveness>
In one aspect, the invention relates to a method of determining the efficacy of a drug against primary central nervous system lymphoma in a human subject, comprising a GRB2 and / or MYD88 mutant or a coding thereof from a sample from the subject. And a method of determining that the drug is highly effective against primary malignant lymphoma of a subject when the mutation is detected. Since the mutants of GRB2 and / or MYD88 or the nucleic acid encoding them, and the steps for detecting them are as described above, description thereof is omitted here.

This method makes it possible to select or identify a drug having high efficacy for primary malignant lymphoma of the central nervous system. The method also allows selection or identification of subject groups for which the drug is highly effective. “High drug efficacy” for primary malignant lymphoma of the central nervous system indicates that the drug is effective for the treatment and / or prevention of primary malignant lymphoma of the central nervous system of the subject.

In the present specification, the “agent” is not particularly limited, but an anticancer agent, for example, an agent that inhibits the activity of GRB2 and / or a downstream signaling factor in the MAPK pathway such as a MAP2K inhibitor, and B cell depleting agents such as rituximab are mentioned. For example, the effectiveness of a drug that inhibits the activity of GRB2 and / or downstream signaling factors in the MAPK pathway can be determined by detecting a mutant of GRB2 or a nucleic acid that encodes it in a subject. By detecting a mutant of MYD88 or a nucleic acid encoding the same, the effectiveness of a drug of a B cell depleting agent such as rituximab can be determined. Since the agent that inhibits the activity of GRB2 and / or a downstream signal transduction factor in the MAPK pathway and the B cell depleting agent are as described above, description thereof is omitted here.

<Kit>
In one aspect, the present invention provides for the development of a central nervous system primary malignant lymphoma of a subject comprising a means for detecting a mutant of GRB2 and / or MYD88 or a nucleic acid encoding it from a sample from a human subject. It relates to a kit for determining a risk.

The kit of the present invention includes a means for detecting a mutant of GRB2 and / or MYD88 or a nucleic acid encoding it as an essential component. The kit of the present invention may contain a buffer, an enzyme, instructions for use, and the like in addition to the above means.

The means for detecting a mutant of GRB2 and / or MYD88 or a nucleic acid encoding the same is not particularly limited as long as it can detect a mutant of the protein or a gene encoding the same. Examples of the means for detecting a protein mutation include an antibody capable of recognizing an amino acid mutation, and examples of the means for detecting a gene mutation include a primer set capable of detecting a gene mutation. It is done.

<Example 1 Detection of mutation in a subject having PCNSL>
Informed consent was obtained from 44 subjects with primary malignant lymphoma of the central nervous system, and surgically excised brain lymphoma tissue and peripheral blood mononuclear cells were collected. Genomic DNA is extracted from each sample, and exon sequences are enriched using the SureSelect Human All Exon Kit (Agilent) according to the procedure described in Genome Biology 12: R94, 2011. HiSeq2000 (Illumina) next-generation sequencer (NGS) The gene sequence was analyzed by The specific method followed the protocol attached to the kit and the instructions for the sequencer. As a result, as mutations frequently detected in lymphoma tissues, in GRB2, seven subjects (L17R, S96P, V140G, L148R, Q153 *, A163T, and V213G) shown in FIG. Mutations were identified. These mutations are based on six missense mutations and one nonsense mutation on the GDB gene. In MYD88, four types of mutations (Q133R, G159A, M233T, and L265P) shown in FIG. 5 were identified in 32 subjects. These mutations are based on four missense mutations in the MYD88 gene.

<Example 2 Functional study of GRB2 mutation>
Method 1) Preparation of expression vector and virus Using cDNA derived from Glioblastoma cell line LN-18 cell line (American Type Culture Collection: ATCC) as a template, sense primer: aggagggttattgctgcttcggc (SEQ ID NO: 69) and antisense primer: caaccaaagtgagagggtcac (SEQ ID NO: 70) was used to amplify the wild-type GRB2 (NM_002086) gene (from the 35th base to the 1155th base) by PCR. After the amplified sequence was inserted into pT7Blue-2 T-Vector (Novagen), the sequence was confirmed using a capillary sequencer (Life Technologies). Thereafter, the GRB2 gene sequence was taken out using BamHI and NotI (both New England Biolabs) and incorporated into a pMXS retroviral vector. Using this retroviral vector as a template, primers that add an EcoRI restriction enzyme site to the sense strand and an XhoI restriction enzyme site to the antisense strand (sense primer: TTTGAATTCgaagccatcgccaaatatgac (SEQ ID NO: 71), antisense primer: TTTCTCGAGcaaccaaagtgagagggtcac (SEQ ID NO: 72) PCR was performed to amplify the wild type GRB2 gene from the 361st base to the 1155th base, treated with restriction enzymes EcoRI and XhoI (both New England Biolabs), and then incorporated into the pcDNA3-N-FLAG vector. The -N-FLAG vector was prepared by incorporating TTTCTCGAGcaaccaaagtgagagggtcac (SEQ ID NO: 73) (uppercase represents FLAG sequence) between the BamHI and EcoRI restriction enzyme sites of pcDNA3 (Addgene).

The pMXS retrovirus vector and pcDNA3-N-FLAG vector containing the GRB2 gene of each mutant are the QuickChange site-specific, using the pMXS retrovirus vector or the pcDNA3-N-FLAG vector incorporating the wild type GRB2 gene as a template, respectively. A mutagenesis kit (Agilent Technologies) was used according to the manufacturer's instructions, and the base sequence was confirmed by capillary sequencing. The primers used are shown below (S; sense primer, AS; antisense primer).
L17R: S; ccccttttgaagctccgctcgtcgtctgcag (SEQ ID NO: 74), AS; ctgcagacgacgagcggagcttcaaaagggg (SEQ ID NO: 75)
S96P: S; ctcctggggacttccccctctctgtcaag (SEQ ID NO: 76), AS; cttgacagagagggggaagtccccaggag (SEQ ID NO: 77)
V140G: S; tcacagatctacatctggctccagaaaccagcaga (SEQ ID NO: 78), AS; tctgctggtttctggagccagatgtagatctgtga (SEQ ID NO: 79)
L148R: S; gaaaccagcagatattccggcgggacatagaacag (SEQ ID NO: 80), AS; ctgttctatgtcccgccggaatatctgctggtttc (SEQ ID NO: 81)
Q153 *: S; attcctgcgggacatagaataggtgccacagc (SEQ ID NO: 82), gctgtggcacctattctatgtcccgcaggaat (SEQ ID NO: 83)
A163T: S; gccgacatacgtccagaccctctttgactttga (SEQ ID NO: 84), AS; tcaaagtcaaagagggtctggacgtatgtcggc (SEQ ID NO: 85)
V213G: S; caattatgtcacccccgggaaccggaacgtctaag (SEQ ID NO: 86), AS; cttagacgttccggttcccgggggtgacataattg (SEQ ID NO: 87)

Preparation of recombinant retrovirus was performed according to the following procedure. pGPS, pE-eco packaging plasmid (both Takara Bio), and pMXS retrovirus vector (Cell BioBios) incorporating the wild-type or mutant GRB2 gene prepared as described above, and 293T cells using Lipofectamine (Life Technologies) (ATCC) was transfected. After 48 hours, the supernatant containing the retrovirus was collected.

2) Cell Proliferation Assay Mouse 3T3 cells were seeded at 1 × 10 ⁵ cells in a 6-well plate (Falcon), and the following day, the medium was replaced with 600 μL of supernatant containing retrovirus collected according to 1) above. After 4 hours, DMEM-F12 medium (both Invitrogen) supplemented with 1.4 mL of 10% fetal calf serum was added to make a total volume of 2 mL, and cultured for 2 days. Thereafter, the medium was replaced with DMEM-F12 medium supplemented with 5% fetal calf serum, and cultured for 12 days while changing the medium every 3 days. Then, the cells were observed with an optical microscope.

3) Immunoblotting Using the Neon Transfection System (Life Technologies), the manufacturer's instructions were prepared using the pcDNA3 vector containing the wild-type or mutant GRB2 gene with a FLAG epitope tag at the amino terminus, prepared according to 1) above. Mouse 3T3 fibroblasts were transfected as follows. Cells were solubilized using Lysis / Binding / Wash Buffer attached to Active Ras pull-down and detection kit (Thermo Scientific) according to the manufacturer's instructions, and GTP-linked activated RAS was converted to Active Ras pull- Purified using a down and detection kit (Thermo Scientific). The specific method followed the protocol attached to the kit. It was further immunoblotted with pan-RAS antibody. Cell-soluble fraction obtained from the same cell (total cell lysate: TCL) by SDS-PAGE (13% gel when using anti-RAS and anti-FLAG antibodies, 10% gel when using other antibodies) After electrophoresis, immunoblotting was performed with antibodies against RAS, phosphorylated MAP2K1 / 2, MAP2K1 / 2, phosphorylated ERK, ERK, β-actin and FLAG tag. The basic method of immunoblotting was according to the method described in Green, MR and Sambrook, J., 2012, Molecular Cloning: A Laboratory Manual Fourth Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Primary antibodies include sc-8014 for anti-IKBKB antibody, sc-6216 for anti-LMNB1 / 2 antibody (both SantaSCruz Biotechnology), # 4694 for anti-MAP2K1 / 2 antibody, and anti-phosphorylated MAP2K1 / 2 antibody # 9154, # 4695 for anti-ERK1 / 2 antibody, # 4370 for anti-phosphorylated ERK1 / 2 antibody, # 4691 for anti-AKT antibody, # 4060 for anti-phosphorylated AKT antibody, # 9242 for anti-NFKBIA antibody # 9246 for anti-phosphorylated NFKBIA antibody, # 8242 for anti-RELA antibody, # 3036 for anti-phosphorylated RELA antibody, # 2217 for anti-RPS6 antibody, # 4858 for anti-phosphorylated RPS6 antibody, and anti-ACTB # 4970 (all Cell Signaling Technology) was used as the antibody, and M2 (Sigma-Aldrich) was used as the anti-FLAG antibody.

# 7076 was used as the secondary antibody for the mouse antibody, and # 7074 (both Cell Signaling Technology) was used as the secondary antibody for the rabbit antibody.

4) Effect confirmation test of MAP2K inhibitor 6-well plate (Falcon) was seeded with mouse 3T3 cells at 1 × 10 ⁵ cells, and the following day, the wild type GRB2 or GRB2 (V140G) mutation recovered according to 1) above. The supernatant was replaced with 600 μL containing the retrovirus containing the gene encoding the body. After 4 hours, DMEM-F12 medium (both Invitrogen) supplemented with 1.4 mL of 10% fetal calf serum was added to make a total volume of 2 mL, and cultured for 2 days. Thereafter, trametinib (Selleck Chemicals) 0.1 nM, 1 nM, or 10 nM, inhibitors of MAP2K1 / 2, selmethinib (Selleck Chemicals) 1 nM, 10 nM, and or 100 nM, or dimethyl sulfoxide (DMSO) for control with the inhibitor solvent. ) The medium was replaced with a DMEM-F12 medium supplemented with 5% fetal bovine serum supplemented with vehicle, and cultured for 12 days while changing the medium every 3 days. Thereafter, the cells were stained with Giemsa solution and the number of cells was evaluated. The darker the color of the medium, the more the cells grew.

Results and Discussion In the 3T3 cell transformation assay, two of the above amino acid mutations, V140G and L148R, contributed to significant proliferative activity (carcinogenic activity), and L17R and A163T also contributed to proliferative activity (carcinogenic activity). Contributed (Figure 2).

Furthermore, in the activated state of the signal molecule downstream of GRB2, an increase in GTP-bound RAS was also observed in the S96P and V140G mutants (FIG. 3, “GTP-RAS” lane). The L148R and V213G mutants induced strong MAP2K and ERK1 / 2 phosphorylation, and the other mutants had the same effect (FIG. 3).

Since the RAS-ERK pathway was activated by the GRB2 mutation, it was investigated whether inhibition of MAP2K1 / 2 activity would have a therapeutic effect. As a result, excessive proliferation of 3T3 cells by the GRB2 mutant (V140G) was inhibited in a concentration-dependent manner by the MAP2K1 / 2 inhibitors trametinib (0.1 nM to 10 nM) and selmethinib (1 nM to 100 nM) (Fig. 4).

<Example 3 Detection of MYD88 mutation in peripheral blood>
32 people (72.7%) as described above by the MuTect algorithm (see Cibulskis, K. et al, 2013, Nat. Biotechnol. 31, pp.213-219), which is an algorithm for finding somatic mutations We found that PCNSL patients were somatic mutation positive, and that substitution of L265P was the most frequently detected substitution detected in 31 persons (FIG. 5). A close examination of the data for MYD88 gene mutation-negative subjects found mutations in an additional 4 patients, all of which were confirmed by Sanger sequencing. As a result, the frequency of mutation of MYD88 gene in PCNSL reached 81.8%.

In 5 subjects who were positive for MYD88 gene mutation (L265P) in tumor biopsy, NGS data corresponding to MYD88 gene mutation (L265P) was also detected in peripheral blood mononuclear cells (PBMNC) . In order to ascertain the frequency of genetic mutation more accurately, the amount of DNA encoding MYD88 mutation (L265P) and wild-type MYD88 is determined for PBMNC in subjects in which MYD88 gene mutation (L265P) was detected in the tumor tissue. Examined by digital PCR. That is, genomic DNA (25 ng for each sample) was subjected to QX200 system (Bio-Rad) and PCR was performed. The primers used are shown in Table 1 below.

As a result of digital PCR, MYD88 gene mutation (L265P) was detected in PBMNC of 7 subjects in addition to the above 5 subjects. The detection of the MYD88 gene mutation (L265P) in 12 subjects with PBMNC suggests that B cells carrying this gene mutation are clonally expanded in peripheral blood.

To further evaluate this gene mutation, the MYD88 gene mutation (L265P) and the gene that was detected in the tumor at high frequency were tested in triplicate by digital PCR analysis, and the occurrence of a mutation in the MYD88 gene. The average value of the frequency was obtained. The results are shown in Table 2.

Despite detection of MYD88 gene mutation (L265P) in PBMNC, PBMNC detected more frequent mutations in the tumor than MYD88 gene mutation (L265P) (eg, MTMR8, COL4A6, and BEND2) Then, it was not detected at all. This is not because MYD88 gene mutation (L265P) -positive B cells have infiltrated the central nervous system from the central nervous system, but MYD88 gene mutation-positive “prelymphoma” cells develop outside the central nervous system and then Suggests circulating to peripheral blood and lymphatic vessels. These cells then invade the central nervous system and are thought to accumulate further genetic and epigenetic mutations that favor growth.

The present invention makes it possible to easily determine the risk of developing central nervous system malignant lymphoma. In addition, the present invention makes it possible to provide a composition for effectively treating primary central nervous system malignant lymphoma.

Sequence numbers 37 to 87: Primer

All publications, patents and patent applications cited in this specification are incorporated herein by reference in their entirety.

Claims (16)

1. A method for determining the risk of developing central nervous system lymphoma of a human subject comprising:
   A step of detecting a protein mutant comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 or a nucleic acid encoding the same from a sample derived from a subject, and detecting the mutant or the nucleic acid encoding the same And determining that the subject has a high risk of developing primary central nervous system lymphoma.
2. The method according to claim 1, wherein the mutant is a constitutively active mutant.
3. When the mutant has the methionine at position 1 in SEQ ID NO: 2, substitution of leucine at position 17 with arginine (L17R), substitution of serine at position 96 (S96P), valine at position 140 Glycine (V140G), leucine at position 148 to arginine (L148R), glutamine at position 153 to a stop codon (Q153 *), alanine at position 163 to threonine (A163T), And 213 at least one substitution selected from the group consisting of substitution of valine with glycine (V213G) at position 213.
4. 4. The method of claim 3, wherein the mutant has at least one substitution selected from the group consisting of L17R, V140G, L148R, and A163T.
5. A composition for treating malignant lymphoma of the central nervous system in a human subject, comprising a protein consisting of the amino acid sequence of SEQ ID NO: 2 in the MAPK pathway and / or an activity inhibitor of a downstream signaling factor, The composition as described above, wherein the neurogenic malignant lymphoma is caused by at least one substitution selected from the group consisting of L17R, S96P, V140G, L148R, Q153 *, A163T, and V213G in the amino acid sequence of SEQ ID NO: 2.
6. The composition according to claim 5, wherein the activity inhibitor is a low molecular compound or an aptamer.
7. The composition according to claim 5 or 6, wherein the signaling factor is selected from the group consisting of Sos, Ras, Raf, MAP2K, and ERK.
8. The composition according to claim 7, wherein the signaling factor is MAP2K.
9. The activity inhibitor is trametinib (GSK1120212), pimaceltib (AST03026), selumetinib (AZD6244), PD-0325901, refametinib (REDA119), TAK733, MEK162, RO5126766, WX-544, RO4987655, GDC-0973, AZD8330, Kobimetib Or the composition of Claim 8 which is CI-1040.
10. Substitution of glutamine at position 133 to arginine (Q133R), substitution of 159 for glycine to alanine (G159A), and methionine at position 233 when the mutant has the first methionine as position 1 in SEQ ID NO: 4. The method according to claim 1, comprising at least one substitution selected from the group consisting of substitution of threonine with threonine (M233T) and substitution of leucine at position 265 with proline (L265P).
11. The method of claim 10, wherein the mutant has L265P in SEQ ID NO: 4.
12. The method according to claim 10 or 11, wherein the sample is a peripheral blood mononuclear cell.
13. The method according to any one of claims 10 to 12, wherein the subject has no history of systemic lymphoma.
14. A composition for treating central nervous system primary malignant lymphoma in a human subject, comprising rituximab, wherein the central nervous system primary lymphoma is from the group consisting of Q133R, G159A, M233T, and L265P in the amino acid sequence of SEQ ID NO: 4 Said composition due to at least one substitution chosen.
15. CNS primary malignant lymphoma of a subject, comprising means for detecting a mutant of a protein consisting of the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 or a nucleic acid encoding the same from a sample derived from a human subject A kit for determining the risk of developing the disease.
16. A method for determining the efficacy of a drug against primary malignant lymphoma of the central nervous system in a human subject comprising:
    A step of detecting a protein mutant comprising the amino acid sequence of SEQ ID NO: 2 and / or SEQ ID NO: 4 or a nucleic acid encoding the same from a sample derived from a subject, and detecting the mutant or the nucleic acid encoding the same Said method comprising the step of determining that the drug is highly effective against primary malignant lymphoma of the subject.
    

Images