WO2017083562A1 - High efficiency construction of dna libraries - Google Patents

High efficiency construction of dna libraries Download PDF

Info

Publication number
WO2017083562A1
WO2017083562A1 PCT/US2016/061395 US2016061395W WO2017083562A1 WO 2017083562 A1 WO2017083562 A1 WO 2017083562A1 US 2016061395 W US2016061395 W US 2016061395W WO 2017083562 A1 WO2017083562 A1 WO 2017083562A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
oligonucleotide
adaptor
ligation
repaired
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/061395
Other languages
English (en)
French (fr)
Inventor
Christopher K. Raymond
Lee P. Lim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Resolution Bioscience Inc
Original Assignee
Resolution Bioscience Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES16865029T priority Critical patent/ES2856598T3/es
Priority to IL285202A priority patent/IL285202B2/en
Priority to RU2018121254A priority patent/RU2018121254A/ru
Priority to MX2018005858A priority patent/MX2018005858A/es
Priority to CA3004435A priority patent/CA3004435A1/en
Priority to CN202210236083.9A priority patent/CN115044645A/zh
Priority to KR1020187016475A priority patent/KR102788327B1/ko
Priority to NZ742379A priority patent/NZ742379B2/en
Priority to EP16865029.9A priority patent/EP3374525B1/en
Priority to CN201680076637.6A priority patent/CN108431233B/zh
Priority to JP2018524250A priority patent/JP6913089B2/ja
Application filed by Resolution Bioscience Inc filed Critical Resolution Bioscience Inc
Priority to DK16865029.9T priority patent/DK3374525T3/da
Priority to BR112018009606-7A priority patent/BR112018009606B1/pt
Priority to AU2016353133A priority patent/AU2016353133B2/en
Priority to EP21152311.3A priority patent/EP3889257A1/en
Publication of WO2017083562A1 publication Critical patent/WO2017083562A1/en
Priority to US15/965,048 priority patent/US11339391B2/en
Priority to IL259237A priority patent/IL259237B/en
Anticipated expiration legal-status Critical
Priority to US17/587,230 priority patent/US20220267763A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1093General methods of preparing gene libraries, not provided for in other subgroups
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • C12Q1/6855Ligating adaptors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/191Modifications characterised by incorporating an adaptor

Definitions

  • the invention relates generally to improved compositions and methods for constructing DNA libraries.
  • the present invention relates to efficiently constructing DNA clone libraries for quantitative genetic analyses.
  • cfDNA cell-free DNA
  • tumor DNA is shed into the bloodstream in highly variable quantities ranging from ⁇ 0.1% to > 10% total circulating DNA.
  • Blood draws contain only a few nanograms of DNA and if tumor genomes are present at 0.1% of the total circulating DNA, then only 1 to 10 total copies of the tumor genome are present.
  • To unambiguously identify tumor DNA by sequence analysis it is necessary to observe two or more copies of a tumor-specific genetic lesion.
  • the need to maximize the detection sensitivity of DNA meaning accurate detection of tumor DNA in the 0.1% range has yet to be achieved
  • the invention relates generally to compositions and methods for high efficiency attachment of DNA adaptors to DNA fragments to generate DNA libraries for quantitative genetic analyses.
  • a method for increasing the efficiency of adaptor ligation to one or more DNA fragments comprising: removing the terminal phosphate residues of one or more DNA fragments; treating the dephosphorylated DNA fragments with one or more end- repair enzymes to generate end-repaired DNA; ligating one or more double-stranded DNA (dsDNA) pre-adaptors to the 3 ' end of each strand of the end-repaired DNA to form pre- adaptor/end-repaired DNA complexes, wherein each dsDNA pre-adaptor comprises a ligation strand oligonucleotide that is ligated to the 3 ' end of each strand of the end-repaired DNA, and a non-ligation partner strand oligonucleotide; displacing the non-ligation partner strand oligonucleotide from the pre-adaptor/end-repaired DNA complexes with a repair
  • each adaptor comprises the ligation strand oligonucleotide and the repair oligonucleotide; and treating the adaptor/end-repaired DNA complexes with one or more enzymes to form a contiguous, double-stranded, DNA library; wherein the efficiency of adapter ligation is increased compared to a method wherein dephosphorylated adapter molecules are ligated to
  • a method for constructing a DNA library comprising:
  • each dsDNA pre-adaptor comprises a ligation strand oligonucleotide that is ligated to the 3 ' end of each strand of the end-repaired DNA, and a non-ligation partner strand oligonucleotide; displacing the non-ligation partner strand oligonucleotide from the pre-adaptor/end-repaired DNA complexes with a repair oligonucleotide, to form adaptor/end- repaired DNA complexes, wherein each adaptor comprises the ligation strand oligonucleotide and the repair oligon
  • the non-ligation partner strand oligonucleotide comprises a modification at the 3 ' terminus that prevents its ligation to the 5 ' end of the end-repaired DNA and/or adaptor dimer formation.
  • the source of the one or more DNA fragments is DNA selected from the group consisting of: genomic DNA (gDNA), complementary DNA
  • cDNA cell-free DNA
  • cfDNA cell-free DNA
  • the source of the DNA is a biological sample selected from the group consisting of: blood, skin, hair, hair follicles, saliva, oral mucous, vaginal mucous, sweat, tears, epithelial tissues, urine, semen, seminal fluid, seminal plasma, prostatic fluid, pre-ejaculatory fluid (Cowper's fluid), excreta, biopsy, ascites, cerebrospinal fluid, lymph, and tissue extract sample or biopsy sample.
  • the source of the DNA is a biological sample selected from the group consisting of: amniotic fluid, blood, plasma, serum, semen, lymphatic fluid, cerebral spinal fluid, ocular fluid, urine, saliva, stool, mucous, and sweat.
  • the methods further comprise isolating the DNA from a biological sample of a subject.
  • the methods further comprise fragmenting the DNA from a biological sample of a subject.
  • the methods further comprise repairing damage of the one or more DNA fragments prior to ligation.
  • the damage is a deaminated cytosine (Uracil), an abasic site, methylation of guanine to 06MeG, DNA nicks, gaps, or a thymine dimer.
  • a method constructing a cfDNA library comprising: isolating or obtaining cfDNA from a biological sample of a subject; removing the terminal phosphate residues of the cfDNA; treating the dephosphorylated cfDNA with one or more end-repair enzymes to generate end-repaired cfDNA, and optionally to repair DNA damage; ligating one or more double-stranded DNA (dsDNA) pre-adaptors to the 3 ' end of each strand of the end- repaired cfDNA to form pre-adaptor/end-repaired cfDNA complexes, wherein each dsDNA pre-adaptor comprises a ligation strand oligonucleotide that is ligated to the 3 ' end of each strand of the end-repaired cfDNA, and a non-ligation partner strand oligonucleotide;
  • each adaptor comprises the ligation strand oligonucleotide and the repair oligonucleotide; treating the adaptor/end-repaired cfDNA complexes with one or more enzymes to form a contiguous, double-stranded, cfDNA library; and amplifying the cfDNA library to generate a cell-free DNA clone library is provided.
  • the ligation strand oligonucleotide comprises one or more modifications to prevent adaptor dimer formation, optionally wherein the modification of the 3 ' end of the no-ligation partner strand oligonucleotide prevents adaptor dimer formation.
  • the ligation strand oligonucleotide comprises an anchor sequence, a read code, or a PCR primer binding site.
  • the ligation strand oligonucleotide comprises an anchor sequence, a read code, and a PCR primer binding site.
  • the ligation strand oligonucleotide comprises one or more PCR primer binding sites for PCR amplification of the one or more contiguous, double-stranded, DNA library molecules.
  • the ligation strand oligonucleotide comprises one or more unique read codes.
  • the ligation strand oligonucleotide comprises one or more sample codes for sample multiplexing.
  • the ligation strand oligonucleotide comprises one or more sequences for DNA sequencing.
  • the ligation strand oligonucleotide comprises an anchor sequence.
  • the repair oligonucleotide comprises an anchor sequence, a read code, or a PCR primer binding site.
  • the repair oligonucleotide comprises an anchor sequence, a read code, and a PCR primer binding site.
  • the repair oligonucleotide comprises one or more primer binding sites for PCR amplification of the one or more contiguous, double-stranded, DNA library molecules.
  • the repair oligonucleotide comprises one or more unique read codes.
  • the repair oligonucleotide comprises one or more sample codes for sample multiplexing.
  • the repair oligonucleotide comprises one or more sequences for DNA sequencing.
  • the ligation strand oligonucleotide is complementary to the repair oligonucleotide.
  • the anchor sequence of the ligation strand oligonucleotide is complementary to the anchor sequence of the repair oligonucleotide.
  • the PCR primer binding site of the ligation strand is PCR primer binding site of the ligation strand
  • oligonucleotide is complementary to the PCR primer binding site of the repair
  • the one or more adaptors comprises a plurality of ligation strand oligonucleotide species.
  • the one or more adaptors comprises a plurality of repair oligonucleotide species.
  • the primer binding site of the ligation strand is the primer binding site of the ligation strand
  • oligonucleotide is not complementary to the primer binding site of the repair oligonucleotide.
  • the primer binding site of the ligation strand oligonucleotide is substantially different from the primer binding site of the repair oligonucleotide.
  • a primer that binds the primer binding site of the ligation strand oligonucleotide does not substantially bind the primer binding site of the repair oligonucleotide.
  • the DNA library is amplified to generate a DNA clone library.
  • qPCR is performed on the DNA clone library and a qPCR measurement is compared to standards of known genome equivalents to determine the genome equivalents of the DNA clone library.
  • the qPCR is performed with a primer that binds to an Alu sequence and a primer that binds to a sequence in an adaptor.
  • quantitative genetic analysis is performed on a plurality of genetic loci in the DNA clone library.
  • quantitative genetic analysis is performed on a plurality of genetic loci in a plurality of DNA clone libraries.
  • quantitative genetic analysis comprises hybridizing one or more capture probes to a target genetic locus to form capture probe module-DNA clone complexes.
  • quantitative genetic analysis comprises isolating the capture probe -DNA clone complexes.
  • the quantitative genetic analysis comprises amplification of the DNA clone sequence in the isolated capture probe-DNA clone complexes.
  • quantitative genetic analysis comprises DNA sequencing to generate a plurality of sequencing reads.
  • the methods further comprise bioinformatic analysis of the plurality of sequencing reads.
  • quantitative genetic analysis is performed on a plurality of genetic loci in the DNA clone library and wherein bioinformatic analysis is used: to quantify the number of genome equivalents analyzed in the DNA clone library; to detect genetic variants in a target genetic locus; to detect mutations within a target genetic locus; to detect genetic fusions within a target genetic locus; and/or to measure copy number fluctuations within a target genetic locus.
  • the quantitative genetic analysis is used to identify or detect one or more genetic lesions that cause or associated with the genetic disease.
  • the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion.
  • the genetic disease is cancer.
  • the quantitative genetic analysis is used to identify or detect one or more genetic variants or genetic lesions of one or more target genetic loci in fetal cfDNA.
  • the capture probe is a component of a capture probe module that is optionally duplexed with a hapten-labeled partner oligonucleotide that hybridizes to a tail sequence in the capture probe module.
  • a method of predicting, diagnosing, or monitoring a genetic disease in a subject comprising: isolating or obtaining DNA from a biological sample of a subject; removing the terminal phosphate residues of the DNA; treating the dephosphorylated DNA with one or more end-repair enzymes to generate end-repaired DNA; ligating one or more double-stranded DNA (dsDNA) pre-adaptors to the 3 ' end of each strand of the end- repaired DNA to form pre-adaptor/end-repaired DNA complexes, wherein each dsDNA pre- adaptor comprises a ligation strand oligonucleotide that is ligated to the 3 ' end of each strand of the end-repaired DNA, and a non-lig
  • oligonucleotide treating the adaptor/end-repaired DNA complexes with one or more enzymes to form a contiguous, double-stranded, DNA library; amplifying the DNA library to generate a DNA clone library; determining the number of genome equivalents in the DNA clone library; and performing a quantitative genetic analysis of one or more target genetic loci associated with the genetic disease in the DNA clone library, wherein the identification or detection of one or more genetic lesions in the one or more target genetic loci is prognostic for, diagnostic of, or monitors the progression of the genetic disease is provided.
  • the DNA is genomic DNA, DNA from formalin-fixed, paraffin embedded (FFPE) samples, cDNA, or cfDNA.
  • FFPE paraffin embedded
  • the cfDNA is isolated from a biological sample selected from the group of: amniotic fluid, blood, plasma, serum, semen, lymphatic fluid, cerebral spinal fluid, ocular fluid, urine, saliva, stool, mucous, and sweat.
  • the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion.
  • the genetic disease is cancer.
  • a companion diagnostic for a genetic disease comprising: isolating or obtaining DNA from a biological sample of a subject; removing the terminal phosphate residues of the DNA; treating the dephosphorylated DNA with one or more end- repair enzymes to generate end-repaired DNA; ligating one or more double-stranded DNA (dsDNA) pre-adaptors to the 3 ' end of each strand of the end-repaired DNA to form pre- adaptor/end-repaired DNA complexes, wherein each dsDNA pre-adaptor comprises a ligation strand oligonucleotide that is ligated to the 3 ' end of each strand of the end-repaired DNA, and a non-ligation partner strand oligonucleotide; displacing the non-ligation partner strand oligonucleotide from the pre-adaptor/end-repaired DNA complexes with a repair
  • each adaptor comprises the ligation strand oligonucleotide and the repair oligonucleotide; treating the adaptor/end-repaired DNA complexes with one or more enzymes to form a contiguous, double-stranded, DNA library; amplifying the DNA library to generate a DNA clone library; determining the number of genome equivalents in the DNA clone library; and performing a quantitative genetic analysis of one or more biomarkers associated with the genetic disease in the DNA clone library, wherein detection of, or failure to detect, at least one of the one or more biomarkers indicates whether the subject should be treated for the genetic disease is provided.
  • the DNA is genomic DNA, DNA from formalin-fixed, paraffin embedded (FFPE) samples, cDNA, or cfDNA.
  • FFPE paraffin embedded
  • the cfDNA is isolated from a biological sample selected from the group consisting of: amniotic fluid, blood, plasma, serum, semen, lymphatic fluid, cerebral spinal fluid, ocular fluid, urine, saliva, stool, mucous, and sweat.
  • the biomarker is a genetic lesion.
  • the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion.
  • the genetic disease is cancer.
  • Figure 1 shows conventional versus high efficiency (HE) ligation technology.
  • A Target DNA fragments are 5 ' phosphorylated prior to DNA ligation with unphosphorylated duplex adapters.
  • B A common inefficiency with conventional ligation approaches is that 5 ' target DNA fragment ends lacking a phosphate group fails to ligate with unphosphorylated duplex adapters.
  • C Ligation of target DNA fragments to one another.
  • D Duplex adaptor comprising a 5 ' phosphate group required is ligated to 3 ' end of target DNA fragment The hatched circle one the partner strand oligonucleotide of the adaptor represents a 3 ' blocking group.
  • E The 3 ' blocking group also prevents adaptors from ligating to one another.
  • F Occasional adaptor duplexes lacking a 5 ' phosphate fail to ligate to target fragments.
  • Figure 2 shows a representative image of an agarose gel of the complete ligation of Rsal digested, dephosphorylated pUC19 plasmid to a series of nine different HE adaptors. Unligated fragments are indicated in the control lane, which is next to the molecular weight (MW) markers of 740, 500, 300, and 150 bp (top to bottom). The complete shift in the mobility of the three vector fragments (arrows) indicates the complete ligation of adaptors to both ends across all nine adaptors. These results show that the HE ligation technology is generalizable.
  • MW molecular weight
  • FIG. 3 shows exemplary methods of completing HE ligated constructs.
  • the HE ligation product is a 3 ' extended adaptor oligonucleotide attached to the 3 ' end of fragments.
  • One strategy for "repairing" the initial ligation product is to add a repair oligonucleotide (top strand; green); T4 polynucleotide kinase can add a phosphate (P) to the 5 ' end of the target fragment, and a nick sealing ligase such as Taq DNA ligase can be used to ligate the repair oligonucleotide to the target fragment.
  • a repair oligonucleotide top strand; green
  • T4 polynucleotide kinase can add a phosphate (P) to the 5 ' end of the target fragment
  • a nick sealing ligase such as Taq DNA ligase can be used to ligate the repair oligonucle
  • C An alternative strategy is to combine the complementary adaptor oligonucleotide, a DNA polymerase that has 5 ' to 3 ' exonuclease activity ⁇ e.g., Bstl DNA polymerase), and a Taq DNA ligase.
  • the Bstl DNA polymerase extends the repair oligonucleotide by removing 5 ' bases from the target fragment to expose 5 ' phosphates that enable nick-sealing ligation by the Taq DNA ligase.
  • Complementary adaptor oligonucleotides can also be designed to introduce additional sequence features into the original HE ligation strand with the Bstl ON A polymerase.
  • Figure 4 shows the preparation of DNA libraries using HE ligation technology.
  • DNA fragments can possess heterogeneous, "ragged" ends that may or may not possess phosphate groups (P). Treatment of the DNA fragments with a phosphatase removes exposed 5 ' and 3 ' phosphates. The DNA can then be treated with enzymes that repair DNA damage such as deaminated cytosines (U), abasic sites ( ⁇ ), and thymine dimers, and that "polish” 5 ' or 3 ' overhangs to blunt ends.
  • U deaminated cytosines
  • abasic sites
  • thymine dimers thymine dimers
  • a duplex adaptor comprising a 5 ' phosphorylated ligation strand and a 3 ' blocked partner strand is ligated to the target fragments.
  • the partner strand which has a melting temperature of ⁇ 30°C, is removed in subsequent steps that occur at temperatures > 37°C.
  • repair oligonucleotides are annealed to the adaptor ligated fragments; the repair oligonucleotides become covalently attached to the 5 ' end of the target fragment either using a kinase/ligase strategy or a polymerase/exonuclease/ligase strategy ( Figure 3).
  • Primer extension of the initial ligation strand copies the repair oligo information into a full-length adaptor duplex that is suitable for downstream analysis.
  • Figure 5 shows a FIE ligation technology strategy for generating dual PCR primer adapted DNA fragments.
  • the ligation strand carries additional sequences (primer 2) that serve as an independent primer binding site.
  • the repair oligonucleotide while complementary to a portion of the ligation strand, has its own divergent sequence that serves as a second PCR primer binding site (primer 1).
  • the fully completed adaptors allow amplification of the DNA specimen fragments using more conventional, universal dual-primer PCR methods.
  • the present invention contemplates, in part, compositions and methods to address the acute need in the field of quantitative genetic analyses for improved, highly-efficient methods to clone such DNA fragments for downstream analysis.
  • Current methods for DNA analysis comprise ligation of specialized adaptors to DNA fragments ( Figure 1).
  • target DNA fragments are 5 '
  • the target DNA fragment and adaptor may be blunt-ended, or they may share complementary overhangs (e.g., T/A).
  • T/A complementary overhangs
  • the present invention contemplates, in part, compositions and methods for efficiently attaching adaptor sequences to target DNA fragments.
  • phosphates are removed from both the 5 ' and 3 ' termini of target DNA fragments.
  • These dephosphorylated fragments are then treated with enzymes that create blunt DNA ends and optionally with enzymes that that repair many types of DNA damage that may have been inflicted on the DNA, e.g., deaminated cytosine (Uracil), an abasic site, methylation of guanine to 0 6 MeG, nicks, double strand breaks, or a thymine dimer.
  • the adaptor comprises a ligation strand oligonucleotide duplexed with a non-ligation partner strand oligonucleotide.
  • the ligation strand of the adaptor carries the 5 ' phosphate group required for ligation to target DNA fragments and the partner strand comprises a 3 ' blocking group ( Figure ID).
  • the 3 ' blocking group prevents the formation of adaptor: adaptor dimers ( Figure IE).
  • adaptor dimers Figure IE
  • compositions and methods contemplated herein for high efficiency construction of DNA libraries provide a novel comprehensive framework address molecular genetic analysis using DNA available from a variety of biological sources. Cloning of purified DNA introduces tagged DNA sequences that inform downstream analysis and enable amplification of the resulting clone libraries. Hybrid capture with target specific oligonucleotides is used to retrieve specific sequences for subsequent analysis. Independent measurements of the number of genomes present in the library are applied to each sample, and these assays provide a means to estimate the assay's sensitivity.
  • the assays contemplated herein provide reliable, reproducible, and robust methods for the analysis, detection, diagnosis, or monitoring of genetic states, conditions, or disease.
  • the term "about” or “approximately” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
  • the term "about” or “approximately” refers a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length ⁇ 15%, ⁇ 10%, ⁇ 9%, ⁇ 8%, ⁇ 7%, ⁇ 6%, ⁇ 5%, ⁇ 4%, ⁇ 3%, ⁇ 2%, or ⁇ 1% about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
  • isolated means material that is substantially or essentially free from components that normally accompany it in its native state.
  • the term "obtained” or “derived” is used synonymously with isolated.
  • DNA refers to deoxyribonucleic acid.
  • DNA refers to genomic DNA, recombinant DNA, synthetic DNA, complementary DNA (cDNA), or cell-free DNA (cfDNA).
  • DNA refers to genomic DNA or cDNA.
  • DNA refers to cfDNA.
  • the DNA is a DNA fragment that comprises a "target region,” which is also referred to as a target DNA fragment in certain embodiments.
  • DNA libraries contemplated herein include genomic DNA libraries, cfDNA libraries, and cDNA libraries constructed from RNA, e.g., an RNA expression library.
  • the DNA libraries comprise one or more additional DNA sequences and/or tags.
  • a “target genetic locus” or “DNA target region” refers to a region of interest within a DNA sequence. In various embodiments, targeted genetic analyses are performed on the target genetic locus.
  • the DNA target region is a region of a gene that is associated with a particular genetic state, genetic condition, genetic diseases; fetal testing; genetic mosaicism, paternity testing; predicting response to drug treatment;
  • circulating DNA As used herein, the terms “circulating DNA,” “circulating cell-free DNA” and “cell- free DNA” are often used interchangeably and refer to DNA that is extracellular DNA, DNA that has been extruded from cells, or DNA that has been released from necrotic or apoptotic cells.
  • a "subject,” “individual,” or “patient” as used herein, includes any animal that exhibits a symptom of a condition that can be detected or identified with compositions contemplated herein. Suitable subjects include laboratory animals (such as mouse, rat, rabbit, or guinea pig), farm animals (such as horses, cows, sheep, pigs), and domestic animals or pets (such as a cat or dog). In particular embodiments, the subject is a mammal. In certain embodiments, the subject is a non-human primate and, in preferred embodiments, the subject is a human.
  • reaction vessel means a container suitable for carrying out one of the reactions contemplated herein.
  • reaction vessels suitable for use in particular embodiments include, but are not limited to test tubes, microfuge tubes (e.g., PCR tubes), microtitre plates (e.g., 96 well plates, 384 well plates, 1536 well plates), slides, plates, arrays, and microarrays.
  • methods of constructing DNA libraries contemplated herein comprise high efficiency ligation of adaptors to target DNA fragments.
  • DNA suitable for use in the compositions and methods contemplated herein can come from any source known to those of skill in the art.
  • the DNA is genomic DNA isolated from any source, copy DNA (cDNA) synthesized from RNA, or cell-free DNA (cfDNA).
  • the DNA is high molecular weight DNA (>1000 bp).
  • Use of high molecular weight DNA in the compositions and methods contemplated herein often comprises a fragmentation step.
  • the high molecular weight DNA can be fragmented to about 25 to about 750 base pairs, about 25 to about 500 base pairs, about 25 to about 250 base pairs, about 25 to about 200 base pairs, about 25 to about 150 base pairs, about 25 to about 100 base pairs, about 25 to about 50 base pairs, about 100 to about 200 base pairs, about 150 to about 180 base pairs, about 150 base pairs, about 155 base pairs, about 160 base pairs, about 165 base pairs, about 170 base pairs, about 175 base pairs, or about , about 180 base pairs.
  • compositions and methods contemplated herein include, but are not limited to:
  • any method known in the art for fragmenting DNA can be employed with the present invention.
  • Illustrative sources of genomic DNA and RNA (to generate cDNA) suitable for use in particular embodiments of the compositions and methods contemplated herein include, but are not limited to biological samples selected from the group consisting of: brain tissue, bone tissue, ocular tissue, olfactory tissue, muscles tissue, heart tissue, lung tissue, liver tissue, pancreatic tissue, kidney tissue, gastric tissue, intestinal tissue, colon tissue, blood, skin, hair, hair follicles, saliva, oral mucous, vaginal mucous, sweat, tears, epithelial tissues, urine, semen, seminal fluid, seminal plasma, prostatic fluid, pre-ejaculatory fluid (Cowper's fluid), excreta, biopsy, ascites, cerebrospinal fluid, lymph, and tissue extract sample or biopsy sample, and the like.
  • biological samples selected from the group consisting of: brain tissue, bone tissue, ocular tissue, olfactory tissue, muscles tissue, heart tissue, lung tissue, liver tissue, pancreatic tissue, kidney tissue, gas
  • the DNA is cfDNA.
  • the size distribution of cfDNA ranges from about 150 bp to about 180 bp fragments. Fragmentation may be the result of endonucleolytic and/or exonucleolytic activity and presents a daunting challenge to the accurate, reliable, and robust analysis of cfDNA.
  • Another challenge for analyzing cfDNA is its short half-life in the blood stream, on the order of about 15 minutes.
  • the present invention contemplates, in part, that analysis of cfDNA is like a "liquid biopsy" and is a real-time snapshot of current biological processes.
  • cfDNA isolated from the blood plasma fraction can be substantially contaminated with long (>10 kilobase pair), high-molecular weight genomic DNA that is liberated from nucleated blood cells that lyse during the collection protocol. This long, contaminating DNA, if left unfragmented, does not clone and amplify well and is therefore lost during downstream library preparation.
  • the high-efficiency DNA library construction methods contemplated herein selectively clones shorter ( ⁇ 1000 bp) fragments from a collection of fragment sizes present in a DNA specimen.
  • the selective cloning of short cfDNA fragments from a DNA specimen that is a blend of long and short fragments is advantageous in the construction of a liquid biopsy.
  • Illustrative examples of biological samples that are suitable sources from which to isolate cfDNA in particular embodiments include, but are not limited to amniotic fluid, blood, plasma, serum, semen, lymphatic fluid, cerebral spinal fluid, ocular fluid, urine, saliva, mucous, and sweat.
  • the biological sample is blood or blood plasma.
  • the DNA sample could be derived from embedded tissues such as FFPE or fine needle aspirates, from swabs intended to interrogate microbiome sequences present, from forensic samples such as hair, clothing, fingerprints, etc. or from any other source of DNA requiring the library construction methods contemplated herein that are especially efficient for constructing libraries from low-input DNA samples.
  • embedded tissues such as FFPE or fine needle aspirates
  • swabs intended to interrogate microbiome sequences present from forensic samples such as hair, clothing, fingerprints, etc. or from any other source of DNA requiring the library construction methods contemplated herein that are especially efficient for constructing libraries from low-input DNA samples.
  • kits and other methods known to the skilled artisan can used to isolate cfDNA directly from the biological samples of a patient or from a previously obtained and optionally stabilized biological sample, e.g., by freezing and/or addition of enzyme chelating agents including, but not limited to EDTA, EGTA, or other chelating agents specific for divalent cations.
  • enzyme chelating agents including, but not limited to EDTA, EGTA, or other chelating agents specific for divalent cations.
  • the input DNA e.g., target DNA fragments
  • the input DNA is first treated with a thermo-labile phosphatase that removes terminal phosphate residues. See, e.g., Figure 4A.
  • thermo-labile phosphatases that are suitable for use in particular embodiments of the compositions and methods contemplated herein include, but are not limited to APexTM Heat-Labile Alkaline Phosphatase (Epicentre Biotechnologies), NTPhosTM Thermolabile Phosphatase (Epicentre Biotechnologies), HKTM Thermolabile Phosphatase (Epicentre Biotechnologies), and Shrimp Alkaline Phosphatase (SAP; NEB).
  • APexTM Heat-Labile Alkaline Phosphatase Epicentre Biotechnologies
  • NTPhosTM Thermolabile Phosphatase Epicentre Biotechnologies
  • HKTM Thermolabile Phosphatase Epicentre Biotechnologies
  • SAP Shrimp Alkaline Phosphatase
  • thermo-labile phosphatase is SAP.
  • the input DNA or dephosphorylated DNA is also treated with one or more enzymes that reverse common sources of DNA damage such as deamination of cytosines to uracil, oxidative addition to guanines, thymidine dimers, loss of bases leading to abasic sites, nicks or gaps on one strand of duplex DNA, etc. See, e.g., Figure 4A.
  • the internal damage to the DNA is reversed using a composition comprising one or more of the following enzymes: Taq DNA Ligase, Endonuclease IV, Bst DNA Polymerase, Fpg (8-oxoguanine DNA glycosylase), Uracil-DNA Glycosylase (UDG), T4 PDG (T4 Endonuclease V), Endonuclease VIII, and T4 DNA polymerase.
  • Taq DNA Ligase Endonuclease IV
  • Bst DNA Polymerase Fpg (8-oxoguanine DNA glycosylase), Uracil-DNA Glycosylase (UDG), T4 PDG (T4 Endonuclease V), Endonuclease VIII, and T4 DNA polymerase.
  • the internal damage to the DNA is reversed using a composition comprising Taq DNA Ligase, Endonuclease IV, Bst DNA Polymerase, Fpg, Uracil-DNA Glycosylase (UDG), T4 PDG (T4 Endonuclease V), Endonuclease VIII, and T4 DNA polymerase.
  • compositions and methods contemplated herein comprise generating end-repaired DNA fragments.
  • the DNA fragments are end-repaired to generate end-repaired DNA fragments with blunt ends, 5'- overhangs, or 3 '-overhangs. See, e.g., Figure 4A.
  • the DNA is cfDNA.
  • the end-repaired DNA contains blunt ends. In some embodiments, the end-repaired DNA is processed to contain blunt ends. In preferred embodiments, the DNA fragments are end-repaired by one or more end-repair enzymes to generate end-repaired DNA fragments with blunt ends.
  • Illustrative examples of end-repair enzymes suitable for generating blunt-ended DNA fragments in particular embodiments of the compositions and methods contemplated herein include DNA polymerases which retains polymerization activity and 3 ' ⁇ 5 ' exonuclease activity, but that lacks 5 ' ⁇ 3 ' exonuclease activity (e.g., T4 DNA polymerase, Klenow fragment of DNA polymerase I, etc.). The DNA polymerase is used to either fill in 5' overhangs or "chew back" 3 ' overhangs, leaving the DNA fragments with blunt ends.
  • DNA polymerase is used to either fill in 5' overhangs or "chew back" 3 ' overhangs, leaving the DNA fragments with blunt ends.
  • the blunt ends of the end-repaired DNA are further modified to contain a single base pair overhang.
  • end-repaired DNA containing blunt ends can be further processed to contain adenine (A)/thymine (T) overhang.
  • end-repaired DNA containing blunt ends can be further processed to contain adenine (A)/thymine (T) overhang as the single base pair overhang.
  • the end-repaired DNA has non-templated 3' overhangs.
  • the end- repaired DNA is processed to contain 3' overhangs.
  • the end-repaired DNA is processed with terminal transferase (TdT) to contain 3' overhangs.
  • a G-tail can be added by TdT.
  • the end-repaired DNA is processed to contain overhang ends using partial digestion with any known restriction enzymes (e.g., with the enzyme Sau3A, and the like).
  • compositions and methods contemplated herein comprise ligating a duplex DNA pre-adaptor to each end of the end-repaired DNA.
  • pre-adaptor refers to a double-stranded DNA molecule or DNA duplex that comprises a ligation strand oligonucleotide and a partner strand
  • the pre-adapter may be ligated to the end-repaired DNA fragments using any suitable ligase.
  • the ligase is T4 DNA ligase. See, e.g., Figures 4B and 5.
  • the "ligation strand oligonucleotide” is a polynucleotide that comprises a 5 ' phosphate and is capable of being ligated to each 3 ' end of the end-repaired DNA fragment.
  • the "partner strand oligonucleotide” is complementary to, and anneals to, a portion of, or to all of, the nucleotides of the ligation strand oligonucleotide.
  • the partner strand oligonucleotide comprises a modification at its 3 ' end that prevents or substantially inhibits the partner strand oligonucleotide from being ligated to another adapter or to a phosphorylated 5 ' end of a target DNA fragment.
  • Chemical modifications of the 3 ' end of the partner stand that can block ligation include, but are not limited to dideoxy ribose nucleotide analogs, 2- hydroxyl deoxyribose ribose analogs, and a broad variety of chemical modification to the ribose sugar.
  • the ligation strand oligonucleotide can vary in length from the minimum length required to form a stable DNA duplex at temperatures where DNA ligase is active ( ⁇ 5 nt) to oligonucleotides that push the limits of current synthesis capabilities (>200 nt).
  • the ligation strand oligonucleotide is about 8 to about 60 nucleotides or about 8 to about 15 nucleotides.
  • the DNA bases incorporated by the ligation strand are used by the sequencing instrument to calibrate DNA base calls throughout the DNA sequencing run.
  • the instrument and software of these instruments require that all four DNA bases be present at every base position throughout the length of the initial 8 - 15 nucleotides sequenced, and this often includes bases embedded in the ligation adaptor strand. For this reason, sets of four ligation strands that mutually possess all four bases across the length of the ligation strand sequence are often used.
  • Non-limiting examples of such ligation strand oligonucleotides are shown in Tables 1 and 2.
  • the ligation strand oligonucleotide comprises the following elements: (i) a PCR primer binding site for the single-primer library amplification; (ii) a 5 nucleotide read code that acts to uniquely identified each sequencing read; (iii) an 8 to 15 nucleotide anchor sequence that acts as a sample identification sequence, enables sample multiplexing within a sequencing run; enables calibration of proper base calls in sequencing reads, and acts as an anchor for hybridization to a partner strand oligonucleotide.
  • the ligation strand oligonucleotide comprises an 8 to 15 nucleotide anchor sequence that acts as a sample identification sequence, enables sample multiplexing within a sequencing run; enables calibration of proper base calls in sequencing reads, and acts as an anchor for hybridization to a partner strand oligonucleotide.
  • a ligation strand oligonucleotide comprises one or more PCR primer sequences, one or more read codes, one or more sample codes, one or more anchor sequences, or two or more 3 ' nucleotides that are efficient ligation substrates.
  • the ligation strand oligonucleotide further comprises one or more sequencing primer binding sites.
  • a ligation strand oligonucleotide comprises one or more PCR primer binding sequences for amplification of a DNA library.
  • the PCR primer binding sequence is about 12 to about 40 nucleotides, about 18 to about 40 nucleotides, about 20 to about 35 nucleotides, or about 20 to about 30 nucleotides.
  • the PCR primer binding sequence is about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, or about 40 nucleotides or more.
  • the PCR primer binding sequence is about 25 nucleotides.
  • a ligation strand oligonucleotide comprises one or more read code sequences.
  • the term "read code” refers to a polynucleotide that is used to identify unique sequencing reads.
  • the read code is a random sequence of nucleotides.
  • the read code is about 1 nucleotide, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6
  • nucleotides about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides, or more.
  • a 5 nucleotide read code consists of 256 possible unique sequences where each code chosen is 2 nucleotides different from every other code in the set. This feature enables unique and distinct reads to be differentiated from reads that appear to be unique owing to a sequencing error in the code region.
  • codes that have been empirically determined to interfere with adaptor function, owing to particular sequence combinations may be excluded from use, e.g., seven codes of the 256 had an overrepresentation of G nucleotides and were excluded.
  • each read code of 5, 6, 7, 8, 9, 10 or more nucleotides may differ by 2, 3, 4, or 5 nucleotides from every other read code.
  • the read code is about 5 nucleotides and optionally, differs from every other read code by 2 nucleotides.
  • a ligation strand oligonucleotide comprises one or more sample code sequences.
  • sample code refers to a polynucleotide that is used to identify the sample.
  • the sample code is also useful in establishing multiplex sequencing reactions because each sample code is unique to the sample and thus, can be used to identify a read from a particular sample within a multiplexed sequencing reaction.
  • the sample code comprises sequence that is about 1, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, or about 5 nucleotides, or more. In another embodiment, each sample code of 2, 3, 4, 5 or more nucleotides may differ from every other sample code by 2, 3, 4, or 5 nucleotides.
  • the sample code is about three nucleotides and differs from every other sample code used in other samples by two nucleotides.
  • a ligation strand oligonucleotide comprises a one or more anchor sequences.
  • an “anchor sequence” refers to a nucleotide sequence of at least 8 nucleotides, at least 10 nucleotides, at least 12 nucleotides, at least 14 nucleotides, or at least 16 nucleotides that hybridizes to a partner strand oligonucleotide and that comprises the following properties: (1) each anchor sequence is part of a family of four anchor sequences that collectively represent each of the four possible DNA bases at each site within extension; this feature, balanced base representation, is useful to calibrate proper base calling in sequencing reads in particular embodiments; and (2) each anchor sequence is composed of equal numbers of A+C and G+T, and thus, each anchor sequence shares roughly the same melting temperature and duplex stability as every other anchor sequence in a set of four.
  • the anchor sequence or a portion thereof also serves to identify the sample, enables sample multiplexing within a sequencing run, enable calibration of proper base calls in sequencing reads, and act as an anchor for hybridization to a partner strand oligonucleotide.
  • the partner strand oligonucleotide is at least partially complementary (>5 nt) to the ligation strand oligonucleotide in the region that forms the phosphorylated blunt end.
  • the 3 ' end of the partner strand oligonucleotide is modified to block or substantially inhibit the oligonucleotide from becoming a ligation substrate, particular in the formation of self-ligated adaptor dimers.
  • the partner strand oligonucleotide is designed to form a stable duplex with the ligation strand at temperatures where ligations are performed ( ⁇ 22°C) but is also designed to dissociate from the ligation strand oligonucleotide at temperatures where a repair oligonucleotide is incorporated into the adaptor (> 37°C).
  • This design consideration is depicted as the dissociated partner strand oligonucleotide shown in Figures 4B and 5 in the generation of the adaptor/end-repaired DNA complexes, as the reaction is shifted from ligation to the adaptor completion step that is mediated by repair oligonucleotides.
  • compositions and methods contemplated herein comprise a ligation step wherein a pre-adaptor is ligated to the end-repaired DNA to generate a "tagged" DNA library.
  • a single species of pre-adaptor is employed.
  • two, three, four or five species of pre-adaptors are employed.
  • a pre-adaptor of identical sequence is ligated to each end of the fragmented end-repaired DNA.
  • a plurality of pre-adaptor species is ligated to an end-repaired DNA library.
  • Each of the plurality of pre-adaptors may comprise one or more primer binding site for amplification of the DNA library, one or more read code sequences, one or more sequences for sample multiplexing, one or more anchor sequences, or one or more sequences for DNA sequencing.
  • compositions and methods contemplated herein comprise displacing the partner strand oligonucleotide from the pre-adaptor/end-repaired DNA complex and replacing the displaced partner strand oligonucleotide with a repair oligonucleotide to generate an adaptor/end-repaired DNA complex.
  • the design of the adaptor can be manipulated to enable single primer or dual primer amplification strategies. See, e.g., Figures 4A, and 5.
  • compositions and methods contemplated herein comprise a ligation step wherein an adaptor comprising a ligation strand oligonucleotide and a repair oligonucleotide is ligated to the end-repaired DNA to generate a "tagged" DNA library.
  • an adaptor comprising a ligation strand oligonucleotide and a repair oligonucleotide is ligated to the end-repaired DNA to generate a "tagged" DNA library.
  • a single species of adaptor is employed.
  • two, three, four or five species of adaptors are employed.
  • an adaptor of identical sequence is ligated to each end of the fragmented end-repaired DNA.
  • the design considerations of the partner strand oligonucleotide allow it to be displaced from the pre-adaptor/end-repaired DNA complex because it dissociates from the ligation strand oligonucleotide at temperatures at which the repair oligonucleotide anneals to the ligation strand oligonucleotide (e.g., > 37°C) and at temperatures at which the enzymatic steps are carried out to incorporate the repair oligonucleotide into an adaptor/end-repaired DNA complex generate a contiguous, double-stranded, DNA library molecule (e.g., > 37°C).
  • repair oligonucleotide refers to a polynucleotide sequence that is complementary to, and anneals to, a portion of, or to all of, the nucleotides of the ligation strand oligonucleotide.
  • the repair oligonucleotide can vary in length from the minimum length required to form a stable DNA duplex at temperatures where DNA ligase is active ( ⁇ 8 nt) to oligonucleotides that push the limits of current synthesis capabilities (>200 nt).
  • the "repair oligonucleotide” includes additional, functional DNA sequences that are not necessarily present in the ligation strand oligonucleotide.
  • the ligation strand oligonucleotide is about 8 to about 15 nucleotides and the repair oligonucleotide is 35 to 60 nucleotides.
  • the sequence of the ligand strand oligonucleotide is extended by primer extension and generates a nucleotide sequence complementary to the repair oligonucleotide. This design would yield identical PCR primer binding sites. Identical PCR primer binding sites allows for a single primer library amplification strategy. See, e.g., Figures 3D and 4A.
  • the ligation strand oligonucleotide is about 35 to about 60 nucleotides and the repair oligonucleotide is completely complementary to the ligation strand oligonucleotide.
  • Identical PCR primer binding sites allows for a single primer library amplification strategy. See, e.g., Figure 4A.
  • the ligation strand oligonucleotide is about 35 to about 60 nucleotides and the repair oligonucleotide is about 35 to about 60 nucleotides and the two oligonucleotides are complementary but for the PCR primer binding sites.
  • Different PCR primer binding sites allows for a dual primer library amplification strategy. See, e.g., Figure 5.
  • the ligation strand oligonucleotide comprises the following elements: (i) a PCR primer binding site for the single-primer library amplification; (ii) a 5 nucleotide read code that acts to uniquely identified each sequencing read; (iii) an 8 to 15 nucleotide anchor sequence that is partially or completely complementary to the anchor sequence of the ligation strand oligonucleotide.
  • the ligation strand oligonucleotide comprises an 8 to 15 nucleotide anchor sequence that is partially or completely complementary to the anchor sequence of the ligation strand oligonucleotide.
  • a repair oligonucleotide comprises one or more PCR primer sequences, one or more read codes, one or more sample codes, one or more anchor sequences, or two or more 3 ' nucleotides that are efficient ligation substrates.
  • the repair oligonucleotide further comprises one or more sequencing primer binding sites.
  • a repair oligonucleotide comprises (i) one or more PCR primer binding sequences that are complementary to the PCR primer binding sites in the ligation strand oligonucleotide (enables single-primer DNA library amplification) or (ii) one or more PCR primer binding sequences that are not complementary to the PCR primer binding sites in the ligation strand oligonucleotide (enables dual-primer DNA library amplification.
  • the PCR primer binding sequence is about 12 to about 40 nucleotides, about 18 to about 40 nucleotides, about 20 to about 35 nucleotides, or about 20 to about 30 nucleotides.
  • the PCR primer binding sequence is about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, or about 40 nucleotides or more.
  • the PCR primer binding sequence is about 25 nucleotides.
  • a repair oligonucleotide comprises one or more read code sequences.
  • the read code is a random sequence of nucleotides.
  • the read code is about 1 nucleotide, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6 nucleotides, about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides, or more.
  • a 5 nucleotide read code consists of 256 possible unique sequences where each code chosen is 2 nucleotides different from every other code in the set. This feature enables unique and distinct reads to be differentiated from reads that appear to be unique owing to a sequencing error in the code region.
  • codes that have been empirically determined to interfere with adaptor function, owing to particular sequence combinations may be excluded from use, e.g., seven codes of the 256 had an overrepresentation of G nucleotides and were excluded.
  • each read code of 5, 6, 7, 8, 9, 10 or more nucleotides may differ by 2, 3, 4, or 5 nucleotides from every other read code.
  • the read code is about 5 nucleotides and optionally, differs from every other read code by 2 nucleotides.
  • a repair oligonucleotide comprises one or more sample code sequences.
  • the sample code comprises sequence that is about 1, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, or about 5 nucleotides, or more.
  • each sample code of 2, 3, 4, 5 or more nucleotides may differ from every other sample code by 2, 3, 4, or 5 nucleotides.
  • the sample code is about three nucleotides and differs from every other sample code used in other samples by two nucleotides.
  • a repair oligonucleotide comprises a one or more anchor sequences complementary to the one or more anchor sequences of the ligation strand oligonucleotide.
  • the partner strand oligonucleotide is displaced from the pre- adaptor/end-repaired DNA complex; repair oligonucleotide is added and allowed to anneal to the ligation strand; polynucleotide kinase, e.g., T4 polynucleotide kinase, is used to add a phosphate group to the 5 ' end of the end-repaired DNA fragment; and DNA ligase is used to repair the nick that exists between the 5 ' end of the repair oligonucleotide and the 3 ' end of the end-repaired DNA fragment.
  • polynucleotide kinase e.g., T4 polynucleotide kinase
  • the DNA ligase is a thermostable nick-specific ligase that has activity across a broad range of temperatures, including, but not limited to Taq DNA ligase, E. coli DNA ligase, 9° North ligase (NEB), and any other ligase that can seal a phosphorylated nick. See, e.g., Figures 3A and 3B.
  • the partner strand oligonucleotide is displaced from the pre- adaptor/end-repaired DNA complex; repair oligonucleotide is added and allowed to anneal to the ligation strand; a low processivity DNA polymerase that has a 5 ' - 3 ' exonuclease activity (and no intrinsic 3 ' - 5 ' exonuclease activity) extends the 3 ' end of ligation strand oligonucleotide and in addition, removes the dephosphorylated 5 ' terminal nucleotide and adjacent nucleotides with a 5 ' - 3 ' exonuclease activity thereby exposing ligatable 5 ' phosphate groups and replacing them with incorporated bases that leave behind a nick when the enzyme dissociates; and DNA ligase, e.g., Taq DNA ligase, is used to repair the nicks.
  • DNA ligase e.g., Taq DNA liga
  • low processivity DNA polymerases suitable for use in particular embodiments of the compositions and methods contemplated herein include, but are not limited to Taq DNA polymerase, and BstlONA polymerase.
  • methods contemplated herein comprise amplification of a DNA library to generate a DNA clone library or a library of DNA clones.
  • the DNA is cfDNA.
  • Each molecule of the DNA library comprises an adaptor ligated to each end of an end-repaired DNA, and each adaptor comprises one or more PCR primer binding sites.
  • different adaptors are ligated to different ends of the end-repaired DNA.
  • the same adaptor is ligated to both ends of the DNA. Ligation of the same adaptor to both ends of end-repaired DNA allows for PCR amplification with a single primer sequence. In particular embodiments, a portion of the adaptor ligated-DNA library will be amplified using standard PCR techniques with a single primer sequence driving amplification. In one embodiment, the single primer sequence is about 25 nucleotides, optionally with a projected Tm of > 55° C under standard ionic strength conditions.
  • the adaptor ligated to the 3 ' end of an end-repaired DNA fragment comprises a different PCR primer binding site from the adaptor ligated to the 5 ' end of the end-repaired DNA fragment.
  • a portion of the adaptor ligated- DNA library will be amplified using standard PCR techniques with two primers riving amplification.
  • picograms of the initial DNA library are amplified into micrograms of DNA clones, implying a 10,000-fold amplification.
  • the amount of amplified product can be measured using methods known in the art, e.g., quantification on a Qubit 2.0 or Nanodrop instrument.
  • a method for genetic analysis of DNA is provided.
  • the DNA is cfDNA.
  • cfDNA is cell-free DNA that is found in plasma or other bodily fluids.
  • a method for genetic analysis of DNA comprises:
  • a method for genetic analysis of DNA comprises determining the number of genome equivalents in the DNA clone library.
  • Geno equivalent refers to the number of genome copies in each library.
  • An important challenge met by the compositions and methods contemplated herein is achieving sufficient assay sensitivity to detect and analysis rare genetic mutations or differences in genetic sequence.
  • To determine assay sensitivity value on a sample-by-sample basis the numbers of different and distinct sequences that are present in each sample are measured, by measuring the number of genome equivalents that are present in a sequencing library. To establish sensitivity, the number of genome equivalents must be measured for each sample library.
  • the number of genome equivalents can be determined by qPCR assay or by using bioinformatics-based counting after sequencing is performed.
  • qPCR measurement of genome equivalents is used as a QC step for DNA libraries. It establishes an expectation for assay sensitivity prior to sequence analysis and allows a sample to be excluded from analysis if its corresponding DNA clone library lacks the required depth of genome equivalents.
  • bioinformatics-based counting of genome equivalents is also used to identify the genome equivalents - and hence the assay sensitivity and false negative estimates - for each given DNA clone library.
  • the empirical qPCR assay and statistical counting assays should be well correlated. In cases where sequencing fails to reveal the sequence depth in a DNA clone library, reprocessing of the DNA clone library and/or additional sequencing may be required.
  • the genome equivalents in a DNA clone library are determined using a quantitative PCR (qPCR) assay.
  • qPCR quantitative PCR
  • a standard library of known concentration is used to construct a standard curve and the measurements from the qPCR assay are fit to the resulting standard curve and a value for genome equivalents is derived from the fit.
  • the number of genome equivalents measured by the repeat-based assays provides a more consistent library-to-library performance and a better alignment between qPCR estimates of genome equivalents and bioinformatically counted tag equivalents in sequencing runs.
  • repeats suitable for use in the repeat-based genome equivalent assays contemplated herein include, but not limited to: short interspersed nuclear elements (SINEs), e.g., Alu repeats; long interspersed nuclear elements (LINEs), e.g., LINEl, LINE2, LINE3; microsatellite repeat elements, e.g., short tandem repeats (STRs), simple sequence repeats (SSRs); and mammalian-wide interspersed repeats (M Rs).
  • SINEs short interspersed nuclear elements
  • LINEs long interspersed nuclear elements
  • STRs short tandem repeats
  • SSRs simple sequence repeats
  • M Rs mammalian-wide interspersed repeats
  • the repeat is an Alu repeat.
  • a method for genetic analysis of DNA comprises quantitative genetic analysis of one or more target genetic loci of the DNA library clones.
  • Quantitative genetic analysis comprises one or more of, or all of, the following steps: capturing DNA clones comprising a target genetic locus; amplification of the captured targeted genetic locus; sequencing of the amplified captured targeted genetic locus; and bioinformatic analysis of the resulting sequence reads.
  • the present invention contemplates, in part, a capture probe module that is multifunctional and designed to retain the efficiency and reliability of larger probes but that minimizes uninformative sequence generation in a DNA clone library.
  • a “capture probe module” refers to a polynucleotide that comprises a capture probe sequence and a tail sequence.
  • the capture probe module sequence or a portion thereof serves as a primer binding site for one or more sequencing primers.
  • a capture probe module comprises a capture probe.
  • a capture probe refers to a polynucleotide comprising a region capable of hybridizing to a specific DNA target region. Because the average size of DNA is relatively small and is highly fragmented, the compositions and methods contemplated herein comprise the use of high density and relatively short capture probes to interrogate DNA target regions of interest.
  • a capture probe module is combined with a partner oligonucleotide that optionally comprises a hapten and that hybridizes the tail sequence to generate a capture probe module duplex.
  • capture probes are designed using specific "sequence rules.” For example, regions of redundant sequence or that exhibit extreme base composition biases are generally excluded in designing capture probes.
  • sequence rules For example, regions of redundant sequence or that exhibit extreme base composition biases are generally excluded in designing capture probes.
  • the present inventors have discovered that the lack of flexibility in capture probe design rules does not substantially impact probe performance.
  • capture probes chosen strictly by positional constraint provided on-target sequence information; exhibit very little off-target and unmappable read capture; and yield uniform, useful, on-target reads with only few exceptions.
  • the high redundancy at close probe spacing more than compensates for occasional poor-performing capture probes.
  • a target region is targeted by a plurality of capture probes, wherein any two or more capture probes are designed to bind to the target region within 10 nucleotides of each other, within 15 nucleotides of each other, within 20 nucleotides of each other, within 25 nucleotides of each other, within 30 nucleotides of each other, within 35 nucleotides of each other, within 40 nucleotides of each other, within 45 nucleotides of each other, or within 50 nucleotides or more of each other, as well as all intervening nucleotide lengths.
  • the capture probe is about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, about 40 nucleotides, about 41 nucleotides, about 42 nucleotides, about 43 nucleotides, about 44 nucleotides, or about 45 nucleotides.
  • the capture probe is about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, or about 100 nucleotides. In another embodiment, the capture probe is from about 100 nucleotides to about 500 nucleotides, about 200 nucleotides to about 500 nucleotides, about 300 nucleotides to about 500 nucleotides, or about 400 nucleotides to about 500 nucleotides, or any intervening range thereof.
  • the capture probe is 60 nucleotides.
  • the capture probe is not 60 nucleotides.
  • the capture probe is substantially smaller than 60 nucleotides but hybridizes comparably, as well as, or better than a 60 nucleotide capture probe targeting the same DNA target region.
  • the capture probe is 40 nucleotides.
  • a capture probe module comprises a tail sequence.
  • tail sequence refers to a polynucleotide at the 5' end of the capture probe module, which in particular embodiments can serve as a primer binding site.
  • a sequencing primer binds to the primer binding site in the tail region.
  • the tail sequence is about 5 to about 100 nucleotides, about 10 to about 100 nucleotides, about 5 to about 75 nucleotides, about 5 to about 50 nucleotides, about 5 to about 25 nucleotides, or about 5 to about 20 nucleotides.
  • the third region is from about 10 to about 50 nucleotides, about 15 to about 40 nucleotides, about 20 to about 30 nucleotides or about 20 nucleotides, or any intervening number of nucleotides.
  • the tail sequence is about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, or about 40 nucleotides.
  • the capture probe module comprises a specific member of a binding pair to enable isolation and/or purification of one or more captured fragments of a tagged and or amplified DNA library that hybridizes to the capture probe.
  • the capture probe module is conjugate to biotin or another suitable hapten, e.g., dinitrophenol, digoxigenin.
  • the capture probe module is hybridized to a tagged and optionally amplified DNA library to form a complex. In some embodiments, the
  • multifunctional capture probe module substantially hybridizes to a specific genomic target region in the DNA library.
  • Hybridization or hybridizing conditions can include any reaction conditions where two nucleotide sequences form a stable complex; for example, the tagged DNA library and capture probe module forming a stable tagged DNA library— capture probe module complex.
  • reaction conditions are well known in the art and those of skill in the art will appreciated that such conditions can be modified as appropriate, e.g., decreased annealing temperatures with shorter length capture probes, and within the scope of the present invention.
  • Substantial hybridization can occur when the second region of the capture probe complex exhibits 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92% 91%, 90%, 89%, 88%, 85%, 80%, 75%, or 70% sequence identity, homology or complementarity to a region of the tagged DNA library.
  • the capture probe is about 40 nucleotides and has an optimal annealing temperature of about 44° C o about 47° C.
  • the methods contemplated herein comprise isolating a tagged DNA library— capture probe module complex.
  • methods for isolating DNA complexes are well known to those skilled in the art and any methods deemed appropriate by one of skill in the art can be employed with the methods of the present invention (Ausubel et al, Current Protocols in Molecular Biology, 2007-2012).
  • the complexes are isolated using biotin— streptavidin isolation techniques.
  • the capture partner oligonucleotide capable of hybridizing to the tail sequence of the multifunctional capture probe module is modified to contain a biotin at the 5'- end or 3 '-end which is capable of interacting with streptavidin linked to a column, bead or other substrate for use in DNA complex isolation methods.
  • the capture partner oligonucleotide capable of hybridizing to the tail sequence of the multifunctional capture probe module is modified to contain a biotin at the 3 '-end which is capable of interacting with streptavidin linked to a column, bead or other substrate for use in DNA complex isolation methods.
  • a tail sequence of a multifunctional capture probe module is bound to a capture partner oligonucleotide.
  • the multifunctional capture probe module is bound to the capture partner oligonucleotide prior to formation of a tagged DNA library— multifunctional capture probe module complex.
  • the multifunctional capture probe module is bound to the capture partner oligonucleotide after the formation of a tagged DNA library— multifunctional capture probe module complex.
  • the multifunctional capture probe module is bound to the capture partner oligonucleotide simultaneously with the formation of a tagged DNA library— multifunctional capture probe module complex.
  • the capture partner oligonucleotide is chemically modified.
  • the capture partner oligonucleotide is modified by adding a hapten to the 5' or 3 ' end. In one embodiment the hapten is biotin.
  • removal of the single stranded 3 '-ends from the isolated tagged DNA library- capture probe module complex is contemplated.
  • the methods comprise 3'-5' exonuclease enzymatic processing of the isolated tagged DNA library-multifunctional capture probe module complex to remove the single stranded 3' ends. In certain other embodiments, the methods comprise performing 5'-3' DNA
  • the methods comprise creating a hybrid capture probe- isolated tagged DNA target molecule through the concerted action of a 5' FLAP
  • a variety of enzymes can be employed for the 3 '-5' exonuclease enzymatic processing of the isolated tagged DNA library-multifunctional capture probe module complex.
  • Suitable enzymes which exhibit 3 '-5' exonuclease enzymatic activity, that can be employed in particular embodiments include, but are not limited to: T4 or
  • Exonucleases I, III, V see also, Shevelev IV, Hiibscher U., "The 3' 5' exonucleases,” Nat Rev Mol Cell Biol. 3(5):364-76 (2002)).
  • the enzyme comprising 3'-5' exonuclease activity is T4.
  • an enzyme which exhibits 3'-5' exonuclease enzymatic activity and is capable of primer template extension can be employed, including for example T4 or Exonucleases I, III, V. Id.
  • the methods contemplated herein comprise performing sequencing and/or PCR on the 3'-5' exonuclease enzymatically processed complex discussed supra and elsewhere herein.
  • a tail portion of a capture probe molecule is copied in order to generate a hybrid nucleic acid molecule.
  • the hybrid nucleic acid molecule generated comprises the target region capable of hybridizing to the capture probe module and the complement of the capture probe module tail sequence.
  • genetic analysis comprises a) hybridizing one or more capture probe modules to one or more target genetic loci in a plurality of DNA library clones to form one or more capture probe module-DNA library clone complexes; b) isolating the one or more capture probe module-DNA library clone complexes from a); c) enzymatically processing the one or more isolated capture probe module-DNA library clone complexes from step b); d) performing PCR on the enzymatically processed complex from c) wherein the tail portion of the capture probe molecule is copied in order to generate amplified hybrid nucleic acid molecules, wherein the amplified hybrid nucleic acid molecules comprise a target sequence in the target genomic locus capable of hybridizing to the capture probe and the complement of the capture probe module tail sequence; and e) performing quantitative genetic analysis on the amplified hybrid nucleic acid molecules from d).
  • methods for determining copy number of a specific target genetic locus comprising: a) hybridizing one or more capture probe modules to one or more target genetic loci in a plurality of DNA library clones to form one or more capture probe module-DNA library clone complexes; b) isolating the one or more capture probe module-DNA library clone complexes from a); c) enzymatically processing the one or more isolated capture probe module-DNA library clone complexes from step b); d) performing PCR on the enzymatically processed complex from c) wherein the tail portion of the capture probe molecule is copied in order to generate amplified hybrid nucleic acid molecules, wherein the amplified hybrid nucleic acid molecules comprise a target sequence in the target genetic locus capable of hybridizing to the capture probe and the complement of the capture probe module tail sequence; e) performing PCR amplification of the amplified hybrid nucleic acid molecules in d); and f) quantitating
  • the enzymatic processing of step c) comprises performing 3'-5' exonuclease enzymatic processing on the one or more capture probe module-DNA library clone complexes from b) using an enzyme with 3 '-5' exonuclease activity to remove the single stranded 3' ends; creating one or more hybrid capture probe module-DNA library clone molecules through the concerted action of a 5' FLAP endonuclease, DNA polymerization and nick closure by a DNA ligase; or performing 5 '-3' DNA polymerase extension of the capture probe using the isolated DNA clone in the complex as a template.
  • the enzymatic processing of step c) comprises performing 5'-3' DNA polymerase extension of the capture probe using the isolated DNA clone in the complex as a template.
  • PCR can be performed using any standard PCR reaction conditions well known to those of skill in the art.
  • the PCR reaction in e) employs two PCR primers.
  • the PCR reaction in e) employs a first PCR primer that hybridizes to a repeat within the target genetic locus.
  • the PCR reaction in e) employs a second PCR primer that hybridizes to the hybrid nucleic acid molecules at the target genetic locus/tail junction.
  • the PCR reaction in e) employs a first PCR primer that hybridizes to the target genetic locus and a second PCR primer hybridizes to the amplified hybrid nucleic acid molecules at the target genetic locus/tail junction.
  • the second primer hybridizes to the target genetic locus/tail junction such that at least one or more nucleotides of the primer hybridize to the target genetic locus and at least one or more nucleotides of the primer hybridize to the tail sequence.
  • the amplified hybrid nucleic acid molecules obtained from step e) are sequenced and the sequences aligned horizontally, i.e., aligned to one another but not aligned to a reference sequence.
  • steps a) through e) are repeated one or more times with one or more capture probe modules.
  • the capture probe modules can be the same or different and designed to target either DNA strand of a target genetic locus.
  • when the capture probes are different they hybridize at overlapping or adjacent target sequences within a target genetic locus in the tagged DNA clone library.
  • a high density capture probe strategy is used wherein a plurality of capture probes hybridize to a target genetic locus, and wherein each of the plurality of capture probes hybridizes to the target genetic locus within about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, bp of any other capture probe that hybridizes to the target genetic locus in a tagged DNA clone library, including all intervening distances.
  • the method can be performed using two capture probe modules per target genetic locus, wherein one hybridizes to the "Watson" strand (non-coding or template strand) upstream of the target region and one hybridizes to the "Crick” strand (coding or non-template strand) downstream of the target region.
  • the methods contemplated herein can further be performed multiple times with any number of capture probe modules, for example 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more capture probe modules per target genetic locus any number of which hybridize to the Watson or Crick strand in any combination.
  • the sequences obtained can be aligned to one another in order to identify any of a number of differences.
  • a plurality of target genetic loci are interrogated, e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 10000, 50000, 100000, 500000 or more in a single reaction, using one or more capture probe modules.
  • the quantitative genetic analysis comprises sequencing a plurality of hybrid nucleic acid molecules, as discussed elsewhere herein, supra, to generate sufficient sequencing depths to obtain a plurality of unique sequencing reads.
  • a unique read is defined as the single consensus read from a "family" of reads that all share the same read code and sequence start point within DNA. Each capture probe yields a set of unique reads that are computationally distilled from total reads by grouping into families. The unique reads for a given sample are then computed as the average of all the unique reads observed on a probe-by-probe basis. Cases where there is an obvious copy number change are excluded from the data set used to compute the average. Unique reads are important because each unique read must be derived from a unique DNA clone.
  • Each unique read represents the input and analysis of a haploid equivalent of genomic DNA.
  • the sum of unique reads is the sum of haploid genomes analyzed.
  • the number of genomes analyzed defines the sensitivity of the sequencing assay. By way of a non-limiting example, if the average unique read count is 100 genome equivalents, then that particular assay has a sensitivity of being able to detect one mutant read in 100, or 1%. Any observation less than this is not defensible.
  • the quantitative genetic analysis comprises multiplex sequencing of hybrid nucleic acid molecules derived from a plurality of samples.
  • the quantitative genetic analysis comprises obtaining one or more or a plurality of tagged DNA library clones, each clone comprising a first DNA sequence and a second DNA sequence, wherein the first DNA sequence comprises a sequence in a targeted genetic locus and the second DNA sequence comprises a capture probe sequence; performing a paired end sequencing reaction on the one or more clones and obtaining one or more sequencing reads or performing a sequencing reaction on the one or more clones in which a single long sequencing read of greater than about 100, 200, 300, 400, 500 or more nucleotides is obtained, wherein the read is sufficient to identify both the first DNA sequence and the second DNA sequence; and ordering or clustering the sequencing reads of the one or more clones according to the probe sequences of the sequencing reads.
  • the quantitative genetic analysis further comprises bioinformatic analysis of the sequencing reads.
  • Bioinformatic analysis excludes any purely mental analysis performed in the absence of a composition or method for sequencing.
  • bioinformatics analysis includes, but is not limited to: sequence alignments; genome equivalents analysis; single nucleotide variant (SNV) analysis; gene copy number variation (CNV) analysis; and detection of genetic lesions.
  • SNV single nucleotide variant
  • CNV gene copy number variation
  • bioinformatics analysis is useful to quantify the number of genome equivalents analyzed in the DNA clone library; to detect the genetic state of a target genetic locus; to detect genetic lesions in a target genetic locus; and to measure copy number fluctuations within a target genetic locus.
  • Sequence alignments may be performed between the sequence reads and one or more human reference DNA sequences.
  • sequencing alignments can be used to detect genetic lesions in a target genetic locus including, but not limited to detection of a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion. Detection of genetic lesions that are causal or prognostic indicators may be useful in the diagnosis, prognosis, treatment, and/or monitoring of a particular genetic condition or disease.
  • sequence alignment analysis methods for sequence alignment analysis that can be performed without the need for alignment to a reference sequence, referred to herein as horizontal sequence analysis. Such analysis can be performed on any sequences generated by the methods contemplated herein or any other methods.
  • sequence analysis comprises performing sequence alignments on the reads obtained by the methods contemplated herein.
  • the genome equivalents in a DNA clone library are determined using bioinformatics-based counting after sequencing is performed. Each sequencing read is associated with a particular capture probe, and the collection of reads assigned to each capture probe is parsed into groups. Within a group, sets of individual reads share the same read code and the same DNA sequence start position within genomic sequence.
  • the number of genome equivalents analyzed is about 1/10, about 1/12, about 1/14, about 1/16, about 1/18, about 1/20, about 1/25 or less the number of possible unique clones. It should be understood that the procedure outlined above is merely illustrative and not limiting.
  • the number of genome equivalents to be analyzed may need to be increased.
  • the first solution is to use more than one adaptor set per sample. By combining adaptors, it is possible to multiplicatively expand the total number of possible clones and therefore, expand the comfortable limits of genomic input.
  • the second solution is to expand the read code by 1, 2, 3, 4, or 5 or more bases.
  • the number of possible read codes that differ by at least 2 bases from every other read code scales as 4 (n_1) where n is the number of bases within a read code.
  • n_1 the number of bases within a read code.
  • quantitative genetic analysis comprises bioinformatic analysis of sequencing reads to identify rare single nucleotide variants (SNV).
  • SNV rare single nucleotide variants
  • Next-generation sequencing has an inherent error rate of roughly 0.02-0.02%, meaning that anywhere from 1/200 to 1/500 base calls are incorrect.
  • analysis of 5000 unique molecules using targeted sequence capture technology would generate - at sufficient sequencing depths of >50,000 reads - a collection of 5000 unique reads, with each unique read belonging to a "family" of reads that all possess the same read code.
  • a SNV that occurs within a family is a candidate for being a rare variant. When this same variant is observed in more than one family, it becomes a very strong candidate for being a rare variant that exists within the starting sample.
  • variants that occur sporadically within families are likely to be sequencing errors and variants that occur within one and only one family are either rare or the result of a base alteration that occurred ex vivo (e.g., oxidation of a DNA base or PCR-introduced errors).
  • the methods of detecting SNVs comprise introducing 10-fold more genomic input (genomes or genome equivalents) as the desired target sensitivity of the assay.
  • the desired sensitivity is 2% (2 in 100)
  • the experimental target is an input of 2000 genomes.
  • bioinformatics analysis of sequencing data is used to detect or identify SNV associated with a genetic state, condition or disease, genetic mosaicism, fetal testing, paternity testing, predicting response to drug treatment, diagnosing or monitoring a medical condition, microbiome profiling, pathogen screening, and monitoring organ transplants.
  • a method for copy number determination analysis comprising obtaining one or more or a plurality of clones, each clone comprising a first DNA sequence and a second DNA sequence, wherein the first DNA sequence comprises a sequence in a targeted genetic locus and the second DNA sequence comprises a capture probe sequence.
  • a paired end sequencing reaction on the one or more clones is performed and one or more sequencing reads are obtained.
  • a sequencing reaction on the one or more clones is performed in which a single long sequencing read of greater than about 100 nucleotides is obtained, wherein the read is sufficient to identify both the first DNA sequence and the second DNA sequence.
  • the sequencing reads of the one or more clones can be ordered or clustered according to the probe sequence of the sequencing reads.
  • Copy number analyses include, but are not limited to analyses, that examine the number of copies of a particular gene or mutation that occurs in a given genomic DNA sample and can further include quantitative determination of the number of copies of a given gene or sequence differences in a given sample.
  • copy number analysis is used to detect or identify gene amplification associated with genetic states, conditions, or diseases, fetal testing, genetic mosaicism, paternity testing, predicting response to drug treatment, diagnosing or monitoring a medical condition, microbiome profiling, pathogen screening, and monitoring organ transplants.
  • bioinformatics analysis of sequencing data is used to detect or identify one or more sequences or genetic lesions in a target locus including, but not limited to detection of a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion. Detection of genetic lesions that are causal or prognostic indicators may be useful in the diagnosis, prognosis, treatment, and/or monitoring of a particular genetic condition or disease.
  • genetic lesions are associated with genetic states, conditions, or diseases, fetal testing, genetic mosaicism, paternity testing, predicting response to drug treatment, diagnosing or monitoring a medical condition, microbiome profiling, pathogen screening, and monitoring organ transplants.
  • the present invention contemplates a method of detecting, identifying, predicting, diagnosing, or monitoring a condition or disease in a subject.
  • a method of detecting, identifying, predicting, diagnosing, or monitoring a genetic state, condition or disease in a subject comprises performing a quantitative genetic analysis of one or more target genetic loci in a DNA clone library to detect or identify a change in the sequence at the one or more target genetic loci.
  • the DNA is cfDNA.
  • a method of detecting, identifying, predicting, diagnosing, or monitoring a genetic state, or genetic condition or disease selected from the group consisting of: genetic diseases; genetic mosaicism; fetal testing; paternity testing; paternity testing; predicting response to drug treatment; diagnosing or monitoring a medical condition; microbiome profiling; pathogen screening; and organ transplant monitoring comprises performing a quantitative genetic analysis of one or more target genetic loci in a DNA clone library to detect or identify a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion in the sequence at the one or more target genetic loci.
  • genetic diseases that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to cancer, Alzheimer's disease (APOEl), Charcot-Marie-Tooth disease, Leber hereditary optic neuropathy (LHON), Angelman syndrome (UBE3A, ubiquitin-protein ligase E3A), Prader-Willi syndrome (region in chromosome 15), ⁇ -Thalassaemia (HBB, ⁇ -Globin), Gaucher disease (type I) (GBA, Glucocerebrosidase), Cystic fibrosis (CFTR Epithelial chloride channel), Sickle cell disease (HBB, ⁇ -Globin), Tay-Sachs disease (HEXA,
  • LDLR Low density lipoprotein receptor
  • PPDl Polycystin
  • HDD Huntington disease
  • NFl Neurofibromatosis type I
  • DM Myotonic dystrophy
  • TSC Tuberous sclerosis
  • FMR Fragile X syndrome
  • DMD Duchenne muscular dystrophy
  • H8C Blood coagulation factor VIII
  • HPRT Hypoxanthine guanine ribosyltransferase 1
  • ABCDl Adrenoleukodystrophy
  • cancers that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to: B cell cancer, e.g., multiple myeloma, melanomas, breast cancer, lung cancer (such as non-small cell lung carcinoma or NSCLC), bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematological tissues, adenocarcinomas, inflammatory myofibroblastic tumors, gastrointestinal stromal tumor (GIST), colon cancer, multiple myeloma
  • myelodysplastic syndrome MDS
  • myeloproliferative disorder MPD
  • acute lymphocytic leukemia ALL
  • acute myelocytic leukemia AML
  • chronic myelocytic leukemia CML
  • chronic lymphocytic leukemia CLL
  • polycythemia Vera Hodgkin lymphoma, non-Hodgkin lymphoma (NHL)
  • soft-tissue sarcoma fibrosarcoma
  • myxosarcoma myxosarcoma
  • liposarcoma liposarcoma
  • osteogenic sarcoma chordoma
  • angiosarcoma endotheliosarcoma
  • lymphangiosarcoma renethelialcoma
  • lymphangioendotheliosarcoma synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary
  • adenocarcinomas medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, follicular lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, hepatocellular carcinoma, thyroid cancer, gastric cancer, head and neck cancer, small cell cancers, essential thrombocythemia, agnogenic myeloid metaplasia, hypereosinophilic syndrome, systemic mastocytosis
  • the genetic lesion is a lesion annotated in the Cosmic database (the lesions and sequence data can be downloaded from cancer.sanger.ac.uk/cosmic/census) or a lesion annotated in the Cancer Genome Atlas (the lesions and sequence data can be downloaded from tcga-data.nci.nih.gov/tcga/tcgaDownload.jsp).
  • genes that harbor one or more genetic lesions associated with cancer that can be detected, identified, predicted, diagnosed, or monitored with the
  • compositions and methods contemplated herein include, but are not limited to ABCB 1, ABCC2, ABCC4, ABCG2, ABLl, ABL2, AKT1, AKT2, AKT3, ALDH4A1, ALK, APC, AR, ARAF, ARFRPl, ARIDl A, ATM, ATR, AURKA, AURKB, BCL2, BCL2A1, BCL2L1, BCL2L2, BCL6, BRAF, BRCA1, BRCA2, Clorfl44, CARD11, CBL, CC D1, CC D2, CC D3, CC E1, CDH1, CDH2, CDH20, CDH5, CDK4, CDK6, CDK8, CDKN2A,
  • the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion.
  • the genetic lesion is a gene fusion that fuses the 3 ' coding region of the ALK gene to another gene.
  • the genetic lesion is a gene fusion that fuses the 3 ' coding region of the ALK gene to the EML4 gene.
  • Illustrative examples of conditions suitable for fetal testing that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include but are not limited to: Down Syndrome (Trisomy 21), Edwards Syndrome (Trisomy 18), Patau Syndrome (Trisomy 13), Klinefelter's Syndrome (XXY), Triple X syndrome, XYY syndrome, Trisomy 8, Trisomy 16, Turner Syndrome (XO), Robertsonian translocation, DiGeorge Syndrome and Wolf-Hirschhorn Syndrome.
  • Illustrative examples of alleles suitable for paternity testing that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include but are not limited to 16 or more of: D20S1082, D6S474, D12ATA63, D22S1045, D10S1248, D1 S1677, D11 S4463, D4S2364, D9S1122, D2S1776, D10S1425, D3S3053, D5S2500, D1 S1627, D3S4529, D2S441, D17S974, D6S1017, D4S2408, D9S2157, Amelogenin, D17S1301, D1GATA113, D18S853, D20S482, and D14S1434.
  • genes suitable for predicting the response to drug treatment that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to, one or more of the following genes: ABCBl (ATP-binding cassette, sub-family B (MDR/TAP), member 1), ACE
  • ADH1 A alcohol dehydrogenase 1 A (class I), alpha polypeptide
  • ADH1B alcohol dehydrogenase IB (class I), beta polypeptide
  • ADH1C alcohol dehydrogenase 1C (class I), gamma polypeptide
  • ADRB l adrenergic, beta-1-, receptor
  • ADRB2 adrenergic, beta-2-, receptor, surface
  • AHR aryl hydrocarbon receptor
  • ALDHlAl aldehyde dehydrogenase 1 family, member Al
  • ALOX5 arachidonate 5- lipoxygenase
  • BRCA1 breast cancer 1, early onset
  • COMT catechol-O-methyltransferase
  • CYP2A6 cytochrome P450, family 2, subfamily A, polypeptide 6
  • CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6
  • CYP2A6 cytochrome P450
  • vitamin D (1,25- dihydroxyvitamin D3) receptor
  • VKORC1 vitamin K epoxide reductase complex, subunit 1).
  • Illustrative examples of medical conditions that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to: stroke, transient ischemic attack, traumatic brain injury, heart disease, heart attack, angina, atherosclerosis, and high blood pressure.
  • pathogens that can be screened for with the compositions and methods contemplated herein include, but are not limited to: bacteria fungi, and viruses.
  • pathogens that can be screened for with the compositions and methods contemplated herein include, but are not limited to: bacteria fungi, and viruses.
  • bacteria fungi and viruses.
  • bacterial species that can be screened for with the compositions and methods contemplated herein include, but are not limited to: bacteria fungi, and viruses.
  • bacterial species that can be screened for with the compositions and methods contemplated herein.
  • compositions and methods contemplated herein include, but are not limited to: a
  • Mycobacterium spp. a Pneumococcus spp., an Escherichia spp., a Campylobacter spp., a Cory neb acterium spp., a Clostridium spp., a Streptococcus spp., a Staphylococcus spp., a Pseudomonas spp., a Shigella spp., a Treponema spp., or a Salmonella spp.
  • Illustrative examples of fungal species that can be screened for with the compositions and methods contemplated herein include, but are not limited to: an Aspergillis spp., a Blastomyces spp., a Candida spp., a Coccicioides spp., a Cryptococcus spp., dermatophytes, a Tinea spp., a Trichophyton spp., a Microsporum spp., a Fusarium spp., a Histoplasma spp., a Mucoromycotina spp., a Pneumocystis spp., a Sporothrix spp., an Exserophilum spp., or a Cladosporium spp.
  • genes suitable for monitoring an organ transplant in a transplant recipient that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to, one or more of the following genes: HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DP, and HLA-DQ.
  • a bioinformatic analysis is used to quantify the number of genome equivalents analyzed in the DNA clone library; detect genetic variants in a target genetic locus; detect mutations within a target genetic locus; detect genetic fusions within a target genetic locus; or measure copy number fluctuations within a target genetic locus.
  • a companion diagnostic for a genetic disease comprising: isolating or obtaining DNA, e.g., cfDNA from a biological sample of a subject; removing the terminal phosphate residues of the DNA; treating the dephosphorylated DNA with one or more end-repair enzymes to generate end-repaired DNA; ligating one or more double-stranded DNA (dsDNA) pre-adaptors to the 3 ' end of each strand of the end-repaired DNA to form pre-adaptor/end-repaired DNA complexes, wherein each dsDNA pre-adaptor comprises a ligation strand oligonucleotide that is ligated to the 3 ' end of each strand of the end-repaired DNA, and a non-ligation partner strand oligonucleotide; displacing the non- ligation partner strand oligonucleotide from the pre-adaptor/end-repaired DNA complexes with a repair oligon
  • the term "companion diagnostic” refers to a diagnostic test that is linked to a particular anti-cancer therapy.
  • the diagnostic methods comprise detection of genetic lesion in a biomarker associated with in a biological sample, thereby allowing for prompt identification of patients should or should not be treated with the anti-cancer therapy.
  • Anti-cancer therapy includes, but is not limited to surgery, radiation,
  • anti-cancer drugs include, but are not limited to: alkylating agents such as thiotepa and cyclophosphamide (CYTOXANTM); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine,
  • alkylating agents such as thiotepa and cyclophosphamide (CYTOXANTM)
  • alkyl sulfonates such as busulfan, improsulfan and piposulfan
  • aziridines such as benzodopa, carboquone, meturedopa, and uredopa
  • ethylenimines and methylamelamines including altretamine
  • lentinan lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin;
  • phenamet pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK®; razoxane; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2, 2',2"-trichlorotriethylamine;
  • mercaptopurine methotrexate
  • platinum analogs such as cisplatin and carboplatin
  • vinblastine platinum
  • platinum etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine;
  • vinorelbine navelbine; novantrone; teniposide; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoic acid derivatives such as TargretinTM (bexarotene), PanretinTM (alitretinoin); ONTAKTM (denileukin diftitox) ; esperamicins; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • DMFO difluoromethylomithine
  • retinoic acid derivatives such as TargretinTM (bexarotene), PanretinTM (alitretinoin); ONTAKTM (denileukin diftitox) ; esperamicins; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • anti-hormonal agents that act to regulate or inhibit hormone action on cancers
  • anti-estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (Fareston); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • immunomodulators include, but are not limited to:
  • cyclosporine tacrolimus, tresperimus, pimecrolimus, sirolimus, verolimus, laflunimus, laquinimod and imiquimod, as well as analogs, derivatives, salts, ions and complexes thereof.
  • Patent Application Nos: 14/102,285, filed December 10, 2013, and 14/466,741, filed August 22, 2014, are each incorporated by reference herein, in its entirety.
  • Plasmid DNA from the cloning vector pUC19 was digested with the restriction enzyme Rsal to generate blunt ends and dephosphorylated with Antarctic Alkaline
  • the cfDNA fragment ends were dephosphorylated by combining 81 ⁇ of purified cfDNA, 10 ⁇ of New England Biolabs (NEB) CutSmart buffer (B7204S), and 5 ⁇ of NEB Shrimp Alkaline Phosphatase (M0371). The reaction mixture was incubated at 37°C for 15 min. and then at 65°C for 5 min.
  • NEB New England Biolabs
  • the internal damage to dephosphorylated cfDNA fragments was repaired by adding 4 ⁇ of the following mixture, prepared on ice: 1.1 ⁇ of 10 mM dNTP mix (NEB N0447), 2.2 ⁇ of PreCR enzyme mix (M0309) and 1.1 ⁇ of T4 DNA polymerase (M0203). This reaction mixture was incubated at 20°C for 15 min. and then at 70°C for 10 min. cfDNA fragments repaired and polished in this manner are ready for direct use in a DNA ligation reaction.
  • pre-adaptors which are made up of a ligation strand oligonucleotide and a complementary partner strand oligonucleotide with a blocked 3 ' end.
  • the pre-adaptors used in this example were designed to have the following features: a ligation strand oligonucleotide that is 10 nt in length; an equal balance of A/T or G/C residues; each of the four DNA bases represented at each base position within each set of pre- adaptors; a predicted melting temperature of the 10 base sequence that is ⁇ 37°C in 50 mM Na + (or K + ), 10 mM MgCh; both an A/T and a G/C nt as the first two bases of each pre-adaptor sequence; a complementary partner oligonucleotide sequence that is 8 nt in length, that is chemically blocked with by using 2-hydroxyl ribose-modified DNA bases (MWG Eurofins), and that has a melting temperature of ⁇ 25°C in 50 mM Na + or K + , 10 mM MgCh.
  • MWG Eurofins 2-hydroxyl ribose-modified DNA bases
  • a pre-adaptor was ligated to end-repaired fragments generated in step I of this example. 25 ⁇ of end-repaired fragment was combined with 10 ⁇ of 10 ⁇ adaptor.
  • ligation reactions typically 1 to 4 ligation reactions were performed depending on the number of separate adaptors added to the reaction.
  • 15 ⁇ of ligation cocktail (5 ⁇ of 10X T4-DNA ligation buffer, 7.5 ⁇ of 50% PEG8000, and 2.5 ⁇ of HC T4 DNA ligase (NEB; M0202)) was added to each ligation reaction in a final volume of 50 ⁇ .
  • the reaction was mixed and incubated at 20°C for 60 min., then at 65°C for 10 min, then cooled to room temperature.
  • TEzero 10 mM Tris pH 8.0, 0.1 mM EDTA, 0.05% Tween 20
  • 120 ul of DNA purification beads were added to each reaction and mixed well. The reaction was incubated for 10 min. at room temperature, then the beads were washed two times with 200 ⁇ of 70% ethanol/water (v/v), air-dried briefly ( ⁇ 5 min.), and eluted with 20 ⁇ of TEzero.
  • repair oligonucleotides used in this example is shown in Table 3.
  • Each repair oligonucleotide is a pool of 249 individual oligonucleotides.
  • the invariant sequence in each repair oligonucleotide represents a PCR primer binding site and is shown in the left hand portion of Table 3.
  • Each of the 249 oligonucleotides comprises a 5 nucleotide sample code, shown as an
  • XXXXX in repair oligonucleotide sequence.
  • the 5 nucleotide sample are shown in the right hand portion of Table 3.
  • the 5 nucleotide codes consist of 256 possible unique sequences that were chosen to be 2 base changes different from every other code in the set.
  • RO 12-1 TGCAGGACCAGAGAATTCGAATACAXXXXXAGTACGGATC
  • the repair oligonucleotides illustrated in this example contain a PCR primer binding site; sample codes; and an anchor sequence, which is a random sequence label that acts as a means to identify the sequence, that enables calibration of proper base calls in sequencing reads, and that acts as an anchor for hybridization to the ligation strand oligonucleotide.
  • a 40 ⁇ repair oligonucleotide reaction was prepared by combining 24 ⁇ repair oligonucleotide/ligase mixture with 16 ⁇ of the following mixture, on ice: 11 ⁇ of water, 4.4 ⁇ of buffer "B" (190 ⁇ of CutSmart buffer (NEB; B7204) and 10 ⁇ of 1M dithiothreitol
  • nucleotide mix "N” (combine 50 ⁇ of 10 mM dNTP mixture (NEB; N0447) with 25 ⁇ of 100X NAD+(NEB; B9007) and 0.88 ⁇ of enzyme mix "E” (combine 20 ⁇ of T4 polynucleotide kinase (NEB; M0201), 10 ⁇ of full- length Bstl polymerase (NEB; M0328) and 10 ⁇ of Taq DNA ligase (NEB; M0208). The reaction was mixed and incubated at 37°C for 15 min. then at 60°C for 15 min.
  • the reactions were removed from the thermal cycler and 48 ul of bead resuspension solution (19% PEG8000, 2M NaCl, 10 mM Tris pH 8.0, 10 mM EDTA, 0.1% Tween 20) was added to the reaction and incubated at room temperature for 10 min.
  • the beads were washed twice with 200 ⁇ of 70% ethanol, air-dried briefly ( ⁇ 5 min.) and resuspended in 25 ⁇ of TEzero. A magnet was used to localize the beads and the clarified DNA library was transferred to a fresh reaction vessel.
  • the resulting DNA libraries constructed using the methods contemplated herein throughout and described in Example 1 are amplification ready and suitable for next generation sequencing, qPCR analysis, and other quantitative genetic analyses of one or more target genetic loci.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2016/061395 2015-11-11 2016-11-10 High efficiency construction of dna libraries Ceased WO2017083562A1 (en)

Priority Applications (18)

Application Number Priority Date Filing Date Title
JP2018524250A JP6913089B2 (ja) 2015-11-11 2016-11-10 Dnaライブラリーの高効率構築
RU2018121254A RU2018121254A (ru) 2015-11-11 2016-11-10 Высокоэффективное построение библиотек днк
MX2018005858A MX2018005858A (es) 2015-11-11 2016-11-10 Construccion de alta eficacia de bibliotecas de adn.
CA3004435A CA3004435A1 (en) 2015-11-11 2016-11-10 High efficiency construction of dna libraries
CN202210236083.9A CN115044645A (zh) 2015-11-11 2016-11-10 Dna文库的高效率构建
KR1020187016475A KR102788327B1 (ko) 2015-11-11 2016-11-10 Dna 라이브러리의 고효율 작제
NZ742379A NZ742379B2 (en) 2016-11-10 High efficiency construction of dna libraries
EP16865029.9A EP3374525B1 (en) 2015-11-11 2016-11-10 High efficiency construction of dna libraries
DK16865029.9T DK3374525T3 (da) 2015-11-11 2016-11-10 Højeffektiv konstruktion af dna-biblioteker
ES16865029T ES2856598T3 (es) 2015-11-11 2016-11-10 Construcción de alta eficiencia de bibliotecas de ADN
IL285202A IL285202B2 (en) 2015-11-11 2016-11-10 High-efficiency construction of DNA libraries
CN201680076637.6A CN108431233B (zh) 2015-11-11 2016-11-10 Dna文库的高效率构建
BR112018009606-7A BR112018009606B1 (pt) 2015-11-11 2016-11-10 Método para construir uma biblioteca de dna e de previsão, diagnóstico ou monitoramento de doença genética
AU2016353133A AU2016353133B2 (en) 2015-11-11 2016-11-10 High efficiency construction of dna libraries
EP21152311.3A EP3889257A1 (en) 2015-11-11 2016-11-10 High efficiency construction of dna libraries
US15/965,048 US11339391B2 (en) 2015-11-11 2018-04-27 High efficiency construction of DNA libraries
IL259237A IL259237B (en) 2015-11-11 2018-05-09 A highly efficient structure of DNA libraries
US17/587,230 US20220267763A1 (en) 2015-11-11 2022-01-28 High efficiency construction of dna libraries

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562254110P 2015-11-11 2015-11-11
US62/254,110 2015-11-11

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/965,048 Continuation US11339391B2 (en) 2015-11-11 2018-04-27 High efficiency construction of DNA libraries

Publications (1)

Publication Number Publication Date
WO2017083562A1 true WO2017083562A1 (en) 2017-05-18

Family

ID=58695623

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/061395 Ceased WO2017083562A1 (en) 2015-11-11 2016-11-10 High efficiency construction of dna libraries

Country Status (13)

Country Link
US (2) US11339391B2 (https=)
EP (2) EP3374525B1 (https=)
JP (4) JP6913089B2 (https=)
KR (1) KR102788327B1 (https=)
CN (2) CN115044645A (https=)
AU (1) AU2016353133B2 (https=)
CA (1) CA3004435A1 (https=)
DK (1) DK3374525T3 (https=)
ES (1) ES2856598T3 (https=)
IL (2) IL285202B2 (https=)
MX (2) MX2018005858A (https=)
RU (1) RU2018121254A (https=)
WO (1) WO2017083562A1 (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018039463A1 (en) 2016-08-25 2018-03-01 Resolution Bioscience, Inc. Methods for the detection of genomic copy changes in dna samples
US9932576B2 (en) 2012-12-10 2018-04-03 Resolution Bioscience, Inc. Methods for targeted genomic analysis
WO2019006269A1 (en) * 2017-06-30 2019-01-03 The Regents Of The University Of California METHODS AND SYSTEMS FOR ASSESSING METHYLATION OF DNA IN ACELLULAR DNA
WO2019051484A1 (en) * 2017-09-11 2019-03-14 Ludwig Institute For Cancer Research Ltd SELECTIVE MARKING OF 5-METHYLCYTOSINE IN CIRCULATING ACELLULAR DNA
JP2021514663A (ja) * 2018-03-08 2021-06-17 セント・ジョーンズ・ユニバーシティSt. Johns University 循環性血清無細胞dnaバイオマーカー及び方法
WO2022038291A1 (en) * 2020-08-21 2022-02-24 University College Cardiff Consultants Ltd A method for the isolation of double-strand breaks
US11339391B2 (en) 2015-11-11 2022-05-24 Resolution Bioscience, Inc. High efficiency construction of DNA libraries
EP3827011A4 (en) * 2018-07-24 2022-06-22 Salish Bioscience Inc. METHODS AND COMPOSITION FOR TARGETED GENOME ANALYSIS
US11410750B2 (en) 2018-09-27 2022-08-09 Grail, Llc Methylation markers and targeted methylation probe panel
US12024750B2 (en) 2018-04-02 2024-07-02 Grail, Llc Methylation markers and targeted methylation probe panel
US12203127B2 (en) 2014-08-22 2025-01-21 Resolution Bioscience, Inc. Methods for quantitative genetic analysis of cell free DNA

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111526793A (zh) 2017-10-27 2020-08-11 朱诺诊断学公司 用于超低体积液体活检的设备、系统和方法
US12462935B2 (en) 2018-03-30 2025-11-04 Nucleix Ltd. Deep learning-based methods, devices, and systems for prenatal testing
US11781169B2 (en) * 2018-10-05 2023-10-10 Microsoft Technology Licensing, Llc Enzymatic DNA repair
CN111074353B (zh) * 2018-10-18 2023-10-13 深圳华大智造科技股份有限公司 全基因组甲基化文库单链建库方法和得到的全基因组甲基化文库
US11926821B2 (en) * 2018-10-22 2024-03-12 The Chinese University Of Hong Kong Cell-free DNA quality
CN109576799B (zh) * 2018-11-30 2022-04-26 深圳安吉康尔医学检验实验室 Fh测序文库的构建方法和引物组及试剂盒
US20220162591A1 (en) * 2019-03-27 2022-05-26 Juno Diagnostics, Inc. Optimized ultra-low volume liquid biopsy methods, systems, and devices
WO2022055984A1 (en) * 2020-09-08 2022-03-17 Resolution Bioscience, Inc. Adaptors and methods for high efficiency construction of genetic libraries and genetic analysis
CN114317528A (zh) * 2020-09-30 2022-04-12 北京吉因加科技有限公司 特异分子标签umi组、混合特异分子标签接头及应用
CN114438184B (zh) * 2022-04-08 2022-07-12 昌平国家实验室 游离dna甲基化测序文库构建方法及应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140274731A1 (en) 2012-12-10 2014-09-18 Clearfork Bioscience, Inc. Methods for targeted genomic analysis
US20140274740A1 (en) 2013-03-15 2014-09-18 Verinata Health, Inc. Generating cell-free dna libraries directly from blood
WO2015117040A1 (en) 2014-01-31 2015-08-06 Swift Biosciences, Inc. Improved methods for processing dna substrates
WO2015134552A1 (en) 2014-03-03 2015-09-11 Swift Biosciences, Inc. Enhanced adaptor ligation

Family Cites Families (102)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5591582A (en) 1985-07-23 1997-01-07 The Board Of Rijks Universiteit Leiden Methods for detecting activated RAS oncogenes
US5888731A (en) 1995-08-30 1999-03-30 Visible Genetics Inc. Method for identification of mutations using ligation of multiple oligonucleotide probes
EP0991779A1 (en) 1997-08-28 2000-04-12 The Perkin-Elmer Corporation Improved detection of mutations in nucleic acids by chemical cleavage
US6480791B1 (en) 1998-10-28 2002-11-12 Michael P. Strathmann Parallel methods for genomic analysis
US6812341B1 (en) 2001-05-11 2004-11-02 Ambion, Inc. High efficiency mRNA isolation methods and compositions
AU2002365028A1 (en) 2001-07-17 2003-06-30 Stratagene Methods for detection of a target nucleic acid using multi-subunit probes
WO2003020979A1 (en) 2001-08-31 2003-03-13 Rosetta Inpharmactis Llc. Methods for preparing nucleic acid samples
US7361821B2 (en) 2002-09-20 2008-04-22 Intel Corporation Controlled alignment of nanobarcodes encoding specific information for scanning probe microscopy (SPM) reading
JP4441623B2 (ja) * 2002-12-11 2010-03-31 学校法人慶應義塾 対応付け分子およびその構成要素のライブラリーの製造方法および利用方法
TW200506052A (en) 2003-05-07 2005-02-16 Takara Bio Inc Method of analyzing DNA region
US7393665B2 (en) 2005-02-10 2008-07-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
EP2476761A3 (en) 2005-07-07 2012-10-17 Athlomics Pty Ltd Polynucleotide marker genes and their expression, for diagnosis of endotoxemia
GB0522310D0 (en) 2005-11-01 2005-12-07 Solexa Ltd Methods of preparing libraries of template polynucleotides
JP5106416B2 (ja) 2006-01-06 2012-12-26 アジレント・テクノロジーズ・インク 濃縮(packed)DNAポリメラーゼを含む核酸複製のための反応緩衝液組成物
WO2007087312A2 (en) 2006-01-23 2007-08-02 Population Genetics Technologies Ltd. Molecular counting
US8383338B2 (en) 2006-04-24 2013-02-26 Roche Nimblegen, Inc. Methods and systems for uniform enrichment of genomic regions
US7754429B2 (en) 2006-10-06 2010-07-13 Illumina Cambridge Limited Method for pair-wise sequencing a plurity of target polynucleotides
WO2008045158A1 (en) 2006-10-10 2008-04-17 Illumina, Inc. Compositions and methods for representational selection of nucleic acids fro complex mixtures using hybridization
US12180549B2 (en) 2007-07-23 2024-12-31 The Chinese University Of Hong Kong Diagnosing fetal chromosomal aneuploidy using genomic sequencing
WO2009023676A1 (en) 2007-08-12 2009-02-19 Integrated Dna Technologies, Inc. Microarray system with improved sequence specificity
US9388457B2 (en) 2007-09-14 2016-07-12 Affymetrix, Inc. Locus specific amplification using array probes
EP2227563B1 (en) * 2007-12-05 2012-06-06 Complete Genomics, Inc. Efficient base determination in sequencing reactions
WO2009091798A1 (en) 2008-01-16 2009-07-23 Helicos Biosciences Corporation Quantitative genetic analysis
US8202691B2 (en) 2008-01-25 2012-06-19 Illumina, Inc. Uniform fragmentation of DNA using binding proteins
EP2334802A4 (en) * 2008-09-09 2012-01-25 Life Technologies Corp METHODS OF GENERATING SPECIFIC LIBRARIES OF GENES
US8383345B2 (en) 2008-09-12 2013-02-26 University Of Washington Sequence tag directed subassembly of short sequencing reads into long sequencing reads
WO2010038042A1 (en) 2008-10-02 2010-04-08 Illumina Cambridge Ltd. Nucleic acid sample enrichment for sequencing applications
WO2010068856A1 (en) 2008-12-11 2010-06-17 Trustees Of Boston University Isolation of rna
SG174617A1 (en) 2009-04-02 2011-10-28 Fluidigm Corp Multi-primer amplification method for barcoding of target nucleic acids
US9085798B2 (en) 2009-04-30 2015-07-21 Prognosys Biosciences, Inc. Nucleic acid constructs and methods of use
US20110003301A1 (en) 2009-05-08 2011-01-06 Life Technologies Corporation Methods for detecting genetic variations in dna samples
PT2669387T (pt) 2009-08-25 2016-09-20 Illumina Inc Métodos para selecção e amplificação de polinucleótidos
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9315857B2 (en) 2009-12-15 2016-04-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US10388403B2 (en) 2010-01-19 2019-08-20 Verinata Health, Inc. Analyzing copy number variation in the detection of cancer
US10378064B1 (en) 2010-04-16 2019-08-13 Chronix Biomedical Analyzing circulating nucleic acids to identify a biomarker representative of cancer presented by a patient population
US9677118B2 (en) 2014-04-21 2017-06-13 Natera, Inc. Methods for simultaneous amplification of target loci
US8828688B2 (en) 2010-05-27 2014-09-09 Affymetrix, Inc. Multiplex amplification methods
EP2580378A4 (en) 2010-06-08 2014-01-01 Nugen Technologies Inc MULTIPLEX SEQUENCING METHODS AND COMPOSITION
EP2426217A1 (en) 2010-09-03 2012-03-07 Centre National de la Recherche Scientifique (CNRS) Analytical methods for cell free nucleic acids and applications
EP2619329B1 (en) 2010-09-24 2019-05-22 The Board of Trustees of The Leland Stanford Junior University Direct capture, amplification and sequencing of target dna using immobilized primers
CN105243295B (zh) 2010-11-30 2018-08-17 香港中文大学 与癌症相关的遗传或分子畸变的检测
KR102759126B1 (ko) 2010-12-30 2025-01-24 파운데이션 메디신 인코포레이티드 종양 샘플의 다유전자 분석의 최적화
RU2671980C2 (ru) 2011-02-09 2018-11-08 Натера, Инк. Способы неинвазивного пренатального установления плоидности
WO2012129363A2 (en) 2011-03-24 2012-09-27 President And Fellows Of Harvard College Single cell nucleic acid detection and analysis
RS57837B1 (sr) 2011-04-12 2018-12-31 Verinata Health Inc Razrešavanje genomskih frakcija upotrebom broja kopija polimorfizama
ES2986436T3 (es) 2011-04-15 2024-11-11 Univ Johns Hopkins Sistema de secuenciación segura
WO2013056178A2 (en) 2011-10-14 2013-04-18 Foundation Medicine, Inc. Novel estrogen receptor mutations and uses thereof
CN103103624B (zh) * 2011-11-15 2014-12-31 深圳华大基因科技服务有限公司 高通量测序文库的构建方法及其应用
US10227587B2 (en) 2012-01-10 2019-03-12 Berry Genomics Co., Ltd. Method for constructing a plasma DNA sequencing library
US9892230B2 (en) 2012-03-08 2018-02-13 The Chinese University Of Hong Kong Size-based analysis of fetal or tumor DNA fraction in plasma
PT2828218T (pt) 2012-03-20 2020-11-11 Univ Washington Through Its Center For Commercialization Métodos para baixar a taxa de erro da sequenciação paralela massiva de adn utilizando sequenciação duplex de consensus
US20130288915A1 (en) 2012-04-27 2013-10-31 Htg Molecular Diagnostics, Inc. Compositions and methods for alk molecular testing
AU2013267609C1 (en) 2012-05-31 2019-01-03 Board Of Regents, The University Of Texas System Method for accurate sequencing of DNA
ES2769796T3 (es) 2012-07-03 2020-06-29 Integrated Dna Tech Inc Oligonucleótidos de bloqueo aumentados en Tm y señuelos para un enriquecimiento de diana mejorado y una selección fuera de diana reducida
ES2742285T3 (es) 2012-07-31 2020-02-13 Novartis Ag Marcadores asociados con la sensibilidad a inhibidores del doble minuto humano 2 (MDM2)
AU2013296237B2 (en) 2012-08-03 2019-05-16 Foundation Medicine, Inc. Human papilloma virus as predictor of cancer prognosis
CN104781421B (zh) 2012-09-04 2020-06-05 夸登特健康公司 检测稀有突变和拷贝数变异的系统和方法
US10876152B2 (en) 2012-09-04 2020-12-29 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
US20160040229A1 (en) 2013-08-16 2016-02-11 Guardant Health, Inc. Systems and methods to detect rare mutations and copy number variation
WO2014052487A1 (en) 2012-09-28 2014-04-03 Cepheid Two-primer pcr for microrna multiplex assay
US10482994B2 (en) 2012-10-04 2019-11-19 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
CA3120521A1 (en) 2012-10-04 2014-04-10 Sequenom, Inc. Methods and processes for non-invasive assessment of genetic variations
WO2014071295A1 (en) 2012-11-02 2014-05-08 Enzymatics Inc. Methods and kits for nucleic acid sample preparation for sequencing
EP2914621B1 (en) 2012-11-05 2023-06-07 Foundation Medicine, Inc. Novel ntrk1 fusion molecules and uses thereof
EP2931922B1 (en) 2012-12-14 2018-10-17 Chronix Biomedical Personalized biomarkers for cancer
US11158425B2 (en) 2013-01-05 2021-10-26 Foundation Medicine, Inc. System and method for managing genomic information
WO2014116881A1 (en) 2013-01-23 2014-07-31 Reproductive Genetics And Technology Solutions, Llc Compositions and methods for genetic analysis of embryos
US10745686B2 (en) 2013-02-08 2020-08-18 Qiagen Gmbh Method for separating DNA by size
WO2014151117A1 (en) 2013-03-15 2014-09-25 The Board Of Trustees Of The Leland Stanford Junior University Identification and use of circulating nucleic acid tumor markers
ES3022582T3 (en) 2013-05-10 2025-05-28 Found Medicine Inc Analysis of genetic variants
US20150072344A1 (en) 2013-09-10 2015-03-12 Imdaptive Incorporated Barcoded Universal Marker Indicator (BUMI) Tags
US10851414B2 (en) 2013-10-18 2020-12-01 Good Start Genetics, Inc. Methods for determining carrier status
WO2015073711A1 (en) 2013-11-13 2015-05-21 Nugen Technologies, Inc. Compositions and methods for identification of a duplicate sequencing read
CN103668471B (zh) * 2013-12-19 2015-09-30 上海交通大学 一种构建dna高通量测序文库的方法及其配套试剂盒
ES2660989T3 (es) 2013-12-28 2018-03-27 Guardant Health, Inc. Métodos y sistemas para detectar variantes genéticas
US10975371B2 (en) 2014-04-29 2021-04-13 Illumina, Inc. Nucleic acid sequence analysis from single cells
CA2953469A1 (en) 2014-06-26 2015-12-30 10X Genomics, Inc. Analysis of nucleic acid sequences
CA2957633A1 (en) 2014-08-06 2016-02-11 Nugen Technologies, Inc. Digital measurements from targeted sequencing
CN115029342B (zh) * 2014-08-22 2025-04-08 分析生物科学有限公司 用于无细胞dna的定量遗传分析的方法
US20160053301A1 (en) 2014-08-22 2016-02-25 Clearfork Bioscience, Inc. Methods for quantitative genetic analysis of cell free dna
EP3842544A1 (en) * 2014-09-05 2021-06-30 QIAGEN GmbH Preparation of adapter-ligated amplicons
DK3192869T3 (da) * 2014-09-12 2019-05-20 Mgi Tech Co Ltd Isoleret oligonukleotid og anvendelse deraf i nukleinsyresekvensering
CN107075730A (zh) * 2014-09-12 2017-08-18 利兰·斯坦福青年大学托管委员会 循环核酸的鉴定及用途
EP3227464B1 (en) 2014-12-05 2022-04-20 Foundation Medicine, Inc. Multigene analysis of tumor samples
EP3502273B1 (en) 2014-12-12 2020-07-08 Verinata Health, Inc. Cell-free dna fragment
EP3766986B1 (en) 2014-12-31 2022-06-01 Guardant Health, Inc. Detection and treatment of disease exhibiting disease cell heterogeneity and systems and methods for communicating test results
HUE058263T2 (hu) 2015-02-10 2022-07-28 Univ Hong Kong Chinese Mutációk detektálása rákszûrési és magzatelemzési célból
IL305462A (en) 2015-07-23 2023-10-01 Univ Hong Kong Chinese DNA fragmentation pattern analysis suitable clean
JP6991134B2 (ja) 2015-10-09 2022-01-12 ガーダント ヘルス, インコーポレイテッド 無細胞dnaを使用する集団ベースの処置レコメンダ
WO2017062970A1 (en) 2015-10-10 2017-04-13 Guardant Health, Inc. Methods and applications of gene fusion detection in cell-free dna analysis
JP6913089B2 (ja) 2015-11-11 2021-08-04 レゾリューション バイオサイエンス, インコーポレイテッド Dnaライブラリーの高効率構築
US10095831B2 (en) 2016-02-03 2018-10-09 Verinata Health, Inc. Using cell-free DNA fragment size to determine copy number variations
CN114959918A (zh) 2016-02-29 2022-08-30 基础医疗股份有限公司 用于评估肿瘤突变负荷的方法和系统
US11708574B2 (en) 2016-06-10 2023-07-25 Myriad Women's Health, Inc. Nucleic acid sequencing adapters and uses thereof
US11319594B2 (en) 2016-08-25 2022-05-03 Resolution Bioscience, Inc. Methods for the detection of genomic copy changes in DNA samples
EP3461274B1 (en) 2016-09-30 2020-11-04 Guardant Health, Inc. Methods for multi-resolution analysis of cell-free nucleic acids
US9850523B1 (en) 2016-09-30 2017-12-26 Guardant Health, Inc. Methods for multi-resolution analysis of cell-free nucleic acids
IL307463B2 (en) * 2016-11-17 2026-01-01 Lgc Clinical Diagnostics Inc Methods for preparing DNA reference material and controls
US11268137B2 (en) 2016-12-09 2022-03-08 Boreal Genomics, Inc. Linked ligation
EP3885445B1 (en) 2017-04-14 2023-08-23 Guardant Health, Inc. Methods of attaching adapters to sample nucleic acids
JP2022513124A (ja) 2018-11-21 2022-02-07 アヴィダ バイオメッド, インコーポレイテッド 標的化された核酸ライブラリー形成のための方法

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140274731A1 (en) 2012-12-10 2014-09-18 Clearfork Bioscience, Inc. Methods for targeted genomic analysis
US20140274740A1 (en) 2013-03-15 2014-09-18 Verinata Health, Inc. Generating cell-free dna libraries directly from blood
WO2015117040A1 (en) 2014-01-31 2015-08-06 Swift Biosciences, Inc. Improved methods for processing dna substrates
WO2015134552A1 (en) 2014-03-03 2015-09-11 Swift Biosciences, Inc. Enhanced adaptor ligation

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ANAND: "Techniques for the Analysis of Complex Genomes", 1992, ACADEMIC PRESS
AUSUBEL ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 2007
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", July 2008, JOHN WILEY AND SONS
GLOVER: "Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology", vol. I & II, 1985, GREENE PUB. ASSOCIATES
HARLOWLANE: "Antibodies", 1998, COLD SPRING HARBOR LABORATORY PRESS
MANIATIS ET AL.: "Molecular Cloning: A Laboratory Manual", 1982
PERBAL, A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984
SHEVELEV IVHIIBSCHER U.: "The 3' 5' exonucleases", NAT REV MOL CELL BIOL., vol. 3, no. 5, 2002, pages 364 - 76, XP008098898, DOI: 10.1038/nrm801

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9932576B2 (en) 2012-12-10 2018-04-03 Resolution Bioscience, Inc. Methods for targeted genomic analysis
US11999949B2 (en) 2012-12-10 2024-06-04 Resolution Bioscience, Inc. Methods for targeted genomic analysis
US10907149B2 (en) 2012-12-10 2021-02-02 Resolution Bioscience, Inc. Methods for targeted genomic analysis
US12203127B2 (en) 2014-08-22 2025-01-21 Resolution Bioscience, Inc. Methods for quantitative genetic analysis of cell free DNA
US11339391B2 (en) 2015-11-11 2022-05-24 Resolution Bioscience, Inc. High efficiency construction of DNA libraries
US12559799B2 (en) 2016-08-25 2026-02-24 Resolution Bioscience, Inc. Methods for the detection of genomic copy changes in DNA samples
EP3504347A4 (en) * 2016-08-25 2020-04-29 Resolution Bioscience, Inc. METHOD FOR DETECTING CHANGES IN GENOMIC COPIES IN DNA SAMPLES
AU2017315769B2 (en) * 2016-08-25 2024-02-01 Resolution Bioscience, Inc. Methods for the detection of genomic copy changes in DNA samples
WO2018039463A1 (en) 2016-08-25 2018-03-01 Resolution Bioscience, Inc. Methods for the detection of genomic copy changes in dna samples
EP4667584A3 (en) * 2016-08-25 2026-04-01 Resolution Bioscience, Inc. Methods for quantitative genetic analysis of dna fragments using adaptors with unique molecular identifiers and sample tags
US11319594B2 (en) 2016-08-25 2022-05-03 Resolution Bioscience, Inc. Methods for the detection of genomic copy changes in DNA samples
JP2020527340A (ja) * 2017-06-30 2020-09-10 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア セルフリーdna中のdnaメチル化を評価するための方法およびシステム
WO2019006269A1 (en) * 2017-06-30 2019-01-03 The Regents Of The University Of California METHODS AND SYSTEMS FOR ASSESSING METHYLATION OF DNA IN ACELLULAR DNA
US11946043B2 (en) 2017-09-11 2024-04-02 Ludwig Institute For Cancer Research Ltd Selective labeling of 5-methylcytosine in circulating cell-free DNA
WO2019051484A1 (en) * 2017-09-11 2019-03-14 Ludwig Institute For Cancer Research Ltd SELECTIVE MARKING OF 5-METHYLCYTOSINE IN CIRCULATING ACELLULAR DNA
US11767562B2 (en) 2018-03-08 2023-09-26 St. John's University Circulating serum cell-free DNA biomarkers and methods
JP2021514663A (ja) * 2018-03-08 2021-06-17 セント・ジョーンズ・ユニバーシティSt. Johns University 循環性血清無細胞dnaバイオマーカー及び方法
US12146194B2 (en) 2018-03-08 2024-11-19 St. John's University Circulating serum cell-free DNA biomarkers and methods
US12435375B2 (en) 2018-04-02 2025-10-07 Grail, Inc. Methylation markers and targeted methylation probe panel
US12024750B2 (en) 2018-04-02 2024-07-02 Grail, Llc Methylation markers and targeted methylation probe panel
EP3827011A4 (en) * 2018-07-24 2022-06-22 Salish Bioscience Inc. METHODS AND COMPOSITION FOR TARGETED GENOME ANALYSIS
AU2019311015B2 (en) * 2018-07-24 2025-04-24 Salish Bioscience Inc. Methods and composition for targeted genomic analysis
US12195731B2 (en) 2018-07-24 2025-01-14 Salish Bioscience Inc. Methods and composition for targeted genomic analysis
US11795513B2 (en) 2018-09-27 2023-10-24 Grail, Llc Methylation markers and targeted methylation probe panel
US11725251B2 (en) 2018-09-27 2023-08-15 Grail, Llc Methylation markers and targeted methylation probe panel
US12410482B2 (en) 2018-09-27 2025-09-09 Grail, Inc. Methylation markers and targeted methylation probe panel
US11685958B2 (en) 2018-09-27 2023-06-27 Grail, Llc Methylation markers and targeted methylation probe panel
US11410750B2 (en) 2018-09-27 2022-08-09 Grail, Llc Methylation markers and targeted methylation probe panel
EP4368725A3 (en) * 2020-08-21 2024-05-29 University College Cardiff Consultants Ltd A method for the isolation of double-strand breaks
US12421554B2 (en) 2020-08-21 2025-09-23 University College Cardiff Consultants Limited Method for the isolation of double-strand breaks
US12428683B2 (en) 2020-08-21 2025-09-30 University College Cardiff Consultants Limited Method for the isolation of double-strand breaks
WO2022038291A1 (en) * 2020-08-21 2022-02-24 University College Cardiff Consultants Ltd A method for the isolation of double-strand breaks

Also Published As

Publication number Publication date
CA3004435A1 (en) 2017-05-18
MX2018005858A (es) 2019-02-20
IL285202B2 (en) 2025-03-01
BR112018009606A2 (pt) 2018-11-06
KR102788327B1 (ko) 2025-03-27
JP7318054B2 (ja) 2023-07-31
IL285202B1 (en) 2024-11-01
EP3374525A1 (en) 2018-09-19
JP7223788B2 (ja) 2023-02-16
JP2019504618A (ja) 2019-02-21
US20220267763A1 (en) 2022-08-25
JP2023113960A (ja) 2023-08-16
NZ742379A (en) 2024-12-20
IL259237B (en) 2021-08-31
JP2021073252A (ja) 2021-05-13
CN115044645A (zh) 2022-09-13
EP3889257A1 (en) 2021-10-06
JP2022105062A (ja) 2022-07-12
EP3374525A4 (en) 2019-05-29
KR20180113973A (ko) 2018-10-17
CN108431233A (zh) 2018-08-21
DK3374525T3 (da) 2021-04-06
RU2018121254A (ru) 2019-12-16
BR112018009606A8 (pt) 2019-02-26
AU2016353133B2 (en) 2022-12-08
JP6913089B2 (ja) 2021-08-04
EP3374525B1 (en) 2021-01-20
IL259237A (en) 2018-07-31
AU2016353133A1 (en) 2018-05-24
MX2023008338A (es) 2023-07-25
US11339391B2 (en) 2022-05-24
IL285202A (en) 2021-08-31
US20180245072A1 (en) 2018-08-30
ES2856598T3 (es) 2021-09-27
CN108431233B (zh) 2022-04-01

Similar Documents

Publication Publication Date Title
US20220267763A1 (en) High efficiency construction of dna libraries
US20250257387A1 (en) Methods for quantitative genetic analysis of cell free dna
US12559799B2 (en) Methods for the detection of genomic copy changes in DNA samples
EP3194612B1 (en) Methods for quantitative genetic analysis of cell free dna
EP4211246B1 (en) Adaptors and methods for high efficiency construction of genetic libraries and genetic analysis
HK40061892A (en) High efficiency construction of dna libraries
HK40112151A (en) Methods for quantitative genetic analysis of cell free dna
HK1261166A1 (en) High efficiency construction of dna libraries
HK1261166B (en) High efficiency construction of dna libraries
HK40096223B (en) Adaptors and methods for high efficiency construction of genetic libraries and genetic analysis
HK40096223A (en) Adaptors and methods for high efficiency construction of genetic libraries and genetic analysis
HK1241932B (en) Methods for quantitative genetic analysis of cell free dna
HK1241932A1 (en) Methods for quantitative genetic analysis of cell free dna

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16865029

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3004435

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/005858

Country of ref document: MX

Ref document number: 259237

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2018524250

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018009606

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2016353133

Country of ref document: AU

Date of ref document: 20161110

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20187016475

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020187016475

Country of ref document: KR

Ref document number: 2016865029

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2018121254

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 112018009606

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180511

WWG Wipo information: grant in national office

Ref document number: MX/A/2018/005858

Country of ref document: MX

WWG Wipo information: grant in national office

Ref document number: 742379

Country of ref document: NZ