WO2017081171A1 - Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti estrogen - Google Patents

Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti estrogen Download PDF

Info

Publication number
WO2017081171A1
WO2017081171A1 PCT/EP2016/077295 EP2016077295W WO2017081171A1 WO 2017081171 A1 WO2017081171 A1 WO 2017081171A1 EP 2016077295 W EP2016077295 W EP 2016077295W WO 2017081171 A1 WO2017081171 A1 WO 2017081171A1
Authority
WO
WIPO (PCT)
Prior art keywords
pdgf
breast cancer
estrogen
antibody
treatment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/077295
Other languages
English (en)
French (fr)
Inventor
Ulf Eriksson
Kristian Pietras
Pernilla ROSWALL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Paracrine Therapeutics AB
Original Assignee
Paracrine Therapeutics AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Paracrine Therapeutics AB filed Critical Paracrine Therapeutics AB
Priority to EP16795300.9A priority Critical patent/EP3373967B9/en
Priority to CN201680065636.1A priority patent/CN108348605B/zh
Priority to AU2016352592A priority patent/AU2016352592B2/en
Priority to JP2018543455A priority patent/JP7048505B2/ja
Priority to US15/774,341 priority patent/US11633382B2/en
Publication of WO2017081171A1 publication Critical patent/WO2017081171A1/en
Anticipated expiration legal-status Critical
Priority to JP2022011194A priority patent/JP2022058781A/ja
Priority to US18/121,075 priority patent/US20230310385A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/135Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/138Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/4025Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil not condensed and containing further heterocyclic rings, e.g. cromakalim
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41961,2,4-Triazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/451Non condensed piperidines, e.g. piperocaine having a carbocyclic group directly attached to the heterocyclic ring, e.g. glutethimide, meperidine, loperamide, phencyclidine, piminodine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/452Piperidinium derivatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4535Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a heterocyclic ring having sulfur as a ring hetero atom, e.g. pizotifen
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/565Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. estrane, estradiol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/565Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. estrane, estradiol
    • A61K31/566Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids not substituted in position 17 beta by a carbon atom, e.g. estrane, estradiol having an oxo group in position 17, e.g. estrone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/75Agonist effect on antigen

Definitions

  • the present invention relates to the field of treatment of cancer, and in particular to the field of treatment of ER-negative breast cancer.
  • the molecular subtype of breast cancer impacts on the recurrence rate and median time to recurrence.
  • women carrying basal-like tumors have the highest recurrence rate (34% vs 20% for all other subtypes) and the shortest median time to recurrence (2.6 years vs 5 years for all other subtypes).
  • the prognosis for women carrying basal-like breast cancers is the worst among all subtypes and the only therapeutic option offered today is high-dose chemotherapy; a treatment regimen that is accompanied by severe side effects.
  • Endocrine therapy which is associated with mild side effects compared to high-dose chemotherapy is not effective against basal-like tumors.
  • ER-negative breast cancers can be converted into ER-positive breast cancers, such as to a breast cancer of luminal-like phenotype by treatment with anti-PDGF-CC antibodies.
  • ER-positive breast cancers, including luminal-like breast cancers can be treated with anti-estrogen treatment.
  • ER-negative breast cancers can be treated with anti-estrogen treatment, if the treatment is combined with treatment with anti-PDGF-CC antibodies.
  • Said treatment may for example be an adjuvant treatment, for example a treatment aiming at reducing the risk of relapse of a breast cancer after removal of the primary tumor by surgery.
  • kits-of-parts comprising an anti-PDGF-CC antibody and an anti-estrogen for the treatment of ER-negative breast cancer in an individual in need thereof.
  • the invention also provides kit-of-parts comprising an inhibitor of PDGF-R and an anti- estrogen for the treatment of ER-negative breast cancer in an individual in need thereof.
  • the invention also provides methods for treatment of ER-negative breast cancer in an individual in need thereof, said method comprising administering an anti-PDGF-CC antibody and an anti-estrogen to said individual either simultaneously or sequentially in any order, thereby treating the ER-negative breast cancer.
  • the invention also provides methods for treatment of ER-negative breast cancer in an individual in need thereof, said method comprising administering an inhibitor of PDGF- R and an anti-estrogen to said individual either simultaneously or sequentially in any order, thereby treating the ER-negative breast cancer.
  • the invention also provides methods for sensitizing a ER-negative breast cancer to anti-estrogen treatment, said method comprising administering an anti-PDGF-CC to an individual suffering from ER-negative breast, thereby sensitizing said ER-negative breast cancer to anti-estrogen treatment.
  • the invention also provides methods for sensitizing an ER-negative breast cancer to anti-estrogen treatment, said method comprising administering an inhibitor of PDGF-R to an individual suffering from ER-negative breast, thereby sensitizing said ER-negative breast cancer to anti- estrogen treatment.
  • the invention also provides methods of converting a ER-negative breast cancer to an ER-positive breast cancer, said method comprising administering an anti-PDGF-CC to an individual suffering from ER-negative breast, thereby converting said ER-negative breast cancer to an ER-positive breast cancer.
  • the invention also provides methods of reducing the risk of relapse of an ER-negative breast cancer in an individual having suffered from ER-negative breast cancer, wherein said breast cancer in said individual has been treated by surgery, said method comprising
  • the invention also provides methods of reducing the risk of relapse of an ER-negative breast cancer in an individual having suffered from ER-negative breast cancer, wherein said breast cancer in said individual has been treated by surgery, said method comprising
  • kits-of-parts comprising an anti-PDGF-CC antibody and an anti-estrogen for use in above-mentioned methods.
  • Figure 1 shows expression of PDGF-CC.
  • Panel A and B shows expression in normal breast tissue.
  • Panels C to F shows expression in breast tumors.
  • Panel G shows expression correlated to clinicopathological parameters.
  • Panel H shows months survival in patients having moderate to high expression of PDGF-C compared to PDGF-C negative patients.
  • Panel I shows expression of PDGFR.
  • Panel A shows PDGF-CC, PDGFRa and PDGFR3 expression in tumors of MMTV-PyMT mice.
  • Panel B shows tumor volume of mammary tumors of MMTV-PyMT mice.
  • Panel C-D shows tumor latency and survival.
  • Panel E-F shows tumor stage and necrosis.
  • Panel G shows pulmonary metastases.
  • Panel H shows tumor volume after transplantation.
  • Panel I shows tumor volume after injection.
  • FIG. 3 Panel A shows Masson tri-chrome staining of tumor sections.
  • Panel B shows that MMTV-PyMT; Pdgfc lacz/Iacz mice were severely hemorrhagic.
  • Panel C shows immunostaining for HIF-1 a.
  • Panel D shows expression of VEGF-A as determined by quantitative PCR analysis.
  • Panels E-F show tumor volume and blood vessel density in SCID mice bearing orthotopically implanted MDA-MB-231 tumors and treated with A3B6 antibody or with control antibody.
  • Panel A and B show expression of Foxal ; lacZ/lacZ is equivalent of PDGFC - /-.
  • Panel C shows that expression of Foxal is highly correlated with a non-basal-like molecular subtype based on transcriptional profiles of breast tumors collected within The Cancer Genome Atlas project.
  • Panel D shows expression of Foxa l as a specific feature of tumors of the luminal subtype.
  • Panel E shows immunostaining of a cohort of human breast tumor specimens for Foxal .
  • Panel F shows expression of PDGF-CC in breast tumor cell lines.
  • Panel G shows that expression of Foxal is inversely correlated to expression of PDGF-CC.
  • Panel A shows expression of FoxA1 and ERa in tumor protein lysates.
  • Panel B shows expression of stanniocalcin (STC)-1 , hepatocyte growth factor (HGF) and insulin growth factor binding protein 3 (IGFBP3) as determined by quantitative PCR.
  • Panels C to E shows expression of the luminal-like subtype markers FoxA1 , ERa and GAT A3, respectively after stimulation with STC-1 , HGF and/or IGFBP3.
  • Panel F shows sensitivity to tamoxifen-induced growth arrest.
  • Panel G shows that conditioned medium from stromal fibroblasts can be substituted for the three paracrine PDGF-CC-induced factors.
  • Panel H shows immunostaining of tumors from MMTV-PyMT mice for STC-1 , HGF and IGFBP3.
  • Panel A shows tumor growth of wt tumors of tamoxifen-treated mice and untreated mice.
  • Panel B shows tumor growth of tumors from Pdgfc-deficient mice upon treatment with tamoxifen.
  • Panel C shows tumor growth of fully established MDA-MB- 231 tumors after treatment with tamoxifen.
  • Panel D shows tumor growth of fully established MDA-MB-231 tumors after combined treatment with anti-PDGF-CC antibody A3B6 and tamoxifen.
  • Panel E shows expression of ERa after treatment with monoclonal anti-PDGF-CC antibody A3B6.
  • Panel F shows ERa expression in MDA- MB-231 tumors following blockade of signaling by PDGF-CC.
  • Panel G shows a theoretical model of a paracrine signaling network in breast tumor microenvironment.
  • FIG. 1 Tumor growth in mice treated with anti-PDGF-CC antibody, Letrozole, a combination of anti-PDGF-CC antibody and Letrozole, and control.
  • FIG. 1 Tumor growth in mice treated with Imatinib, Tamoxifen, a combination of Imatinib and Tamoxifen, control.
  • antibody as used herein is a polypeptide or protein capable of recognizing and binding an antigen comprising at least one antigen binding site. Said antigen binding site preferably comprises at least one CDR.
  • the antibody may be a naturally occurring antibody, a fragment of a naturally occurring antibody or a synthetic antibody.
  • the term "antigen” as used herein refers to a molecule comprising at least one epitope.
  • the antigen may for example be a polypeptide, polysaccharide, protein, lipoprotein or glycoprotein.
  • the term "Basal-like breast cancer” as used herein refers to a breast cancer of a triple- negative phenotype, i.e. said cancer does not express estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor (HER)-2 at detectable levels. Furthermore, basal-type breast cancer typically does not express FoxA1 . Basal-like breast cancer is associated with high grade, poor prognosis, and younger patient age.
  • epitope refers to a determinant capable of specific binding to an antibody.
  • the epitope may be comprised within PDGF- C or PDGF-CC.
  • Epitopes usually consist of chemically active surface groupings of molecules such as amino acids and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Epitopes may be
  • Epitopes may be continous or
  • ER-negative breast cancer refers to a breast cancer lacking expression of the estrogen receptor.
  • an ER-negative breast cancer is a breast cancer, where ⁇ 1 % of the tumor cells of said breast cancer express estrogen receptor at levels detectable by immunohistochemistry.
  • ER-positive breast cancer refers to a breast cancer expressing the estrogen receptor.
  • a breast cancer is considered an ER-positive breast cancer, when >10% of the tumor cells of said breast cancer express estrogen receptor at levels detectable by immunohistochemistry.
  • luminal-like breast cancer refers to a breast cancer which is responsive to anti-estrogen therapy.
  • a “luminal-like breast cancer” expresses the estrogen receptor (ER).
  • ER estrogen receptor
  • a “lumical-like breast cancer” according to the present invention may be true luminal breast cancer, such as a luminal A or luminal B breast cancer.
  • Naturally occurring antibody refers to heterotetrameric glycoproteins capable of recognizing and binding an antigen and comprising two identical heavy (H) chains and two identical light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain comprises a heavy chain variable region (abbreviated herein as V H ) and a heavy chain constant region (abbreviated herein as C H ).
  • Each light chain comprises a light chain variable region (abbreviated herein as V L ) and a light chain constant region (abbreviated herein as C L ).
  • the V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs).
  • Antibodies may comprise several identical heterotetramers.
  • the term "treatment” as used herein may refer to any kind of treatment.
  • the treatment may be a curative treatment, it may also be an ameliorating treatment and/or a treatment reducing the effects of the cancer.
  • the treatment may also be a treatment which delays progression of the cancer, for example the treatment may reduce the growth of cancer, reduce metastasis or in other ways delay cancer progression.
  • the treatment may also be a treatment to reduce the risk of relapse.
  • the present invention provides methods for treatment of ER-negative breast cancers in an individual in need thereof.
  • the methods of the invention comprise administering an anti-PDGF-CC antibody and an anti-estrogen to an individual suffering from ER- negative breast cancer either simultaneously or sequentially in any order, thereby treating the ER-negative breast cancer.
  • the present disclosure also provides methods for treatment of ER-negative breast cancers in an individual in need thereof, the methods comprising administering an inhibitor of PDGF-R and an anti-estrogen to an individual suffering from ER-negative breast cancer either simultaneously or sequentially in any order, thereby treating the ER-negative breast cancer.
  • the method of treatment according to the invention may be combined with one or more conventional methods for treatment of ER-negative breast cancer.
  • the methods of the invention may comprise a combination of treatment with an anti-PDGF-CC antibody and an anti-estrogen combined with one or more additional methods.
  • the methods of the invention may also comprise a combination of treatment with an inhibitor of PDGF-R and an anti-estrogen combined with one or more additional methods.
  • said ER-negative breast cancer may be treated by a method selected from the group consisting of surgery, irradiation and chemotherapy.
  • the individual to be treated with the methods of the invention may be an individual suffering from ER-negative breast cancer, wherein said individual has already been subjected to treatment of said breast cancer by surgery.
  • the individual to be treated may be an individual who has suffered from ER-negative breast cancer, wherein the primary tumor has been removed by surgery.
  • the treatment of the present invention can frequently be considered an adjuvant therapy, which reduces the risk of relapse.
  • the treatment may be a treatment to reduce the risk of relapse within 5 years from onset of the treatment.
  • the treatment may be treatment to prevent relapse within 5 years from the onset of treatment.
  • the treatment with anti-PDGF-CC antibodies and anti-estrogen is initiated at the latest 1 months after surgery, for example at the latest one week after surgery. Treatment may be initiated earlier, for example even prior to surgery.
  • the treatment with inhibitors of PDGF-R and anti-estrogen is initiated at the latest 1 month after surgery, for example at the latest one week after surgery. Treatment may be initiated earlier, for example even prior to surgery.
  • the individual to be treated with anti-PDGF-CC antibodies and anti-estrogen, or the individual to be treated with inhibitors of PDGF-R and anti-estrogen have not been subjected to surgery. This may be because the particular breast cancer is an inoperable breast cancer, a breast cancer less suitable for removal by surgery or because the individual has not yet undergone surgery. Such treatment may for example be a neoadjuvant treatment.
  • the anti-PDGF-CC antibody may be any antibody capable of binding PDGF-CC, for example any of the antibodies described herein below in the section "anti-PDGF-CC antibody”.
  • the anti-estrogen may be any compound having an anti-estrogen effect, for example any of the compounds described herein below in the section anti-estrogen.
  • the invention also provides methods for sensitizing an ER-negative breast cancer to anti-estrogen treatment.
  • ER-negative breast cancers are not responsive to anti- estrogen treatment (see e.g. Early Breast Cancer Trialists' Collaborative Group (EBCTCG) doi: 10.1016/S0140-6736(1 1 )60993-8), but the invention interestingly discloses that ER-negative breast cancer can be sensitized to treatment with anti- estrogen by treatment with anti-PDGF-CC antibodies.
  • the invention provides methods for sensitizing an ER-negative breast cancer to anti-estrogen treatment, said methods comprising administering an anti-PDGF-CC to an individual suffering from ER-negative breast cancer, thereby sensitizing said ER- negative breast cancer to anti-estrogen treatment.
  • the disclosure also provides methods for sensitizing an ER-negative breast cancer to anti-estrogen treatment, said methods comprising administering an inhibitor of PDGF-R to an individual suffering from ER-negative breast cancer, thereby sensitizing said ER- negative breast cancer to anti-estrogen treatment.
  • the invention may provide methods for sensitizing an ER-negative breast cancer to anti-estrogen treatment in an individual,
  • a breast cancer sensitized to anti-estrogen treatment may thus be treated with anti- estrogen.
  • the methods may thus comprise a step of administering an anti-estrogen to the individual suffering from ER-negative breast cancer, wherein said anti-PDGF-CC antibody and said anti-estrogen may be administered simultaneously or sequentially in any order.
  • the invention also provides methods of treatment of ER-negative breast cancer in an individual in need thereof, said method comprising a. Sensitizing an ER-negative breast cancer to treatment with anti-estrogen by administering an anti-PDGF-CC antibody to an individual suffering from ER- negative breast cancer;
  • the disclosure also provides methods of treatment of ER-negative breast cancer in an individual in need thereof, said method comprising a. Sensitizing an ER-negative breast cancer to treatment with anti-estrogen by administering an inhibitor of PDGF-R to an individual suffering from ER- negative breast cancer;
  • the invention also provides methods of treatment of ER-negative breast cancer in an individual, wherein said individual has suffered from ER-negative breast cancer, and wherein said breast cancer in said individual has been treated by surgery, said method comprising
  • the invention also provides methods of treatment of ER-negative breast cancer in an individual, wherein said individual has suffered from ER-negative breast cancer, and wherein said breast cancer in said individual has been treated by surgery, said method comprising a. Sensitizing the ER-negative breast cancer to treatment with anti-estrogen by administering an inhibitor of PDGF-R to an individual suffering from ER- negative breast cancer;
  • the invention also provides methods of treatment of ER-negative breast cancer in an individual in need thereof, said method comprising
  • the invention also provides methods of treatment of ER-negative breast cancer in an individual in need thereof, said method comprising
  • the invention also provides methods of converting an ER-negative breast cancer to a ER-positive breast cancer.
  • Such methods comprise administering an anti-PDGF-CC to an individual suffering from ER-negative breast cancer, thereby converting said ER- negative breast cancer to an ER-positive breast cancer.
  • the invention also provides methods of converting an ER-negative breast cancer to a luminal-like breast cancer.
  • Such methods comprise administering an anti-PDGF-CC to an individual suffering from ER-negative breast cancer, thereby converting said ER- negative breast cancer to a luminal-like breast cancer.
  • a breast cancer is considered to be a luminal-like breast cancer, when said cancer is expressing the estrogen receptor (ER) at detectable levels. It is preferred that at least 1 %, such as at least 10% of the breast cancer cells of said breast cancer are expressing ER at detectable levels.
  • ER estrogen receptor
  • the method may comprise an additional step of testing whether the breast cancer has been converted to a luminal-like breast cancer and/or to an ER- positive breast cancer.
  • Said test may be performed subsequent to administration of said anti-PDGF-CC antibody and may in general comprise the steps of: a) obtaining a sample from said breast cancer
  • test may be any test useful for determining whether a breast cancer expresses ER.
  • the test is an immunohistochemical test, for example a test, wherein step b) involves staining the sample obtained in step a) with the aid of antibodies recognizing ER, and followed by detection of ER expression e.g. by microscopy. If a larger percentage of cells express ER than in the initial ER-negative tumor (e.g. if more than 1 % of the tumor cells express ER) then ER may be considered expressed. Preferably, if at least 10% of tumor cells of said sample expressed ER, then the breast cancer is considered ER -positive.
  • the invention provides methods of treatment of ER-negative breast cancer in an individual in need thereof, said method comprising a. converting a ER-negative breast cancer to a luminal-like breast cancer by administering an anti-PDGF-CC antibody to an individual suffering from ER- negative breast cancer;
  • the methods of the invention may comprise the steps of administering an anti-PDGF- CC antibody and an anti-estrogen.
  • Said anti-PDGF-CC antibody and said anti-estrogen may be administered simultaneously or sequentially in any order.
  • the methods of the invention may in alternative comprise the steps of administering an inhibitor of PDGF-R and an anti-estrogen.
  • Said inhibitor of PDGF-R and said anti- estrogen may be administered simultaneously or sequentially in any order.
  • kits-of-parts comprising
  • said anti-PDGF-CC antibody or said inhibitor of PDGF-R is administered to said individual simultaneously with administration of said anti-estrogen.
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R is administered to said individual prior to administration of said anti-estrogen. Such an order of administration may ensure that the ER-negative breast cancer is sensitized to anti-estrogen prior to administration of said anti-estrogen.
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R is administered more than once, for example it may be administered at least twice, such as at least 3 times, for example in the range of 1 to 20 times, such as in the range of 2 to 10 times.
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R is administered at least twice to an individual suffering from ER-negative breast cancer, wherein one or more administrations are prior to treatment by surgery, and one or more additional administrations are administered post treatment by surgery.
  • administration(s) after surgery may be simultaneous with anti-estrogen treatment.
  • anti-estrogen may be administered more than once.
  • Many anti-estrogens are administered over an extended period of time, for example once daily, twice daily or even more frequently for an extended period of time.
  • Anti-estrogens may also be administered less frequently, e.g. in the range of 1 to 6 times per week, or for example in the range of 1 to 4 times per months.
  • administration of an anti-estrogen may be very frequent over an extended period of time, for example for at least 1 month, such as for at least 6 months, for example for at least 1 year, such as for several years.
  • the anti-estrogen treatment may be once daily for at least 1 year, for example of in the range 1 to 10 years, such as in the range of 4 to 6 years, such as for 5 years.
  • the first administration of anti-estrogen may be simultaneous with at least one administration of anti-PDGF-CC antibodies or inhibitors of PDGF-R, whereas subsequent administrations may be performed individually. It is also possible that each administration of anti-PDGF-CC antibody or inhibitors of PDGF- R is performed simultaneously with an administration of anti-estrogen, but that anti- estrogens in addition are administered separately.
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R is administered at least once prior to the first administration of anti-estrogen.
  • the first dosage of said anti-estrogen may be administered in the range of 1 hours to several weeks after the first administration of said anti-PDGF-CC antibody or of said inhibitor of PDGF-R.
  • the anti-estrogen is administered for a longer time than the anti-PDGF-CC antibody or the inhibitor of PDGF-R.
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R may for example be administered at the onset of treatment, whereas the anti-estrogen typically may be administered continuously for a longer time period.
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R may for example be administered in the range of 1 to 5 times, whereas the anti-estrogen typically may be administered continuously for in the range of 1 to 10 years, such as in the range of 4 to 6 years, such as for 5 years.
  • the last administration of anti-estrogen is preferably given later than the last administration of anti-PDGF-CC antibody or inhibitor of PDGF-R.
  • the route of administration may be chosen according to the particular anti-PDGF-CC antibody, inhibitor of PDGF-R and the anti-estrogen. Frequently, the anti-PDGF-CC antibody or the inhibitor of PDGF-R is administered parenterally. Inhibitors of PDGF-R can be administered parenterally, for example as intravenous formulation, and also enetrally, for example orally in the form of tablets. Methods and useful formulations for parenteral administration are described below in the section "Pharmaceutical formulation”.
  • the anti-estrogen may be administered by any useful route, which may be chosen according to the particular anti-estrogen used. Frequently, the anti-estrogen is administered orally. Methods and useful formulations for oral administration are described below in the section "Pharmaceutical formulation”.
  • the individual to be treated may be any individual suffering from ER-negative breast cancer. Frequently, the individual will be a human being, for example a male or a female human being. Preferably, the individual is a female human being.
  • the methods of the present disclosure comprise administration of an anti-PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist as described in the section below "Anti-estrogen”.
  • the methods of the present disclosure comprise administration of an anti-PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist selected from the group consisting of tamoxifen, raloxifene, 4- hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant and toremifene.
  • the methods of the present disclosure comprise administration of an anti-PDGF-CC antibody and an estrogen antagonist, wherein the estrogen antagonist is tamoxifen.
  • the methods of the present disclosure comprise administration of an anti-PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an aromatase inhibitor as described in the section below "Anti-estrogen".
  • the methods of the present disclosure comprise administration of an anti-PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an aromatase inhibitor selected from the group consisting of exemestane, formestane, aminoglutethimide, vorozole, fadrozole, anastrozole and letrozole.
  • an aromatase inhibitor selected from the group consisting of exemestane, formestane, aminoglutethimide, vorozole, fadrozole, anastrozole and letrozole.
  • the methods of the present disclosure comprise administration of an anti-PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is letrozole.
  • the methods of the present disclosure comprise administration of an inhibitor of PDGF-R and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist as described in the section below "Anti-estrogen”.
  • the methods of the present disclosure comprise administration of an inhibitor of PDGF-R and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist selected from the group consisting of tamoxifen, raloxifene, 4- hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant and toremifene.
  • an estrogen antagonist selected from the group consisting of tamoxifen, raloxifene, 4- hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant and toremifene.
  • the methods of the present disclosure comprise administration of an inhibitor of PDGF-R and an anti-estrogen, wherein the anti-estrogen is tamoxifen.
  • the invention provides a kit-of-parts comprising an anti-PDGF-CC antibody and an anti-estrogen.
  • the invention also provides a kit-of-parts comprising an inhibitor of
  • kits-of-part may in particular be for the treatment of ER-negative breast cancer in an individual in need thereof.
  • the kit-of-parts may be prepared for use in any of the methods of treatment, described herein above in the section "Method of treatment".
  • the kit-of-parts may be provided as separate units, i.e. one or more units comprising an anti-PDGF-CC antibody and one or more units comprising an anti-estrogen, wherein the units are separately provided.
  • the kit-of-parts may comprise one or more units comprising an inhibitor of PDGF-R and one or more units comprising an anti-estrogen, wherein the units are separately provided.
  • kit-of-parts may be prepared for sequential administration, wherein each part of the kit-of-part are provided and administered separately.
  • the anti-PDGF-CC antibody and the anti-estrogen may be prepared for sequential administration.
  • the inhibitor of PDGF-R and the anti-estrogen may be prepared for sequential
  • kit-of-part is prepared for administration according to any of the methods described above in the section "Method of treatment".
  • the kit-of-parts may be prepared for treatment of ER- negative breast cancer, wherein said treatment comprises the steps of a. administration of the anti-PDGF-CC antibody to an individual in need thereof; b. subsequent administration of the anti-estrogen.
  • the kit-of-parts may be prepared for treatment of ER-negative breast cancer, wherein said treatment comprises the steps of a. administration of the inhibitor of PDGF-R to an individual in need thereof;
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R is prepared for parenteral administration for a limited number of times.
  • the anti-PDGF-CC antibody or the inhibitor of PDGF-R may be prepared for parenteral administration as described herein above in the section "Method of treatment”.
  • the inhibitor of PDGF-R is also frequently prepared for oral administration, for example in the form of tablets.
  • the anti-estrogen may be prepared by administration by any means.
  • the anti-estrogen may be prepared for frequent oral administration as described herein above in the section "Method of treatment”.
  • the kit-of-parts of the present disclosure comprises an anti- PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist as described in the section below "Anti-estrogen".
  • the kit-of-parts of the present disclosure comprises an anti- PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist selected from the group consisting of tamoxifen, raloxifene, 4- hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant and toremifene.
  • the anti-estrogen is an estrogen antagonist selected from the group consisting of tamoxifen, raloxifene, 4- hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant and toremifene.
  • kit-of-parts of the present disclosure comprises an anti- PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is tamoxifen. In some embodiments the kit-of-parts of the present disclosure comprises an anti-
  • PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an aromatase inhibitor as described in the section below "Anti-estrogen”.
  • kit-of-parts of the present disclosure comprises an anti- PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is an aromatase inhibitor selected from the group consisting of exemestane, formestane,
  • kit-of-parts of the present disclosure comprises an anti- PDGF-CC antibody and an anti-estrogen, wherein the anti-estrogen is letrozole
  • kit-of-parts of the present disclosure comprises an inhibitor of PDGF-R and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist as described in the section below "Anti-estrogen”.
  • the kit-of-parts of the present disclosure comprises an inhibitor of PDGF-R and an anti-estrogen, wherein the anti-estrogen is an estrogen antagonist selected from the group consisting of tamoxifen, raloxifene, 4-hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant and toremifene.
  • the kit-of-parts of the present disclosure comprises an inhibitor of PDGF-R and an anti-estrogen, wherein the anti-estrogen is tamoxifen.
  • the present invention relates to a kit-of-part comprising an anti-PDGF-CC antibody as well as to methods of treatment employing an anti-PDGF-CC antibody.
  • Said anti- PDGF-CC antibody may be any antibody capable of binding PDGF-CC, in particular it may be an antibody specifically binding PDGF-CC.
  • PDGF-CC is described in detail in the section "PDGF-CC" herein below. Since PDGF-CC is a dimer of PDGF-C, and accordingly, the anti-PDGF-CC antibody may specifically bind both PDGF-CC and PDGF-C.
  • the present invention relates also to a kit-of-part comprising an inhibitor of PDGF-R as well as to methods of treatment employing an inhibitor of PDGF-R.
  • an anti-PDGF-CC antibody is preferred as the antibody targets with great specificity PDGF-CC, but not other members of the PDGF family and therefore side effects are minimal.
  • Inhibitors of PDGF-R are also effective in blocking the PDGF-R signaling pathways, but they act non-specifically on all the PDGF-R and may so result in undesired effects. However, such undesired effects are minimized when the inhibitor of PDGF-R is an antibody against PDGF-R.
  • the anti-PDGF-CC antibodies may bind to any PDGF-CC. However, in general it is preferred that the anti-PDGF-CC antibodies to be used are capable of binding PDGF- CC of the individual to be treated. Accordingly, in embodiments of the invention where the individual is a human being, then it is preferred that the anti-PDGF-CC antibodies are capable of binding human PDGF-CC.
  • the sequence of human PDGF-C is provided as SEQ ID NO:1 herein.
  • the anti-PDGF-CC antibody according to the present invention may be any one of the anti-PDGF-CC antibody according to the present invention.
  • polypeptide or protein capable of recognizing and binding PDGF-CC capable of recognizing and binding PDGF-CC.
  • specifically binding is meant binding with at least 10 times higher affinity to PDGF-CC than to a non-specific antigen (e.g. BSA).
  • the antibody binds with an affinity corresponding to a K D of about 10 "7 M or less, such as about 10 "8 M or less, such as about 10 ⁇ 9 M or less, for example about 10 ⁇ 10 M or less, when measured as apparent affinities based on IC 50 values.
  • the anti-PDGF-CC antibody specifically binds PDGF-CC and optionally also PDGF-C, but not any other PDGF.
  • said anti-PDGF-CC antibody is a naturally occurring antibody or a functional homologue thereof.
  • a naturally occurring antibody is a heterotetrameric glycoproteins capable of recognizing and binding an antigen comprising two identical heavy (H) chains and two identical light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain comprises or preferably consists of a heavy chain variable region (abbreviated herein as V H ) and a heavy chain constant region (abbreviated herein as C H ).
  • Each light chain comprises or preferably consists a light chain variable region (abbreviated herein as V L ) and a light chain constant region (abbreviated herein as C L ).
  • V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs).
  • CDRs complementarity determining regions
  • FRs framework regions
  • Each V H and V L comprises and preferably consists of three CDRs and four FRs, arranged from amino-terminus to carboxy- terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4.
  • Naturally occurring antibodies according to the invention may consist of one heterotetramer or they may comprise several identical heterotetramers.
  • the naturally occurring antibody according to the invention may for example be selected from the group consisting of IgG, IgM, IgA, IgD and IgE.
  • the subunit structures and three-dimensional configurations of these different classes of immunoglobulins are well known.
  • the antibody is IgG,
  • lgG-1 e.g. lgG-1 , lgG-2, lgG-3 and lgG-4.
  • Naturally occurring antibodies according to the invention may be antibodies of a particular species, for example the antibody may be a murine, a rat, a rabbit, a goat, a sheep, a chicken, a donkey, a camelid or a human antibody.
  • the antibody according to the invention may however also be a hybrid between antibodies from several species, for example the antibody may be a chimeric antibody, such as a humanized antibody.
  • the anti-PDGF-CC antibody according to the invention may be a human antibody or a humanized antibody, e.g. a naturally occurring human antibody.
  • the anti-PDGF-CC antibody according to the invention may be a human
  • immunoglobulin or a humanized immunoglobulin, e.g. a naturally occurring human immunoglobulin.
  • a human antibody as used herein is an antibody, which is obtained from a system using human immunoglobulin sequences.
  • Human antibodies may for example be antibodies isolated from an animal (e.g., a mouse) that is transgenic or
  • Human antibodies may also be isolated from a host cell transformed to express the antibody, e.g., from a transfectoma. Human antibodies may also be isolated from a recombinant, combinatorial human antibody library.
  • Human antibodies have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis or in vivo somatic mutagenesis and thus the amino acid sequences of the V H and V L regions of the recombinant antibodies are sequences that, while derived from and related to human germline V H and V L sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • a human antibody is preferably at least 90%, more preferably at least 95%, even more preferably at least 96%, 97%, 98%, or 99% identical in amino acid sequence to the amino acid sequence encoded by a wild type human immunoglobulin gene.
  • Said transgenic of transchromosomal animal may contain a human immunoglobulin gene miniloci that encodes unrearranged human heavy ( ⁇ and/or ⁇ ) and ⁇ light chain immunoglobulin sequences. Furthermore, the animal may contain one or more mutations that inactivate the endogenous heavy and light chain loci. Examples of such animals are described in Lonberg, N. et al. (1994) Nature 36S (6474):856-859 and WO 02/43478.
  • the anti-PDGF-CC antibody according to the invention may be a chimeric antibody, i.e. an antibody comprising regions derived from different species.
  • the chimeric antibody may for example comprise variable regions from one species of animal and constant regions from another species of animal.
  • a chimeric antibody can be an antibody having variable regions which derive from a mouse monoclonal antibody and constant regions which are human. Such antibodies may also be referred to as humanized antibodies.
  • the anti-PDGF-CC antibody according to the invention may also be a humanized antibody, which is encoded partly by sequences obtained from human germline immunoglobulin sequences and partly from other sequences. Said other sequences are preferably germline immunoglobulines from other species, more preferably from other mammalian species.
  • a humanized antibody may be an antibody in which the antigen binding site is derived from an immunoglobulin from a non-human species, preferably from a non-human mammal, e.g. from a mouse or a rat, whereas some or all of the remaining immunoglobulin-derived parts of the molecule are derived from a human immunoglobulin.
  • the antigen binding site from said non-human species may for example consist of a complete V L or V H or both or one or more CDRs grafted onto appropriate human framework regions in V L or V H or both.
  • the CDRs can be from a mouse or rat monoclonal antibody and the other regions of the antibody are of human origin.
  • the anti-PDGF-CC antibody according to the invention may be a monoclonal antibody, such as a naturally occurring monoclonal antibody or it may be polyclonal antibodies, such as naturally occurring polyclonal antibodies.
  • the anti-PDGF-CC antibody may be any protein or polypeptide containing an antigen binding site, such as a single polypeptide, a protein or a glycoprotein.
  • the antigen binding site comprises at least one CDR, or more preferably a variable region.
  • the antigen binding site may comprise a V H and/or V L .
  • the V H and V L together may contain the antigen binding site, however, either one of the V H or the V L may comprise an antigen binding site.
  • the anti-PDGF-CC antibody may for example be an antigen binding fragment of antibody, preferably an antigen binding fragment of a naturally occurring antibody, a heterospecific antibody, a single chain antibody or a recombinant antibody.
  • An anti-PDGF-CC antibody according to the invention may comprise one or more antigen binding sites.
  • Naturally occurring heterotetrameric antibodies comprises two antigen binding sites.
  • the anti-PDGF-CC antibodies to be used with the invention are capable of recognizing and binding PDGF-CC.
  • the anti- PDGF-CC antibodies specifically bind one or more epitopes on PDGF-CC.
  • the antibody is a monoclonal antibody, then the antibody generally binds one epitope on PDGF-CC. Said epitope(s) may be positioned in any useful part of PDGF-CC.
  • the antibodies are inhibitory antibodies, i.e. the antibodies are capable of inhibiting PDGF-CC activity.
  • the antibodies are capable of inhibiting binding of PDGF-CC to the PDGFRa homodimer and/or to the PDGFRa/ ⁇ heterodimer.
  • the anti-PDGF-CC antibodies may also be capable of inhibiting activation of the PDGFRa homodimer and/or of the PDGFRa/ ⁇ heterodimer. Activation of PDGFRa homodimer and/or the PDGFRa/ ⁇ heterodimer may for example be determined by determining the kinase activity of PDGFRa homodimer and/or to the PDGFRa/ ⁇ heterodimer.
  • the anti-PDGF-CC antibody is capable of inhibiting proteolytic processing of PDGF-CC.
  • said anti-PDGF-CC antibody may be any of the antibodies described in US patent application no. 62/357,536.
  • the anti-PDGF-CC may include the entire antibody, a fragment or substantially homologous fragment of the monoclonal antibodies (mAbs) A3B6, 1 1 F5, 19C7 and 12F5, of the
  • the anti-PDGF-CC antibody may in a preferred embodiment be a humanized antibody, in particular the antibody huA3B6 described in US application 62/357,536.
  • the anti-PDGF-CC antibody may bind one or more epitopes within the PDGF-CC core active domain, which is provided at residues 230-345 of the full- length sequence, which is provided as SEQ ID NO.: 1 .
  • the anti-PDGF-CC antibody binds an epitope positioned in the region of PDGF-CC, which includes the cleavage site.
  • the cleavage site is positioned at amino acids 231 to 234 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody is capable of binding an epitope comprising at least part of an amino acid selected from the group consisting of amino acids 231 , 232, 233 and 234 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may be capable of binding an epitope comprising at least one of amino acids 231 , 232, 233 and 234 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may be capable of binding an epitope immediately adjacent to the cleavage site thereby inhibiting proteolytic processing of PDGF-C.
  • the anti-PDGF-CC antibody is capable of binding an epitope positioned within amino acids 230 to 250 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody binds a PDGF-C epitope described in WO2005/087812.
  • the anti-PDGF-CC antibody may bind an epitope comprised of amino acids 231 to 274 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody binds a PDGF-C epitope described in WO2007/124308.
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 228 to 238 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody binds a PDGF-C epitope described in WO2013/160359.
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 308 to 322 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 242 to 254 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 288 to 308 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 325 to 345 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 256 to 274 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 256 to 264 of SEQ ID NO:1 .
  • the anti-PDGF-CC antibody may bind an epitope positioned within, comprising or consisting of amino acids 256 to 260 of SEQ ID NO:1 .
  • Platelet-derived growth factors are growth factors important for normal tissue growth and maintenance.
  • PDGF-C is secreted from cells as a latent dimer, PDGF-CC.
  • PDGF-CC signals through the PDGFR-a, in particular through the PDGFRa
  • Tissue plasminogen activator is a secreted serine protease with highly restricted substrate specificity, and tPA cleaves and activates latent dimeric PDGF-CC.
  • PDGF-CC is human PDGF-CC.
  • the sequence of human PDGF-C is provided herein as SEQ ID NO:1 and human PDGF- CC is a dimer of two polypeptides of SEQ ID NO:1 .
  • PDGF-CC may however also be a functional homologue of human PDGF-C, for example a dimer of polypeptides, which each share at least 70%, such as at least 80%, for example at least 85%, such as at least 90%, for example at least 95% sequence identity with SEQ ID NO:1 .
  • PDGF-CC may thus also be PDGF-CC of other mammals.
  • the present disclosure relates to a kit-of-part comprising an inhibitor of platelet-derived growth factor receptor (PDGF-R) as well as methods of treatment employing an inhibitor of PDGF-R.
  • PDGF-Rs are cell surface tyrosine kinase receptors for members of the platelet-derived growth factor (PDGF) family.
  • PDGF-Rs There are two forms of the PDGF-R, alpha (UniProt accession number P16234; SEQ ID NO:8) and beta (UniProt accession number P09619; SEQ ID NO:9) each encoded by a different gene.
  • PDGF-R may homo- or heterodimerize.
  • the extracellular region of the receptor consists of five immunoglobulin-like domains while the intracellular part is a tyrosine kinase domain.
  • the PDGFs bind the tyrosine kinase domain of PDGF-R alpha or beta and so cause the receptor to dimerize.
  • the different PDGFs interact with different receptor dimers. Dimerization is a prerequisite for the activation of the kinase, which will phosphorylate some critical residues of the receptor itself as well as of the receptor substrates.
  • the phosphorylated residue of the receptor is located in proximity to usually three specific binding sites for signal transduction molecules, in the extracellular region.
  • the signal transduction molecules may be equipped with different enzymatic activities, or may act as adaptor molecules, which in some but not all cases are found in complexes with subunits that carry a catalytic activity. Upon interaction with the activated receptor, the catalytic activities become up-regulated.
  • the main downstream mediators of the PDGF-R signaling appear to be Ras/mitogen-activated protein kinase (MAPK), PI-3 kinase and phospholipase- ⁇ (PLCy) pathways.
  • MAPK Ras/mitogen-activated protein kinase
  • PLCy phospholipase- ⁇
  • ROS reactive oxygen species
  • the inhibitor of PDGF-R may be any compound capable of interacting with the PDGF-R and blocking its tyrosine kinase activity.
  • the inhibitor of PDGF-R may bind and specifically occupy the tyrosine kinase site of PDGF-R.
  • PDGF-R refers to both PDGF-R alpha (PDGF-Ra) and PDGF-R beta (PDGF-R3) as well as variants thereof, for example the naturally occurring isoforms of PDGF-Ra and PDGF-R3.
  • the inhibitor of PDGF-R is capable of inhibiting the tyrosine kinase activity of PDGF-Ra and PDGF-R3.
  • the inhibitor of PDGF-R is capable of inhibiting the tyrosine kinase activity of PDGF-Ra. In some embodiments, the inhibitor of PDGF-R is capable of inhibiting the tyrosine kinase activity of PDGF-R3.
  • the inhibitor of PDGF-R is a tyrosine-kinase inhibitor.
  • Several inhibitors of PDGF-R are known, for example imatinib, nilotinib, axitinib sunitinib, dasitinib, sorafenib, SU6668, pazopanib, lenvatinib, cabozantinib and nintedanib.
  • the inhibitor of PDGF-R is imatinib.
  • the inhibitor of PDGF-R is an antibody against PDGF-R.
  • Some antibodies are in fact capable of interacting with PDGF-Rs and block or neutralize their activity; in particular they can block or neutralize signaling departing from the PDGF-Rs.
  • the anti-PDGF-R antibodies may bind to any PDGF-R.
  • the anti-PDGF-R antibodies to be used are capable of binding PDGF-R of the individual to be treated. Accordingly, in embodiments of the invention where the individual is a human being, then it is preferred that the anti-PDGF-R antibodies are capable of binding human PDGF-R, for example human PDGF-Ra and/or human PDGF-R3.
  • the anti-PDGF-R antibody according to the present invention may be any polypeptide or protein capable of recognizing and binding PDGF-R.
  • specifically binding is meant binding with at least 10 times higher affinity to PDGF-R, PDGF-Ra and/or PDGF-R3, than to a non-specific antigen (e.g. BSA).
  • the antibody binds with an affinity corresponding to a K D of about 10 ⁇ 7 M or less, such as about 10 ⁇ 8 M or less, such as about 10 ⁇ 9 M or less, for example about 10 affinities based on IC 50 values.
  • Naturally occurring antibodies according to the invention may consist of one heterotetramer or they may comprise several identical heterotetramers.
  • the naturally occurring antibody according to the invention may for example be selected from the group consisting of IgG, IgM, IgA, IgD and IgE.
  • the subunit structures and three-dimensional configurations of these different classes of immunoglobulins are well known.
  • said anti-PDGF-R antibody is a naturally occurring antibody or a functional homologue thereof, as defined in the section "Anti-PDGF-CC antibody”.
  • Naturally occurring antibodies according to the invention may be antibodies of a particular species.
  • the antibodies may also be a hybrid between antibodies from several species, for example the antibody may be a chimeric antibody, such as a humanized antibody.
  • the anti-PDGF-R antibody according to the invention may be a human antibody or a humanized antibody, e.g. a naturally occurring human antibody, as described in the above section "Anti-PDGF-CC antibody”.
  • the anti-PDGF-R antibody according to the invention may be a human immunoglobulin or a humanized immunoglobulin, e.g. a naturally occurring human immunoglobulin.
  • the anti-PDGF-R antibody according to the invention may be a monoclonal antibody, such as a naturally occurring monoclonal antibody or it may be polyclonal antibodies, such as naturally occurring polyclonal antibodies, as described in the above section "Anti-PDGF-CC antibody”.
  • the anti-PDGF-R antibody may be any protein or polypeptide containing an antigen binding site, such as a single polypeptide, a protein or a glycoprotein.
  • the antigen binding site comprises at least one CDR, or more preferably a variable region.
  • the anti-PDGF-R antibodies to be used with the invention are capable of recognizing and binding PDGF-Ra and/or PDGF-R3.
  • the anti-PDGF-R antibodies specifically bind one or more epitopes on PDGF-Ra and/or PDGF-R3.
  • the antibody is a monoclonal antibody
  • the antibody generally binds one epitope on PDGF-Ra and/or PDGF- R3.
  • Polyclonal antibodies that bind one or more epitope on PDGF-Ra and/or PDGF-R3 can also be used.
  • the inhibitor of PDGF-R is an antibody that targets both PDGF- Ra and PDGF-R3.
  • the antibody may also be specific for PDGF-Ra.
  • the antibody may be specific for PDGF-R3.
  • the present invention relates to a kit-of-part comprising an anti-estrogen as well as to methods of treatment employing an anti-estrogen.
  • Said anti-estrogen may be any compound capable of reducing the production or utilization of estrogen.
  • anti-estrogens can be divided into two different subclasses, namely compounds capable of reducing or inhibiting production of estrogens and compounds capable of reducing and/or inhibiting the activity of estrogen.
  • the latter group includes compounds capable of preventing or reducing signaling mediated by estrogen receptors.
  • the anti-estrogen is an aromatase inhibitor.
  • Aromatase inhibitors work by blocking or reducing the synthesis of estrogen in a mammal and thereby lowering the level of estrogen.
  • aromatase inhibitors include but are not limited to exemestane, anastrozole, letrozole, aminoglutethimide, testolactone, vorozole, formestane and fadrozole.
  • the anti-estrogen is an estrogen antagonist.
  • estrogen antagonists include but are not limited to tamoxifen, raloxifene, 4- hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant, arzoxifene, lasofozone and toremifene.
  • the estrogen antagonist may be a compound which both is an antagonist, but also a partial agonist of estrogen.
  • An example of such an anti-estrogen is tamoxifen.
  • the estrogen antagonist may also be a full antagonist of estrogen.
  • An example of such an anti-estrogen is fulvestrant.
  • a preferred anti-estrogen to be used with the present invention is tamoxifen.
  • Tamoxifen is a triphenylalkylene derivative that binds to the estrogen receptor (ER).
  • ER estrogen receptor
  • the therapeutic mechanisms of tamoxifen are complex, but the primary effect of tamoxifen is exerted via estrogen receptors.
  • N- desmethyltamoxifen and endoxifen (4-hydroxy-N-desmethyl-tamoxifen) may be used as anti-estrogens with the invention.
  • the anti-estrogen to be used with the present invention may thus be a
  • triphenylalkylene derivative such as tamoxifen or structurally similar compounds including clomiphene, 4- hydroxylated, the N-dealkylated and the 4-hydroxy-N- dealkylated analogs of clomiphene, tamoxifen, pyrrolidinotamoxifen, toremifene, fixed ring tamoxifen, fispemifene, as well as all other molecules with substantially similar structures. Also both cis and trans isomer of the aforementioned may be employed.
  • the anti-estrogen may also be a selective estrogen receptor modulator (SERM).
  • SERM selective estrogen receptor modulator
  • SERMs of the invention include, without limitation, triphenylalkylenes, which include: 2- [4-(1 ,2-diphenylbut-1 -enyl)phenoxy]-N,N-dimethyl-ethanamine (tamoxifen) and other compounds described in U.S. Patent No. 4,536,516, incorporated herein by reference; 4'-hydroxy-2-[4-(1 ,2-diphenylbut-1 -enyl)phenoxy]-N,N-dimethyl- ethanamine (4'- hydroxytamoxifen) and other compounds described in U.S. Patent No.
  • SERMS to be used with the invention also include, without limitation, benzothiphene derivatives such as: [6-hydroxy-2-(4-hydroxypheny1 )-benzothiophen-3-y1 ]-[4-[2- (1 - piperidinyl)ethoxy)pheny1 ]-methanone (raloxifene) and other compounds described in U.S. Patent Nos. 4,418,068 and 5,393,763, both of which are incorporated herein by reference; LY353381 ; and LY335563 and other compounds described in WO
  • chromans such as 3,4- trans-2,2-dimethy1 -3-pheny1 -4-[4-(2-(2-(pyrrolidin-1 -ypethoxy)phenyl]-7- methoxychroman (levormeloxifene) and other compounds described in WO 97/25034, WO 97/25035, WO 97/25037 and WO 97/25038; and 1 -(2-((4-(-methoxy-2,2, dimethyl - 3-phenyl-chroman-4-y1 )-phenoxy)-ethyl)-pyrrolidine (centchroman) and other compounds described in U.S. Patent No. 3,822,287, incorporated herein by reference.
  • SERMs of the invention include, without limitation, the compounds described in U.S. Patent Nos. 6,387,920, 6,743,815, 6,750,213, 6,869,969, 6,927,224, 7,045,540, 7,138,426, 7,151 ,196, and 7,157,604, each of which is incorporated herein by reference.
  • anti-estrogens to be used with the invention include: 6a-chloro- 16a- methyl-pregn-4-ene-3,20-dione (clometherone); 6-chloro-17-hydroxypregna-1 ,4,6- triene-3,20-dione (delmadinone); 1 -[2-[4-[1 -(4-methoxypheny1 )-2-nitro-2- phenylethenyl]phenoxy]ethy1 ]-pyrrolidine (nitromifene/CN-55, 945-27); and 1 -[2- [p- (3,4-Dihydro-6-methoxy-2-pheny1 -1 -naphthyl)phenoxy]ethyl]pyrrolidine (nafoxidene).
  • anti-estrogens to be used with the invention include indoles such as those disclosed in J. Med. Chem., 33:2635-2640 (1990), J. Med. Chem., 30:131 -136 (1987), CA 02889770 2015-04-24 WO 2014/070523 PCT/US2013/066141 WO
  • anti-estrogens to be used with the invention include 2-[3-(1 - cyano- 1 - methyl-ethyl)-5-(1 H-1 ,2,4-triazol-1 -ylmethyl)phenyl]-2-methyl-propanenitrile
  • Patent 5,047,431 incorporated herein by reference; 2a,3a-Epithio-5a- androstan- 1713-01 (epitiostanol); 2a,3a-Epitio-5a-androstane-1713-yl-l- methoxycyclopentyloxy (mepitiostane); 4-[(2Z,4Z)-4-(4-hydroxyphenyphexa-2,4-dien-3-yl]phenol (cycladiene) and other compounds described in U.S. Pat. Nos.
  • Still other antiestrogens of the invention include, without limitation: (2e)-3-(4- ((1 e)-1 ,2- diphenylbut-1 -enyl)phenyl)acrylic acid (GW5638), GW7604 and other compounds described in Wilson et al., Endocrinology, 138(9):3901 -391 1 (1997) and WO 95/10513; 144-(2-diethylaminoethoxy)pheny1 ]-2-(4-methoxypheny1 )-1 -phenyl- ethanol (MER-25), N,N-diethy1 -244-(5-methoxy-2-phenyl-3H-inden-1 - y1 )phenoxylethanamine
  • Still other antiestrogens of the invention include, without limitation: non- steroidal estrogen receptor ligands such as those described in U.S. Patent Nos. 5,681 ,835, 5,877,219, 6,207,716, 6,340,774 and 6,599,921 , each of which is incorporated herein by reference; steroid derivatives such as those described in U.S. Patent No.
  • the anti-estrogen to be used with the invention may also be a pharmaceutically acceptable salt, ester, or prodrug of any of the aforementioned anti-estrogens.
  • compositions are prepared in a standard manner. If the parent compound is a base it is treated with an excess of an organic or inorganic acid in a suitable solvent. If the parent compound is an acid, it is treated with an inorganic or organic base in a suitable solvent.
  • the anti-estrogens of the invention may be administered in the form of an alkali metal or earth alkali metal salt thereof, concurrently, simultaneously, or together with a pharmaceutically acceptable carrier or diluent in an effective amount.
  • Examples of pharmaceutically acceptable acid addition salts for use in the present inventive pharmaceutical composition include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric and sulfuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, p-toluenesulphonic acids, and arylsulphonic, for example.
  • mineral acids such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric and sulfuric acids
  • organic acids such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, p-toluenesulphonic acids, and arylsulphonic, for example.
  • the anti-PDGF-CC antibody, the kit-of-parts and the methods of the invention are useful for treatment of ER-negative breast cancer.
  • the ER-negative breast cancer may be any breast cancer characterized by lack of expression of the estrogen receptor (ER).
  • the ER-negative breast cancer is a breast cancer, where ⁇ 1 % of the tumor cells of said breast cancer express estrogen receptor at levels detectable by immunohistochemistry
  • Immunohistochemistry may preferably be a test involving staining of a sample from a breast cancer with the aid of antibodies recognizing ER, and followed by detection of ER expression in the cells of said sample, e.g. by microscopy.
  • the ER-negative breast cancer is a breast cancer wherein ⁇ 1 % tumor nuclei are positive for ER expression as recommended by
  • ER expression may be determined by any useful means, preferably by any useful immunohistochemical method.
  • ER expression may be determined as described by Hammond et al., 2010.
  • the ER-negative breast cancer also is a
  • Progesterone receptor negative (PR-negative) breast cancer Progesterone receptor negative (PR-negative) breast cancer.
  • the breast cancer be to treated may in particular be an ER-negative and PR-negative breast cancer.
  • the PR-negative breast cancer is a breast cancer, where ⁇ 2% of the tumor cells of said breast cancer express PR at levels detectable by immunohistochemistry.
  • the PR-negative breast cancer is a breast cancer, where ⁇ 1 % of the tumor cells of said breast cancer express PR at levels detectable by immunohistochemistry.
  • PR expression may be determined by any useful means, preferably by any useful immunohistochemical method.
  • PR expression may be determined as described by Hammond et al., 2010.
  • the ER-negative breast cancer may in some embodiments express the human epidermal growth factor receptor 2 (HER-2).
  • HER-2 human epidermal growth factor receptor 2
  • the ER-negative breast cancer is a triple- negative breast cancer, i.e. said cancer is ER-negative, PR-negative and human epidermal growth factor receptor (HER)-2 negative.
  • HER human epidermal growth factor receptor
  • a HER-2 negative breast cancer may be a breast cancer which expresses no detectable HER-2.
  • the test for HER-2 expression may be performed by any useful method, for example by an immunohistochemical method or by FISH.
  • a HER-2 negative breast cancer is HER-2 negative when determined as recommended in Wolff et al., 2013.
  • the ER-negative breast cancer is a basal-like breast cancer.
  • said basal-like breast cancer may be a triple- negative breast cancer.
  • a basal-like breast cancer may also be an ER-negative breast cancer, which expresses one or more high-molecular weight/basal cytokeratins, for example selected from the group consisting of CK5/6, CK14 and CK17.
  • the basal-like breast cancer may also be an ER-negative and HER-2 negative breast cancer, which expresses CK5/& and/or epidermal growth factor receptor.
  • the basal-like breast cancer may also be a triple-negative breast cancer expressing CK5/6 and/or EGFR.
  • basal-type breast cancer typically does not express FoxA1 .
  • Basal-like breast cancer is associated with high grade, poor prognosis, and younger patient age.
  • the ER-negative breast cancer may be a breast cancer, which at the time of first diagnosis was an ER-negative breast cancer.
  • the ER-negative breast cancer may be characterized as ER-negative from the onset, rather than as a breast cancer having lost ER expression as a result of treatment. It may be preferred that the ER-negative breast cancer is a breast cancer, wherein the primary tumor is ER- negative.
  • the anti-PDGF-CC antibodies and the anti-estrogens of the present invention may be administered as the raw compounds, it is preferred to present them in the form of a pharmaceutical formulation.
  • the pharmaceutical formulations may be prepared by conventional techniques, e.g. as described in Remington: The Science and Practice of Pharmacy 2005, Lippincott, Williams & Wilkins.
  • the compounds to be used with the present invention may be formulated for parenteral administration and may be presented in any suitable form, for example in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers, optionally with an added preservative.
  • the anti-PDGF-CC antibodies are formulated for parenteral administration, however, also anti-estrogens may be formulated for parenteral administration.
  • the formulations may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, for example solutions in aqueous polyethylene glycol.
  • the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilisation from solution for constitution before use with a suitable vehicle, e.g., sterile, pyrogen-free water.
  • a suitable vehicle e.g., sterile, pyrogen-free water.
  • the formulations can for example be presented in unit-dose or multi-dose sealed containers, such as ampoules, vials, pre-filled syringes, infusion bags, or can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets.
  • oily or non-aqueous carriers examples include propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters, and may contain formulatory agents such as preserving, wetting, emulsifying or
  • the formulations for injection will typically contain from about 0.5 to about 25% by weight of the active ingredient in solution for example of the anti-PDGF-CC antibody.
  • the dosage may be in the range of 1 to 100 mg anti-PDGF-CC antibody per kg body weight, such as in the range of 1 to 20 mg of anti-PDGF-CC antibody per kg body weight, for example in the range of 5 to 15 mg of anti-PDGF-CC antibody per kg body weight.
  • the compounds of the present invention may also be formulated in a wide variety of formulations for oral administration. This may in particular be the case for the anti- estrogens.
  • Solid form preparations may include powders, tablets, drops, capsules, cachets, lozenges, and dispersible granules. Other forms suitable for oral
  • liquid form preparations including emulsions, syrups, elixirs, aqueous solutions, aqueous suspensions, toothpaste, gel dentrifrice, chewing gum, or solid form preparations which are intended to be converted shortly before use to liquid form preparations, such as solutions, suspensions, and emulsions.
  • the carrier is a finely divided solid which is a mixture with the finely divided active component.
  • the active component is mixed with the carrier having the n necessary binding capacity in suitable proportions and compacted in the shape and size desired.
  • Suitable carriers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like.
  • Drops according to the present invention may comprise sterile or non-sterile aqueous or oil solutions or suspensions, and may be prepared by dissolving the active ingredient in a suitable aqueous solution, optionally including a bactericidal and/or fungicidal agent and/or any other suitable preservative, and optionally including a surface active agent.
  • suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol.
  • Emulsions may be prepared in solutions in aqueous propylene glycol solutions or may contain emulsifying agents such as lecithin, sorbitan monooleate, or acacia.
  • Aqueous solutions can be prepared by dissolving the active component in water and adding suitable colorants, flavors, stabilizing and thickening agents.
  • Aqueous suspensions can be prepared by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium
  • any dosage of anti-estrogen used as required for efficacy, as recommended by the manufacturer, can be used.
  • Appropriate dosages for anti-estrogens are known in the art.
  • conventional dosages used for treatment of luminal-like breast cancers can be used for treatment of the basal-like breast cancers according to the invention.
  • anti-estrogens may be prepared form administration in a dosage range between 0.01 to 10 mg/kg of body weight per day (preferably 0.05 to 1 .0 mg/kg), with 20 to 40 mg per day being preferred for a person of average body weight when orally administered, or in a dosage range between 0.003 to 3.0 mg/kg of body weight per day (preferably 0.015 to 0.3 mg/ml), with 1 .5 mg per day, especially 3.0 mg per day, in two equally divided doses being preferred for a person of average body weight when parentally administered.
  • SEQ ID NO:1 Amino acid sequence of PDGF-CC from Homo sapiens SEQ ID NO:2 MMTV-PyMT primer
  • kits-of-parts comprising an anti-PDGF-CC antibody and an anti-estrogen for the treatment of ER-negative breast cancer in an individual in need thereof.
  • kits-of-parts comprising an inhibitor of PDGF-R and an anti-estrogen for the treatment of ER-negative breast cancer in an individual in need thereof.
  • kit-of-parts according to item 1 wherein said anti-PDGF-CC antibody and said anti-estrogen are prepared for sequential administration.
  • kit-of-parts according to any one of items 1 and 3 for use in the treatment of ER-negative breast cancer wherein said treatment comprises the steps of a. administration of the anti-PDGF-CC antibody to an individual in need thereof; b. subsequent administration of the anti-estrogen.
  • said kit-of-parts according to item 2 wherein said inhibitor of PDGF-R and said anti-estrogen are prepared for sequential administration.
  • said treatment comprises the steps of a. administration of the inhibitor of PDGF-R to an individual in need thereof; b. subsequent administration of the anti-estrogen.
  • a method for treatment of ER-negative breast cancer in an individual in need thereof comprising administering an anti-PDGF-CC antibody and an anti-estrogen to said individual either simultaneously or sequentially in any order, thereby treating the ER-negative breast cancer.
  • a method for treatment of ER-negative breast cancer in an individual in need thereof comprising administering an inhibitor of PDGF-R and an anti-estrogen to said individual either simultaneously or sequentially in any order, thereby treating the ER-negative breast cancer.
  • a method for sensitizing an ER-negative breast cancer to anti-estrogen treatment comprising administering an anti-PDGF-CC to an individual suffering from ER-negative breast, thereby sensitizing said ER- negative breast cancer to anti- estrogen treatment.
  • a method for sensitizing an ER-negative breast cancer to anti-estrogen treatment comprising administering an inhibitor of PDGF-R to an individual suffering from ER-negative breast, thereby sensitizing said ER- negative breast cancer to anti- estrogen treatment.
  • a method of converting an ER-negative breast cancer to an ER-positive breast cancer said method comprising administering an anti-PDGF-CC to an individual suffering from ER-negative breast, thereby converting said ER-negative breast cancer to an ER-positive breast cancer.
  • the method according to item 12 wherein the ER-positive breast cancer is a luminal like breast cancer.
  • a method of treatment of ER-negative breast cancer in an individual in need thereof comprising a. performing the method according to any one of items 8 to 1 1
  • a method of reducing the risk of relapse of an ER-negative breast cancer in an individual having suffered from ER-negative breast cancer, wherein said breast cancer in said individual has been treated by surgery comprising a. sensitizing the ER-negative breast cancer to treatment with anti-estrogen by administering an inhibitor of PDGF-R to an individual suffering from ER- negative breast cancer;
  • 19. The kit-of-parts or the method according to any one of items 4, 7 and 8 14, 15 and 17,, wherein the last administration of said anti-estrogen is later than the last of said anti-PDGF-CC antibody.
  • the anti-PDGF-CC antibody is administered at least twice to an individual suffering from ER-negative breast cancer wherein one or more administrations are prior to treatment by surgery, and one or more additional administrations are administered post treatment by surgery.
  • the anti-PDGF-CC antibody is administered in the range of 1 to 5 times, whereas the anti-estrogen is administered continuously for in the range of 1 to 10 years, such as in the range of 4 to 6 years, such as for 5 years.
  • the inhibitor of PDGF-R is administered in the range of 1 to 5 times, whereas the anti-estrogen is administered continuously for in the range of 1 to 10 years, such as in the range of 4 to 6 years, such as for 5 years.
  • the anti-PDGF-CC antibody is capable of inhibiting binding of PDGF-CC to the PDGFRa homodimer and/or to the PDGFRa/ ⁇ heterodimer.
  • the anti-PDGF-CC antibody is capable of inhibiting binding of PDGF-CC to the PDGFRa homodimer and/or to the PDGFRa/ ⁇ heterodimer.
  • the inhibitor of PDGF-R is an antibody capable of inhibiting PDGF-Ra and/or PDGF-R3.
  • tamoxifen is selected from the group consisting of tamoxifen, raloxifene, 4- hydroxytramoxifen, trioxifene, keoxifene, afimoxifene, LY1 17018, fulvestrant and toremifene
  • the anti-estrogen is selected from the group consisting of exemestane, formestane,
  • the individual is a human being, wherein the primary breast cancer tumor has been removed by surgery.
  • the ER-negative breast cancer is a basal-like breast cancer.
  • the ER-negative breast cancer is a breast cancer wherein the primary tumor was ER-negative.
  • Formalin fixed paraffin embedded material of a representative variety of normal and malignant human tissues and tumor cell lines were compiled and assembled on a single block, as described (Kristiansen et al, Br J Cancer 2008).
  • A3B6 The epitope of the A3B6 antibody is amino acids 256 to 260 of SEQ ID NO:1 within the sequence of amino acids 256 to 274 of SEQ ID NO:1 .
  • the basal cell marker cytokeratin CK5/6 (clone cocktail D5/16B4, 1 :25, Dako, Denmark), HER2 (clone 10A7, 1 :50, Novocastra, UK), EGFR (clone 3C6, pre-diluted, Ventana, Arlington, USA) and Ki-67 (clone Mib-1 , 1 :20, Dako, Danmark) were processed in parallel.
  • mice Upon completion of the treatment, mice were anesthetized with 2.5% Avertin (12,5 mg/kg body weight; Sigma-Aldrich) and 300 ⁇ of blood were collected by heart puncture and immediately mixed with RNAIater solution (Life Technologies) and stored at -20 'C. Mice were heart-perfused with PBS followed by 4% paraformaldehyde (for transplanted FVB/N mice only). For paraffin embedding, organs were post-fixed in 4% paraformaldehyde for 2 h before proceeding to embedding.
  • Avertin 12,5 mg/kg body weight; Sigma-Aldrich
  • RNAIater solution Life Technologies
  • Paraffin-embedded sections were deparaffinized and re-hydrated followed by antigen retrieval in high pH buffer (pH 6; DAKO) in a pressure cooker (ERa) or in 95 ⁇ C water-bath for 20 minutes (PR, STC1 , IGFBP3 and HGF). Peroxidase activity was quenched with 3% H 2 0 2 in methanol for 10 minutes at room temperature, followed by washes with 0.1 % BSA in PBS.
  • M.O.M. blocking Mae on Mouse basic kit, Vectorlabs
  • CAS-block Life Technologies
  • M.O.M. diluent The primary antibody against estrogen receptor ERa (1 :200, clone 1 D5; DAKO) was incubated in M.O.M. diluent.
  • CAS-block was used for the blocking and incubation of primary antibodies against STC1 (1 :200; SC-30183, Santa Cruz), IGFBP3 (1 :200; SC-9028, Santa Cruz) and HGF (1 :200; ab83760, Abeam). Primary incubation was performed overnight at 4 ⁇ C in a humidified chamber.
  • Optimal Cutting Temperature (OCT) medium HistoLab
  • Frozen sections were fixed in ice-cold acetone, followed by blocking using Serum Free Protein Block (DAKO) for > 90 minutes at room temperature.
  • Primary antibodies directed against PDGFRa PE-conjugated, 1 :200; 12-1401 , eBioscience
  • PDGFR3 (1 :200; 3169S, Cell Signaling
  • DAPI diamidino-2-phenylindole
  • RNA isolation and preparation primary tumor, liver, lungs and brain were snap- frozen in liquid N 2 and stored at -80 "C.
  • FVB/N-Tg(MMTV-PyVT) 634Mul/J transgenic mice have been described previously (Guy et al Molecular and Cellular Biology 1992) and were purchased from The Jackson Laboratory. The presence of the MMTV-PyMT transgene and the generation of heterozygous and homozygous knock-out PDGF-C offspring were verified by genotyping. DNA was prepared from either ear or tail biopsies according to a common tissue lysis, nucleic acid extraction and purification protocol. PCR products were run on a 1 ,5% agarose gel. MMTV-PyMT primer pair (5' to 3'): GGAAGCAAGTACTTC ACAAGGG [SEQ ID NO:2] and
  • PDGF-C wild-type pair GGAAAGTCACTAGGAGCAGGG [SEQ ID NO:3].
  • PDGF-C mutant pair CTC ATGTTCTCGTGACTCTGA [SEQ ID NO:6] and TAGCTAGTCGATACCGTCGA [SEQ ID NO:7].
  • Tumor size of the ten different glands were measured at 12 weeks of age using a caliper. Tumor volume was calculated as length ⁇ width2 ⁇ ⁇ /6. Mice of different ages where anesthetized with Avertin (Sigma Aldrich, St Louis, MO) and then euthanized by heart perfusion with Hank ' s balanced salt solution (HBSS) followed by 4%
  • Avertin Sigma Aldrich, St Louis, MO
  • Paraformaldehyde The left cervical and thoracic mammary glands where excised and subjected to overnight fixation in 4% PFA before embedding in paraffin. For frozen sectioning the tumor tissue was subjected to 30% sucrose before
  • mice Mouse mammary cell lines MMTV... MMTV/PDGF-C-/-... (established in our laboratory) were orthotopically injected into the 4 th inguinal mammary gland on FVB/N mice. Furthermore, small tumor pieces (2mm 3 ) of MMTV-PyMT and MMTV-PDGF-CC- /- tumors were directly orthotopically transplanted under anesthesia. The mice were subjected to Rimadyl immediately after the surgery and the following two days for analgetics. The tumors were measured twice a week and mice were euthanized as described above.
  • Murine MMTV-PyMT or MMTV-PyMT;PDGF-C /_ cells and human MDA-MB-231 cells were maintained in culture in DMEM Glutamax (Invitrogen), supplemented with 1 % Penicillin/Streptomycin, 10% Fetal Bovine Serum (FBS) and glutamate.
  • bovine serum albumin 1 % bovine serum albumin (BSA; Sigma Aldrich).
  • the cells were stimulated with rmSTCI (400 ng/mL; BioVendor), rmHGF (30 ng/mL;), rhlGFBP3 (250 ng/mL; R&D) or combinations of these factors in starvation medium for 48 hours.
  • the cell line CAF2 (Kojima et al, PNAS, 2010) was used to produce CAF-conditioned medium. A monolayer of CAF2 cells was incubated for 48 hours in starvation medium. This conditioned medium was spun down (1500 ⁇ g) to remove cells and used for downstream experiments.
  • EGFR and ESR1 QuantiTect Primer assay (Qiagen) primers were used. L1 9 primer pair (5' to 3') : GGTGACCTGGATGAGAAGGA and TTCAGCTTGTGGATGTGCTC. GATA3 primer pair (5' to 3'): CAATGCCTGCGGACTCTACC and GGTGGTGGTCTCG ACAGTTCG .
  • the membrane was blocked 1 hour with 5% milk powder in PBST (0.05% Tween-20 in PBS) and incubated O/N at 4 °C with anti-Estrogen Receptor alpha antibody (ERa 1 :200; SC- 542, Santa Cruz) in blocking buffer. After washing, anti-Rabbit-HSP was applied 1 :5000 in blocking buffer and incubated for 2 hours at RT. The membrane was washed and developed with SuperSignaIR West Pico Chemoluminescent Substrate (Thermo Scientific). Luminescence signal was measured with an CCD camera (FluorChem E, Cell Biosciences). In vitro 4-hydroxytamoxifen treatment
  • Tumor tissue from MMTV-PyMT, MMTV-PyMT;PDGF-C +/" and MMTV-PyMT;PDGF-C /_ mice was classified into different degrees of progression by quantifying the area of transformed glands occupied by each stage. Progression follows from normal fat tissue to a "precancerous stage” characterized by premalignant hyperplasia and adenoma (with the retention of some normal ductal and acinar mammary gland morphology), to a more epithelial cell-dense "early carcinoma" with stromal invasion, and finally to an invasive, very dense, high-mitotic index "late-stage carcinoma". Tumors were evaluated for the proportion of mammary fat tissue, hyperplastic tissue, adenoma, early carcinoma and late carcinoma. PDGF-C specific necrosis was described by a pathologist and scored blindly in the samples.
  • MDA-MB-231 human xenograft tumor tissue was immunostained and nuclear ERa positivity was evaluated at the end of the therapeutic trials. The region of interested was restricted to the tumor mass, without including the surrounding fat tissue. Both single-cell and foci quantification (n >3 cells/focus) was performed.
  • the left lung lobes of MMTV-PyMT were embedded in paraffin upon tissue fixation.
  • the metastatic burden was assessed by serial sectioning of the entire lung/liver lobe. Following hematoxylin and eosin staining on every 25th section, the number of metastatic foci (>8 cells in diameter) was determined in >15 sections per mouse and > 5 mice per group. Results
  • PDGF-CC is an independent prognostic factor for poor survival in breast cancer
  • PDGF-CC was expressed by malignant cells, intra-tumoral capillaries and stromal fibroblasts (Fig. 1 b-e).
  • PDGF-CC immunoreactivity was most conspicuous in the stroma directly adjacent to the malignant epithelium (Fig. 1 f).
  • the staining intensity for PDGF-CC was graded independently for the epithelial and stromal compartment and correlated to clinico-pathological parameters (Fig. 1 g).
  • Stromal immunoreactivity for PDGF-CC was not correlated to patient outcome.
  • PDGF-CC is functionally important for the growth of experimental breast cancer
  • Pdgfc lacz/Iacz mice deficient for Pdgfc
  • Fig. 4b The expression of Foxa l was also found to be dramatically elevated in tumor cell lines isolated from MMTV-PyMT; Pdgfc laozllaoz mice (Fig. 4b).
  • Human breast cancers may be classified into different molecular subtypes, including ER-positive breast cancers, such as normal-like, luminal A, luminal B, HER2 + and ER-negative breast cancers, for example basal-like tumors.
  • ER-positive breast cancers such as normal-like, luminal A, luminal B, HER2 + and ER-negative breast cancers, for example basal-like tumors.
  • Analysis of transcriptional profiles of breast tumors collected within The Cancer Genome Atlas project revealed that expression of Foxal is highly correlated with a non-basal-like molecular subtype (Fig. 4c), confirming previous studies (ref).
  • the luminal subtype markers FoxA1 and ERa protein was found to be more abundant in tumor protein lysates from Pdgfc- deficient mice (Fig. 5a).
  • Fig. 5a In order to elucidate the mechanism whereby paracrine signaling by epithelium-derived PDGF-CC elicited specification of basal-like features of breast tumors, we stimulated the immortalized breast cancer-associated fibroblast cell line CAF2 with PDGF-CC.
  • STC stanniocalcin
  • HGF hepatocyte growth factor
  • IGFBP3 insulin growth factor binding protein 3
  • ERa which confers sensitivity to hormone therapy, such as tamoxifen.
  • hormone therapy such as tamoxifen.
  • Non-transgenic mice bearing orthopically transplanted tumors from MMTV-PyMT; Pdgfc +/+ or MMTV-PyMT; Pdgfd acz/lacz mice were treated daily with tamoxifen starting from x weeks of age.
  • the wt tumors of tamoxifen- treated mice continued to grow at a similar rate as tumors from untreated mice (Fig.
  • the basal-like subtype tumor that originally did not express meaningful levels of ERa, substantially upregulated expression of ERa upon treatment with monoclonal anti- PDGF-CC antibody A3B6, corroborating the role of paracrine signaling by PDGF-CC in establishing the absence of ERa in basal-like subtype breast tumors (Fig. 6e).
  • the upregulation of ERa expression in MDA-MB-231 tumors following blockade of signaling by PDGF-CC was not uniform, but rather occurred in differentiated nests of malignant cells (Fig. 6f).
  • mice were alternately assigned into the treatment groups in which mice were treated with letrozole (1 mg/dose via oral gavage daily, Sigma), dissolved in a vehicle of ethanol and corn oil (Sigma) by heating to 55 °C, or with vehicle alone. All therapeutic administrations were open-label.
  • the A3B6 + letrozole group is statistically significantly smaller than all other groups (p ⁇ 0.01 vs control, p ⁇ 0.05 vs A3B6, p ⁇ 0.001 vs letrozole, Student's unpaired, 2-sided t-test assuming equal variance); no other differences are statistically significant (Figure
  • mice were alternately assigned into the treatment groups in which mice were treated with tamoxifen (1 mg/dose via oral gavage daily, Sigma), dissolved in a vehicle of ethanol and corn oil (Sigma) by heating to 55 'C, or with vehicle alone. All therapeutic administrations were open-label.
  • the imatinib + tamoxifen group is statistically significantly smaller than all other groups (p ⁇ 0.01 vs control, p ⁇ 0.05 vs A3B6, p ⁇ 0.01 vs letrozole, Student's unpaired, 2-sided t- test assuming equal variance); no other differences are statistically significant (Figure

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Endocrinology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
PCT/EP2016/077295 2015-11-10 2016-11-10 Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti estrogen Ceased WO2017081171A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP16795300.9A EP3373967B9 (en) 2015-11-10 2016-11-10 Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti estrogen
CN201680065636.1A CN108348605B (zh) 2015-11-10 2016-11-10 用pdgf-cc抑制剂和抗雌激素治疗er阴性乳癌
AU2016352592A AU2016352592B2 (en) 2015-11-10 2016-11-10 Treatment of ER-negative breast cancer with an PDGF-CC inhibitor and an anti estrogen
JP2018543455A JP7048505B2 (ja) 2015-11-10 2016-11-10 Pdgf-cc阻害剤および抗エストロゲン剤によるer陰性乳癌の処置
US15/774,341 US11633382B2 (en) 2015-11-10 2016-11-10 Treatment of ER-negative breast cancer with an PDGF-CC inhibitor and anti-estrogen
JP2022011194A JP2022058781A (ja) 2015-11-10 2022-01-27 Pdgf-cc阻害剤および抗エストロゲン剤によるer陰性乳癌の処置
US18/121,075 US20230310385A1 (en) 2015-11-10 2023-03-14 Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti-estrogen

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
SE1551455-7 2015-11-10
SE1551455 2015-11-10
SE1650974-7 2016-07-04
SE1650974 2016-07-04

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/774,341 A-371-Of-International US11633382B2 (en) 2015-11-10 2016-11-10 Treatment of ER-negative breast cancer with an PDGF-CC inhibitor and anti-estrogen
US18/121,075 Continuation US20230310385A1 (en) 2015-11-10 2023-03-14 Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti-estrogen

Publications (1)

Publication Number Publication Date
WO2017081171A1 true WO2017081171A1 (en) 2017-05-18

Family

ID=57321296

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/077295 Ceased WO2017081171A1 (en) 2015-11-10 2016-11-10 Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti estrogen

Country Status (6)

Country Link
US (2) US11633382B2 (enExample)
EP (1) EP3373967B9 (enExample)
JP (2) JP7048505B2 (enExample)
CN (1) CN108348605B (enExample)
AU (1) AU2016352592B2 (enExample)
WO (1) WO2017081171A1 (enExample)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022164269A1 (ko) * 2021-01-29 2022-08-04 한국과학기술원 악성 유방암의 치료 또는 예방용 약학적 조성물

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3666276A1 (en) * 2018-12-14 2020-06-17 dcic Biopharmaceutical Limited Medication against estrogen-receptor beta (erbeta) positive breast tumor
BR112022020322A2 (pt) * 2020-04-10 2022-12-13 Jina Pharmaceuticals Inc Método para gerenciar ou diminuir um risco de efeitos adversos em um paciente submetido ao tratamento de distúrbio bipolar i
WO2023172891A2 (en) * 2022-03-07 2023-09-14 Baylor College Of Medicine Biomarkers for combination therapy for er+ breast cancer

Citations (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2464203A (en) 1943-05-21 1949-03-15 Boots Pure Drug Co Ltd Manufacture of dienoestrol
US2465505A (en) 1944-12-05 1949-03-29 Hoffmann La Roche Process for the manufacture of 3, 4-di-(p-hydroxy-phenyl)-hexadiene-2, 4
US2914562A (en) 1957-08-06 1959-11-24 Wm S Merrell Co Amine derivatives of triphenylethanol
US3822287A (en) 1969-04-17 1974-07-02 Rexall Drug Chemical Process for preparation of substituted 3,4-(diphenyl)chromans
US4094994A (en) 1976-12-22 1978-06-13 Klinge Pharma Gmbh Novel di-(3'-hydroxyphenyl)-alkane compounds, process of preparation and their use in medicine
US4133814A (en) 1975-10-28 1979-01-09 Eli Lilly And Company 2-Phenyl-3-aroylbenzothiophenes useful as antifertility agents
US4230862A (en) 1975-10-28 1980-10-28 Eli Lilly And Company Antifertility compounds
US4418068A (en) 1981-04-03 1983-11-29 Eli Lilly And Company Antiestrogenic and antiandrugenic benzothiophenes
US4536516A (en) 1962-09-13 1985-08-20 Imperial Chemical Industries Plc Alkene derivatives
US4623660A (en) 1977-08-22 1986-11-18 Imperial Chemical Industries Plc Triphenylalkene derivatives
US4659516A (en) 1983-10-12 1987-04-21 Imperial Chemical Industries Plc Steroid derivatives
US4696949A (en) 1982-06-25 1987-09-29 Farmos Group Ltd. Novel tri-phenyl alkane and alkene derivatives and their preparation and use
US4751240A (en) 1984-04-27 1988-06-14 Imperial Chemical Industries Plc Phenol derivatives
EP0296749A1 (en) 1987-06-16 1988-12-28 Zeneca Limited (Substituted aralkyl) heterocyclic compounds
US4808616A (en) 1985-07-09 1989-02-28 Farmitalia Carlo Erba S.R.L. 6-substituted androsta-1,4-diene-3,17-diones
US4839155A (en) 1986-09-11 1989-06-13 National Research Development Corporation Iodotamoxifen derivatives and use for estrogen receptor-positive breast cancer detection and therapy
US5047431A (en) 1980-12-11 1991-09-10 Klinge Pharma Gmbh & Co. 1,1,2-triphenylbut-1-ene derivatives
WO1993010741A2 (en) 1991-12-02 1993-06-10 Endorecherche Inc. Sex steroid activity inhibitors
WO1993023374A1 (fr) 1992-05-08 1993-11-25 Otsuka Pharmaceutical Factory, Inc. Derive d'indole
US5393763A (en) 1992-07-28 1995-02-28 Eli Lilly And Company Methods for inhibiting bone loss
WO1995010513A1 (en) 1993-10-12 1995-04-20 Pfizer Inc. Benzothiophenes and related compounds as estrogen agonists
WO1995017383A1 (en) 1993-12-23 1995-06-29 Karo Bio Ab Indole derivatives as anti-estrogens
US5473078A (en) 1986-03-07 1995-12-05 Ciba-Geigy Corporation Alpha-heterocycle substituted tolunitriles
US5491173A (en) 1982-06-25 1996-02-13 Orion-Yhtyma Oy Tri-phenyl alkene derivatives and their preparation and use
WO1996026201A1 (en) 1995-02-21 1996-08-29 Endorecherche, Inc. Benzopyran-containing compounds and method for their use
US5552412A (en) 1995-01-09 1996-09-03 Pfizer Inc 5-substitued-6-cyclic-5,6,7,8-tetrahydronaphthalen2-ol compounds which are useful for treating osteoporosis
WO1997025034A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of the l-enantiomer of centchroman for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of breast cancer
WO1997025038A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of 3,4-diphenyl chromans for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of benign prostatic hypertrophy
WO1997025037A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of 3,4-diphenyl chromans for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of prostatic carcinoma
WO1997025035A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of 3,4-diphenyl chromans for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of menopausal symptoms
US5681835A (en) 1994-04-25 1997-10-28 Glaxo Wellcome Inc. Non-steroidal ligands for the estrogen receptor
WO1998007740A1 (de) 1996-08-20 1998-02-26 Schering Aktiengesellschaft 7α-(κ-AMINOALKYL)-ESTRATRIENE, VERFAHREN ZU DEREN HERSTELLUNG, PHARMAZEUTISCHE PRÄPARATE, DIE DIESE 7α-(κ-AMINOALKYL)-ESTRATRIENE ENTHALTEN SOWIE DEREN VERWENDUNG ZUR HERSTELLUNG VON ARZNEIMITTELN
US5780497A (en) 1996-04-19 1998-07-14 American Home Products Corporation 2-phenyl-1- 4-(amino-1-yl-alk-1-ynyl)-benzyl!-1H-indol-5-ols as estrogenic agents
WO1998045287A1 (en) 1997-04-09 1998-10-15 Eli Lilly And Company Treatment of central nervous system disorders with selective estrogen receptor modulators
WO1998045286A1 (en) 1997-04-09 1998-10-15 Eli Lilly And Company Prevention of breast cancer with selective estrogen receptor modulators
WO1998045288A1 (en) 1997-04-09 1998-10-15 Eli Lilly And Company Treatment or prophylaxis of prostatic cancer and benign prostatic hyperplasia with selective estrogen receptor modulators
US5880137A (en) 1996-04-19 1999-03-09 American Home Products Corporation 2-phenyl-1- 4-(amino-1-yl-alk-1-ynyl)-benzyl!-1H-indol-5-ols as estrogenic agents
WO1999033855A1 (de) 1997-12-23 1999-07-08 Schering Aktiengesellschaft 11β-HALOGEN-7α-SUBSTITUIERTE-ESTRATRIENE, VERFAHREN ZUR HERSTELLUNG PHARMAZEUTISCHER PRÄPARATE, DIE DIESE 11β-HALOGEN-7α-SUBSTITUIERTE-ESTRATRIENE ENTHALTEN, SOWIE DEREN VERWENDUNG ZUR HERSTELLUNG VON ARZNEIMITTELN
US5985910A (en) 1996-04-19 1999-11-16 American Home Products Corporation 3- [4- (2- Phenyl-Indole-1-ylmethyl) Phenyl]- Acrylamides as estrogenic agents
US5998402A (en) 1996-04-19 1999-12-07 American Home Products Corporation 2-phenyl-1-[4-(2-aminoethoxy)-benzyl]-indoles as estrogenic agents
US6069153A (en) 1998-05-12 2000-05-30 American Home Products Corporation Indenoindoles and benzocarbazoles as estrogenic agents
US6340774B1 (en) 2000-01-31 2002-01-22 The Board Of Trustees Of The Leland Stanford Junior University Non-steroidal estrogen-receptor antagonists
US6387920B2 (en) 1998-08-07 2002-05-14 Chiron Corporation Estrogen receptor modulators
WO2002043478A2 (en) 2000-11-30 2002-06-06 Medarex, Inc. Transgenic transchromosomal rodents for making human antibodies
US6455517B1 (en) 1997-12-24 2002-09-24 Sri International Anti-estrogenic steroids, and associated pharmaceutical compositions and methods of use
US6503938B1 (en) 1994-07-27 2003-01-07 Schering Aktiengesellschaft 2-phenylindoles as antiestrogenic pharmaceutical agents
US6509356B1 (en) 1997-08-07 2003-01-21 Eli Lilly And Company 1-(4-(Substituted alkoxy)benzyl)naphthalene compounds having estrogen inhibitory activity
US6548491B2 (en) 1997-12-24 2003-04-15 Sri International Anti-estrogenic steroids, and associated pharmaceutical compositions and methods of use
US6576645B1 (en) 1999-11-16 2003-06-10 Hormos Medical Oy Ltd Triphenylalkene derivatives and their use as selective estrogen receptor modulators
US6599921B2 (en) 2001-02-22 2003-07-29 Nanodesign, Inc. Non-steroidal estrogen receptor ligands
US6750213B2 (en) 2000-10-19 2004-06-15 Merck & Co., Inc. Estrogen receptor modulators
US6844336B2 (en) 2000-03-15 2005-01-18 Schering Ag 4-fluoroalkyl-2h-benzopyrans with anti-estogenic activity
US6927224B2 (en) 2001-08-11 2005-08-09 Bristol Myers Squibb Company Selective estrogen receptor modulators
WO2005087812A1 (en) 2004-03-05 2005-09-22 Ludwig Institute For Cancer Research Multivalent antibody materials and methods for vegf/pdgf family of growth factors
US7041839B2 (en) 2000-06-22 2006-05-09 Northeastern University Steroidal antiestrogens and antiandrogens and uses thereof
US7138426B2 (en) 2002-04-24 2006-11-21 Merck & Co., Inc. Estrogen receptor modulators
US7151196B2 (en) 2004-11-01 2006-12-19 Merck & Co., Inc. Estrogen receptor modulators
US7157604B2 (en) 2001-08-13 2007-01-02 Merck & Co., Inc. Selective estrogen receptor modulators
WO2007124308A2 (en) 2006-04-17 2007-11-01 Ludwig Institute For Cancer Research Methods and compositions for modulation of blood-neural barrier
US7504530B2 (en) 2007-02-14 2009-03-17 Hormos Medical Ltd. Methods for the preparation of fispemifene from ospemifene
WO2013160359A1 (en) 2012-04-24 2013-10-31 Thrombogenics N.V. Anti-pdgf-c antibodies
WO2014070523A1 (en) 2012-11-02 2014-05-08 Repros Therapeutics Inc. Trans-clomiphene for use in cancer therapy

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2068911A4 (en) * 2006-09-13 2011-08-03 Arca Biopharma Inc METHOD FOR THE TREATMENT OF CANCER
NZ586125A (en) * 2007-11-12 2012-12-21 Bipar Sciences Inc Treatment of breast cancer with a parp inhibitor alone or in combination with anti-tumor agents
EP2558098A2 (en) 2010-04-16 2013-02-20 Novartis AG Treatment of endocrine resistant breast cancer

Patent Citations (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2464203A (en) 1943-05-21 1949-03-15 Boots Pure Drug Co Ltd Manufacture of dienoestrol
US2465505A (en) 1944-12-05 1949-03-29 Hoffmann La Roche Process for the manufacture of 3, 4-di-(p-hydroxy-phenyl)-hexadiene-2, 4
US2914562A (en) 1957-08-06 1959-11-24 Wm S Merrell Co Amine derivatives of triphenylethanol
US4536516A (en) 1962-09-13 1985-08-20 Imperial Chemical Industries Plc Alkene derivatives
US3822287A (en) 1969-04-17 1974-07-02 Rexall Drug Chemical Process for preparation of substituted 3,4-(diphenyl)chromans
US4230862A (en) 1975-10-28 1980-10-28 Eli Lilly And Company Antifertility compounds
US4133814A (en) 1975-10-28 1979-01-09 Eli Lilly And Company 2-Phenyl-3-aroylbenzothiophenes useful as antifertility agents
US4094994A (en) 1976-12-22 1978-06-13 Klinge Pharma Gmbh Novel di-(3'-hydroxyphenyl)-alkane compounds, process of preparation and their use in medicine
US4623660A (en) 1977-08-22 1986-11-18 Imperial Chemical Industries Plc Triphenylalkene derivatives
US5047431A (en) 1980-12-11 1991-09-10 Klinge Pharma Gmbh & Co. 1,1,2-triphenylbut-1-ene derivatives
US4418068A (en) 1981-04-03 1983-11-29 Eli Lilly And Company Antiestrogenic and antiandrugenic benzothiophenes
US4996225A (en) 1982-06-25 1991-02-26 Farmos Group Ltd. Tri-phenyl alkane derivatives and their oestrogenic, anti-oestrogenic and progestanic uses
US5491173A (en) 1982-06-25 1996-02-13 Orion-Yhtyma Oy Tri-phenyl alkene derivatives and their preparation and use
US4696949A (en) 1982-06-25 1987-09-29 Farmos Group Ltd. Novel tri-phenyl alkane and alkene derivatives and their preparation and use
US4659516A (en) 1983-10-12 1987-04-21 Imperial Chemical Industries Plc Steroid derivatives
US4751240A (en) 1984-04-27 1988-06-14 Imperial Chemical Industries Plc Phenol derivatives
US4808616A (en) 1985-07-09 1989-02-28 Farmitalia Carlo Erba S.R.L. 6-substituted androsta-1,4-diene-3,17-diones
US5473078A (en) 1986-03-07 1995-12-05 Ciba-Geigy Corporation Alpha-heterocycle substituted tolunitriles
US4839155A (en) 1986-09-11 1989-06-13 National Research Development Corporation Iodotamoxifen derivatives and use for estrogen receptor-positive breast cancer detection and therapy
EP0296749A1 (en) 1987-06-16 1988-12-28 Zeneca Limited (Substituted aralkyl) heterocyclic compounds
WO1993010741A2 (en) 1991-12-02 1993-06-10 Endorecherche Inc. Sex steroid activity inhibitors
WO1993023374A1 (fr) 1992-05-08 1993-11-25 Otsuka Pharmaceutical Factory, Inc. Derive d'indole
US5393763A (en) 1992-07-28 1995-02-28 Eli Lilly And Company Methods for inhibiting bone loss
WO1995010513A1 (en) 1993-10-12 1995-04-20 Pfizer Inc. Benzothiophenes and related compounds as estrogen agonists
WO1995017383A1 (en) 1993-12-23 1995-06-29 Karo Bio Ab Indole derivatives as anti-estrogens
US5681835A (en) 1994-04-25 1997-10-28 Glaxo Wellcome Inc. Non-steroidal ligands for the estrogen receptor
US6207716B1 (en) 1994-04-25 2001-03-27 Glaxo Wellcome Inc. Non-steroidal ligands for the estrogen receptor
US5877219A (en) 1994-04-25 1999-03-02 Glaxo Wellcomeinc. Non-steroidal ligands for the estrogen receptor
US6503938B1 (en) 1994-07-27 2003-01-07 Schering Aktiengesellschaft 2-phenylindoles as antiestrogenic pharmaceutical agents
US5552412A (en) 1995-01-09 1996-09-03 Pfizer Inc 5-substitued-6-cyclic-5,6,7,8-tetrahydronaphthalen2-ol compounds which are useful for treating osteoporosis
WO1996026201A1 (en) 1995-02-21 1996-08-29 Endorecherche, Inc. Benzopyran-containing compounds and method for their use
WO1997025034A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of the l-enantiomer of centchroman for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of breast cancer
WO1997025035A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of 3,4-diphenyl chromans for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of menopausal symptoms
WO1997025037A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of 3,4-diphenyl chromans for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of prostatic carcinoma
WO1997025038A1 (en) 1996-01-11 1997-07-17 Novo Nordisk A/S Use of 3,4-diphenyl chromans for the manufacture of a pharmaceutical composition for the treatment or prophylaxis of benign prostatic hypertrophy
US5780497A (en) 1996-04-19 1998-07-14 American Home Products Corporation 2-phenyl-1- 4-(amino-1-yl-alk-1-ynyl)-benzyl!-1H-indol-5-ols as estrogenic agents
US5998402A (en) 1996-04-19 1999-12-07 American Home Products Corporation 2-phenyl-1-[4-(2-aminoethoxy)-benzyl]-indoles as estrogenic agents
US7132417B2 (en) 1996-04-19 2006-11-07 Wyeth 2-phenyl-1-[4-(2-aminoethoxy)-benzyl]-indoles as estrogenic agents
US5880137A (en) 1996-04-19 1999-03-09 American Home Products Corporation 2-phenyl-1- 4-(amino-1-yl-alk-1-ynyl)-benzyl!-1H-indol-5-ols as estrogenic agents
US5985910A (en) 1996-04-19 1999-11-16 American Home Products Corporation 3- [4- (2- Phenyl-Indole-1-ylmethyl) Phenyl]- Acrylamides as estrogenic agents
WO1998007740A1 (de) 1996-08-20 1998-02-26 Schering Aktiengesellschaft 7α-(κ-AMINOALKYL)-ESTRATRIENE, VERFAHREN ZU DEREN HERSTELLUNG, PHARMAZEUTISCHE PRÄPARATE, DIE DIESE 7α-(κ-AMINOALKYL)-ESTRATRIENE ENTHALTEN SOWIE DEREN VERWENDUNG ZUR HERSTELLUNG VON ARZNEIMITTELN
WO1998045287A1 (en) 1997-04-09 1998-10-15 Eli Lilly And Company Treatment of central nervous system disorders with selective estrogen receptor modulators
WO1998045286A1 (en) 1997-04-09 1998-10-15 Eli Lilly And Company Prevention of breast cancer with selective estrogen receptor modulators
WO1998045288A1 (en) 1997-04-09 1998-10-15 Eli Lilly And Company Treatment or prophylaxis of prostatic cancer and benign prostatic hyperplasia with selective estrogen receptor modulators
US6509356B1 (en) 1997-08-07 2003-01-21 Eli Lilly And Company 1-(4-(Substituted alkoxy)benzyl)naphthalene compounds having estrogen inhibitory activity
WO1999033855A1 (de) 1997-12-23 1999-07-08 Schering Aktiengesellschaft 11β-HALOGEN-7α-SUBSTITUIERTE-ESTRATRIENE, VERFAHREN ZUR HERSTELLUNG PHARMAZEUTISCHER PRÄPARATE, DIE DIESE 11β-HALOGEN-7α-SUBSTITUIERTE-ESTRATRIENE ENTHALTEN, SOWIE DEREN VERWENDUNG ZUR HERSTELLUNG VON ARZNEIMITTELN
US6548491B2 (en) 1997-12-24 2003-04-15 Sri International Anti-estrogenic steroids, and associated pharmaceutical compositions and methods of use
US6747018B2 (en) 1997-12-24 2004-06-08 Sri International Anti-estrogenic steroids, and associated pharmaceutical compositions and methods of use
US6455517B1 (en) 1997-12-24 2002-09-24 Sri International Anti-estrogenic steroids, and associated pharmaceutical compositions and methods of use
US6069153A (en) 1998-05-12 2000-05-30 American Home Products Corporation Indenoindoles and benzocarbazoles as estrogenic agents
US6387920B2 (en) 1998-08-07 2002-05-14 Chiron Corporation Estrogen receptor modulators
US6869969B2 (en) 1998-08-07 2005-03-22 Chiron Corporation Estrogen receptor modulators
US6743815B2 (en) 1998-08-07 2004-06-01 Chiron Corporation Estrogen receptor modulators
US6576645B1 (en) 1999-11-16 2003-06-10 Hormos Medical Oy Ltd Triphenylalkene derivatives and their use as selective estrogen receptor modulators
US6340774B1 (en) 2000-01-31 2002-01-22 The Board Of Trustees Of The Leland Stanford Junior University Non-steroidal estrogen-receptor antagonists
US6844336B2 (en) 2000-03-15 2005-01-18 Schering Ag 4-fluoroalkyl-2h-benzopyrans with anti-estogenic activity
US7041839B2 (en) 2000-06-22 2006-05-09 Northeastern University Steroidal antiestrogens and antiandrogens and uses thereof
US6750213B2 (en) 2000-10-19 2004-06-15 Merck & Co., Inc. Estrogen receptor modulators
WO2002043478A2 (en) 2000-11-30 2002-06-06 Medarex, Inc. Transgenic transchromosomal rodents for making human antibodies
US6599921B2 (en) 2001-02-22 2003-07-29 Nanodesign, Inc. Non-steroidal estrogen receptor ligands
US6927224B2 (en) 2001-08-11 2005-08-09 Bristol Myers Squibb Company Selective estrogen receptor modulators
US7045540B2 (en) 2001-08-11 2006-05-16 Bristol Meyers Squibb Company Selective estrogen receptor modulators
US7157604B2 (en) 2001-08-13 2007-01-02 Merck & Co., Inc. Selective estrogen receptor modulators
US7138426B2 (en) 2002-04-24 2006-11-21 Merck & Co., Inc. Estrogen receptor modulators
WO2005087812A1 (en) 2004-03-05 2005-09-22 Ludwig Institute For Cancer Research Multivalent antibody materials and methods for vegf/pdgf family of growth factors
US7151196B2 (en) 2004-11-01 2006-12-19 Merck & Co., Inc. Estrogen receptor modulators
WO2007124308A2 (en) 2006-04-17 2007-11-01 Ludwig Institute For Cancer Research Methods and compositions for modulation of blood-neural barrier
US7504530B2 (en) 2007-02-14 2009-03-17 Hormos Medical Ltd. Methods for the preparation of fispemifene from ospemifene
WO2013160359A1 (en) 2012-04-24 2013-10-31 Thrombogenics N.V. Anti-pdgf-c antibodies
WO2014070523A1 (en) 2012-11-02 2014-05-08 Repros Therapeutics Inc. Trans-clomiphene for use in cancer therapy
CA2889770A1 (en) 2012-11-02 2014-05-08 Repros Therapeutics Inc. Trans-clomiphene for use in cancer therapy

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
"Early Breast Cancer Trialists' Collaborative Group (EBCTCG", LANCET, 2011
"Merck Index, 10th ed.", ., article "#2149"
"Merck Index, 10th ed.", ., article "#3668"
"Remington: The Science and Practice of Pharmacy", 2005, LIPPINCOTT, WILLIAMS & WILKINS
AMERICAN SOCIETY OF CLINICAL ONCOLOGY/COLLEGE OF AMERICAN PATHOLOGISTS: "Guideline Recommendation for Immunohistochemical Testing of Estrogen and Progesterone Receptors in Breast Cancer.", .
ASTRID PEDERSEN ET AL: "Sorafenib and nilotinib resensitize tamoxifen resistant breast cancer cells to tamoxifen treatment via estrogen receptor [alpha]", INTERNATIONAL JOURNAL OF ONCOLOGY, vol. 45, 22 August 2014 (2014-08-22), GR, pages 2167 - 2175, XP055336103, ISSN: 1019-6439, DOI: 10.3892/ijo.2014.2619 *
DURANI ET AL., J. MED. CHEM., vol. 32, 1989, pages 1700 - 1707
GEYNET ET AL., GYNECOL. INVEST., vol. 3, no. 1, 1972, pages 2 - 29
HAMMOND ET AL., JOURNAL OF CLINICAL ONCOLOGY, vol. 28, no. 16, 2010, pages 2784 - 3543
HAMMOND ET AL., JOURNAL OF CLINICAL ONCOLOGY, vol. 31, no. 31, 2013, pages 3997 - 4013
J CLIN ONCOL., vol. 31, no. 31, 7 October 2013 (2013-10-07), pages 3997 - 4013
J. MED. CHEM., vol. 30, 1987, pages 131 - 136
J. MED. CHEM., vol. 33, 1990, pages 2635 - 2640
JOENSUU; GLIGOROV, LANCET, vol. 378, 2011, pages 771 - 84
KOJIMA ET AL., PNAS, 2010
KRISTIANSEN ET AL., BR J CANCER, 2008
LONBERG, N. ET AL., NATURE, vol. 368, no. 6474, 1994, pages 856 - 859
MUNDHENKE ET AL: "Effects of tamoxifen and imatinib on the radiosensitivity of breast carcinoma cells", J CLIN ONCOL, vol. 26, 20 May 2008 (2008-05-20), pages 1, XP055337107 *
S.-C. WENG ET AL: "Sensitizing estrogen receptor-negative breast cancer cells to tamoxifen with OSU-03012, a novel celecoxib-derived phosphoinositide-dependent protein kinase-1/Akt signaling inhibitor", MOLECULAR CANCER THERAPEUTICS, vol. 7, no. 4, 1 April 2008 (2008-04-01), US, pages 800 - 808, XP055336173, ISSN: 1535-7163, DOI: 10.1158/1535-7163.MCT-07-0434 *
SAEED ET AL., J. MED. CHEM., vol. 33, 1990, pages 3210 - 3216
SHARMA ET AL., J. MED. CHEM., vol. 33, 1990, pages 3216 - 3229
TERENIUS ET AL., GYNEC. INVEST., vol. 3, 1972, pages 96 - 107
THEURILLAT ET AL., INT J CANCER, 2007
UNLISTED DRUGS, vol. 26, no. 7, 1974, pages 106
UNLISTED DRUGS, vol. 28, no. 10, 1976, pages 169
WILSON ET AL., ENDOCRINOLOGY, vol. 138, no. 9, 1997, pages 3901 - 3911

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022164269A1 (ko) * 2021-01-29 2022-08-04 한국과학기술원 악성 유방암의 치료 또는 예방용 약학적 조성물

Also Published As

Publication number Publication date
JP2022058781A (ja) 2022-04-12
US20230310385A1 (en) 2023-10-05
US11633382B2 (en) 2023-04-25
CN108348605A (zh) 2018-07-31
US20210186932A1 (en) 2021-06-24
EP3373967C0 (en) 2023-06-07
CN108348605B (zh) 2023-06-09
JP7048505B2 (ja) 2022-04-05
AU2016352592A1 (en) 2018-04-26
EP3373967B1 (en) 2023-06-07
EP3373967A1 (en) 2018-09-19
JP2019501957A (ja) 2019-01-24
EP3373967B9 (en) 2023-10-04
AU2016352592B2 (en) 2023-04-27

Similar Documents

Publication Publication Date Title
US20230310385A1 (en) Treatment of er-negative breast cancer with an pdgf-cc inhibitor and an anti-estrogen
Arpino et al. Treatment of human epidermal growth factor receptor 2–overexpressing breast cancer xenografts with multiagent HER-targeted therapy
Huober et al. Higher efficacy of letrozole in combination with trastuzumab compared to letrozole monotherapy as first-line treatment in patients with HER2-positive, hormone-receptor-positive metastatic breast cancer–results of the eLEcTRA trial
Hesse et al. Sclerostin inhibition alleviates breast cancer–induced bone metastases and muscle weakness
Lainé et al. Lasofoxifene as a potential treatment for therapy-resistant ER-positive metastatic breast cancer
Cottu et al. Modeling of response to endocrine therapy in a panel of human luminal breast cancer xenografts
Lin et al. Advances in adjuvant endocrine therapy for postmenopausal women
US20190045758A1 (en) Biomarker and Therapeutic Target for Triple Negative Breast Cancer
Chen et al. N-acetylcysteine prevents orchiectomy-induced osteoporosis by inhibiting oxidative stress and osteocyte senescence
Su et al. Progression of prostate carcinoma is promoted by adipose stromal cell-secreted CXCL12 signaling in prostate epithelium
Su et al. Endocan blockade suppresses experimental ocular neovascularization in mice
US9861694B2 (en) EGFR antagonist for the treatment of heart disease
Ocaña et al. Trastuzumab and antiestrogen therapy: focus on mechanisms of action and resistance
US20120178757A1 (en) Method For The Prevention Of Cancer Metastasis
Fernández et al. Igf-I regulates pheochromocytoma cell proliferation and survival in vitro and in vivo
Saurel et al. Changes to adjuvant systemic therapy in breast cancer: a decade in review
Zeng et al. Insulin-like growth factors and breast cancer therapy
Jung Personalized therapy for advanced breast cancer using molecular signatures
Cavaliere et al. Combined inhibitory effect of formestane and herceptin on a subpopulation of CD44+/CD24low breast cancer cells
Yildiz et al. Adjuvant Systemic Therapy: Endocrine Therapy
Tan A novel oncogene-induced de novo model of triple negative human breast cancer
Choucair Crosstalk between IGF-1 and estrogen receptor non-genomic signaling pathway in breast cancer
Wegman et al. Expression of the forkhead transcription factor FOXL2 correlates with good prognosis in breast cancer patients treated with tamoxifen
Komaranchath Adjuvant Endocrine Therapy in Early Breast Cancer
Paratala Translational relevance of RET gene alterations in breast cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16795300

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2016352592

Country of ref document: AU

Date of ref document: 20161110

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2018543455

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016795300

Country of ref document: EP