WO2017079636A1 - Extreme reverse transcription pcr - Google Patents

Extreme reverse transcription pcr Download PDF

Info

Publication number
WO2017079636A1
WO2017079636A1 PCT/US2016/060650 US2016060650W WO2017079636A1 WO 2017079636 A1 WO2017079636 A1 WO 2017079636A1 US 2016060650 W US2016060650 W US 2016060650W WO 2017079636 A1 WO2017079636 A1 WO 2017079636A1
Authority
WO
WIPO (PCT)
Prior art keywords
pcr
polymerase
time
concentration
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/060650
Other languages
English (en)
French (fr)
Inventor
Carl T. Wittwer
John Francis QUACKENBUSH
Jessica Anne HOUSKEEPER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Utah Research Foundation Inc
Original Assignee
University of Utah Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Utah Research Foundation Inc filed Critical University of Utah Research Foundation Inc
Priority to DK16863087.9T priority Critical patent/DK3337615T3/da
Priority to US15/771,968 priority patent/US10900074B2/en
Priority to JP2018543065A priority patent/JP7319646B2/ja
Priority to PL16863087.9T priority patent/PL3337615T3/pl
Priority to CN201680064778.6A priority patent/CN108367287B/zh
Priority to ES16863087T priority patent/ES2916153T3/es
Priority to EP16863087.9A priority patent/EP3337615B1/en
Priority to CA3000824A priority patent/CA3000824C/en
Publication of WO2017079636A1 publication Critical patent/WO2017079636A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00Heating or cooling apparatus; Heat insulating devices
    • B01L7/52Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • B01L7/525Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples with physical movement of samples between temperature zones
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00Heating or cooling apparatus; Heat insulating devices
    • B01L7/52Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples
    • B01L7/525Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples with physical movement of samples between temperature zones
    • B01L7/5255Heating or cooling apparatus; Heat insulating devices with provision for submitting samples to a predetermined sequence of different temperatures, e.g. for treating nucleic acid samples with physical movement of samples between temperature zones by moving sample containers
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/18Means for temperature control
    • B01L2300/1838Means for temperature control using fluid heat transfer medium
    • B01L2300/185Means for temperature control using fluid heat transfer medium using a liquid as fluid

Definitions

  • PGR Polymerase chain reaction
  • PGR is conceptually divided into 3 reactions, each usually assumed to occur over time at each of three temperatures.
  • Such an "equilibrium paradigm" of PGR is easy to understand in terms of three reactions (denaturation, annealing, and extension) occurring at 3 temperatures over 3 time periods each cycle.
  • this equilibrium paradigm does not fit well with physical reality. Instantaneous temperature changes do not occur; it takes time to change the sample temperature.
  • individual reaction rates vary with temperature, and once primer annealing occurs, polymerase extension immediately follows. More accurate, particularly for rapid PGR, is a kinetic paradigm where reaction rates and temperature are always changing. Holding the temperature constant during PGR is not necessary as long as the products denature and the primers anneal.
  • rapidly PCR is both relative and vague. A 1 hour PCR is rapid compared to 4 hours, but slow compared to 15 minutes. Furthermore, PCR protocols can be made shorter if one starts with higher template concentrations or uses fewer cycles. A more specific measure is the time required for each cycle. Thus, “rapid cycle PCR” (or “rapid cycling”) was defined in 1994 as 30 cycles completed in 10-30 minutes (1), resulting in cycles of 20-60 seconds each. This actual time of each cycle is longer than the sum of the times often programmed for denaturation, annealing and extension, as time is needed to ramp the temperatures between each of these stages. Initial work in the early 1990s established the feasibility of rapid cycling using capillary tubes and hot air for temperature control. Over the years, systems have become faster, and the kinetic requirements of denaturation, annealing, and extension have become clearer.
  • thermocouple In one early rapid system, a heating element and fan from a hair dryer, a thermocouple, and PCR samples in capillary tubes were enclosed in a chamber (2).
  • the fan created a rapid flow of heated air past the thermocouple and capillaries.
  • the temperature of the thermocouple closely tracked the temperature of the samples, even during temperature changes.
  • air has a low thermal conductivity, rapidly moving air against the large surface area exposed by the capillaries was adequate to cycle the sample between denaturation, annealing, and extension temperatures.
  • Electronic controllers monitored the temperature, adjusted the power to the heating element, and provided the required timing and number of cycles. For cooling, the controller activated a solenoid that opened a portal to outside air, introducing cooling air to the otherwise closed chamber.
  • the samples can be physically moved to different temperature baths, or through channels with fixed temperature zones.
  • Mierofluidie methods have become popular, with the PCR fluid passing within channels through different segments kept at denaturation, annealing, and extension temperatures.
  • Continuous flow PCR has been demonstrated within serpentine channels that pass back and forth through 3 temperature zones (22) and within loops of increasing or decreasing radius that pass through 3 temperature sectors (23).
  • a variant with a serpentine layout uses stationary thermal gradients instead of isothermal zones, to more closely fit the kinetic paradigm of PCR (24).
  • To limit the length of the microchannel necessary for PCR some systems shuttle samples back and forth between temperature zones by bi-directional pressure-driven flow (25), pneumatics (26), or electrokinetic forces (27).
  • a single circular channel can be used with sample movement driven as a magnetic ferrofluid (28) or by convection (29).
  • One potential advantage of microsystem PCR. including continuous flow methods, is cycling speed.
  • Continuous flow systems have achieved 12-14 second cycles with thermal gradient PCR (24) and sample shuttling (26), while a ferrofluid loop claims successful PCR with 9 second cycles (28).
  • Continuous flow systems through glass and plastic substrates have achieved cycle times of 6.9 seconds (22) and 5.2 seconds (23) for various size PCR products.
  • Alternating hot and cool water conduction through an aluminum substrate amplified 1 ⁇ droplets under oil with 5.25 second cycles (33).
  • water conduction through a porous copper block amplified 5 ⁇ samples with 4.6 second cycles (34).
  • a continuous flow device of 1 ⁇ reaction plugs augmented by vapor pressure achieved 3 second cycles (35).
  • PCR amplification in capillaries cycled by pressurized hot and cool gases obtained 2.6 second cycles (48).
  • Table 1 summarizes work to minimize PCR cycle times to less than the 20 second cycles that originally defined "Rapid PCR". Over the past 20 years, new prototype instruments have been developed that incrementally improve cycling speed. However, practical PCR performance (efficiency and yield) is often poor. As a general rule, as cycles become increasingly shorter, claims for successful PCR correlate with lower complexity targets (bacteria, phage, multicopy plasmids, or even PCR products) that are used at higher starting concentrations (see, e.g., U.S. Patent No. 6,210,882, wherein 5 ng of amplicon was used as the starting sample). Indeed, none of the studies listed in Table 1 with ⁇ 20 second cycles used complex eukaryotic DNA such as human DNA.
  • the starting copy number of template molecules is often very high (e.g., 180,000,000 copies of lambda phage/ ⁇ ), so that little amplification is needed before success is claimed. Furthermore, the lack of no template controls in many studies raises questions regarding the validity of positive results, especially in an environment with high template concentrations.
  • One instrument-oriented report focuses extensively on the design and modeling of the thermal cycling device, with a final brief PCR demonstration using a high concentration of a low complexity target. Heating and cooling rates (up to 175°C/s) have been reported based on modeling and measurements without PGR samples present (17).
  • One way to decrease cycle time is to introduce variations to the PGR protocol to ease the temperature cycling requirements.
  • Longer primers with higher Tms allow higher annealing temperatures.
  • denaturation temperatures can be lowered to just above the product Tm.
  • higher annealing and lower denaturation temperatures decrease the temperature range required for successful amplification.
  • Reducing 3 -step cycling (denaturation, annealing, and extension) to 2-steps (denaturation and a combined annealing/extension step) also simplifies the temperature cycling requirements. Both decreased temperature range and 2-step cycling are typical for the studies in Table 1 with cycle times ⁇ 20 seconds.
  • Two-step cycling can, however, compromise polymerase extension rates if the combined annealing/extension step is performed at temperatures lower than the 70 to 80°C temperature optimum where the polymerase is most active.
  • Polymerase extension rates are log-linear with temperature until about 70-80°C, with a reported maximum of 60-120 bp/s (50).
  • the instrumentation in various references disclosed in Table 1 may be suitable for extremely fast PGR, if reaction conditions are compatible.
  • a focus on increased concentrations of primers, polymerase, and Mg++ allows for "extreme PGR" (PGR with ⁇ 20 second cycles (30 cycles in ⁇ 10 min)), while retaining reaction robustness and yield.
  • a focus on increased concentrations of primers, reverse transcriptase, and the inclusion of a sugar such as trehalose allows for faster reverse transcription (RT) for use in reverse-transcription PGR (RT-PCR).
  • methods for amplifying a target RNA in a biological sample during amplification comprising the steps of providing a reaction mixture comprising the biological sample, a reverse transcription enzyme, a thermostable polymerase and primers configured for amplification of the target RNA to the biological sample, wherein the polymerase is provided at a concentration of at least 0.5 ⁇ and primers are each provided at a concentration of at least 2 ⁇ ; reverse transcribing the RNA to DNA by incubating for no longer than 5 minutes, and amplifying the DNA by polymerase chain reaction by thermally cycling the biological sample between at least a denaturation temperature and an elongation temperature through a plurality of amplification cycles using an extreme temperature cycling profile, wherein each cycle is completed in a cycle time less than 20 seconds per cycle.
  • Kits and reaction mixtures are also provided herein.
  • FIG. 1 a shows a schematic for performing extreme PGR.
  • Fig. 1 b is an illustrative device for performing extreme PGR with real-time capabilities for monitoring one sample tube in a water bath.
  • Fig. l c is an illustrative device for performing extreme PGR with three- temperature cycling.
  • Fig. I d is a close up view of the optics of the device in Fig. lb that also shows the temperature reference capillary.
  • Fig. 2a is a graph that superimposes the location of the sample holder ( ) of
  • Fig. 2b is a temperature graph of extreme PCR using the device shown in Fig. lb.
  • Fig. 2c is a temperature graph of rapid cycle PCR using a carousel LightCycler (Roche) shown for comparison against Fig. 2b.
  • Fig. 3a shows derivative melting curves of extreme PCR products ( ) and rapid cycle PCR products (— ⁇ ⁇ — ), with negative controls for extreme ( ) and rapid (—
  • Fig. 3b is a 2% SeaKem LE agarose gel of the same samples of Fig. 3a, lanes 1 and 8 are size markers, lanes 2 and 3 are products resulting from 30 sec extreme PCR, lane 4 is a no template control for 30 sec extreme PCR, lanes 5 and 6 are products resulting from 12 min PCR, and lane 7 is the no template control for 12 min PCR.
  • Fig. 3c shows an extreme PGR temperature trace ( ) that amplified the same products shown in Fig. 3 a and 3b, along with real-time monitoring ( ) of the same reaction.
  • FIG. 4a shows an extreme PCR temperature trace that increases the extension rate by temperature control.
  • Fig. 4b shows a magnified portion of Fig. 4a, superimposing the location of the sample holder ( ) of Fig. lb with the temperature of the sample ( ).
  • Fig. 4c is a negative derivative melting curve (-dF/dT) of a 58 bp amplicon of
  • IRL10RB wherein AA ( ), AG (— -— ), and GG ( ) genotypes are shown.
  • Fig. 5a is a three dimensional graph plotting polymerase concentration vs. primer concentration vs. concentration of PCR product, using extreme PCR.
  • Fig. 5b is the extreme PCR temperature trace used in Fig. 5a.
  • Fig. 5c shows negative derivative melting curves of the 4 ⁇ KlenTaq polymerase (KT POL) products from Fig. 5a.
  • Fig. 5d is an agarose gel showing results of extreme PCR using varying polymerase concentrations at 10 ⁇ primer concentrations from Fig. 5a.
  • Fig. 6a is a temperature trace of extreme PCR performed in a 19 gauge stainless steel tube.
  • Fig. 6b is a gel of the PCR products produced by the extreme temperature cycles of Fig. 6a.
  • Fig. 7a is an extreme PCR temperature trace with a long (1 second) combined annealing/extension step.
  • Fig. 7b is a three dimensional graph plotting polymerase concentration vs.
  • primer concentration vs. concentration of PCR product, using extreme PCR for a 102 bp product.
  • Fig. 8a shows an extreme PCR temperature profile used to amplify a 226 bp product, using a one second combined annealing/extension step.
  • Fig. 8b shows an extreme PCR temperature profile used to amplify a 428 bp product, using a four second combined annealing/extension step.
  • Fig. 8c shows the real time results obtained from Fig. 8a and a similar temperature trace using a 2 second annealing/extension step, including no template controls for each.
  • Fig. 8d shows the real time results obtained from Fig. 8b and a similar temperature trace using a 5 second annealing/extension step, including no template controls for each.
  • Fig. 9a shows amplification curves of a 45 bp fragment of KCNE1 at different starting concentrations.
  • Fig. 9b is a plot of Cq versus log- ⁇ (initial template copies) of the data from Fig. 9a. Reactions were performed in quintuplicate. Figs. 9c-9d are similar to Figs. 9a-9b, except showing amplification of a 102 bp fragment of NQOl .
  • Fig. 10a is a three dimensional graph plotting polymerase concentration vs. primer concentration vs. concentration of PCR product, using extreme PCR for a 300 bp product (20 cycles, 4.9 seconds per cycle).
  • Fig. 10b shows fluorescence versus cycle number plots for PCR amplification of a 500 bp synthetic template using APA2G FAST polymerase and 1-5 second extension times.
  • Fig. 10c is a plot of extension length vs. minimum extension time for several KlenTaq polymerase concentrations and KAPA2G FAST polymerase.
  • Figs. 1 1 a-1 le show fluorescence versus cycle number plots for PCR
  • Fig. 12a shows negative derivative melting curves of a 60 bp fragment of AKAP10 after 35 cycles of extreme PCR, using varying magnesium concentrations.
  • Fig. 12b is a gel of the PCR products shown in the negative derivative melting curves of Fig. 12a.
  • Fig. 13a shows negative derivative melting curves of a 60 bp fragment of AKAP10 after 35 cycles, using varying cycle times with 5 mM Mg++. Cycle times were
  • Cycle times included a 0.1 to 0.4 second hold in a 60°C bath.
  • Fig. 13b is a gel of the PCR products shown in the negative derivative melting curves of Fig. 13a.
  • Fig. 14a shows negative derivative melting curves of a 60 bp fragment of AKAP10, as amplified on three different instruments: (1) extreme PCR, (2) LightCycler, and (3) CFX96 (Bio-Rad).
  • Fig. 14b is a gel of the PGR products shown in the negative derivative melting curves of Fig. 14a.
  • Figs. 15a- 15b show illustrative profiles for an equilibrium paradigm (Fig. 15a) and a kinetic paradigm (Fig. 15b) of PGR. Solid black represents denaturation, striped represents annealing, and solid white represents extension of the nucleic acids during thermal cycling.
  • Figs. 16a- 16c show an amplification profile (Fig. 16a), a melting profile (Fig. 16b), and melting peaks (Fig. 16c) of AKAP10 and ACTB in a duplex RT-PCR protocol. Two runs are shown.
  • Fig. 17 shows percent RT in shorter incubation times as compared to a 30 minute incubation time.
  • Fig. 18 is a gel of PGR products of RT-PCR using various temperatures and times for the RT step.
  • Lanes 1-3 show a 45°C incubation for 15, 20, and 25 seconds respectively
  • lanes 4-6 show a 47.5°C incubation for 15, 20, and 25 seconds respectively
  • lanes 7-9 show a 50°C incubation for 15, 20, and 25 seconds respectively
  • lanes 10-11 show a 55°C incubation for 15 and 20 seconds respectively
  • Figs. 19a- 19b are graphs that show the effect of 0.6 M trehalose on the RT step at various RT incubation temperatures, using iScript with trehalose ( ) and without trehalose ( ) (Fig. 19a), and with iScript ( ) and RocketScript ( ) both with trehalose (Fig. 19b).
  • Fig. 20 is a graph that shows the effects of reverse primer concentration on two- step RT-PCR, with an incubation of 20 seconds ( )and 60 seconds ( ).
  • Fig. 21 is a gel showing one-step RT-PCR amplification of RSV RNA at 5,000, 500, 50, or 5 copies (from left to right, in triplicate).
  • Fig. 22 is a gel showing RT-PCR with incubation times from 10 ms to 20 seconds.
  • Fig. 23 shows the real-time results of a one-step RT-PCR using 5,000 initial template copies of RSV RNA with a 5 second RT step and 45 cycles of PGR.
  • Fig. 24 is a gel showing very short times for an illustrative RT step. From left to right, the negative controls (NC) are the two left lanes, the cold prepared samples with 0, 1, and 5 s incubation at 56°C in the next three lanes, and one minute at room temperature with 0, 1 , and 5 s incubation at 56°C in the last three lanes.
  • Fig. 25 is a gel comparing the effect of trehalose on an illustrative RT step. The trehalose set is on the left, with (left to right) the no template control, blank, 1 , 2, 5, and 10 s of incubation, followed by the no trehalose in the same order.
  • Fig. 26 is a gel showing one-step RT-PCR performed with AMV as the enzyme, at 42°C with varying time and Mg++ concentration. Mg++ was included at 3 (top left), 6(top right), 10 (bottom left), and 13 (bottom right) mM MgCl 2 , each with RT times of 1 , 2, 5, and 10 s (from left to right).
  • Fig. 27 is a gel showing results of an illustrative one-step RT-PCR protocol performed at 0, 10, 20, 40, and 75 (from right to left) mM KC1 with a RT step at 42°C lasting 1 (top left), 5 (top right), and 10 (bottom left) s.
  • Fig. 28 is a gel showing results of an illustrative one-step RT-PCR protocol performed with 0, 10, or 38 mM DTT and 0 or 40 mM KC1 (as indicated) with 1 s (top left), 5 s (top right), and 10 s (bottom left) sec RT incubation at 42°C.
  • Fig. 29 is a graph showing the effect of MMLV concentration and RT time on Cq.
  • Fig. 30 is a graph showing the effect of AMV concentration on Cq at a 2 s RT reaction time.
  • Fig. 31 is a graph showing the effect of MMLV and AMV concentration on Cq, with reactions using AMV containing 8 mM Mg++, 2 s reaction time at 48°C, and reactions using MMLV containing 3.8 mM Mg++, 2.5 s reaction time at 45 °C.
  • Fig. 32 is a graph showing the effect RT temperature and time on Cq.
  • Fig. 33 is a graph showing the effect of RT temperature on Cq, with AMV as the
  • Fig. 34 is a graph showing the effect of RT temperature on Cq, showing results using both MMLV and AMV, wherein open circles represent MMLV and filled circles represent AMV.
  • Fig. 35 is a graph showing the effect of Mg++ concentration on Cq using AMV using a 2 s RT reaction time.
  • Fig. 36 is a graph showing the effect of Mg++ concentration on Cq using MMLV using 2 s and 5 s RT reaction times, wherein the solid line (filled circles) represents 2 s RT, and the dashed line (open circles) represents 5 s RT.
  • Fig. 37 is a graph showing the effect of Mg++ concentration on Cq using MMLV at 1.25 ⁇ / ⁇ at 45°C for 2 s (filled diamonds) and AMV at 0.31 ⁇ / ⁇ at 45°C for 2 s (open squares).
  • Fig. 38 is a graph showing the effect of RT reaction time on Cq using MMLV at 1.25 at 45 °C for 2 s with 7.4 niM MgCk
  • Fig. 39 is a graph showing the effect of RT reaction time on Cq using AMV at 0.31 ⁇ / ⁇ at 45°C for 2 s with 1 1 mM MgCk
  • Fig. 40 is a graph that combines the results shown in Figs. 38-39, with AMV (open circles) and MMLV (filled circles).
  • Fig. 41 is a graph showing the difference between Cqs using the glaciate technique with and without Zika template (two left bars) and with and without hRSV template (two right bars).
  • Fig. 42 is a graph comparing different frozen and chilled portions using the glaciate technique wherein Experiments #1 , #2, #3 are described in Example 26 and Experiment #1 corresponds to Table 4, Experiment #2 corresponds to Table 5, and
  • Fig. 43 is a graph showing the effect of temperature on Cq of positive and negative controls using the glaciate technique described in Example 26.
  • Fig 44 is a graph of the effect of the aptamer Trnc.2-30 on the Cq of positive controls, negative controls, and their difference (delta Cq) using human genomic DNA and rapid cycle PGR, wherein diamonds represent the Cq for the negative control, squares represent the Cq for the positive control, and triangles represent the delta Cq.
  • Fig. 45 is a graph comparing the effect of different DNA aptamers, with and without 3 '-blockers, where None is no blocker, Phos has a 3 '-phosphate, and Amino is modified with a C6-amino terminal modifier at the 3 '-end.
  • Fig. 46 is a graph showing the effect of DNA aptamer concentration on Cq, wherein diamonds represent the Cq for the negative control, squares represent the Cq for the positive control, and triangles represent the delta Cq.
  • Fig. 47 is a graph showing the effect of RNA aptamer concentration on Cq, wherein diamonds represent the Cq for the negative control, squares represent the Cq for the positive control, and triangles represent the delta Cq.
  • the terms “a,” “an,” and “the” are defined to mean one or more and include the plural unless the context is inappropriate. Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value.
  • the term “about” is used herein to mean approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 5%. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and
  • sample is meant an animal; a tissue or organ from an animal; a cell (either within a subject, taken directly from a subject, or a cell maintained in culture or from a cultured cell line); a cell lysate (or lysate fraction) or cell extract; a solution containing one or more molecules derived from a cell, cellular material, or viral material (e.g. a polypeptide or nucleic acid); or a solution containing a naturally or non-naturally occurring nucleic acid, which is assayed as described herein.
  • a sample may also be any body fluid or excretion (for example, but not limited to, blood, urine, stool, saliva, tears, bile) that contains cells, cell components, or nucleic acids.
  • nucleic acid refers to a naturally occurring or synthetic oligonucleotide or polynucleotide, whether DNA or RNA or DNA-RNA hybrid, single-stranded or double-stranded, sense or antisense, which is capable of hybridization to a complementary nucleic acid by Watson-Crick base-pairing.
  • Nucleic acids of the invention can also include nucleotide analogs (e.g., BrdU, dUTP, 7-deaza-dGTP), and non- phosphodiester internucleoside linkages (e.g., peptide nucleic acid (PNA) or thiodiester linkages).
  • nucleic acids can include, without limitation, DNA, RNA, cDNA, gDNA, ssDNA, dsDNA or any combination thereof.
  • probe By “probe,” “primer,” or “oligonucleotide” is meant a single-stranded DNA or RNA molecule of defined sequence that can base-pair to a second DNA or RNA molecule that contains a complementary sequence (the “target”).
  • the stability of the resulting hybrid depends upon the length, GC content, nearest neighbor stacking energy, and the extent of the base-pairing that occurs.
  • the extent of base-pairing is affected by parameters such as the degree of complementarity between the probe and target molecules and the degree of stringency of the hybridization conditions.
  • the degree of hybridization stringency is affected by parameters such as temperature, salt concentration, and the concentration of organic molecules such as formamide, and is determined by methods known to one skilled in the art.
  • Probes, primers, and oligonucleotides may be detectably-labeled, either radioactively, fluorescently, or non-radioactively, by methods well-known to those skilled in the art.
  • dsDNA binding dyes dyes that fluoresce more strongly when bound to double- stranded DNA than when bound to single-stranded DNA or free in solution
  • a "primer” is specifically configured to be extended by a polymerase, whereas a "probe” or “oligonucleotide” may or may not be so configured.
  • a probe, primer, or oligonucleotide recognizes and physically interacts (that is, base-pairs) with a substantially complementary nucleic acid (for example, a sample nucleic acid) under high stringency conditions, and does not substantially base pair with other nucleic acids.
  • high stringency conditions typically occur at about melting temperature (Tm) minus 5°C (i.e. 5° below the Tm of the probe). Functionally, high stringency conditions are used to identify nucleic acid sequences having at least 80% sequence identity.
  • methods and kits are provided for PGR with ⁇ 20 second cycle times, with some embodiments using ⁇ 10 second, ⁇ 5 second, ⁇ 2 second, ⁇ 1 second, and ⁇ 0.5 second cycle times. With these cycle times, a 30 cycle PGR is completed in ⁇ 10 min, ⁇ 5 min, ⁇ 2.5 min, ⁇ 1 min, ⁇ 30 seconds, and ⁇ 15 seconds, respectively. As PCR speeds become increasingly faster, the primer or polymerase concentrations, or both, are increased, thereby retaining PCR efficiency and yield.
  • PCR complementary metal-oxide-semiconductor
  • primer annealing if primers anneal to only 95% of the template, the PCR efficiency cannot be greater than 95%, even if 100% of the templates are denatured and 100% of the primed templates are extended to full length products.
  • extension is only 95% efficient, the maximum possible PCR efficiency is only 95%. In order for the PCR product concentration to double each cycle, all the components must reach 100% completion.
  • 94°C is often used as a default target temperature for denaturation, it is seldom optimal.
  • PCR products melt over a 40°C range, depending primarily on GC content and length (43).
  • Low denaturation target temperatures have both a speed and specificity advantage when the PCR product melts low enough that a lower denaturation temperature can be used.
  • the lower the denaturation temperature the faster the sample can reach the denaturation temperature, and the faster PGR can be performed.
  • Added specificity arises from eliminating all potential products with higher denaturation temperatures, as these potential products will remain double-stranded and will not be available for primer annealing.
  • the target temperature may need to be increased above 94°C.
  • Denaturation however, need not be rate limiting even under extreme cycling conditions, because DNA unwinding is first order and very fast (10-100 msec), even when the temperature is only slightly above the product Tm. Denaturation occurs so rapidly at 2- 3°C above the Tm of the amplification product that it is difficult to measure, but complete denaturation of the amplicon probably occurs in less than 0.1 second. If the product melts in multiple domains, the target denaturation temperature should be 2-3°C above the highest melting domain. As long as the sample reaches this temperature, denaturation is very fast, even for long products. Using capillaries and water baths (40), complete denaturation of PCR products over 20 kB occurred in less than one second (52).
  • Tms and melting domains are illustratively determined experimentally with DNA dyes and high resolution melting (41). Although Tm estimates can be obtained by software predictions (42), their accuracy is limited. Furthermore, observed Tms strongly depend on local reaction conditions, such as salt concentrations and the presence of any dyes and adjuvants. Thus, observed Tms are usually better matched to the reaction conditions.
  • the approach rate to denaturation can be as fast as possible, for example 200-400°C/s, as shown in Fig. 2a and 6a. At these rates, only about 0.1 -0.2 seconds are required to reach denaturation temperatures. However, a slower rate as the target temperature is approached decreases the risk of surpassing the target temperature and avoids possible polymerase inactivation or boiling of the solution.
  • One illustrative method to achieve a slower approach temperature is to submerge the sample in a hot bath that exceeds the target temperature by 5-10°C. The temperature difference between the target and bath temperatures determines the exponential approach curve that automatically slows as the difference decreases.
  • Rapid PCR protocols with 20-60 second cycles suggest an annealing time of ⁇ 1 second at 5°C below the Tm with 500 nM primers (52).
  • Primer concentrations for instruments attempting ⁇ 20 second cycles range from 200-1,000 nM each (Table 1). These concentrations are similar to those used in conventional PCR (>60 second cycles), where long annealing times are used. Lowering the primer concentration is often used to improve specificity, and increasing the primer concentration is seldom considered due to concerns regarding nonspecific amplification. However, with rapid cycling, improved specificity has been attributed to shorter annealing times (5). If this trend is continued, one would expect that very short annealing times of extreme PCR should tolerate high primer concentrations.
  • an annealing temperature 5°C below the primer Tm is recommended for 20-60 second cycles.
  • Tms are best measured experimentally by melting analysis using saturating DNA dyes and oligonucleotides under the same buffer conditions used for amplification.
  • the primer is combined with its complementary target with a 5'- extension as a dangling end, to best approximate the stability of a primer annealed to its template, and melting analysis is performed.
  • annealing efficiency depends on the primer concentration.
  • Primer annealing can become limiting at very fast cycle speeds.
  • Primer annealing is a second order reaction dependent on both primer and target concentrations.
  • the primer concentration is much higher than the target concentration and annealing is effectively pseudo-first order and dependent only on the primer concentration.
  • the fraction of product that is primed depends only on the primer concentration, not the product concentration, so that higher primer concentrations should allow for shorter annealing times.
  • it is believed that the relationship is linear. As the annealing time becomes shorter and shorter, increased primer concentrations become necessary to maintain the efficiency and yield of PCR.
  • rapid cycling allows about 1-3 seconds for annealing at temperatures 5°C below primer Tm (3). If this annealing time (at or below Tm-5°C) is reduced 10-fold in extreme PCR, a similar priming efficiency would be expected if the primer concentration were increased 10-fold. As the available annealing time becomes increasingly shorter, the primer concentration should be made increasingly higher by approximately the same multiple. Typical rapid PCR protocols use 500 nM each primer. If the annealing time in extreme PCR is reduced 3 to 40-fold, the primer concentrations required to obtain the same priming efficiency are 1 ,500 - 20,000 nM each primer. This is equivalent to 3,000 - 40,000 nM total primers, higher than any primer concentration in Table 1.
  • the approach rate to the annealing target temperature may be as fast as possible. For example, at 200-800°C/s (Figs. 2a and 6a), annealing temperatures can be reached in 0.05-0.2 seconds. Rapid cooling also minimizes full length product rehybridization. To the extent that duplex amplification product forms during cooling, PCR efficiency is reduced because primers cannot anneal to the duplex product. Although this is rare early in PCR, as the product concentration increases, more and more duplex forms during cooling. Continuous monitoring with SYBR® Green I suggests that such product reannealing can be a major cause of the PCR plateau (44).
  • Polymerase extension also requires time and can limit PCR efficiency when extension times are short. Longer products are known to require longer extension times during PCR and a final extension of several minutes is often appended at the end of PCR, presumably to complete extension of all products. The usual approach for long products is to lengthen the time for extension. Using lower extension temperatures further increases required times, as in some cases of 2-step cycling where primer annealing and polymerase extension are performed at the same temperature.
  • annealing and extension steps are kept separate at different temperatures.
  • the time allotted to annealing and extension steps can be individually controlled and tailored to specific needs. For example, if only the annealing time is short (0.05 - 0.2 seconds) and the extension time is kept comparatively long (illustratively for 1, 2, 5, 10 or 15 seconds), only the primer concentrations need to be increased for efficient PCR.
  • the extension time is short ( ⁇ 1 sec within 70-80°C), but the annealing time is long, it is believed that only the polymerase concentration needs to be increased to obtain efficient PCR.
  • efficient PCR has an illustrative efficiency of at least 70%, more illustratively of at least 80%, and most illustratively of at least 90%, with >95% efficiency achievable in many instances.
  • the minimum time illustratively should be the extension length (defined as the product length minus the primer length) in bases divided by the polymerase extension rate in bases/second.
  • the polymerase is usually only saturating in the beginning of PCR, before the concentration of template increases to greater than the concentration of polymerase.
  • One way to decrease cycle time is to use two- temperature PCR near the temperature maximum of the polymerase, typically 70-80°C. The required extension time can be determined experimentally using real-time PCR and monitoring the quantification cycle or Cq.
  • a 200 bp product would be expected to require about 2 seconds if the concentration of polymerase is in excess.
  • a 400 bp product would be expected to require about 4 seconds using this same polymerase as long as its concentration is greater than the template being extended. If the polymerase is not in excess, adding more polymerase allows more templates to be extended at the same time, decreasing the required extension time in proportion to the concentration of polymerase.
  • PCR is fast and simple. Rapid cycle and extreme PCR focus on continued reduction of the time required. Real-time PCR increases the information content by acquiring data each cycle. Melting analysis can be performed during or after PCR to monitor DNA hybridization continuously as the temperature is increased.
  • reaction conditions are configured according to at least one
  • PCR can be performed at very fast rates, illustratively with some embodiments in less than one minute for complete amplification, with cycle times of less than two seconds.
  • various combinations of increased polymerase and primer concentrations are used for this extreme PCR.
  • an excess concentration of primers will allow for generally complete primer annealing, thereby increasing PCR efficiency.
  • an increase in polymerase concentration improves PGR efficiency by allowing more complete extension.
  • Increased polymerase concentration favors binding to the annealed primer, and also favors rebinding if a polymerase falls off prior to complete extension.
  • the examples below show that extreme PGR has been successful, even when starting with complex eukaryotic genomic DNA and single-copy targets.
  • thermostable polymerase of similar activity will perform in a similar manner in extreme PGR, with allowances for polymerase extension rates.
  • Herculase, Kapa2G FAST, KOD Phusion, natural or cloned Thermus aquaticus polymerase, Platinum Taq, GoTaq and Fast Start are commercial preparation of polymerases that should enable extreme PGR when used at the increased concentrations presented here, illustratively adjusted for differences in enzyme activity rates.
  • a system 4 was set up to test proof of concept for extreme PCR. However, it is understood that the system 4 is illustrative and other systems that can thermocycle rapidly are within the scope of this disclosure. As shown in Fig. la, a hot water bath 10 of 95.5°C (the temperature of boiling water in Salt Lake City, UT, the location where the present examples were performed), and a cool water bath 14 of 30-60°C are used to change the temperature of 1-5 ⁇ samples contained in a sample container 20.
  • the illustrative water baths 10, 14 are 4.5 quart stainless steel dressing jars (Lab Safety Supply, #41634), although 500 ml glass beakers were used in some examples, and are heated on electric hotplates 12, 16 with magnetic stirring (Fisher Scientific Isotemp Digital Hotplates (#1 1-300-49SHP). However, it is understood that other embodiments may be used to heat and cool the samples.
  • the sample container 20 is a composite glass/plastic reaction tube (BioFire Diagnostics #1720, 0.8 mm ID and 1.0 mm OD).
  • hypodermic needles Becton Dickenson #305187, 0.042" ID, 0.075" OD
  • composite stainless steel/plastic reaction tubes constructed from stainless steel tubing Mall Parts, 0.042" ID/0.075" OD, 0.035" ID/0.042" OD, or 0.0265"
  • sample container 20 ID/0.035" OD
  • sample container 20 ID/0.035" OD
  • the sample containers it is desirable that the sample containers have a large surface area to volume ratio and have a fast heat transfer rate.
  • the open end of the metal tubing was sealed by heating to a red-white color using a gas flame and compressing in a vise.
  • tubes that are optically clear or have an optically clear portion are desirable. Samples were spun down to the bottom of each tube by brief centrifugation.
  • the sample container 20 is held by a tube holder 22 attached to a stepper motor shaft 26 by arm 21.
  • the tube holder 22 was machined from black Delrin plastic to hold 2-5 sample containers 20 (only one sample container 20 is visible in Fig. la, but a row of such sample containers 20 may be present) so that the reaction solutions were held at a radius of 6.5 - 7.5 cm.
  • a thermocouple (Omega type T precision fine wire thermocouple #5SRTC-TT-T-40-36, 36" lead, 0.003' diameter with Teflon insulation) may be used to measure temperature.
  • Fig. Id which shows a similar tube holder and arm of Fig.
  • thermocouple 228 any number of sample containers 20 or 220 may be used in any of the embodiments described herein, with or without a thermocouple, as shown in Fig. Id.
  • Thermocouple amplification and linearization is performed with an Analog Devices AD595 chip (not shown).
  • the analog signal was digitized (PCIe-6363 acquisition board) and processed by LabView software (version 2010, National Instruments) installed on CPU 40 and viewed on user interface 42. Stepper motion illustratively is triggered dynamically at 87-92°C and 60-75 °C or may be held in each water bath for a computer-controlled period of time. Thirty to fifty cycles are typically performed.
  • the stepper motor 24 (Applied Motion Products, #HT23-401, 3V,3A) is positioned between the water baths 10 and 14 so that all sample containers 20 in the tube holder 22 could flip between each water bath 10 and 14, so that the portion of each sample container 20 containing samples are completely submerged.
  • the stepper motor 24 is powered illustratively by a 4SX-41 1 nuDrive (National Instruments, not shown) and controlled with a PCI-7344 motion controller and NI-Motion Software (version 8.2, National Instruments) installed on CPU 40. Stepper motor 24 rotates between water baths
  • Fig. 2a shows a sample temperature trace ( ) juxtaposed over a trace of the position of the sample container 20 ( ), for a run where stepper motion was triggered at 90°C and 50°C.
  • stepper motion was triggered at 90°C and 50°C.
  • there is some overshoot to a temperature lower than 50°C presumably due do the time required to move the sample container 20 out of water bath 14.
  • the examples below the
  • extreme PGR may be performed with ramp rates of at least 200°C/s. In other embodiments, the ramp rate may be 300°C/s or greater.
  • system 4 is also configured for real-time monitoring.
  • a fiber optics tip 50 of optics block 25 is mounted above sample container 20, such that when sample container 20 is being moved from hot water bath 10 to the cold water bath by stepper motor 24, sample container 20 passes by the fiber optics tip 50, with or without a hold in this monitoring position.
  • fiber optics tip is provided in air above the water baths.
  • Thermocycling device 4 may be controlled by CPU 40 and viewed on user interface 42.
  • Fig. l b shows an embodiment similar to Fig. l a.
  • Hot plates 212 and 216 are provided for controlling temperature of hot water bath 210 and cold water bath 214.
  • a stepper motor 224 is provided for moving sample container 220 and thermocouple 228 (shown in Fig. Id), by moving arm 221 and tube holder 222, which is illustratively made of aluminum.
  • the tip 250 of the fiber optics cable 252 is held in water bath 214 by positioning block 254.
  • Fiber optics cable 252 enters water bath 214 through port 248 and provides signal to optics block 225.
  • Thermocycling device 204 may be controlled by CPU 240 and viewed on user interface 242
  • LED Light Source 256 was guided by fiber optics cable 252 (Ocean Optics P600-2-UV-VIS, 600 ⁇ fiber core diameter) into a Hamamatsu Optics Block 258 with a 440 +/-20 nm excitation interference filter, a beamsplitting 458 nm dichroic and a 490 +/- 5 nm emission filter (all from Semrock, not shown).
  • Epifluorescent illumination of the capillary was achieved with another fiber optic cable (not shown) placed approximately 1 -2 mm distant from and in-line with the one sample capillary when positioned in the cooler water bath.
  • Emission detection was with a Hamamatsu PMT 62.
  • Fig. l c shows an illustrative system 304 for three-temperature PGR.
  • a hot water bath 310 of 95.5°C, a cool water bath 314 of 30-60°C, and a medium water bath 313 of 70- 80°C are used to change the temperature of 1-5 ⁇ samples contained in a sample container 320, and are heated on three electric hotplates 312, 316, and 318 with magnetic stirring.
  • the sample container 320 is held by a tube holder 322 attached to a stepper motor 324 by arm 321.
  • Thermocouple 328 is also held by tube holder 322.
  • Arm 321 may be raised as stepper motor 324 rotates.
  • a fiber optics tip 350 is illustratively provided in medium water bath 313, although it is understood that it may be placed in air, as with Fig. 1 a. Due to the set-up of this illustrative embodiment, it was not possible to place the three water baths, 310, 313, and 314 equidistant from one another. Accordingly, the largest space was placed between hot water bath 310 and cool water bath 314, as cooling of the sample between these baths is desirable, whereas the sample moves between the other water baths to be heated. However, it is understood that this configuration is illustrative only and that other configurations are within the spirit of this disclosure.
  • the angular motion of each can be minimized to decrease the time of movement between baths.
  • the required angular motion of the stepper to transfer the sample between baths is greater than 270 degrees.
  • the stepper motor that raises the samples needs to traverse less than 45 degrees while the stepper moving the samples between water baths needs to move only 90 degrees or less.
  • the water baths can also be configured as sectors of a circle (pie-shaped wedges) to further limit the angular movement required. Minimizing the angular movement decreases the transfer time between water baths.
  • Transfer times less than 100 msec or even less than 50 msec are envisioned.
  • Other components of this system 304 are similar to the systems 4, 204 shown in Figs. 1 a-b and are not shown in Fig. lc.
  • Extension to a 4 water bath system is also envisioned.
  • Uses for the fourth water bath include an ice water bath to ensure a cold start to limit the amount of extension before initial PGR denaturation, and a water bath at 37-56°C for reverse transcription prior to PCR (RT-PCR). If both a cold start and a reverse transcription were needed, a 5 water bath system could be used.
  • PCR was performed in 5 ⁇ reaction volumes containing 50 mM Tris (pH 8.3, at 25°C), 3 mM MgCl 2 , 200 ⁇ each dNTP (dATP, dCTP, dGTP, dTTP), 500 ⁇ g/ml non-acetylated bovine serum albumin (Sigma), 2% (v/v) glycerol (Sigma), 50 ng of purified human genomic DNA, and IX LCGreen® Plus (BioFire Diagnostics). The concentration of the primers and the polymerase varied according to the specific experimental protocols. KlentaqlTM DNA polymerase was obtained from either AB Peptides, St.
  • KlenTaq is the equivalent of 0.75 U/ ⁇ , with a unit defined as 10 nmol of product synthesized in 30 min at 72 °C with activated salmon sperm DNA.
  • Primers were synthesized by the University of Utah core facility, desalted, and concentrations determined by A260. The final concentrations of each primer typically varied from 2.5-20 ⁇ .
  • KCNE1 100133 J A 45 bp fragment of KCNE1 was amplified from human genomic DNA using primers CCCATTCAACGTCTACATCGAGTC (SEQ ID NOT) and
  • TCCTTCTCTTGCCAGGCAT (SEQ ID NO:2).
  • Fig. 3a shows a melting curve of the PCR product generated by extreme PCR using the device shown in Fig. l a, where 0.64 ⁇ KlenTaq and 10 ⁇ of each primer were used, and cycled between 91 °C and 50°C, as shown in Fig. 2b, for 35 cycles and a total amplification time of 28 seconds. Each cycle required 0.8 seconds. Also shown in Fig. 3a is a melting curve of the same amplicon generated by rapid cycling in the LightCycler, where 0.064 ⁇ KlenTaq and 0.5 ⁇ of each primer were used, and cycling was between 90°C and 50°C for 35 cycles and a total amplification time of 12 minutes (Fig. 2c).
  • this reaction has a quantification cycle (Cq) of about 25 cycles, but it does not seem to plateau until at least 50 cycles. Also, because the reaction was stopped after 64 cycles, it is possible that the quantity of amplicon may continue to increase and not plateau until significantly later. Without being bound to theory, it is believed that the increase in primer concentration allows for improved yield and delayed plateau, illustratively 20 cycles after Cq, and more illustratively 25 cycles or more after Cq.
  • Example 1 The reaction mixtures in Example 1 were the same for both the extreme PCR and rapid cycle PCR, except for the amounts of polymerase and primers, and a minor difference in glycerol concentration that apparently caused the shift in Tm seen in Fig. 3a. In this and all future examples, the glycerol concentration was held at 2% by equalizing its concentration as necessary. For extreme PCR, 1 ⁇ polymerase and 10 ⁇ M of each primer were used, while for rapid cycle PCR, 0.064 ⁇ polymerase and 0.5 ⁇ of each primer were used. As discussed above, it is believed that faster annealing times provide for improved primer specificity.
  • primers may be used, which is believed to favor primer binding and allow reduced annealing times.
  • polymerase concentrations favor binding to the annealed primer, and also favor rebinding to the incomplete amplicon if a polymerase falls off prior to complete extension.
  • polymerase concentrations favor binding to the annealed primer, and also favor rebinding to the incomplete amplicon if a polymerase falls off prior to complete extension.
  • Fig. 5a summarizes the results of extreme PCR cycling with various polymerase and primer concentrations.
  • a 49 bp fragment of the interleukin 10 beta receptor was amplified with primers GGGAGTCACCTGCTTTTGCC (SEQ ID NO:7) and TACTGAGCTGTGAAAGTCAGGTTCC (SEQ ID NO:8) and 3 niM MgCl 2 , to generate: GGGAGTCACCTGCTTTTGCCAAAGGGAACCTGACTTTCACAGCTCAGTA (SEQ ID NO: 9).
  • the device shown in Figs, lb was used without real time monitoring.
  • the temperature was cycled between 90°C and 63 °C for 35 cycles, for a total reaction time of just under 26 seconds (0.73 second cycles) as shown in Fig 5b.
  • Reaction conditions were as discussed in Example 1 , except that the amounts of polymerase and primers were varied, as shown in Fig. 5a.
  • the vertical axis in Fig. 5a is quantified as the peak of the negative derivative plot of the melting curve, obtained without normalization on the 1 IR- l instrument.
  • At 0.5 ⁇ polymerase virtually no amplification was seen at any level of primer concentration. However, at 1.0 ⁇ polymerase, discernible levels of amplification were seen at primer concentrations of 5 ⁇ and above.
  • the polymerase levels increase, so do the amount of amplicon, up to levels of about 4 ⁇ .
  • the amount of amplicon plateaued or dropped off, depending on the primer concentration, with a significant drop off at 16 ⁇ at lower primer concentrations. It appears that under these extreme temperature cycling conditions for a 49 bp product, the polymerase has a favored concentration range between about 1 and 8 ⁇ , and more specifically between 2 and 8 ⁇ , depending on the primer concentration.
  • Fig. 5c shows melting curves for various primer concentrations at 4 ⁇ KlenTaq
  • Fig. 5d verifies the size of the product as the polymerase concentration varies while the primer concentration is held at 10 ⁇ . Despite the high concentrations of polymerase and primers, no nonspecific amplification is seen.
  • the ratio between the amount of enzyme and amount of primer is important for extreme PCR cycling, provided that both are above a threshold amount. It is noted that the above amounts are provided based on each primer. Given that the polymerase binds to each of the duplexed primers, the total primer concentration may be the most important. For KlenTaq, suitable ratios are 0.03-0.4 (3-40% enzyme to total primer concentration), with an illustrative minimum KlenTaq concentration of about 0.5 ⁇ , and more illustratively about 1.0 ⁇ , for extreme PCR.
  • the primers may be provided in equimolar amounts, or one may be provided in excess, as for asymmetric PCR.
  • the optimal polymerase:primer percentage may also depend on the temperature cycling conditions and the product size. For example, standard (slow) temperature cycling often uses a much lower polymerase to primer percentage, typically 1.5 nM (0.04 U/ ⁇ ) polymerase (49) and 1 ,000 nM total primer concentration, for a percentage of 0.15%, over 10 times lower than the percentages found effective for extreme PCR.
  • CTCTGTGCTTTCTGTATCCTCAGAGTGGCATTCT SEQ ID NO: 10.
  • CG 1 C I GCTGGAG 1 G 1 GCCCAATGCTA ' f A (SEQ ID NO: l 1) and the instrument of Fig. lb without the real-time components.
  • the polymerase concentration was varied between 0.25 and 4 ⁇ , while each primer concentration was varied between 0.5 and 8 ⁇ .
  • the primers were designed to anneal at higher temperatures (low 70s) so that extension at a combined annealing/extension phase would be at a more optimal temperature for the polymerase. Greater polymerization rates at these temperatures were expected to enable amplification of longer products.
  • the cooler water bath was controlled at 72°C and the end of the annealing/extension phase triggered by time (1 second), rather than temperature.
  • Fig. 7a Cycling between 72 and 90°C for 30 cycles required 58 seconds using 1.93 second cycles.
  • Fig. 7a shows the sample temperature drops about 3°C below the annealing/extension temperature while it travels through the air to the hot water bath.
  • Fig. 7b shows the amount of product amplified by quantifying the melting curves as in Fig. 5a. Melting curve analysis showed only a single product of Tm 84°C. Very little product was observed at 0.25 ⁇ polymerase or at 1 ⁇ each primer. Some amplification occurs at 2 ⁇ each primer, with the best amplification at 2-4 ⁇ polymerase and 8 ⁇ each primer.
  • the extreme PCR temperature profile used for the 226 bp product is shown in Fig. 8a, which included a 1 second combined annealing/extension at 75°C and denaturation at 87°C. Also performed was a 2 second annealing/extension phase at the same temperature (trace not shown). Real time PCR results for these amplifications are shown in Fig. 8c, revealing about a 5 cycle shift to higher Cq with the 1 second extension as compared to the 2 second extension, presumably reflecting a decrease in efficiency as the extension time is decreased.
  • the extreme PCR temperature profile used for the 428 bp product is shown in Fig. 8b, showing a 4 second combined annealing/extension at 75 °C and denaturation at 87°C.
  • Optimal concentrations of primers and polymerase were first determined for the intermediate length 300-bp product using a 4 second combined annealing/extension segment with 4.9 seconds per cycles (Fig. 10a). Identical primer (4 ⁇ ) and polymerase (2 ⁇ ) concentrations were then used for all product lengths and minimum extension times were determined (Fig. 1 la-e). Depending on the product length, increased extension times resulted in decreased fractional quantification cycles (Cq) until no further change was observed, reflecting the minimum extension time required for efficient PGR. For example, amplification curves using the KAPA2GTM FAST polymerase (Kapa Biosystems) for the 500 bp product are shown in Fig. 10b.
  • the minimum extension time using KAPA2G FAST polymerase was 3 s, compared to 7 s using KlenT aql (a deletion mutant of Taq polymerase, AB Peptides).
  • KlenT aql a deletion mutant of Taq polymerase, AB Peptides.
  • Fig. 10c For KlenTaql polymerase, about 1 second is required for each 60 bps, while for KAPA2G FAST, 1 second is required for each 158 bp.
  • these two polymerases were chosen because they are commercially available at sufficient concentrations, while most other polymerases are not commercially available at such high concentrations.
  • the required time for extension depends directly and linearly with the length to be extended, and inversely with the concentration of polymerase and the polymerase speed.
  • a proportionality constant (k2) can be defined that relates these 3 parameters:
  • Each reaction was in a 1 ⁇ volume with time based control (0.07 seconds in a 94 °C water bath, 0.1-0.4 seconds in a 60°C water bath) for 35 cycles using 2-7 mM MgC12.
  • the sample volume was 1 ⁇ , with 5 ng human genomic DNA, 20 ⁇ primers, and 8 ⁇ polymerase.
  • Using a 0.42 second per cycle protocol when the MgCl 2 was 2-3 mM, no product was observed on melting curves (Fig. 12a) or gels (Fig. 12b).
  • illustrative Mg++ concentrations are at least 4 mM, at least 5 mM, at least 6 mM, at least 7 mM, or more, and it is understood that these illustrative Mg++ concentrations may be used with any of the embodiments described herein.
  • Fig. 14a-b shows the results comparing amplification of the AKAP10 60 bp product used in Example 9, wherein amplification was performed using 20 ⁇ of each primer, 8 ⁇ KlenTaq and 10 ng human genomic DNA for 40 cycles using: (1) extreme PGR with set times of 0.5 s at 94°C and 0.2 seconds at 60°C, giving a total time of approximately 17 seconds, (2) Rapid cycle PCR (Roche LightCycler) using set times of 10 s at 94°C for an initial denaturation, followed by cycles of 85 °C for 0 seconds, and 60°C for 0 seconds, giving a total time of approximately 9 minutes, and (3) Legacy (block) temperature cycling (Bio-Rad CFX96) with a 10 s initial denaturation at 94
  • Examples 1 - 17 were all performed using one or more of the devices described in Figs, l a - Id, or minor variations on those configurations, with certain steps performed on the LightCycler, to confirm qPCR results.
  • the methods and reactions described herein may take place in a variety of instruments.
  • the water baths and tubes used in these examples allow for sufficiently rapid temperature change to study the effects of elevated concentrations of primers and polymerase.
  • other embodiments may be more suitable commercially.
  • Microfluidics systems with low volume and high surface area to volume ratios, may be well suited to extreme PCR. Such systems allow for rapid temperature changes required by the high concentrations of primers and polymerase that are used in extreme PCR.
  • Microfluidics systems include micro-flow systems (35, 53) that incorporate miniaturized channels that repeatedly carry the samples through denaturation, annealing, and extension temperature zones. Some of these systems have already demonstrated effective PCR with cycle times as fast as 3 seconds for lower complexity targets. It is expected that more complex targets may be amplified in such systems if the polymerase is provided at a concentration of at least 0.5 ⁇ and primers are each provided at a concentration of at least 2 ⁇ . Stationary PCR chips and PCR droplet systems (54) may also benefit from increased primer and probe concentrations, as the volumes may be as small as 1 nl or smaller and may be low enough to permit very fast cycling. It is understood that the exact instrumentation is unimportant to the present invention, provided that the instrumentation temperature cycles fast enough to take advantage of increased primer and polymerase concentrations without suffering from the loss of specificity associated with higher primer concentrations at slower cycle speeds.
  • PGR is illustrative only, and increased primer and enzyme concentrations combined with shorter amplification times are envisioned for nucleic acid amplification methods other than PGR.
  • Illustrative enzymatic activities whose magnitude may be increased include polymerization (DNA polymerase, RNA polymerase or reverse transcriptase), ligation, helical unwinding (helicase), or exonuclease activity (5' to 3' or 3' to 5'), strand displacement and/or cleavage, endonuclease activity, and RNA digestion of a DNA/RNA hybrid (RNAse H).
  • Amplification reactions include without limitation the polymerase chain reaction, the ligase chain reaction, transcription medicated amplification (including transcription-based amplification system, self-sustained sequence replication, and nucleic acid sequence-based amplification), strand displacement amplification, whole genome amplification, multiple displacement amplification, antisense RNA amplification, loop-mediated amplification, linear-linked amplification, rolling circle amplification, ramification amplification, isothermal oligonucleotide amplification, helicase chain reaction, and serial invasive signal amplification.
  • transcription medicated amplification including transcription-based amplification system, self-sustained sequence replication, and nucleic acid sequence-based amplification
  • strand displacement amplification including transcription-based amplification system, self-sustained sequence replication, and nucleic acid sequence-based amplification
  • strand displacement amplification including transcription-based amplification system, self-sustained sequence replication, and nucleic acid sequence-based amplification
  • the amplification time varies inversely by the same factor.
  • the amplification time varies inversely by the same factor.
  • both enzyme and primer concentrations should be varied in order to maximize the reaction speed. If primer annealing occurs in a unique segment of the amplification cycle (for example, a unique temperature during 3-temperature PGR), then the time required for satisfactory completion of primer annealing in that segment is expected to be inversely related to the primer concentration.
  • the enzyme activity is required in a unique segment of the amplification cycle (for example, a unique temperature during 3-temperature PGR)
  • the time required for satisfactory completion of the enzymatic process in that segment is expected to be inversely related to the enzyme concentration within a certain range. Varying the primer or enzyme
  • concentrations can be used to change the required times of their individual segments, or if both occur under the same conditions (such as in 2-temperature PGR or during an isothermal reaction process), it is expected that a change in both concentrations may be necessary to prevent one reaction from limiting the reaction speed.
  • Increased Mg++ concentration can also be used in combination with increased enzyme and primer concentrations to further speed amplification processes. Higher Mg++ concentrations both increase the speed of primer annealing and reduce the time for many enzymatic reactions used in nucleic acid amplification.
  • Increasing polymerase concentrations can reduce the time necessary for long- range PGR, illustratively where the target is 5-50 kb. Typically, 10 min to 30 min extension periods are used to amplify large targets because the target is so long that such times are needed: 1) for the polymerase to complete extension of a single target, and 2) for enzyme recycling to polymerize additional primed templates. This recycling of polymerase is not needed at the beginning of PGR, when the available enzyme outnumbers the primed template molecules. However, even before the exponential phase is finished, the number of polymerase molecules often becomes limiting and enzyme recycling is necessary. By increasing the concentration of the polymerase, the required extension period can be reduced to less than 5 minutes and possibly less than 2 minutes, while maintaining increased yield due to the high primer concentration. Although the actual enzyme speed is not increased, less recycling is necessary, affecting the minimum time required,
  • Cycle sequencing times can also be reduced by increasing primer and polymerase concentrations.
  • standard cycle sequencing primer concentrations are 0.16 ⁇ and the combined annealing/extension period is 10 min at 50-60 degrees C.
  • the time required for annealing/extension can be reduced approximately 10-fold.
  • the expected time required is inversely proportional to the polymerase or primer concentration, whichever is limiting.
  • Time - time-based segment control does not have a temperature trigger
  • annealing times outside of those currently performed can be used to predict the required primer concentrations for the desired time. For example, using a constant of 5 (s * ⁇ ), for an annealing time of 0.01 s, a primer concentration of 500 ⁇ can be calculated. Conversely, if a primer concentration of 0.01 ⁇ were desired, the required annealing time would be 500 seconds. Although these conditions are outside the bounds of both legacy and extreme PGR, they predict a relationship between primer concentrations and annealing times that are useful for PGR success. Reasonable bounds for kl across legacy, rapid cycle and extreme PGR are 0.5 - 20 (s x ⁇ ), more preferred 1 - 10 (s x ⁇ ) and most preferred 3 - 6 (s x ⁇ ).
  • k2 is defined as the proportionality constant in the above equation under conditions of constant temperature, Mg++, type of polymerase, buffers, additives, and concentration of dsDNA dye.
  • Mg++ constant temperature
  • type of polymerase buffers
  • additives concentration of dsDNA dye.
  • concentration of dsDNA dye concentration of dsDNA dye.
  • the required extension time is proportional to the extension length (product length minus the primer length) and inversely proportional to the polymerase speed and concentration of polymerase.
  • k2 has units of (l/ ⁇ ) and an optimal value for the extreme PCR conditions used here of 0.5 (l/ ⁇ ) with a range of 0.3 - 0.7 (l/ ⁇ ). Similar values for k2 could be derived for other reaction conditions that vary in polymerase type, Mg++ concentration or different buffer or dye conditions.
  • Extreme PCR can be performed in any kind of container, as long as the temperature of the sample(s) can be changed quickly, and preferably homogeneously. Both intra-sample, and inter-sample homogeneity is important in many applications, illustratively for quantitative PCR where different PCR efficiencies of different samples translate directly to quantification errors.
  • micro-droplets of aqueous reactions suspended in an oil stream or thin 2-dimensional wafers provide good thermal contact.
  • Continuous flow PCR of a sample stream (either dispersed as droplets, separated by bubbles, or other means to prevent mixing) past spatial segments at different temperatures is a good method for the temperature control needed for the speeds of extreme PCR.
  • Induction heating as described in WO 2015/069743, herein incorporated by reference in its entirety, may provide suitable methods and devices for extreme PCR.
  • RNA cannot be amplified directly by PCR. RNA must first be reverse transcribed into DNA. Typically, this is done
  • reverse transcriptases enzymatically by enzymes called "reverse transcriptases”. Enzymatic reactions take time, and a typical amount of time recommended for reverse transcription is 30-50 min (see, e.g., Product insert for Superscript II Reverse Transcriptase, MAN0001342, Rev. Date: 20 May, 2010, Invitrogen/Life Technology/ThermoFisher).
  • RT reverse transcription
  • extreme PCR is a technology capable of amplifying DNA in as little as 15 seconds or less.
  • PCR in less than a minute is not so helpful when the reverse transcription of an mRNA or viral RNA takes 30 minutes or more.
  • Faster RT-PCR would be desirable, and it would be particularly desirable to have a one-step RT-PCR protocol in which both the RT and PCR steps take place in the same reaction mixture.
  • a rapid one-step RT-PCR duplex reaction with the common reference gene ACTB is performed.
  • Two human transcripts (AKAP10 and ACTB) were reverse transcribed and amplified in one step with primers for AKAP10
  • TTCCTGGGCATGGAGTC SEQ ID NO:28
  • CAGGTCTTTGCGGATGC SEQ ID NO:29
  • 10 ⁇ reactions were 0.5 ⁇ of each primer, 60 ng of total RNA extracted from human blood leukocytes, 300 Units of Superscript II reverse transcriptase (ThermoFisher), and 0.1 M dithiothreitol in a rapid PCR master solution (IX LCGreen Plus dye, 0.2 ⁇ each dNTP, 3 niM MgCl 2 , 50 niM Tris, pH 8.3, 25 ng/ ⁇ bovine serum albumin, 0.4 U of KlenTaq DNA polymerase (AB Peptides) and 64 ng of anti-Taq antibody (eEnzyme).
  • the samples were placed in a LightCycler capillary tube (Roche) incubated at 45°C for 5 min for reverse transcription, and then cycled for 40 cycles between 94 and 55°C (no holds) for real time amplification on a carousel LightCycler (Fig. 16a).
  • the samples were then melted in the LightCycler by momentary denaturation at 95°C, cooling to 60°C, and finally fluorescence acquisition by heating to 95°C at 0.2°C/s (Figs. 16b- 16c).
  • the peak at 79°C is the AKAP10 amplicon and the peak at 83°C is ACTB.
  • RT-PCR The consistency and quality of RT-PCR depends on many things, including the specific type of RT enzyme (60).
  • Two types of RT enzymes are commonly used for RT- PCR, one from a mouse leukemia virus (Maloney murine leukemia virus - MMLV) and one from a bird virus (avian myeloblastoma virus - AMV), although other RT enzymes are known in the art, and engineered variants of MMLV that have lower (or higher) RNase H activity and increased temperature stability are available commercially.
  • Bustin (60) tested several reverse transcriptases for consistency and yield, and determined that one of the better enzymes is an MMLV sold as iScript (Bio-Rad).
  • one "Unit" of RT is the amount of enzyme required to incorporate 1 nmole of d lTP into acid-precipitable material in 10 min at 37°C using poly(rA)/oligo (dT) 25 as template/primer.
  • the buffer used for determining MMLV Unit activity is 50 mM Tris, pH 8.3, 75 mM KCl. 3 mM MgCl 2 , and 10 mM DTT
  • the buffer used for determining AMV Unit activity is 75 mM potassium acetate, 50 mM Tris-HCl (pH 8.3) 8 mM magnesium acetate and 10 mM DTT.
  • the number of Units used for MMLV RT reactions (10 U/ ⁇ ) is typically 10 times that of AMV RT reactions (lU/ ⁇ ).
  • the RT enzymes used here include: 1 ) native cloned MMLV (New England Biolabs), 2) Superscript II (a modified MMLV with low RNase H activity and increased thermal stability, ThermoFisher), 3) iScript (a modified MMLV with strong RNase H activity, Bio-Rad), 4) RocketScript (a modified MMLV with increased RNase H activity and increased thermal stability, Bioneer), and 5) native cloned AMV (New England Biolabs).
  • the Unit definition and concentration of enzyme are clearly indicated by the manufacturer. Exceptions are RocketScript, where the activity is determined by titration against an enzyme of known activity, and iScript, where the manufacturer does not disclose the concentration used.
  • the suggested procedure (1 ⁇ of enzyme in a RT reaction volume of 20 ⁇ ) is identical to the procedures of the other RT enzymes, suggesting that the concentration of iScript is a 200 U/ ⁇ stock solution, diluted to 10 U/ ⁇ in an RT reaction, the concentrations provided and suggested by the other manufacturers.
  • the recommended incubation time for the iScript MMLV is 30 minutes.
  • a two-step RT-PCR was performed. With this two-step method, the RT was performed separately in microfuge tubes in a water bath for different time periods, and then real-time PCR was performed in a capillary LightCycler. The RT step was performed for varying times (1 min to 30 min) at 45 °C with the ACTB reverse primer listed in Example 1 1.
  • Two ⁇ iScript MMLV (presumptively for a final concentration of 10 U/ ⁇ ) with RNase inhibitor were combined with a reaction mixture including random hexamers, oligo (dT), stabilizers, dNTPs, and a buffer not otherwise specified.
  • the 40 ⁇ reaction included 256 ng total RNA from leukocytes and the ACTB reverse primer at 0.25 ⁇ . After incubation at 45°C, the reaction was stopped by heating to 85°C for 5 min, and the mixture was diluted 3-fold with water.
  • the qPCR was performed as in Example 1 1 , except that 2 ⁇ of the diluted cDNA template and only ACTB primers were used.
  • the quantification cycle (Cq) of each curve, relative to the Cq of the 30 min control was used to calculate relative concentrations of ACTB cDNA, assuming an amplification efficiency of 100%. Results are displayed in Fig. 17. Approximately 60% of the cDNA was formed in the first 5 min, with 80% at 10 min, and 100% at 20 min. Additional studies varying the incubation time (0.5, 1 , 2, 4, 8, 16, 30 min) and the primer concentration (0.125, 0.25, 0.5, 1 ⁇ ) showed that increasing the primer concentration compensates for lower incubation times. It was not possible to study times faster than 0.5 minutes with microfuge tubes because of slow temperature equilibration.
  • extreme PCR combines rapid temperature cycling with high primer and polymerase concentrations to enable PCR in 2 minutes or less. Annealing times can be reduced because the high primer concentrations drive the reaction faster in direct proportion to increase in primer concentration. Similarly, high enzyme concentration should proportionally speed the extension step when the amount of enzyme is limiting. Analogy to RT suggests that higher primer and enzyme concentrations might also help to speed RT reactions. However, combining both the RT step and the PCR step into one reaction with two different enzymes is difficult. In general, reverse transcriptase and DNA polymerase reaction conditions are not believed to be compatible.
  • KCl is used in RT reactions but is absent from the rapid PCR master solution of Example 1 1 because KCl inhibits polymerase activity by 80% at 50 mM KCl (61).
  • KCl concentrations of 0 to 10 mM KCl may be appropriate in a one-step RT- PCR reaction.
  • Higher concentrations of dNTPs 0.5 - 1.0 mM each (RT) vs. 0.2 mM each (PCR)
  • Mg++ (3-15 mM (RT) vs. 1.5-5 mM (PCR)
  • RNA has more secondary structure than DNA, and strong secondary structure is thought to inhibit RT. Increasing the temperature is one way to release secondary structure in RNA so that it is easier to reverse transcribe. However, commonly used RT enzymes are believed to be thermolabile, so there is a limit to how much one can heat the sample to unfold secondary structure without inactivating the reverse transcriptase. Shorter reaction times would be expected to preserve more of the generated nucleic acid for PCR, both by limiting the time of exposure to any RNases and limiting chemical degradation.
  • a one-step RT-PCR was performed using 8 times the normal primer concentrations in less than 1 minute.
  • the 5 ⁇ one step RT-PCR contained 4 ⁇ of each ACTB primer, 25 ng of total leukocyte RNA, 50 U iScript RT (final concentration 10 U/ ⁇ ) similar to Example 12 except that no random hexamers or poly (dT) were included, and 2 ⁇
  • Trehalose is a sugar that has been used to thermostabilize and thermoactivate RT enzymes and can be used as an enhancer of PCR (63).
  • the temperature profile of iScript MMLV with and without 0.6 M trehalose was measured by two-step RT-PCR. Conditions were the same as in Example 13, except that the RNA source was a human reference total RNA sample obtained from multiple tissues (Stratagene) included at 5 ng/ ⁇ , and the reverse transcription incubation was for 20 seconds at temperatures from 42-69°C.
  • RT was performed in capillaries in a water bath at varying temperatures, with immediate RT inactivation by moving the capillaries in 125 msec to an 85°C water bath for 60 seconds.
  • the samples were then diluted and transferred to a capillary LightCycler for qPCR, as described in Example 12.
  • the no template controls were negative and samples were compared to a positive control with the RT run at 42° C for 30 min. From 55-63°C in the RT step, trehalose had a protective effect, increasing the amount of product as measured by qPCR by 20-40% (Fig. 19a).
  • iScript MMLV RT was compared to RocketScript MMLV RT (Bioneer). Set up and analysis were the same except that RocketScript RT was performed in a 10 ⁇ reaction with 100 U RT (final concentration 10 U/ ⁇ ), 10 mM dithiothreitol, 0.25 mM each dNTP, and 0.5 U RNase inhibitor. Very similar results were obtained (Fig. 19B) for the two enzymes across the tested temperature range, suggesting that these engineered MMLV mutants may be the same or similar enzymes. Both manufacturers claim their MMLV mutants are more stable than the native enzyme and have RNase H activity.
  • Reverse transcription was performed at 56°C for 20 or 60 seconds, otherwise following the procedure of Example 14. With 60 s RT, the relative quantity increased through 4 ⁇ of primer, then leveled off between 4-8 ⁇ (Fig. 20). With 20 seconds of RT, the relative quantity continued to increase through 8 ⁇ primer, suggesting that shorter times can be compensated for by higher concentrations of the RT primer.
  • RNA virus detection and quantification Another very common application of RT-PCR is in RNA virus detection and quantification.
  • viral load assays for HIV and HCV are much in demand, as are the detection of respiratory viruses such as respiratory syncytial virus (RSV).
  • RSV respiratory syncytial virus
  • RSV RNA was obtained from the ATCC, catalog #VR-3233SD.
  • RSV primers were forward: TGGGGCAAA l ATGTCACGAAG (SEQ ID NO:30) and reverse:
  • CCATTTAAGCAATGACCTCGAATTTCA (SEQ ID NO:3 1 ). with a resultant amplicon length of 63 bp.
  • Reverse transcription and PCR were performed in 5 ⁇ with 6 ⁇ of each primer, (40 U/ ⁇ ) iScript RT, 2 ⁇ KlenTaq, 0.6 M trehalose and 5,000, 500, 50, or 5 copies of freshly diluted RSV RNA in the rapid PCR master solution of Example 1 1 with the exception of anti-Taq antibody. Reverse transcription was performed for 20 seconds at 56°C followed by 35 cycles of PCR as described in Example 13. Gels of the PCR products (in triplicate) at different initial template copies numbers are shown in Fig. 21.
  • RT-PCR amplification of RSV RNA with reverse transcription incubations down to less than one second was performed.
  • RT-PCR was performed as in Example 16, with 5,000 initial template copies of RSV RNA. All solutions were mixed on ice to limit any reverse transcription prior to initiation of the reaction at 56°C.
  • the RT time at 56°C was varied from 20 seconds down to less than 1 second.
  • the shortest time period labeled as "10 ms" indicates the time in the 56°C water bath when the capillary was stationary. Time including the transition into and out of the water bath and the 10 msec stationary hold may not have been adequate exposure at 56°C to bring the sample up to temperature.
  • sucrose When trehalose was compared against sucrose at 0.2, 0.4 and 0.6 M, sucrose, all samples amplified well with melting analysis indicating that the 0.4 M sucrose produced the highest yield (data not shown). Sucrose appears to be as good as or better than trehalose, suggesting that other sugars, including glucose and fructose may have similar effects. Other stabilizers may be used as well.
  • AMV RT from New England Biolabs is a native, cloned RT usually run at 42 °C in the presence of a reducing agent such as dithiothreitol (10- 250 niM). high Mg++ concentrations (8-13 raM), and high KC1 (75 m.M).
  • the manufacturer's buffer (final concentration in the reaction) was: 50 mM Tris, pH 8.3, 75 mM K acetate, 8 niM Mg acetate, and 10 mM DTT. This mixture was supplemented with BSA (final concentration in the reaction of 500 ⁇ ⁇ ) for compatibility with glass capillary tubes.
  • This buffer was compared to the rapid PGR master solution of Example 1 1 supplemented with 10 niM DTT and 10 mM Mg++ (total 13 mM Mg++) in the final reaction.
  • the main difference between the two buffers is that no K+ was in the rapid PGR mixture, while the manufacturer's buffer included 75 mM K+.
  • the presence of potassium ions has previously been considered critical for RT reactions (64).
  • Two-step RT-PCR reactions were performed. To each buffer, 250 copies of RSV RNA ⁇ L, 2.5 U/ ⁇ AMV RT, and 15 ⁇ reverse RSV primer were added and the RT performed at 42°C for 1 s, 5 s, 20 s, 1 min, or 10 min.
  • the reverse transcriptase was inactivated at 93 °C for 60 s, cooled to room temperature, and diluted 1 : 10 for PGR in a capillary LightCycler.
  • Each 10 ⁇ PGR included 0.5 ⁇ RSV primers and 2 ⁇ of 1 : 10 cDNA in the rapid PGR master solution.
  • Real time PGR was performed by cycling for 45 cycles between 94 and 55°C (no holds). The samples were then melted in the LightCycler by momentary denaturation at 95°C, cooling to 60°C, and finally fluorescence acquisition by heating to 95 °G at 0.2°C.
  • One-step RT-PCR was then performed with AMV at 42°C to study the effects of RT time and Mg" concentration.
  • Mg ++ was included at 3, 6, 10, and 13 mM, each with RT times of 1 , 2, 5, and 10 seconds.
  • the one-step reaction included the rapid PCR master solution of Example 1 1 (without anti-Taq antibody), 2.5 U/ ⁇ of AMV RT, 250 copies/ ⁇ of RSV RNA, 4 ⁇ of each RSV primer, and 10 mM DTT. Cycling conditions were as in Example 13. Results are shown in Fig. 26. Panels include 3 (top left), 6 (top right), 10 (bottom left), and 13 (bottom right) mM MgCl 2 .
  • RT times were 1 , 2, 5, and 10 seconds, left to right.
  • No product was observed for AMV RT at 3 mM MgCl 2
  • variable intensity products were observed at 6 and 10 mM MgCl 2 without any clear trend for the time of RT incubation
  • strong bands at all RT times were observed for 13 mM MgCl 2 .
  • Excellent amplification occurred with 13 mM MgCl 2 , even in the complete absence of K+, contrary to expectations from prior art that suggests no amplification without K+.
  • good results may be obtained using a one-step RT-PCR protocol wherein the reaction mixture is substantially free of potassium.
  • Native MMLV from NEB was compared to the genetically modified MMLV iScript from Bio-Rad. The manufacturer of iScript claims it to have greater RNase H activity and greater heat stability.
  • Initial studies using the rapid PGR master solution of Example 1 1 with RSV RNA and 5 seconds of RT at 56°C in 0.6 M trehalose showed good specific melting curves when iScript (10 U/ ⁇ ) was used, but no amplification with native MLV (2.5 U/ ⁇ ). Similar results were found when each enzyme was increased 4-fold. Finally, the RT temperature was lowered to 37, 42, or 47°C with a 20 second RT step. Results were the same with iScript showing good amplification, but native MMLV showed no amplification. The reactions did not contain any DTT or K+.
  • Example 19 A two-step experiment similar to that of Example 19 was performed with 2 different buffers, one based on the manufacturer's buffer (50 mM Tris, pH 8.3, 3 niM MgCl 2 , 75 mM KCl and 10 mM DTT) supplemented with BSA (500 ⁇ g/ml) and dNTPs (500 ⁇ each), and the other based on the rapid PGR master solution of Example 1 1 (50 mM Tris, pH 8.3, 3 mM MgCl 2 , 200 ⁇ each dNTP, and 250 ⁇ g/ml BSA) supplemented with 10 ⁇ DTT and 75 mM KCl. Instead of AMV.
  • the manufacturer's buffer 50 mM Tris, pH 8.3, 3 niM MgCl 2 , 75 mM KCl and 10 mM DTT
  • BSA 500 ⁇ g/ml
  • dNTPs 500 ⁇ each
  • Example 1 1 50 mM Tris, pH
  • MMLV 20 U/ ⁇ of MMLV was used in each reaction, as well as 6 ⁇ reverse RSV primer. Each reaction also included 250 copies of RSV RNA ⁇ L. Both DTT and KCl were present in both buffers at the same concentration, although there were slight differences in dNTP and BSA concentrations that were not expected to affect the results.
  • RT was performed at 42°C for 1 second, 10 seconds, 1 min, or 10 min. After RT, the reverse transcriptase was inactivated at 93 °C for 60 seconds, cooled to room temperature, and diluted 1 :20 for PGR in a capillary LightCycler. Each 10 ⁇ PCR included 0.5 ⁇ RSV primers and 2 ⁇ of 1 :20 cDNA in the rapid PGR master solution of Example 1 1. Real-time PCR and melting were performed as in the two-step procedure detailed in Example 19.
  • DTT is a powerful sulfhydryl reducing agent required by some enzymes that have free sulfhydryl groups.
  • One-step RT-PCR similar to the preceding paragraph was performed with 0, 10, or 38 mM DTT and 0 or 40 mM KCl with 1 , 5, or 10 seconds RT incubation at 42°C. Results (Fig.
  • RSV RNA obtained from ATCC, catalog #VR-26D.
  • RSV primers were TGGGGCAAATATGTCACGAAG (SEQ ID NO: 30) and CCATTTAAGCAATGACCTCGA (SEQ ID NO:31 ).
  • transcription and PGR were performed in glass capillaries in a 5 ⁇ volume with 5 ⁇ of each primer and an extreme PCR master solution (IX LCGreen Plus Dye, 0.2 ⁇ each dNTP, 50 mM Tris (pH 8.3), 1.65 ⁇ KlenTaq DNA polymerase, and 25 ng/ ⁇ bovine serum albumin) with 3.8 mM MgCl 2 .
  • Each positive sample included 6000 copies of RSV template in 5 ⁇ . Negatives samples did not include template (no template controls).
  • Results showed a minor decrease in Cq ( ⁇ 2 cycles) with increasing RT times (Fig. 29). However, at the shortest time (2.5 seconds), high concentrations of MMLV strongly inhibited (up to 10 cycles) the overall reaction. At 2.5 seconds, 1.25 UI ⁇ xL appeared optimal, an 8-fold decrease from the recommended concentration of 10 ⁇ / ⁇ . With the goal of reducing the overall time for RT-PCR, 2.5 seconds is small compared to the PCR time of about 30 seconds, only contributing ⁇ 10% of the overall time. It is preferable that the RT time is less than 50% of the overall time in extreme RT-PCR, more preferable that it is less than 20% of the overall time, and most preferable that it is less than 10% of the overall time.
  • RT time minimizes RNA degradation at high temperatures and high magnesium concentrations.
  • both the RT and PCR times may be proportionately increased.
  • amount of reverse transcriptase can be proportionately increased as the length of the intended product increases, but at the small lengths used here, lower amounts of RT are optimal.
  • Reverse transcriptase has been reported to inhibit DNA polymerases such as Taq polymerase, another reason to limit the concentration of RT in one-step RT-PCR reactions.
  • AMV in the cloned native form was diluted to determine the optimal concentration as determined by low Cq values.
  • the recommended concentration of AMV in RT-PCR by the manufacturer is 1.25 ⁇ ⁇ ,. However, initial experiments indicated that optimal concentrations were lower. Reactions were tested at AMV concentrations of 1.25, 0.63, 0.31 , 0.156, 0.078, and 0.039 ⁇ / ⁇ L ⁇
  • AMV performed best at a concentration of 0.31 ⁇ / ⁇ , 4 times lower than the recommended concentration of 1.25 UI iL (Fig. 30), although larger amounts may be used, illustratively 0.5, 0.8, and 1.0 Units ⁇ L, particularly for larger amplicons.
  • Fig. 31 combines the results for both Examples 21 and 22, with the manufacturer's recommended
  • RT-PCR Extreme one-step RT-PCR using MMLV was analyzed across a range of temperatures (37, 42, 45, and 48°C) and hold times (2.5, 5, 10, 20, 40, and 80 seconds) for the RT step.
  • RT-PCR followed Example 21 , except that the MgCl 2 concentration was 7.4 mM and 1.251 ⁇ / ⁇ MMLV was used.
  • the Cq decreased as the RT time increased, although not always (Fig. 32).
  • no temperature optimum could be determined for MMLV.
  • Fig. 33 The lowest average Cq was 45°C, which is also the manufacturer's recommended temperature for RT using AMV.
  • Fig. 34 combines the data for MMLV and AMV. Optimal temperatures are not apparent. Indeed, similar RT activity appears over a wide range of temperatures.
  • MgCl 2 concentrations were studied with both MMLV and AMV.
  • One-step RT-PCR was performed with RSV as described previously (Examples 21 and 22). All samples were treated with a 45 °C RT hold for 2 seconds (AMV) or 2 and 5 seconds (MMLV), followed immediately by PCR amplification for 33 cycles.
  • Samples included RSV template and AMV at 0.31 U/ ⁇ in IX PCR buffer as in Example 22.
  • the MgCL concentration was analyzed in varying increments between 3 mM and 20 mM. The lowest Cq value was measured at 1 1 mM (Fig. 35). Reactions with less than 1 1 mM MgCl 2 rapidly became less efficient, while Cq only rose slowly between 1 1 and 20 mM.
  • RT-PCR samples containing MMLV were performed with IX PCR buffer (Example 21) and 1.25 Units/ ⁇ L RT.
  • MgCl 2 was titrated between 2 mM and 15 mM to determine the optimal concentration. In this case, both 2 and 5 second RT times were studied. The lowest Cq was found between 8 and 1 1 mM MgCl 2 , depending on the RT time (Fig. 36), although between 6 and 12 mM the MgCl 2 was effective. The Cq increased about 1 cycle going from 5 second to 2 second RT times. Both enzymes are compared in Fig. 37 with 2 second RT times. MMLV was more active than AMV at all Mg++ concentrations.
  • MMLV reactions contained 1.25 ⁇ / ⁇ of enzyme, I X PCR buffer (Example 21 ), and 7.4 mM MgCl 2 . Results are shown in duplicate in Fig. 38 with a logarithmic X- axis. There is a large Cq drop between 1 and 2 seconds, and less than a 1 -cycle difference between a 2 and 40 seconds. The majority of the cDNA appears to be made within the first few seconds of RT.
  • AMV reactions contained 0.31 U/ ⁇ enzyme, I X PGR buffer, and 1 1 mM
  • MMLV appears more efficient than AMV in generating cDNA at most time points.
  • Another option is to mix the components within an instrument that holds the solutions at a high temperature during mixing, such as the FilmArray (BioFire Diagnostics, LLC).
  • the high temperature reduces or eliminates primer binding prior to the start of the reaction, but this requires a specialized instrument that may not be needed for many applications.
  • primer dimer When all RT-PCR components are present, non-specific template amplification or non-template amplification (primer dimer) may occur at room temperature during preparation. Therefore, critical reaction components, like the polymerase or dNTPs are typically withheld from the reaction mixture during preparation as long as possible. Primer dimer formation occurs more readily with the high primer and polymerase concentrations that are found in extreme PCR. However, primer dimers do not occur when only one primer is exposed to a polymerase; two different primers are necessary for primer dimer formation (65). The present work demonstrates that primer dimer formation in extreme RT- PCR can be reduced by separating the primers into two half reactions that are mixed immediately before RT. The Cq of no template control reactions was higher (better specificity and hence better sensitivity) when the primers were separated into the two half reactions until just before RT-PCR than when they were prepared together.
  • Primer dimers can also be decreased or prevented by keeping the fully mixed reactions cold and limiting the amount of time after mixing prior to RT-PCR. For example, it has been found that keeping the samples on ice after mixing and centrifuging the samples in the cold before PCR increased the Cqs of no template controls. In general, better results may be obtained by minimizing both the time and temperature after final mixing but before RT-PCR. In addition, rapidly ramping the temperature from the mixing temperature (illustratively 0 to 25 °C) to the RT temperature (37 to 90 °C) lowers primer dimer formation.
  • the temperature change after mixing to the RT temperature illustratively may be performed in less than one second, more illustratively in less than 0.5 s, and most illustratively in less than 200 ms.
  • the present work shows that at short RT times, there is a broad range of acceptable RT temperatures.
  • transcriptase are present in the same reaction tube, inhibition of PCR can occur (66-68).
  • the present work shows that separation of the DNA-directed polymerase (e.g., KlenTaq) and the RNA-directed polymerase (reverse transcriptase) into the 2 separate half reactions also lowers primer dimers as evidenced by an increase in delta Cq, the difference in Cq between positive control and negative control amplifications. Additional experiments have shown better results when the half reaction that contains the reverse transcriptase contains the reverse primer, that is, the primer that can anneal to any template present and extend the primer if dNTPs and Mg++ are present.
  • DNA-directed polymerase e.g., KlenTaq
  • reverse transcriptase reverse transcriptase
  • control of primer dimers was obtained by separating the one-step RT-PCR preparation into two half-reactions.
  • the first half-reaction contains the DNA directed polymerase (e.g., KlenTaq), the primer that does not anneal to the template (the forward primer), and IX buffer (e.g., Tris, BSA, and IX fluorescent dye, e.g., LCGreen plus).
  • the second half reaction contains the reverse transcriptase, the primer that does anneal to the template (the reverse primer), IX buffer, Mg ++ , dNTPs, and template).
  • the solution is kept as cold as practical (illustratively ⁇ 25 °C, more illustratively ⁇ 5 °C, and even more illustratively ⁇ 2) for as short a time as possible
  • An exemplary one-step RT-PCR included components separated into a first frozen half-reaction and a second chilled (but liquid) half-reaction. The two half reaction portions were combined immediately before running one-step RT-PCR, hereinafter called the "glaciate" technique.
  • CCATTTAAGCAATGACCTCGA SEQ ID NO:31. Both half reactions contained IX LCGreen Plus Dye, 50 mM Tris (pH 8.3), and 25 ng/ ⁇ . bovine serum albumin. Working on ice, the half reaction to be frozen contained in addition, 0.2 mM each dNTP, 3.2 mM lenTaq and 10 ⁇ forward primer. Two and a half of this sample was pipetted into each glass capillary and briefly centrifuged ( ⁇ 5 seconds) and frozen at -20°C for a minimum of 20 minutes.
  • the chilled portion of reaction was in the -20°C freezer, the chilled portion was prepared on ice.
  • the chilled portion included 10 ⁇ reverse primer, 12 mM MgCl 2 , 2.5 of RSV.
  • MMLV was not added to the chilled solution until right before addition to the frozen capillaries.
  • Two to three frozen reaction capillaries were removed from the freezer and immediately placed into an ice water bath. Addition of 2.5 ⁇ , of the chilled solution was then pipetted into the top of each capillary and quickly pulsed in a table top centrifuge ( ⁇ 3 seconds) and promptly placed back into the ice bath.
  • RT-PCR was then performed with a 2 second RT hold at 50°C and cycled 45 times between 95°C and 55°C.
  • CAGGTTGGAGTGGGAGTCAT (SEQ ID NO: 32) and reverse primer was TTTGTAACGTGCCACATGGT (SEQ ID NO:33). 1250 copies of Zika RNA were used per 5 ⁇ , RT-PCR reaction.
  • Results from both the RSV and Zika virus experiments showed a substantial increase in ACq (about 10 cycles, or a sensitivity increase of 1000) for no template controls of RT-PCR reactions made by the glaciate techniques as compared to those mixed on ice (Fig. 41). Furthermore, the melting curves of the no-template controls were shifted to lower temperatures and became easily distinguished from positive samples.
  • Aptamers were investigated as a means to decrease no-template control "primer- dimer” amplification in extreme RT-PCR. Aptamers have been used in the past to inhibit polymerization reactions, specifically both DNA-directed DNA polymerases (69-70) and RNA-directed DNA polymerases (71). Aptamers are derived by in vitro evolutionary selection. The basic sequence of the aptamers studied herein are listed below (5'-3'):
  • Trnc.A-30 AAGACCAGACAATGTACAGTATTGGCCTGA (SEQ ID NO:36) Trnc.2-30: GCCGGCCAATGTACAGTATTGGCCGGC (SEQ ID NO:37) Tctw.A-30: CCGGACAA I G I ACAG ⁇ ATTGGCCCGG (SEQ ID NO:38)
  • aptamer blocking with phosphate and C6 amino groups are described herein, additional 3 '-blockers are contemplated, including amino modifiers with different carbon chain lengths, illustratively those with two carbon (C2), three carbon (C3), and up to twelve carbon (C12) linkers. Any 3 '-blocker with a positive charge is also contemplated and thought to increase the binding and effectiveness of the aptamers described herein, although other blockers may be used.
  • the oligonucleotides Tctw.A-30, Tctw.A-30 Phos, and Tctw.A-30 amino are novel aspects of this application because they maintain the hairpin loop and the asymmetric internal loop of the hairpin stem of aptamer Trnc.A-30, while adding stability by changing one of the stem base pairs from A::T to G::C and increasing the length of the stem by an additional G: :C base pair. Additionally, other modifications to Trnc.A-30 that maintain its secondary structure (hairpin loop and asymmetrical internal loop) while increasing the stem stability are expected to produce useful aptamers, with or without a 3 '-amino modifier for the applications described herein.
  • the secondary structures of Trnc.A-30 and Trnc.2-30 have been published (69). The RNA aptamers for MMLV are not blocked because they should not be extended by DNA polymerases.
  • the DNA aptamers were first tested with rapid cycle PGR.
  • the human genomic DNA target was defined by the following PUM1 (intron 2) primers:
  • Samples were amplified by heating to 95 °C for 5 seconds for genomic denaturation, followed by 45 cycles of 95°C for 0 seconds and 55°C for 0 seconds to determine quantification cycle values (Cqs) on a capillary LightCycler 1.5 (Roche). The PCR products were then melted from 60-95°C at 0.2°C/s with continuous fluorescence acquisition.
  • LightCycler PCR its concentration was optimized for extreme PCR. Since the primer concentrations in some embodiments are 10-fold higher in extreme RT-PCR than in the LightCycler experiments, the aptamer concentration may need to be increased.
  • the conditions of the PUM1 (intron 2) amplification above were used except for extreme chemistry (5 ⁇ primers and 1.6 ⁇ polymerase) and extreme amplification
  • RNA aptamers dm 1.1 and m.1.1 listed in Table 7 were used to inhibit primer-dimer formation in RT-PCR.
  • these RNA aptamers were studied without any DNA aptamer.
  • Conditions followed the PI] Ml (intron 2) amplification above, with 2 seconds of RT at 60°C.
  • the results for m.1.1 are shown in Fig. 47, showing the effect of aptamer concentration on Cq. Both the negative control and ACq were maximal at 3 ⁇ of aptamer.
  • aptamer m.1.1 was compared to aptamer dm 1 .1 , each at 3 ⁇ , using the same system.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Clinical Laboratory Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2016/060650 2015-11-05 2016-11-04 Extreme reverse transcription pcr Ceased WO2017079636A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
DK16863087.9T DK3337615T3 (da) 2015-11-05 2016-11-04 Ekstrem pcr via revers transkription
US15/771,968 US10900074B2 (en) 2015-11-05 2016-11-04 Extreme reverse transcription PCR
JP2018543065A JP7319646B2 (ja) 2015-11-05 2016-11-04 エクストリーム逆転写pcr
PL16863087.9T PL3337615T3 (pl) 2015-11-05 2016-11-04 Ekstremalna pcr z odwrotną transkrypcją
CN201680064778.6A CN108367287B (zh) 2015-11-05 2016-11-04 极端逆转录pcr
ES16863087T ES2916153T3 (es) 2015-11-05 2016-11-04 PCR extrema para transcripción inversa
EP16863087.9A EP3337615B1 (en) 2015-11-05 2016-11-04 Extreme reverse transcription pcr
CA3000824A CA3000824C (en) 2015-11-05 2016-11-04 Extreme reverse transcription pcr

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562251400P 2015-11-05 2015-11-05
US62/251,400 2015-11-05

Publications (1)

Publication Number Publication Date
WO2017079636A1 true WO2017079636A1 (en) 2017-05-11

Family

ID=58663164

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/060650 Ceased WO2017079636A1 (en) 2015-11-05 2016-11-04 Extreme reverse transcription pcr

Country Status (9)

Country Link
US (1) US10900074B2 (https=)
EP (1) EP3337615B1 (https=)
JP (1) JP7319646B2 (https=)
CN (1) CN108367287B (https=)
CA (1) CA3000824C (https=)
DK (1) DK3337615T3 (https=)
ES (1) ES2916153T3 (https=)
PL (1) PL3337615T3 (https=)
WO (1) WO2017079636A1 (https=)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018023360A (ja) * 2016-07-29 2018-02-15 セイコーエプソン株式会社 核酸増幅反応方法、試薬、および試薬の使用方法
US11131000B1 (en) 2020-06-01 2021-09-28 Shaheen Innovations Holding Limited Infectious disease screening device
US11181451B1 (en) 2020-06-01 2021-11-23 Shaheen Innovations Holding Limited Infectious disease screening system
US11254979B2 (en) 2020-06-01 2022-02-22 Shaheen Innovations Holding Limited Systems and devices for infectious disease screening
US20220064707A1 (en) * 2019-01-17 2022-03-03 Northwestern University Rapid reverse transcription quantitative polymerase chain reaction
US11338296B2 (en) 2018-07-26 2022-05-24 Lex diagnostics Ltd. Variable temperature reactor, heater and control circuit for the same
CN114885450A (zh) * 2022-07-11 2022-08-09 中国飞机强度研究所 一种空天飞机测试用的极高温极低温热强度循环试验系统
WO2023073143A1 (en) * 2021-11-01 2023-05-04 Anglia Ruskin University Higher Education Corporation Nucleic acid amplification method
WO2023117304A1 (en) 2021-12-21 2023-06-29 Qiagen Gmbh Method for amplifying rna in a sample
US11730193B2 (en) 2019-12-15 2023-08-22 Shaheen Innovations Holding Limited Hookah device

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3615693A4 (en) * 2017-04-28 2021-01-13 Spartan Bioscience Inc. DIRECT NUCLEIC ACID ANALYSIS OF ENVIRONMENTAL AND BIOLOGICAL SAMPLES
JP7563679B2 (ja) * 2019-02-28 2024-10-08 池田食研株式会社 遺伝子増幅法及び遺伝子増幅用キット
SG10201905641YA (en) * 2019-06-19 2021-01-28 Delta Electronics Int’L Singapore Pte Ltd Primer pair, kit and method for detecting zika virus
JP7580877B2 (ja) * 2020-03-30 2024-11-12 国立研究開発法人産業技術総合研究所 核酸増幅用組成物
CN115851740A (zh) * 2022-08-23 2023-03-28 翰飞(武汉)生物科技有限公司 一种DNA聚合酶核酸适配体及在qPCR中应用
CN121889514A (zh) * 2023-08-29 2026-04-17 万迈医疗仪器有限公司 用于快速扩增核酸的装置及其使用方法
CN117363620B (zh) * 2023-12-08 2024-03-01 北京全式金生物技术股份有限公司 一种特异性结合反转录酶的rna适配体及其应用
CN119876354B (zh) * 2025-01-24 2026-01-27 申联生物医药(上海)股份有限公司 一种全预混式荧光pcr试剂盒及稳定剂

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997011085A1 (en) * 1995-09-19 1997-03-27 University Of Massachusetts Inhibited biological degradation of oligodeoxynucleotides
US6020130A (en) * 1995-06-07 2000-02-01 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands that bind to and inhibit DNA polymerases
US20080248535A1 (en) * 2007-04-05 2008-10-09 Waltraud Ankenbauer Rapid one-step reverse transcriptase pcr
US20090269766A1 (en) * 2008-03-19 2009-10-29 Dieter Heindl Nucleic acid amplification in the presence of modified randomers
US20090325169A1 (en) * 2008-04-30 2009-12-31 Integrated Dna Technologies, Inc. Rnase h-based assays utilizing modified rna monomers
US20120003645A1 (en) * 2010-06-21 2012-01-05 Life Technologies Corporation Compositions, Methods and Kits for Nucleic Acid Synthesis and Amplification
US20140141422A1 (en) * 2010-02-26 2014-05-22 Life Technologies Corporation Fast PCR for STR Genotyping
US20140199699A1 (en) * 2013-01-15 2014-07-17 Jun Euihum Lee Compositions and Methods for RT-PCR
US20150118715A1 (en) * 2012-05-24 2015-04-30 University Of Utah Research Foundation Extreme pcr

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2065719A1 (en) 1991-04-30 1992-10-31 John B. Findlay Nucleic acid amplification and detection methods using rapid polymerase chain reaction cycle
US5436149A (en) 1993-02-19 1995-07-25 Barnes; Wayne M. Thermostable DNA polymerase with enhanced thermostability and enhanced length and efficiency of primer extension
WO1995004161A1 (en) 1993-07-29 1995-02-09 Sergio Danilo Junho Pena Method for recognition of the nucleotide sequence of a purified dna segment
US6210882B1 (en) 1998-01-29 2001-04-03 Mayo Foundation For Medical Education And Reseach Rapid thermocycling for sample analysis
US6300073B1 (en) * 1999-10-01 2001-10-09 Clontech Laboratories, Inc. One step RT-PCR methods, enzyme mixes and kits for use in practicing the same
KR20030073875A (ko) 2002-03-13 2003-09-19 주식회사 하이닉스반도체 반도체소자의 소자분리패턴 형성방법
US8232091B2 (en) 2006-05-17 2012-07-31 California Institute Of Technology Thermal cycling system
DE102008008313A1 (de) * 2008-02-07 2009-08-13 Qiagen Gmbh Amplifikation von bisulfitierten Nukleinsäuren
EP2255010B1 (en) 2008-02-20 2018-05-30 Streck Inc. Thermocycler and sample vessel for rapid amplification of dna
WO2010059323A2 (en) 2008-11-18 2010-05-27 Life Technologies Corporation Sequence amplification with target primers
CN101407850B (zh) 2008-11-20 2011-01-05 江苏出入境检验检疫局动植物与食品检测中心 猴痘病毒的pcr快速检测试剂盒及检测方法
CN101935697B (zh) * 2010-04-16 2015-11-25 中生方政生物技术有限公司 用于核酸序列检测的方法和试剂盒
CA2821580A1 (en) 2010-12-17 2012-06-21 Bjs Ip Limited Methods and systems for fast pcr heating
WO2015069743A1 (en) 2013-11-05 2015-05-14 Biofire Diagnostics, Llc Induction pcr

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6020130A (en) * 1995-06-07 2000-02-01 Nexstar Pharmaceuticals, Inc. Nucleic acid ligands that bind to and inhibit DNA polymerases
WO1997011085A1 (en) * 1995-09-19 1997-03-27 University Of Massachusetts Inhibited biological degradation of oligodeoxynucleotides
US20080248535A1 (en) * 2007-04-05 2008-10-09 Waltraud Ankenbauer Rapid one-step reverse transcriptase pcr
US20090269766A1 (en) * 2008-03-19 2009-10-29 Dieter Heindl Nucleic acid amplification in the presence of modified randomers
US20090325169A1 (en) * 2008-04-30 2009-12-31 Integrated Dna Technologies, Inc. Rnase h-based assays utilizing modified rna monomers
US20140141422A1 (en) * 2010-02-26 2014-05-22 Life Technologies Corporation Fast PCR for STR Genotyping
US20120003645A1 (en) * 2010-06-21 2012-01-05 Life Technologies Corporation Compositions, Methods and Kits for Nucleic Acid Synthesis and Amplification
US20150118715A1 (en) * 2012-05-24 2015-04-30 University Of Utah Research Foundation Extreme pcr
US20140199699A1 (en) * 2013-01-15 2014-07-17 Jun Euihum Lee Compositions and Methods for RT-PCR

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"GoTaq 1-Step RT-qPCR System, Instructions for Use of Product", PROMEGA, June 2014 (2014-06-01), pages 9, XP 055382464 *
GERARD ET AL.: "6. Reverse Transcriptase ( EC 2.7.7.49): The Use of Cloned Maloney Murine Leukemia Virus Reverse Transcriptase to Synthesize DNA from RNA", ENZYMES OF MOLECULAR BIOLOGY, 1993, pages 73 - 93, XP009510311 *
See also references of EP3337615A4 *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018023360A (ja) * 2016-07-29 2018-02-15 セイコーエプソン株式会社 核酸増幅反応方法、試薬、および試薬の使用方法
US11338296B2 (en) 2018-07-26 2022-05-24 Lex diagnostics Ltd. Variable temperature reactor, heater and control circuit for the same
US12551897B2 (en) 2018-07-26 2026-02-17 Lex diagnostics Ltd. Variable temperature reactor, heater, and control circuit for the same
EP3911755A4 (en) * 2019-01-17 2022-10-19 Northwestern University FAST QUANTITATIVE REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION
US20220064707A1 (en) * 2019-01-17 2022-03-03 Northwestern University Rapid reverse transcription quantitative polymerase chain reaction
US11730193B2 (en) 2019-12-15 2023-08-22 Shaheen Innovations Holding Limited Hookah device
US11254979B2 (en) 2020-06-01 2022-02-22 Shaheen Innovations Holding Limited Systems and devices for infectious disease screening
US11385148B2 (en) 2020-06-01 2022-07-12 Shaheen Innovations Holding Limited Infectious disease screening system
US11274352B2 (en) 2020-06-01 2022-03-15 Shaheen Innovations Holding Limited Infectious disease screening device
US11440012B2 (en) 2020-06-01 2022-09-13 Shaheen Innovations Holding Limited Systems and devices for infectious disease screening
US11959146B2 (en) 2020-06-01 2024-04-16 Shaheen Innovations Holding Limited Infectious disease screening device
US11181451B1 (en) 2020-06-01 2021-11-23 Shaheen Innovations Holding Limited Infectious disease screening system
US11131000B1 (en) 2020-06-01 2021-09-28 Shaheen Innovations Holding Limited Infectious disease screening device
US11667979B2 (en) 2020-06-01 2023-06-06 Shaheen Innovations Holding Limited Infectious disease screening device
US11946844B2 (en) 2020-06-01 2024-04-02 Shaheen Innovations Holding Limited Infectious disease screening system
WO2023073143A1 (en) * 2021-11-01 2023-05-04 Anglia Ruskin University Higher Education Corporation Nucleic acid amplification method
WO2023117304A1 (en) 2021-12-21 2023-06-29 Qiagen Gmbh Method for amplifying rna in a sample
CN114885450B (zh) * 2022-07-11 2022-09-20 中国飞机强度研究所 一种空天飞机测试用的极高温极低温热强度循环试验系统
CN114885450A (zh) * 2022-07-11 2022-08-09 中国飞机强度研究所 一种空天飞机测试用的极高温极低温热强度循环试验系统

Also Published As

Publication number Publication date
JP2018538007A (ja) 2018-12-27
US10900074B2 (en) 2021-01-26
ES2916153T3 (es) 2022-06-28
EP3337615A4 (en) 2019-03-06
DK3337615T3 (da) 2022-05-09
CN108367287B (zh) 2021-04-02
CN108367287A (zh) 2018-08-03
JP7319646B2 (ja) 2023-08-02
US20190002954A1 (en) 2019-01-03
EP3337615B1 (en) 2022-02-16
EP3337615A1 (en) 2018-06-27
PL3337615T3 (pl) 2022-08-29
CA3000824A1 (en) 2017-05-11
CA3000824C (en) 2024-02-13

Similar Documents

Publication Publication Date Title
US20260110023A1 (en) Methods for fast nucleic acid amplification
CA3000824C (en) Extreme reverse transcription pcr
EP3066222B1 (en) Induction pcr
EP3562592B1 (en) Fast pcr with molecular crowding

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16863087

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3000824

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2018543065

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE